CA2268009A1 - Detergent compositions containing isopeptidase - Google Patents

Abstract

Cleaning compositions, preferably laundry detergent compositions, comprising an isopeptidase enzyme having the ability to catalytically cleave the isopeptide bond between the glutamine gama-carboxamide and lysine epsilonamino group.

Description

DETERGENT COMPOSITIONS CONTAINING ISOPEPTIDASE
CROSS REFERENCE
This application claims priority under Title 3~. United States Code 1 I9(e) from Provisional Application Serial No. 60/028,496, filed October 1 ~, 1996.
FIELD OF THE INVENTION
The present invention relates to cleaning compositions comprising an isopeptidase enzyme, preferably a laundry detergent composition. Preferred laundry compositions are in granular form. More particularly, the invention is directed to detergent compositions containing an isopeptidase enzyme, detersive surfactant and builder (e.g., aluminosilicate, silicate), preferably in combination with detersive enzyme (e.g., proteases, lipases, amylases, cellulases}.
BACKGROUND OF THE INVENTION
Most conventional detergent compositions contain mixtures of various components, typically including enzymes which have cleaning properties.
Commonly encountered detersive enzymes ~~ommercially used in laundry compositions include proteases, amylases, cellulases, and lipases. In addition, the literature is full of a vast array of other classes of enzymes investigated for use in cleaning compositions. I-Iowever, very few of these have advanced beyond the initial evaluation stage to be used in commercial compositions. Obvious technical challenges for commercial use of any enzyme in cleaning compositions include compatibility with other common cleaning components (e.g., surfactants:
builders:
other enzymes), stability and effectiveness at typical storage and use pI-I.
and availability, just to name a few.
One class of enzymes which has not been previously investigated for utility in cleaning compositions is known as isope~~tidases. The first of this class of enzymes has been recently identified, following detection of novel enzymatic activity in the salivary gland secretion of the medicinal leech whereby the isopeptide bond between the glutamine gama-carboxarnide and lysine epsilon-amino group is split [see. for example, Fradkov et al., "Enzyme from the medicinal leech (Hirudo medicinalis) that specifically splits endo-s (-y-Glu)-Lys isopeptide bonds:
cDNA
cloning and protein primary structure", FEESS Letters. 390 ( 1996) 145-148].
This enzyme (called "destabilase") specifically splits isopeptide crossiinks in stabilized fibrin chains, but leaves the polypeptide chains intact, thereby liquefying stabilized SUBSTITUTE SHEET (RULE 26) fibrin in vitro. Based on this enzymatic activity, which reverses the final step in blood coagulation. isopeptidases are currently being studied for possible use as thrombolvtic agents.
It has now been determined that such activity is useful in cleaning processes where certain body soils are desired to be removed. This includes laundry processes whereby typically stubborn body soils and stains are sought to be removed. One such body soil or stain material sought to be removed are fragments which resist, in part, removal by detergents and proteases due to the chemically stable endo-E
(-y-Glu)-Lys isopeptide bonded cross links found in the cornified envelope of stratum corneum (skin) cells, from which is derived some or all of such body soils and stains on fabrics to be cleaned. Such troublesome soils and stains (which may be comprised in part of endo-E (-y-Glu)-Lys crosslinked proteins) are typically found on garments in the area of collars and cuffs, as well as in undergarments. It is therefore an object of the present invention to provide cleaning compositions and methods which utilize isopeptidase enzymes.
BACKGROUND ART
Finot. P.-A., Mottu. F., Bujard, E. and Mauron, J. (1978) Adv. Exp. Med.
Biol. 105, 549-570, demonstrated a y-Glutamyl-~-lysine hydrolytic activity in rat kidney extract. Baskova. I. P., and Nikonov, G. I. ( l985) Biokhimya 50(3), 431, reports leech destabilase mechanism (hydrolysis of y-Glutamyl-e-lysine) for liquefying fibrin, including kinetics on the artificial substrate y-Glutamyl-pNA. [See also, Baskova, I. P., and Nikonov, G. I. ( 199l ) Blood Coagulation and Fibrinolysis 2, 167-l72, which contains kinetics on additional substrates.] Fradkov, A., Berezhnoy, S.) Barsova, E., Zavalova, L., Lukyanov. S.. Baskova, I. and Sverdlov.
E. D. (1996) FEBS Letters 390, 145-l48, describes the cloning and sequencing of destabilase. See also: Baskova, I. P., Nikonov, G. L, "Destabilase: An Enzyme in the Salivary Gland Secretion of Medicinal Leech - Hydrolyzes Isopeptide Bonds in Stabilized Fibrin", Biokhimiya, Vol 50(3), 1985, pp. 424-431; Baskova, I. P., Nikonov, G. L, Zavalova, L. L., and Larionova, "Kinetics of the Hydrolysis of L-y-Glu-pNA by Destabilase, an Enzyme from the Leech Hirudo medicinalis", Biochimiya, Vol 55(4), pp 674-479 (1990).
Hoshino, E., Maruta, K., Wada, Y. and Kazuo, M. (I995) JAOCS 72(7), 785-79l, describes the interaction of highly purif ed alkaline protease from Bacillus sp. KSM-K16 (K16 protease said to have been isolated for use in laundry detergents) with the horny cells of human skin contained in skin grime as observed by electron miscroscopy. This protease is said to first penetrate the homey cells and SUBSTITUTE SHEET (RULE 26) then adsorbs, mainly onto the internal structure of the cells at the initial stage of hydrolysis, and directly hydrolyze the keratin filaments.
SUMMARY Oh THE INVENTION
According to the present inventi~~n there is provided a cleaning composition (preferably laundry detergent compositions, e.g., for use in laundry machine washing or presoak compositions)) comprising an isopeptidase active amount of isopeptidase enzyme.
Preferred are laundry detergent compositions comprising:
a) from about 0.000l % to about 5% (preferably from about 0.001 % to about 2%) by weight of an isopeptidase enzyme; and b) from about 95% to about 99.y999% by weight of detergent composition adjunct ingredients.
The present invention is also directed to laundry detergent compositions comprising:
a) from about 0.1% to about 80~'~ (preferably from about I% to about 50%) by weight of detersive surfactant;
b) from about 0.0001 % to about S% (preferably from about 0.001 % to about 2%) by weight of an isopeptidase enzyme; and c) from about 0.1 % to about 99.8% by weight of detergent composition adjunct ingredients, preferably including from about 0.1 % to about 80% of builder (e.g., aluminosilicates, silicates, phosphates, phosphonates, etc.). Preferred compositions are in granular form.
The present invention is further directed to detergent compositions comprising:
a) from about 0.0001% to about 2% by weight of active detersive enzyme (preferably selected from the group consisting of proteases, cellulases, lipases, amylases, peroxidases, and mixtures the;reofJ;
b) from about 0.0001 % to about 5% (preferably from about 0.001 % to about 2%) by weight of an isopeptidase enzyme; and c) from about 0.1 % to about 99.8% by weight of detergent composition adjunct ingredients (preferably selected from detersive surfactants and/or builders).
Preferably, these detergent compositions comprise one or more detersive surfactants selected from: anionic surfa~~tants, preferably selected from the group of alkyl alkoxylated sulfates, alkyl sulfates, and/or linear alkyl benzenesulfonate surfactants; cationic surfactants, prefera~biy selected from quaternary ammonium surfactants; nonionic surfactants, preferably alkyl ethoxylates, alkyl polyglucosides, and/or amine oxide surfactants; amphoteric surfactants, preferably selected from SUBSTITUTE SHEET (RULE 26) betaines and/or polycarboxylates (for example polyglycinates); and zwiterionic surfactants.
Preferred detergent compositions also comprise oxygen bleaches selected from perborates, percarbonates, and mixtures thereof, more preferably in combination with bleach activators such as nonanoyloxybenzene sulfonate (NOBS) and tetraacetyl ethylene diamine (TAED) activators, and mixtures thereof.
Preformed percarboxylic acid bleaching agents may also be used.
Preferred compositions according to the present invention are directed to granular detergent compositions comprising:
a) from about 0.1 % to about 50% by weight of a bleaching agent;
b) from about 1% to about 80% by weight of a builder selected from the group consisting of aluminosilicates, silicates, and mixtures thereof;
c) from about 0.0001 % to about 2% by weight of active detersive enzyme selected from the group consisting of proteases. amylases, lipases.
cellulases, and mixtures thereof;
d) from about 0.0001 % to about ~% (preferably from about 0.001 % to about 2%) by weight of an isopeptidase enzyme; and e) from about 0.1 % to about 99.8% by weight of detergent composition adjunct ingredients.
The present invention also relates to methods for laundering fabrics. This includes machine laundering processes comprising contacting in a laundry machine a fabric in need of cleaning with an aqueous solution comprising an isopeptidase active amount of an isopeptidase enzyme (and preferably also a detersive surfactant).
Another laundering process is a hand washing method comprising soaking (preferably for at least about ~ minutes. more preferably for at least about minutes) a fabric in need of cleaning in an aqueous solution comprising an isopeptidase active amount of an isopeptidase enzyme.
All percentages, ratios and proportions herein are by weight of ingredients used to prepare the finished compositions unless otherwise specified. All documents cited herein are, in relevant part, incorporated herein by reference.
DETAILED DESCRIPTION OF THE INVENTION
This invention provides detergent compositions which deliver effective cleaning of soils and stains (especially body soils and stains) via use of an isopeptidase enzyme as described herein, preferably in combination with one or more of a bleaching agent, aluminosilicate, silicate, detersive surfactant and/or detersive enzyme, preferably in granular form.
SUBSTITUTE SHEET (RULE 26) WO 98l16604 PCTIUS97118426 - Preferred compositions are formulated with one or more detersive surfactants to assist in the cleaning process with the isopeptidase enzyme. Typical and preferred detersive surfactants are selected from anionic surfactants, preferably selected from the group of alkyl alkoxyla.ted sulfates, alkyl sulfates, and/or linear alkyl benzenesulfonate surfactants; cationic surfactants, preferably selected from quaternary ammonium surfactants; and nonionic surfactants, preferably alkyl ethoxylates. alkyl polyglucosides, and/or a,nine oxide surfactants.
Percarbonate and perborate, which deliver peroxide bleach into the wash, are a cornerstone technology of modern, ultra-compact granular laundry detergent formulas. Peroxide bleach is very hydrophilic and, while it cannot match the bleaching effectiveness delivered by peracids (formed for example from peroxide interaction with TAED), it is effective at decoloration of pigments (e.g., in particulates or beverage stains) and also c~~n help remove the color from the organic residues associated with bodv soils.
This invention also provides deterl;ent compositions which deliver effective cleaning of soils and stains by means of bleach activators (including prefotzned peracids), preferably hydrophobic bleach activators, used in combination with an isopeptidase enzyme in the present compositions and methods.
This invention also provides compositions which deliver effective cleaning of soils and stains via use of bleach catalysts in the present invention compositions and methods. Bleach catalysts (charac~:erized by the presence of at least one transition metal atom) interact with peroxide to form very powerful hydrophilic bleaches. These bleaches deliver strong benefits on colored hydrophilic stains and hydrophilic everyday soils (i.e., socks). The catalysts are typically used at extremely low levels in cleaning products. As disclosed herein, products containing isopeptidase enzyme and bleaching agent:., with catalysts, deliver superior cleaning and/or whiteness performance. It is to be recognized, however, that historical use of bleach catalysts has been made difficult 'because of concerns about fabric damage (dimanganese catalysts are known to cause fabric damage), and thus such concerns must be considered when formulating compositions according to the present invention containing bleach catalysts.
This invention further provides compositions which deliver effective cleaning of soils and stains via use of builders selected from aluminosilicates, silicates, phosphates, carbonates, and mixtures thereof in the present invention compositions, preferably in granular form.
SUBSTITUTE SHEET (RULE 26) In addition, the present invention provides compositions which deliver effective cleaning of soils and stains via use of additional detersive enzymes in the present invention compositions and methods.
SUBSTITUTE SHEET (RULE 26) Isopeptidase Enzymes:
An essential component of the cleaning compositions of the present invention is an isopeptidase enzyme. The team "isopeptidase enzyme", as used herein. means an enzyme having the ability to catalytically cleave the isopeptide bond between the glutamine gama-carboxamide and lysine epsilon-amino group.
Also for purposes of the present invention, the term "isopeptidase active amount" as used herein means a quantity of isopeptidase enzyme having the necessary level of catalytic activity to be effective for providing cleaning benefits under normal use conditions. The isopeptidase enzyme is preferably incorporated into the present invention compositions at a level of from about 0.0001 % to about 5%, preferably from about 0.01 % to about 2.
The catalytic activity of the isopeptid.ase enzyme will typically vary depending on the specific enzyme variant used. Idividual isopeptidase enzyme catalytic activity may be determined by the method of Baskova, I. P., and Nikonov, G. I. ( 199l ), Blood Coagulation and Fibrinolysis 2, 167-l 72, as follows:
"Amidolytic activity of the test preparations was determined using chromogenic substrate L-y-Glu-pNA (Behringwerke, Austria) at 405 nm according to the method described by Svendsen et al. [Svendsen L.) :Blomback B. Blomback M, et al.
Synthetic chromogenic substrate for determination of trypsin, thrombin and thrombin-Like enzymes. Thromb Res 1972; l : 267-278.] Into a spectrophotometer corvette was placed (0.9 - x} ml 0.05 M Tr~is-HCI buffer (pH 8.0); 0.2 ml substrate solution (0.45 mg/ml; 1.58 x 10 -3M in 0.05 M Tris-HCl buffer containing 0.01 M
CaCl2, pH 8.0) and x ml of destabilase solution. Kinetics were determined by the Lineweaver and Burk method."
"Hydrolysis of isopeptide s- (y-Glu)-~Lys by destabilase was determined in a system containing 32 nmol of isopeptide, 1 I .9 nmol of enzyme, 2.5 pl of H20 and 80 ~l of 0.05 M boric buffer, pH 7.4, at 36~C. 10 pl of 0.1 N HCl and 100 ~l of 0.2 M citric buffer (pH 2.2} were divided into ailiquots of 20 pl . Control samples contained saline instead of destabilase. 50 Ell of the sample were put on to the amino acid analyser'Biotronic LC 5001' analytic column (400 x 32 mm) with resin Biotronic BTC 2710, 7 - 8 mmk." [At page 168.]
Using these methods. the isopeptida~e enzyme "destabilase" is reported (at page 169) to have the following properties: "specific activity of 0.15 x 10-g mol s-1 mg-1, Km = 2.2 x 10 -4M, kkat = 3.53 x 10-3 s-I (pH 8.0, 37~C)."
Isopeptidase enzymes herein includf; naturally derived isopeptidases such as "destabilase", whose amino acid sequence i:~ known from the literature [Fradkov et al., "Enzyme from the medicinal leech (Hin.rdo medicinalis) that specifically splits SUBSTITUTE SHEET (RULE 26) endo-s (-y-Glu)-Lys isopeptide bonds: cDNA cloning and protein primary structure", FEBS Letters. 390 ( l996) I ~~-l 48: see SEQ ID Nos. 2 and 7], and any variants (e.g., SEQ ID Nos. 4 and 6') able to provide an isopeptidase active amount for purposes of cleaning compositions and methods according to the present invention. Such variants my be naturally occurring or genetically engineered.
Preferred variants show a positive immunological cross-reaction with an antibody directed against naturally occurring isopeptidase enzyme.
Because the isopeptidase to be used in the present invention compositions and methods should be as inexpensive as possible. the enzyme will need to be economically produced in large amounts and thus is preferably engineered for expression in a transgenic expression system. These systems are known in the art of protein expression. and may include. but are not limited to, expression in gram negative bacteria such as Escherichia coli, gram positive bacteria such as Bacillus subtilis, yeast such as Saccharomvces cerevisiae or Pichia pastoris, fungi such as AsperQillus, mammalian or insect cell cultures. or in crops such as tobacco, corn, soybean or other plants which can be genetically altered to express and accumulate proteins. The cDNA nucleotides have been isolated and sequences determined for destabilase and two variants thereof (SEQ ID Nos. 1,3 and 5).
Any such variants may be specifically designed with regard to the optimization of performance efficiency in the detergent compositions and methods of the invention. For example, variants may be designed such that the compatibility of the enzyme to commonly encountered cleaning composition components is increased. Also the variant may be designed such that optimal pH) bleach stability.
catalytic activity and the like of the enzyme variant is tailored to suit the particular detergent application.
Additional detergent components The detergent compositions of the invention may also contain additional detergent components. The precise nature of these additional components, and levels of incorporation thereof will depend on the physical form of the composition.
and the precise nature of the washing operation for which it is to be used.
The compositions of the invention preferably contain one or more additional detergent components selected from surfactants. bleaching agents, other enzymes.
builders, alkalinity system, organic polymeric compounds, suds suppressers, soil suspension and anti-redeposition agents, and corrosion inhibitors.
SUBSTITUTE SHEET (RULE 26) - Detersive Surfactants:
The detergent compositions according to the present invention preferably further comprise surfactants, herein also referred to as co-surfactants, preferably selected from: anionic surfactants, preferably selected from the group of alkyl alkoxylated sulfates. alkyl sulfates, and/or linear alkyl benzenesulfonate surfactants;
catic;nic surfactants. preferably selected from quaternary ammonium surfactants;
nonionic surfactants, preferably alkyl ethoxylates, alkyl polyglucosides, and/or amine or amine oxide surfactants; amphoteric surfactants, preferably selected from betaines and/or polycarboxylates (e.g., poly~;lycinates); and zwiterionic surfactants.
A wide range of these co-surfactants c,an be used in the detergent compositions of the present invention. A typical listing of anionic, nonionic, ampholvtic and zwitterionic classes, and species of these co-surfactants, is given in US
Patent 3,664,961 issued to Norris on May 23, 1972. Amphoteric surfactants are also described in detail in "Amphoteric Surfactants. Second Edition", E.G. Lomax.
Editor (published 1996. by Marcel Dekker, Inc.) The laundry detergent compositions of the present invention typically comprise from about 0.1% to about 35%, preferably from about 0.5% to about 15%, by weight of co-surfactants. Selected surfactants are further identified as follows.
( 11 Anionic Co-surfactants:
Nonlimiting examples of anionic co-surfactants useful herein, typically at levels from about 0.1 % to about 50%, by weight, include the conventional C 11-alkyl benzene sulfonates ("LAS") and primary) branched-chain and random C 10-C~0 alkyl sulfates (" AS"), the C 10-C 1 g secon~3ary (2,3) alkyl sulfates of the formula CH3(CH2)x(CHOS03-M~) CH3 and CH3 (CH2)y(CHOS03-M'~) CH2CH3 where x and {y + 1 ) are integers of at least about 7, preferably at least about 9, and M is a water-soiubilizing cation, especially sodium, unsaturated sulfates such as oleyl sulfate, the C 10-C 1 g alpha-sulfonated fatty acid esters, the C 10-C 1 g sulfated alkyl polyglycosides, the C 1 p-C 1 g alkyl alkoxy sulfates ("AEXS"; especially EO 1-ethoxy sulfates), and C 10-C 1 g alkyl alkoxy carboxylates (especially the EO

ethoxycarboxylates). The C 12-C 1 g beaaines and sulfobetaines ("sultaines"), C 10-C 1 g amine oxides, and the like, can also be included in the overall compositions. C 10-C20 conventional soaps may also be used. If high sudsing is desired, the branched-chain C 10-C 16 soap:. may be used. Other conventional useful anionic co-surfactants are listed in standard texts.
The alkyl alkoxyiated sulfate surfactants useful herein are preferably water soluble salts or acids of the formula RO(A)mS03M wherein R is an unsubstituted C10-C24 alkyl or hydroxyalkyl group having a C10-C24 alkyl component, SUBSTITUTE SHEIET (RULE 26) i i preferably a C 1 ~-C 1 g alkyl or hydroxyalkyl, more preferably C 12-C 1 ~
alkyl or hydroxyalkyl, A is an ethoxy or propoxy unit, m is greater than zero, typically between about 0.~ and about 6, more preferably between about 0.~ and about 3, and M is H or a cation which can be, for example, a metal canon (e.g., sodium, potassium, lithium, calcium, magnesium, etc.), ammonium or substituted-ammonium cation. Alkyl ethoxylated sulfates as well as alkyl propoxylated sulfates are contemplated herein. Specific examples of substituted ammonium canons include ethanol-, triethanol-, methyl-, dimethyl, trimethyl-ammonium canons and quaternary ammonium cations such as tetramethyl-ammonium and dimethyl piperidinium canons and those derived from alkylamines such as ethylamine, diethylamine. triethvlamine. mixtures thereof, and the like. Exemplary surfactants are C 1 ~-C 1 ~ alkyl polyethoxylate ( 1.0) sulfate (C 12-C 1 SE( i .0)M), C 1 ~-C 1 ~ alkyl polyethoxylate (2.25) sulfate (C 1 ~-C 1 SE(2.25)M), C 12-C 15 alkyl polyethoxylate (3.0) sulfate (C 1 ~-C 1 ~E(3.0)M), and C 12-C 1 ~ alkyl polyethoxylate (4.0) sulfate (C 12-C 15E(4.0)M), wherein M is conveniently selected from sodium and potassium.
The alkyl sulfate surfactants useful herein are preferably water soluble salts or acids of the formula ROS03 M wherein R preferably is a C 10-C24 hydrocarbyl, preferably an alkyl or hydroxyalkyl having a C 10-C 1 g alkyl component. more preferably a C 12-C 1 ~ alkyl or hydroxyalkyl, and M is H or a canon, e.Q., an alkali metal cation (e.g. sodium, potassium, lithium), or ammonium or substituted ammonium (e.g. methyl-, dimethyl-, and trimethyl ammonium cations and quaternary ammonium cations such as tetramethyl-ammonium and dimethyl piperidinium canons and quaternary ammonium canons derived from alkylamines such as ethylamine. diethylamine, triethylamine. and mixtures thereof. and the like).
Other suitable anionic surfactants that can be used are alkyl ester sulfonate surfactants including linear esters of Cg-C20 carboxylic acids (i.e., fatty acids) which are sulfonated with gaseous S03 according to "The Journal of the American Oil Chemists Society", 52 ( 1975), pp. 323-329. Suitable starting materials would include natural fatty substances as derived from tallow, palm oil, etc.
The preferred alkyl ester sulfonate surfactant, especially for laundry applications, comprise alkyl ester sulfonate surfactants of the structural formula ;
R3 - CH(S03M) - C(O) - OR4 wherein R3 is a Cg-C~0 hydrocarbyl, preferably an alkyl, or combination thereof, R4 is a C 1-C6 hydrocarbyl, preferably an alkyl, or combination thereof, and M is a cation which forms a water soluble salt with the alkyl ester sulfonate.
Suitable salt-forming cations include metals such as sodium, potassium, and lithium, and substituted or unsubstituted ammonium canons, such as monoethanolamine, SUHST1TUTE SHEET {RULE 26) diethanolamine, and triethanolamine. Preff;rably, R3 is C 10-C 16 alkyl, and R4 is methyl, ethyl or isopropyl. Especially preferred are the methyl ester sulfonates wherein R3 is C 10-C 16 alkyl.
Other anionic co-surfactants usefiil for detersive purposes can also be included in the laundry detergent compositions of the present invention. These can include salts (including, for example, sodium. potassium, ammonium, and substituted ammonium salts such as mono-, di- and triethanolamine salts) of soap, Cg-C22 primary of secondary alkanesulfonates, Cg-C24 olefinsulfonates, suifonated polycarboxylic acids prepared by sulfonatiion of the pyrolyzed product of alkaline earth metal citrates, e.g., as described in British patent specification No.
1,082,179, Cg-C24 alkylpolyglycolethersulfates (containing up to 10 moles of ethylene oxide);
alkyl glycerol sulfonates, fatty acyl glyceroii sulfonates, fatty oleoyl glycerol sulfates, alkyl phenol ethylene oxide ether sulfates, paraffin sulfonates, alkyl phosphates, isethionates such as the acyl isethionates, N-acyl taurates, alkyl succinamates and sulfosuccinates, monoesters of sulfosuccin~~tes (especially saturated and unsaturated C 12-C 1 g monoesters) and diesters of suifosuccinates (especially saturated and unsaturated C6-C 12 diesters), sulfates of alkylpolysaccharides such as the sulfates of alkylpolyglucoside (the nonionic nonsulfated compounds being described below).
and alkyl polyethoxy carboxylates such a~; those of the formula RO(CH~CH~O)k-CH2C00-M+ wherein R is a Cg-C22 alkyl, k is an integer from 0 to 10, and M is a soluble salt-forming cation. Resin acids and hydrogenated resin acids are also suitable, such as rosin, hydrogenated rosin, and resin acids and hydrogenated resin acids present in or derived from tall oil. F~.uoher examples are described in "Surface Active Agents and Detergents" (Vol. I and II by Schwartz, Perry and Berch). A
variety of such surfactants are also generally disclosed in U.S. Patent 3.929,678.
issued December 30, 197S to Laughlin, et al. at Column 23, line ~8 through Column 29, line 23 (herein incorporated by reference).
A preferred disulfate surfactant has the formula A-X-M+
R--C
B-Y_ M+
where R is an alkyl, substituted alkyl, alkenyl, aryl, alkaryl, ether, ester, amine or amide group of chain length C 1 to C2g, preferably C3 to C24) most preferably Cg to C20, or hydrogen; A and B are independently selected from alkyl, substituted alkyl, and alkenyl groups of chain length C 1 to C2 g, preferably C 1 to C~, most preferably SUBSTITUTE SHEET (RULE 26) G 1 or C~, or a covalent bond, and A and B in total contain at least 2 atoms;
A, B, and R in total contain from 4 to about 31 carbon atoms; X and Y are anionic groups selected from the group consisting of sulfate and sulfonate, provided that at least one of X or Y is a sulfate group; and M is a cationic moiety, preferably a substituted or unsubstituted ammonium ion. or an alkali or alkaline earth metal ion.
The most preferred disulfate surfactant has the formula as above where R is an alkyl group of chain length from C 10 to C 1 g, A and B are independently C
1 or C~, both X and Y are sulfate groups, and M is a potassium, ammonium, or a sodium ion.
The disulfate surfactant is typically present at levels of incorporation of from about 0.1 % to about 50%, preferably from about 0.1 % to about 35%. most preferably from about 0.5% to about 15% by weight of the detergent composition.
Preferred disulfate surfactant herein include:
(a) 1,3 disulfate compounds, preferably 1.3 C7-C?3 (i.e., the total number of carbons in the molecule) straight or branched chain alkyl or alkenyl disulfates, more preferably having the formula:
0S03 M+
R
0S03 M+
wherein R is a straight or branched chain alkyl or alkenyl group of chain length from about C4 to about C 1 g;
(b) 1,4 disulfate compounds, preferably 1,4 C8-C?2 straight or branched chain alkyl or alkenyl disulfates, more preferably having the formula:
R OSO, ~ M
OSO 3 M +
wherein R is a straight or branched chain alkyl or aikenyl group of chain length from about C4 to about C 1 g; preferred R are selected from octanyl, nonanyl, decyl, dodecyl, tetradecyl, hexadecyl, octadecyl, and mixtures thereof; and (c) 1,5 disulfate compounds, preferably 1,5 C9-C23 straight or branched chain alkyl or alkenyi disulfates, more preferably having the formula:
.0S03 M+
R
OSO 3 M +
SUBSTITUTE SHEET (RULE 26) wherein R is a straight or branched chain alkyl or alkenyl group of chain length from about C4 to about C 1 g.
Known syntheses of certain disulfat~:d surfactants, in general, use an alkyl or alkenyl succinic anhydride as the principal ;starting material. This is initially subjected to a reduction step from which a diol is obtained. Subsequently the diol is subjected to a sulfation step to give the disu.lfated product. As an example, US-A-3.634,269 describes 2-alkyl or alkenyl-1,4-butanediol disulfates prepared by the reduction of alkenyl succinic anhydrides with lithium aluminium hydride to produce either alkenyl or alkyl diols which are then sulfated. In addition. US-A-3.959,334 and US-A-4,000,081 describe 2-hydrocarbyl-1,4-butanediol disulfates also prepared using a method involving the reduction of alkenyl succinic anhydrides with lithium aluminium hydride to produce either alkenvl or alkyl diols which are then sulfated.
See aiso US-A-3.832,408 and US-A,-3.860.62 which describe 2-alkyl or alkenyl-1.4-butanediol ethoxylate disulfate;~ prepared by the reduction of alkenyl succinic anhydrides with lithium aluminium hydride to produce either alkenyl or alkyl diols which are then ethoxylated prior to sulfation.
These compounds may also be made by a method involving synthesis of the disulfate surfactant from a substituted cyclic anhydride having one or more carbon chain substituents having in total at least 5 carbon atoms comprlsine the following steps:
(i} reduction of said substituted cyclic anhydride to form a diol; and (ii) sulfation of said diol to form a di:>ulfate wherein said reduction step comprises hydrogenation under pressure in the presence of a transition metal-containing hydrogenaoion catalyst.
When included therein, the laundry detergent compositions of the present invention typically comprise from about C~.1 % to about SO%, preferably from about 1% to about 40% by weight of an anionic ~~urfactant.
(2) Nonionic Co-surfactants:
Nonlimiting examples of nonionic. co-surfactants useful herein typically at levels from about 0.1 % to about 50%, by weight include the alkoxylated alcohols (AE's) and alkyl phenols, polyhydrox.y fatty acid amides (PFAA's), alkyl polyglycosides (APG's), C 10-C 1 g glycerol ethers, and the like.
More specifically, the condensation products of primary and secondary aliphatic alcohols with from about 1 to air~out 25 moles of ethylene oxide (AE) are suitable for use as the nonionic surfactant in the present invention. The alkyl chain of the aliphatic alcohol can either be straiF;ht or branched, primary or secondary, and generally contains from about 8 to about 22 carbon atoms. Preferred are the SUBSTITUTE SHE~ET (RULE 26) condensation products of alcohois having an alkyl group containing from about 8 to about 20 carbon atoms. more preferably from about 10 to about 18 carbon atoms.
with from about 1 to about 1 U moles, preferably 2 to 7, most preferably 2 to ~. of ethylene oxide per mole of alcohol. Especially preferred nonionic surfactants of this type are the Cg-C 1 ~ primary alcohol ethoxylates containing 3-12 moles of ethylene oxide per mole of alcohol. particularly the C 12-C 1 ~ primary alcohols containing i-moles of ethylene oxide per mole of alcohol.
Examples of commercially available nonionic surfactants of this type include: TergitoITM 1 ~-S-9 (the condensation product of C11-C 1 ~ linear alcohol with 9 moles ethylene oxide) and TergitolTM 24-L-6 NMW (the condensation product of C 12-C 14 P~m~'Y alcohol with 6 moles ethylene oxide with a narrow molecular weight distribution), both marketed by Union Carbide Corporation;
NeodolTM 45-9 (the condensation product of C 14-C 1 ~ linear alcohol with 9 moles of ethylene oxide). NeodolTM 23-3 (the condensation product of C 1 ~-C 13 linear alcohol with 3 moles of ethylene oxide), NeodoITM 4~-7 (the condensation product of C 14-C 1 ~ linear alcohol with 7 moles of ethylene oxide) and NeodolTM 4~-~
(the condensation product of C 14-C 15 linear alcohol with ~ moles of ethylene oxide) marketed by Shell Chemical Company; KyroTM EOB (the condensation product of C 13-C 15 alcohol with 9 moles ethylene oxide), marketed by The Procter &
Gamble Company; and Genapol LA 030 or O50 (the condensation product of C 12-C 14 alcohol with 3 or ~ moles of ethylene oxide) marketed by Hoechst. The preferred range of HLB in these AE nonionic surfactants is from 8-17 and most preferred from 8-14. Condensates with propylene oxide and butylene oxides may also be used.
Another class of preferred nonionic co-surfactants for use herein are the polyhydroxy fatty acid amide surfactants of the formula.
R~-II N Z

wherein R 1 is H, or C 1 _4 hydrocarbyl, 2-hydroxy ethyl, 2-hydroxy propyl or a mixture thereof, R2 is CS-31 hYdrocarbyl, and Z is a polyhydroxyhydrocarbyl having a linear hydrocarbyl chain with at least 3 hydroxyls directly connected to the chain, or an alkoxylated derivative thereof. Preferably, R 1 is methyl, R2 is a straight C 11-15 alkyl or C 15-17 alky l or alkenyl chain such as coconut alkyl or mixtures thereof, and Z is derived from a reducing sugar such as glucose, fructose.
maltose, lactose, in a reductive amination reaction. Typical examples include the C 12-and C 12-C 14 N-methylglucamides. See U.S. a 194,639 and 5,298,636. N-alkoxy polyhydroxy fatty acid amides can also be used; see U.S. 5,489,393.
SUBSTITUTE SHEET (RULE 26) 1~
- Also useful as a nonionic co-surfactant in the present invention are the alkylpolysaccharides such as those disclo red in U. S. Patent 4.565,647, Llenado, issued January 21, 1986, having a hydrophobic group containing from about 6 to about 30 carbon atoms, preferably from about 10 to about 16 carbon atoms, and a polysaccharide, e.g. a polyglycoside, hydrophilic group containing from about 1.3 to about 10, preferably from about 1.3 to about 3, most preferably from about 1.3 to about 2.7 saccharide units. Any reducing saccharide containing ~ or 6 carbon atoms can be used, e.g., glucose) galactose and galactosyl moieties can be substituted for the glucosyl moieties (optionally the hydrophobic group is attached at the 2-, 3-, 4-, etc. positions thus giving a glucose or ~;alactose as opposed to a glucoside or galactoside). The intersaccharide bonds can. be, e.g., between the one position of the additional saccharide units and the 2-, 3-, 4-, and/or 6- positions on the preceding saccharide units.
Preferred alkylpolyglycosides have v.he formula R2~(CnH?n0 )t~glYcosyl)x wherein R2 is selected from the group consisting of alkyl, alkylphenyl, hydroxyalkyl, hydroxyalkylphenyl, and mixtures thereof in which the alkyl groups contain from about 10 to about 18, preferably from about 12 to about 14, carbon atoms; n is 2 or 3, preferably 2; t is from G to about 10, preferably 0; and x is from about 1.3 to about 10, preferably from about 1.3 to about 3, most preferably from about 1.3 to about 2.7. The glycosyl is preferably derived from glucose. To prepare these compounds, the alcohol or alkylpolyethoxy alcohol is formed first and then reacted with glucose, or a source of glucose:. to form the giucoside (attachment at the 1-position). The additional glycosyl units can then be attached between their i -position and the preceding glycosyl units 2-, 3-, 4- and/or 6-position, preferably predominately the 2-position. Compounds of this type and their use in detergent are disclosed in EP-B 0 070 077, 0 075 996 and 0 094 118.
Polyethylene, polypropylene, and ~~olybutylene oxide condensates of alkyl phenols are also suitable for use as the nonionic surfactant of the surfactant systems of the present invention, with the polyethylene oxide condensates being preferred.
These compounds include the condensation products of alkyl phenols having an alkyl group containing from about 6 to about 14 carbon atoms, preferably from about 8 to about 14 carbon atoms, in either a straight-chain or branched-chain conf guration with the alkylene oxide. In a preferred embodiment, the ethylene oxide is present in an amount equal to from about 2 to about 25 moles, more preferably SUBSTITUTE SHEET (RULE 26) i i from about 3 to about 1 ~ moles, of ethylene oxide per mole of alkyl phenol.
Commercially available nonionic surfactants of this type include IgepalTM CO-b30, marketed by the GAF Corporation; and TritonTM X-45, X-114, X-100 and X-l02, all marketed by the Rohm & Haas Company. These surfactants are commonly referred to as alkylphenol alkoxylates (e.g., alkyl phenol ethoxylates).
The condensation products of ethylene oxide with a hydrophobic base formed by the condensation of propylene oxide with propylene glycol are also suitable for use as the additional nonionic surfactant in the present invention. The hydrophobic portion of these compounds will preferably have a molecular weight of from about l500 to about 1800 and will exhibit water insolubility. The addition of polyoxyethylene moieties to this hydrophobic portion tends to increase the water solubility of the molecule as a whole, and the liquid character of the product is retained up to the point where the polyoxyethylene content is about 50% of the total weight of the condensation product, which corresponds to condensation with up to about 40 moles of ethylene oxide. Examples of compounds of this type include certain of the commercially-available PluronicTM surfactants, marketed by BASF.
Also suitable for use as the nonionic surfactant of the nonionic surfactant system of the present invention, are the condensation products of ethylene oxide with the product resulting from the reaction of propylene oxide and ethylenediamine. The hydrophobic moiety of these products consists of the reaction product of ethylenediamine and excess propylene oxide, and generally has a molecular weight of from about 2500 to about 3000. This hydrophobic moiety is condensed with ethylene oxide to the extent that the condensation product contains from about 40% to about 80% by weight of polyoxyethylene and has a molecular weight of from about 5.000 to about 11,000. Examples of this type of nonionic surfactant include certain of the commercially available TetronicTM compounds, marketed by BASF.
Also preferred nonionics are amine oxide surfactants. The compositions of the present invention may comprise amine oxide in accordance with the general formula I:
R1(EO)x(PO)y(BO)ZN{O)(CH2R~)2.qH~0 (I).
In general, it can be seen that the structure (I) provides one long-chain moiety R1 (EO)x(PO)y(BO)z and two short chain moieties, CH2R'. R' is preferably selected from hydrogen, methyl and -CH20H. In general R 1 is a primary or branched hydrocarbyl moiety which can be saturated or unsaturated, preferably, R1 is a primary alkyl moiety. When x+y+z = 0, R1 is a hydrocarbyl moiety having SUBSTITUTE SHEET (RULE 26) c~hainlength of from about 8 to about 18. 'When x+y+z is different from 0, R1 may be somewhat longer, having a chainlengoh in the range C 12-C24. The general formula also encompasses amine oxides wherein x+y+z = 0, R1 = Cg-C 1 g, R' = H
and q = 0-2, preferably 2. These amine oxides are illustrated by C12-14 alkyldimethyl amine oxide, hexadecyl dimethylamine oxide, octadecylamine oxide and their hydrates, especially the dihydratfa as disclosed in U.S. Patents i.075.501 and 5,07l,594, incorporated herein by reference.
The invention also encompasses amine oxides wherein x+y+z is different from zero, specifically x+y+z is from about 1 to about 10, R1 is a primary alkyl group containing 8 to about 24 carbons, prc;ferably from about 12 to about i 6 carbon atoms; in these embodiments y + z is preferably 0 and x is preferably from about 1 to about 6, more preferably from about 2 to about 4; EO represents ethyleneoxy; PO
represents propyleneoxy; and BO represents butyleneoxy. Such amine oxides can be prepared by conventional synthetic methods, e.g., by the reaction of alkylethoxysulfates with dimethylamine followed by oxidation of the ethoxylated amine with hydrogen peroxide.
Highly preferred amine oxides herein are solutions at ambient temperature.
Amine oxides suitable for use herein are made commercially by a number of suppliers, including Akzo Chemie, Ethyl Corp., and Procter & Gamble. See McCutcheon's compilation and Kirk-Othmer review article for alternate amine oxide manufacturers.
Whereas in certain of the preferred embodiments R' is H, there is some latitude with respect to having R' slightly larger than H. Specifically, the invention further encompasses embodiments wherein R' is CH~OH, such as hexadecylbis(2-hydroxyethyl)amine oxide, tallowbis(2-lzydroxyethyl)amine oxide, stearylbis(2-hydroxyethyl)amine oxide and oleylbis(2-hydroxyethyl)amine oxide, dodecyldimethylamine oxide dihydrate.
(31 Cationic Co-surfactants:
Nonlimiting examples of cationic co-surfactants useful herein typically at levels from about 0.1 % to about 50%, by ~Neight include the choline ester-type quats and alkoxylated quaternary ammonium (AQA) surfactant compounds, and the like.
Cationic co-surfactants useful as a component of the surfactant system is a cationic choline ester-type quat surfactant which are preferably water dispersible compounds having surfactant properties and comprise at least one ester (i.e. -COO-) linkage and at least one cationically charged group. Suitable cationic ester surfactants, including choline ester surfactants, have for example been disclosed in U.S. Patents Nos. 4,228,042, 4,239,660 and 4,260,529.
SUBSTITUTE SHEET (RULE 26) - Preferred cationic ester surfactants are those having the formula:
R; R~
I
RtfOL(C~nOJbJ a (~u (cH~)m (~v {CH2)~ NI-R3 M _ I
wherein R1 is a Cj-C31 linear or branched alkyl, alkenyl or alkaryl chain or M' .N+(R6R~Rg)(CH2)s; X and Y, independently, are selected from the group consisting of COO, OCO, O, CO, OCOO, CONH, NHCO, OCONH and NHCOO
wherein at least one of X or Y is a COO. OCO, OCOO, OCONH or NHCOO group;
R~, R3, R4, R6, R~ and Rg are independently selected from the group consisting of alkyl, alkenyl, hydroxyalkyl, hydroxyalkenyi and alkaryl groups having from 1 to 4 carbon atoms: and R~ is independently H or a C 1-C3 alkyl group; wherein the values of m, n, s and t independently iie in the range of from 0 to 8, the value of b lies in the range from 0 to 20, and the values of a, a and v independently are either 0 or 1 with the proviso that at least one of a or v must be 1; and wherein M is a counter anion.
Preferably R~, R3 and R4 are independently selected from CH3 and -CH~CH~OH.
Preferably M is selected from the group consisting of halide. methyl sulfate, sulfate) and nitrate, more preferably methyl sulfate, chloride, bromide or iodide.
Preferred water dispersible cationic ester surfactants are the choline esters having the formula:

R~COCH~CH~N-CH3 wherein R1 is a C11-C19 linear or branched alkyl chain.
Particularly preferred choline esters of this type include the stearoyl choline ester quaternary methylammonium halides (R 1=C 1 ~ alkyl), palmitoyl choline ester quaternary methylammonium halides (R1=C 1 ~ alkyl), inyristoyl choline ester quaternary methylammonium halides {R1=C13 alkyl), lauroyl choline ester quaternary methylammonium halides {R1=C 11 alkyl), cocoyi choline ester quaternary methylammonium halides (R 1=C 11-C 13 alkyl), tallowyl choline ester SUBSTITUTE SHEET (RULE 26) quaternary methylammonium halides (RI=C 15-C 17 alkyl), and any mixtures thereof.
The particularly preferred choline esters, given above, may be prepared by the direct esterification of a fatty acid of the desired chain length with dimethyia.minoethanol, in the presence of an acid catalyst. The reaction product is then quatemized with a methyl halide. preferably in the presence of a solvent such as ethanol, propylene glycol or preferably a fatty alcohol ethoxylate such as C

fatty alcohol ethoxylate having a degree of ethoxylation of from 3 to SO
ethoxy groups per mole forming the desired cationic material. They may also be prepared by the direct esterification of a long chain fatty acid of the desired chain length together with 2-haloethanol, in the presence of an acid catalyst material. The reaction product is then quatemized with trimethyla.mine, forming the desired cationic material.
Other suitable cationic ester surfactants have the structural formulas below, wherein d may be from 0 to 20.
1-i3 O O
R~OC(CH~)dCOCH~CH~N ~ CH3 M -CH3 O O ~H3 M - CH3-N CH~CH~OC(CH~)~~COCH~CH~N=CH3 M

In a preferred aspect these cationic ester surfactant are hydrolysable under the conditions of a laundry wash method.
Cationic co-surfactants useful herein also include alkoxylated quaternary ammonium (AQA) surfactant compounds (referred to hereinafter as "AQA
compounds") having the formula:
R\ /ApR3 I \:N + X -~A,qR 4 SUBSTITUTE SHEIET (RULE 26) wherein R 1 is an alkyl or alkenyl moiety containing from about 8 to about 18 carbon atoms, preferably 10 to about 16 carbon atoms, most preferably from about 10 to about 14 carbon atoms; R2 is an alkyl group containing from one to three carbon atoms, preferably methyl; R3 and R4 can vary independently and are selected from hydrogen (preferred), methyl and ethyl; X- is an anion such as chloride, bromide, methylsulfate, sulfate, or the like, sufficiem to provide electrical neutrality. A and A' can vary independently and are each selected from C 1-C4 alkoxy, especially ethoxy (i.e., -CH2CH20-), propoxy, butoxy and mixed ethoxy/propoxy; p is from to about 30, preferably I to about 4 and q is from 1 to about 30, preferably 1 to about 4, and most preferably to about 4: preferably both p and q are 1. See also: EP
2,084, published May 30, 1979, by The Procter & Gamble Company, which describes cationic co-surfactants of this type which are also useful herein..
AQA compounds wherein the hydrocarbyl substituent R1 is Cg-C11, especially C 10, enhance the rate of dissolution of laundry granules.
especially under cold water conditions, as compared with the higher chain length materials.
Accordingly, the Cg-C 11 AQA surfactants may be preferred by some formulators.
The levels of the AQA surfactants used to prepare finished laundry detergent compositions can range from about 0.1% to about ~%, typically from about 0.45%
to about 2.5%. by weight.
According to the foregoing, the following are nonlimiting, specific illustrations of AQA surfactants used herein. It is to be understood that the degree of alkoxylation noted herein for the AQA surfactants is reported as an average, following common practice for conventional ethoxylated nonionic surfactants.
This is because the ethoxylation reactions typically yield mixtures of materials with differing degrees of ethoxylation. Thus) it is not uncommon to report total EO
values other than as whole numbers, e.g., "E02.5", "E03.5", and the like.
Desi nQ ation RI R2 A~R3 A'4R4 (also referred to as Coco Methyl E02) AQA-2 C I2-C I 6 CH3 (E0)2 EO
AQA-3 C 12-C 14 CH3 (E0)2 (E0)2 (Coco Methyl E04) AQA-S C12-C14 CH3 (E0)2 (E0)3 SUBSTITUTE SHEET (RULE 26) AQA-6 C 12-C 14 CH3 (E0)2 (E0)3 AQ~'-~ C8-C 18 CH3 (E0)3 (E0)2 AQA-8 C 12-C 14 CH3 (E0)4 (E0)4 AQA-9 C 12-C 14 C2H5 (E0)3 (E0)3 AQA-10 C 12-C I g C3H7 (E0)3 (E0)4 AQA-11 C I 2-C 1 g CH3 (propoxy) (E0)3 AQA-12 C 1 p-C 1 g C2H5 (iso-propoxy)2(E0)3 AQA-13 C I0-C I g CH3 (EO/PO)2 (E0)3 AQA-14 Cg-CIg CH3 (EO)I~* (EO)IS*

AQA-16 Cg-C 12 CH3 EO EO

AQA-I7 Cg-CI I CH3 - EO 3.~ -Avg.

AQA-18 CI2 CH3 - EO 3.~ -Avg.

AQA-19 Cg-CI4 CH3 (E0)10 (E0)10 AQA-20 C 10 C2H5 (E0)2 (E0)3 AQA-21 C 12-C 14 C2H5 (E0)5 (E0)3 AQA-22 C 12-C I g C3H~ Bu (E0)2 *Ethoxy, optional ly end-capped with meth:rl or ethyl.

SUBSTITUTE SHEET (RULE 26) The preferred bis-ethoxylated cationic surfactants herein are available under the trade name ETHOQUAD from Akzo Nobei Chemicals Company.
SUHST1TUTE SHEET (RULE 26) - Highly preferred bis-AQA compounds for use herein are of the formula R\ /C:H~CH~OH
Ny X
CHI/ \CH=>.CH~OH
wherein R 1 is C 10-C 1 g hydrocarbyl and mixtures thereof, preferably C 1 p, C 12> C 14 alkyl and mixtures thereof, and X is any convenient anion to provide charge balance, preferably chloride. With reference to the l;eneral AQA structure noted above, since in a preferred compound R 1 is derived from coconut (C 1 ~-C 14 alkyl) fraction fatty acids, R2 is methyl and ApR3 and A'qR4 ;ue each monoethoxy, this preferred type of compound is referred to herein as "Cocoi'.~IeE02" or "AQA-1" in the above list.
Other preferred AQA compounds herein include compounds of the formula:
R~ ~(CH_aCH~O)pH
R / 1V \ X_ (CH~CH~O)qH
wherein R 1 is C 1 p-C 1 g hydrocarbyl, preferably C l 0-C 14 alkyl, independently p is 1 to about 3 and q is 1 to about 3, R2 is C1-C3 alkyl, preferably methyl, and X
is an anion, especially chloride.
Other compounds of the foregoing type include those wherein the ethoxy (CH~CH~O) units (EO) are replaced by butoxy (Bu), isopropoxy [CH(CH3)CH~O) and [CH~CH(CH3Oj units (i-Pr) or n-propoxy units (Pr), or mixtures of EO
and/or Pr and/or i-Pr units.
The following illustrates various ether adjunct ingredients which may be used in the compositions of this invention. but is not intended to be limiting thereof.
While the combination of the isopeptidase enzymes with such adjunct compositional ingredients can be provided as finished products in the form of liquids, gels.
bars, or the like using conventional techniques, the manufacture of the granular laundry detergents herein requires some special processing techniques in order to achieve optimal performance. Accordingly, the manufacture of laundry granules will be described hereinafter separately in the Grarmles Manufacture section (below), for the convenience of the formulator.
Bleachine Compounds -Bleaching Aeents and Bleach Activators - The detergent compositions herein preferably further contain bleaching agents or bleaching compositions containing a blf:aching agent and one or more bleach activators. Bleaching agents will typically be at levels of from about 1 % to about 30%, more typically from about 5% to about ?0%, of the detergent composition, SUBSTITUTE SHEET (RULE 26) i i WO 98/16604 PCT/US97/i8426 especially for fabric laundering. If present, the amount of bleach activators will typically be from about 0.1 % to about 60%, more typically from about 0.5% to about 40% of the bleaching composition comprising the bleaching agent-plus-bleach activator.
The bleaching agents used herein can be any of the bleaching agents useful for detergent compositions in textile cleaning, hard surface cleaning, or other cleaning purposes that are now known or become known. These include oxygen bleaches as well as other bleaching agents. Perborate bleaches, e.g., sodium perborate (e.g., mono- or tetra-hydrate) can be used herein.
Another category of bleaching agent that can be used without restriction encompasses percarboxylic acid bleaching agents and salts thereof. Suitable examples of this class of agents include magnesium monoperoxyphthalate hexahydrate, the magnesium salt of metachloro perbenzoic acid, 4-nonyiamino-4-oxoperoxybutyric acid and diperoxydodecanedioic acid. Such bleaching agents are disclosed in U.S. Patent 4.483,781, Hartman, issued November 20, 1984, U.S.
Patent Application 740,446. Burns et al, filed June 3, l985, European Patent Application 0,l33,354, Banks et al, published February 20, 1985, and U.S.
Patent 4,412,934, Chung et al, issued November 1, 1983. Highly preferred bleaching agents also include 6-nonylamino-6-oxoperoxycaproic acid as described in U.S.
Patent 4,634,55l, issued January 6, 1987 to Burns et al.
Peroxygen bleaching agents can also be used. Suitable peroxygen bleaching compounds include sodium carbonate peroxyhydrate and equivalent "percarbonate"
bleaches, sodium pyrophosphate peroxyhydrate, urea peroxyhydrate, and sodium peroxide. Persulfate bleach (e.g., OXONE, manufactured commercially by DuPont) can also be used.
A preferred percarbonate bleach comprises dry particles having an average particle size in the range from about Q00 micrometers to about 1,000 micrometers, not more than about 10% by weight of said particles being smaller than about micrometers and not more than about 10% by weight of said particles being larger than about 1,250 micrometers. Optionally, the percarbonate can be coated with silicate, borate or water-soluble surfactants. Percarbonate is available from various commercial sources such as FMC, Solvay and Tokai Denka.
Mixtures of bleaching agents can also be used.
Peroxygen bleaching agents, the perborates, the percarbonates) etc.) are preferably combined with bleach activators, which lead to the in situ production in aqueous solution (i.e., during the washing process) of the peroxy acid corresponding to the bleach activator. Various nonlimiting examples of activators are disclosed in SUBSTITUTE SHEET (RULE 26) L3.S. Patent 4,9l ~,8~4. issued April 10) 1990 to Mao et al, and U.S. Patent 4,412,934. The nonanoyloxybenzene sulfonate (HOBS) and tetraacetyl ethylene diamine f TAED) activators are typical. and mixtures thereof can also be used.
See also U.S. 4,634.~ 1 for other typical bleaches and activators useful herein.
Highly preferred amido-derived bleach activators are those of the formulae:
R1N(R~)C(O)RZC(O)L or R1C(O)N(R~)R2C(O)L
wherein R 1 is an alkyl group containing from about 6 to about 12 carbon atoms, R2 is an alkylene containing from 1 to about 6 carbon atoms, RS is H or alkyl, aryl, or alkaryl containing from about 1 to about 10 carbon atoms, and L is any suitable leaving group. A leaving group is any group that is displaced from the bleach activator as a consequence of the nucleophilic attack on the bleach activator by the perhydrolysis anion. A preferred leaving group is phenyl sulfonate.
Preferred examples of bleach activators of the above formulae include (6-octanamido-caproyl)oxybenzenesulfonate, (6-nonanamidocaproyl)oxybenzenesul-fonate, (6-deca.namido-caproyl)oxybenzenesulfonate. and mixtures thereof as described in U.S. Patent 4,634g51, incorporated herein by reference.
Another class of bleach activators comprises the benzoxazin-type activators disclosed by Hodge et al in U.S. Patent 4,966,723, issued October 30, 1990, incorporated herein by reference. A highly preferred activator of the benzoxazin-type is:
O
I I
O
I
~~ o Still another class of preferred bleach activators includes the acyl lactam activators, especially acyl caprolactams and acyl valerolactauns of the formulae:
O O
II II
O C-CHz-CHz\ O C-CHz- ~ Hz Rs_'C-N.,CHz-CH2~CHz Rs-C-N~CH2_CHz wherein R6 is H or an alkyl, aryl, alkoxyaryl, or alkaryl group containing from 1 to about 12 carbon atoms. Highly preferred lactam activators include benzoyl caproiactam, octanoyl caprolactam, 3,5,5-trimethylhexanoyl caprolactam, nonanoyl caprolactam, decanoyl caprolactam) undecenoyl caprolactam, benzoyl valerolactam, octanoyl valerolactam, decanoyl valerolactam. undecenoyl valerolactam, nonanoyl valerolactam, 3,5,i-trimethylhexanoyl valecoiactam and mixtures thereof. See also SUBSTITUTE SHEIET (RULE 26) ?6 IJ.S. Patent 4g45,784, issued to Sanderson, October 8, l985, incorporated herein by reference, which discloses acyi caprolactams, including benzoyl caprolactam, adsorbed into sodium perborate.
Bleaching agents other than oxygen bleaching agents are also known in the art and can be utilized herein. One type of non-oxygen bleaching agent of particular interest includes photoactivated bleaching agents such as the sulfonated zinc and/or aluminum phthalocyanines. See U.S. Patent 4.033,718, issued July ~, 1977 to Holcombe et al. If used, detergent compositions will typically contain from about 0.025% to about 1.25%, by weight, of such bleaches, especially sulfonate zinc phthalocyanine.
If desired, the bleaching compounds can be catalyzed by means of a manganese compound. Such compounds are well known in the art and include, for example, the manganese-based catalysts disclosed in U.S. Pat. a246,621. U.S.
Pat.
a244.594; U.S. Pat. a 194,4 i 6; U.S. Pat. i.114,606; and European Pat. App.
Pub.
Nos. 549,271 A 1, 549.272A 1, 544,440A2, and 544,490A 1; Preferred examples of these catalysts include MnIV~(u-O)3(1,4,7-trimethyl-l,4,7-triazacvclononane)2_ (PF6)2, MnIlI2(u-O)1(u-OAc)2(1,4,7-trimethyl-1,4,7-triazacyclononane)2(C104)2.
MnIV4{u-O)6(1,4,7-triazacyclononane)4(C104)4, MnIIIMnIV4(u-O)1(u-OAc)2_ (1,4,7-trimethyl-1,4,7-triazacyclononane)2(C104)3, MnIV(1,4,7-trimethyl-1,4,7-tri-axacyciononane)- (OCH3)3(PF6), and mixtures thereof. Other metal-based bleach catalysts include those disclosed in U.S. Pat. 4,430,243 and U.S. Pat.
i.114,611.
The use of manganese with various complex ligands to enhance bleaching is also reported in the following United States Patents: 4.728.455; a284,944:
i.246.612;

5.256,779; 5,280,117; 5,274, l47; 5,153.161; and i.227.084.
As a practical matter) and not by way of limitation, the compositions and processes herein can be adjusted to provide on the order of at least one part per ten million of the active bleach catalyst species in the aqueous washing liquor, and will preferably provide from about 0.1 ppm to about 700 ppm, more preferably from about 1 ppm to about 500 ppm, of the catalyst species in the laundry liquor.
Cobalt bleach catalysts useful herein are known, and are described, for example, in M. L. Tobe, "Base Hydrolysis of Transition-Metal Complexes", Adv.
Inorg_. Bioinore. Mech., ( 1983), 2, pages 1-94. The most preferred cobalt catalyst useful herein are cobalt pentaamine acetate salts having the formula [Co(NH3)SOAc] Ty, wherein "OAc" represents an acetate moiety and "Ty" is an anion, and especially cobalt pentaamine acetate chloride, [Co(NH3)SOAc]C12; as well as [Co(NH3)SOAc](OAc)2; [Co(NH3)SOAc](PF6)2; [Co(NH3)SOAc](S04);
[Co(NH3)SOAc](BF4)2; and [Co(NH3)SOAc](N03)2 (herein "PAC").
SUBSTITUTE SHEET (RULE 26) 2'7 - These cobalt catalysts are readily prepared by known procedures. such as taught for example in the Tobe article and the references cited therein, in U.S. Patent 4,8 I0,410, to Diakun et al, issued March 7,1989, J. Chem. Ed. ( 1989), 66 ( 12), l043-4~; The Synthesis and Characterization of Inorganic Compounds, W.L. Jolly (Prentice-Hall; I 970), pp. 46l -3; more. Chem., 18, 1497-1 Q02 ( 1979);
Inor~.
Chem., 21, 2881-2885 (1982); IriOrQ. Chem., 18, 2023-2025 (1979); Inorg.
Synthesis, 173-l 76 ( 1960); and Journal of Physical Chemistry) ~6, 22-25 (1952).
As a practical matter, and not by way of limitation, the compositions and cleaning processes herein can be adjusted 'to provide on the order of at least one part per hundred million of the active bleach catalyst species in the aqueous washing medium, and will preferably provide from about 0.01 ppm to about 25 ppm, more preferably from about 0.05 ppm to about 10 ppm, and most preferably from about 0.1 ppm to about ~ ppm. of the bleach catalyst species in the wash liquor. In order to obtain such levels in the wash liquor of an automatic washing process, typical compositions herein will comprise from about 0.0005% to about 0.2%, more preferably from about 0.004% to about 0.08%, of bleach catalyst, especially manganese or cobalt catalysts, by weight of the cleaning compositions.
Enzymes - Enzymes are preferably included in the present detergent compositions for a variety of purposes, including removal of protein-based, carbohydrate-based, or triglyceride-based stains from substrates, for the prevention of refugee dye transfer in fabric laundering, and for fabric restoration.
Suitable enzymes include proteases, amylases, Iipases, cellulases, peroxidases, and mixtures thereof of any suitable origin. such as vel;etable, animal, bacterial, fungal and yeast origin. Preferred selections are influenced by factors such as pH-activity and/or stability optima, thermostability, and stability to active detergents.
builders and the like. In this respect bacterial or fungal enzymes are preferred, such as bacterial amylases and proteases, and fungal cellul2~ses.
"Detersive enzyme") as used herein, means any enzyme having a cleaning, stain removing or otherwise beneficial effect in a laundry, hard surface cleaning or personal care detergent composition. Preferred detersive enzymes are hydrolases such as proteases, amylases and lipases. Preferred enzymes for laundry purposes include, but are not limited to, proteases, cellulases, lipases and peroxidases. Highly preferred for automatic dishwashing are amylases and/or proteases, including both current commercially available types and improved types which, though more and more bleach compatible though successive improvements, have a remaining degree of bleach deactivation susceptibility.
SUBSTITUTE SHEET (RULE 26) i i WO 98I16604 PCTlUS9?l18426 - Enzymes are normally incorporated into detergent or detergent additive compositions at levels sufficient to provide a "cleaning-effective amount".
The term "cleaning effective amount" refers to any amount capable of producing a cleaning, stain removal, soil removal, whitening, deodorizing, or freshness improving effect on substrates such as fabrics, dishware and the like. In practical terms for current commercial preparations, typical amounts are up to about 5 mg by weight, more typically 0.01 mg to 3 mg, of active enzyme per gram of the detergent composition.
Stated otherwise, the compositions herein will typically comprise from 0.001 %
to 5%, preferably 0.01 %-I % by weight of a commercial enzyme preparation.
Protease enzymes are usually present in such commercial preparations at levels sufficient to provide from 0.005 to 0.1 Anson units (AU) of activity per gram of composition.
For certain detergents. such as in automatic dishwashing, it may be desirable to increase the active enzyme content of the commercial preparation in order to minimize the total amount of non-catalvtically active materials and thereby improve spotting/filming or other end-results. Higher active levels may also be desirable in highly concentrated detergent formulations.
Suitable examples of proteases are the subtilisins which are obtained from particular strains of B. subtilis and B. licheniformis. One suitable protease is obtained from a strain of Bacillus, having maximum activity throughout the pH
range of 8-12, developed and sold as ESPER.ASE~ by Novo Industries A/S of Denmark, hereinafter "Novo". The preparation of this enzyme and analogous enzymes is described in GB l.243,784 to Novo. Other suitable proteases include ALCALASE~ and SAVINASE~ from Novo and MAXATASE~ from International Bio-Synthetics, Inc., The Netherlands: as well as Protease A as disclosed in EP 130,756 A, January 9) 1985 and Protease B as disclosed in EP
303,761 A, April 28, 1987 and EP 130,756 A, January 9, l985. See also a high pH
protease from Bacillus sp. NCIMB 40338 described in WO 9318140 A to Novo.
Enzymatic detergents comprising protease, one or more other enzymes, and a reversible protease inhibitor are described in WO 9203529 A to Novo. Other preferred proteases include those of WO 9510591 A to Procter & Gamble . When desired, a protease having decreased adsorption and increased hydrolysis is available as described in WO 9507791 to Procter & Gamble. A recombinant trypsin-like protease for detergents suitable herein is described in WO 9425583 to Novo.
In more detail, an especially preferred protease, referred to as "Protease D"
is a carbonyl hydrolase variant having an amino acid sequence not found in nature, which is derived from a precursor carbonyl hydrolase by substituting a different amino acid for a plurality of amino acid residues at a position in said carbonyl SUBSTITUTE SHEET (RULE 26) WO 98/16604 PCTlUS97118426 2~>
hydrolase equivalent to position +76, preferably also in combination with one or more amino acid residue positions equivalent to those selected from the group consisting of +99, +I01, +103, +1p4, +107, +123, +27, +l05. +109, +l26, +l28, +135. +156, +166, +195, +197, +204, +2~~6, +210, +216, +217, =218, +222, +260, +265, and/or +274 according to the numbering of Bacillus amyloliquefaciens subtilisin) as described in WO 9/10615 published April 20, 1995 by Genencor International.
Useful proteases are also described in PCT publications: WO 95/30010 published Novenber 9, l995 by The Procter & Gamble Company; WO 95/300l 1 published Novenber 9, l995 by The Procter & Gamble Company; WO 95/29979 published Novenber 9, l995 by The Procter & Gamble Company.
Amylases suitable herein, especially for, but not limited to automatic dishwashing purposes, include, for example, a-amylases described in GB
1,296.839 to Novo; R.APIDASE~, International Biio-Synthetics, Inc. and TERMAMYL~, Novo. FIJNGAMYL~ from Novo is especially useful. Engineering of enzymes for improved stability, e.g., oxidative stability. is known. See, for example J.
Biological Chem., Vol. 260, No. 11, June 198'.i, pp. 6518-6521. Certain preferred embodiments of the present compositions can make use of amylases having improved stability in detergents such as automatic dishwashing types.
especially improved oxidative stability as measured against a reference-point of TERMAMYL
in commercial use in 1993. These preferred amylases herein share the characteristic of being "stability-enhanced" amylases. characterized, at a minimum, by a measurable improvement in one or more of: oxidative stability, e.g., to hydrogen peroxide/tetraacetylethylenediarnine in buffered solution at pH 9-10;
thermal stability, e.g., at common wash temperatures such as about 60oC; or alkaline stability, e.g., at a pH from about 8 to about 11, measured versus the above-identified reference-point amylase. Stability can be measured using any of the art-disclosed technical tests. See, for example, references disclosed in WO
9402597.
Stability-enhanced amylases can be obtained from Novo or from Genencor International. One class of highly preferred amylases herein have the commonality of being derived using site-directed muta~;enesis from one or more of the Bacillus amylases, especially the Bacillus a-amylases, regardless of whether one, two or multiple amylase strains are the immediate: precursors. Oxidative stability-enhanced amylases vs. the above-identified reference; amylase are preferred for use, especially in bleaching, more preferably oxygen bleaching, as distinct from chlorine bleaching, detergent compositions herein. Such preferred amylases include (a) an amylase according to the hereinbefore incorporated WO 9402S97, Novo, Feb. 3, 1994, as SUBSTITUTE SHEET (RULE 26) i i further illustrated by a mutant in which substitution is made, using alanine or threonine, preferably threonine, of the methionine residue located in position i 97 of the B. licheniformis alpha-amylase, known as TERMAMYL~, or the homologous position variation of a similar parent amylase, such as B. amyloliquefaciens, B.
subtilis, or B. stearothermophilus; (b) stability-enhanced amylases as described by Genencor International in a paper entitled "Oxidatively Resistant alpha-Amylases"
presented at the 207th American Chemical Society National Meeting, March 13-17 1994, by C. Mitchinson. Therein it was noted that bleaches in automatic dishwashing detergents inactivate alpha-amylases but that improved oxidative stability amylases have been made by Genencor from B. licheniformis NCIB8061.
Methionine (Met) was identified as the most likely residue to be modified. Met was substituted, one at a time, in positions 8, 1 ~) 197, 256, 304, 366 and 438 leading to specific mutants, particularly important being M 197L and M 197T with the M

variant being the most stable expressed variant. Stability was measured in CASCADE~ and SUNLIGHT~; (c) particularly preferred amylases herein include amylase variants having additional modification in the immediate parent as described in WO 9510603 A and are available from the assignee. Novo, as DURAMYL~. Other particularly preferred oxidative stability enhanced amylase include those described in WO 94l8314 to Genencor International and WO 9402597 to Novo. Any other oxidative stability-enhanced amylase can be used. for example as derived by site-directed mutagenesis from known chimeric, hybrid or simple mutant parent forms of available amylases. Other preferred enzyme modifications are accessible. See WO 9509909 A to Novo.
Other amylase enzymes include those described in WO 95/26397 and in co-pending application by Novo Nordisk PCTiDK96/00056. Specific amylase enzymes for use in the detergent compositions of the present invention include a-amylases characterized by having a specific activity at least 25% higher than the specific activity of Tetmamyl~ at a temperature range of 25~C to 55~C and at a pH
value in the range of 8 to 10, measured by the Phadebas~ a-amylase activity assay.
(Such Phadebas~ a-amylase activity assay is described at pages 9-10, WO
95I26397.) Also included herein are a-amylases which are at least 80%
homologous with the amino acid sequences shown in the SEQ ID listings in the references. These enzymes are preferably incorporated into laundry detergent compositions at a level from 0.00018% to 0.060% pure enzyme by weight of the total composition, more preferably from 0.00024% to 0.048% pure enzyme by weight of the total composition.
SUBSTITUTE SHEET (RULE 26) - Cellulases usable herein include both bacterial and fungal types, preferably having a pH optimum between ~ and 9.5. L1.S. 4,435.307) Barbesgoard et al, March 6, 1984, discloses suitable fungal cellulasca from Humicola insolens or Humicola strain DSM 1800 or a cellulase 212-producing fungus belonging to the genus .4eromonas, and cellulase extracted from the hepatopancreas of a marine mollusk, Dolabella Auricula Solander. Suitable cellulases are also disclosed in GB-A-2.075.028; GB-A-2.095.275 and DE-OS-2.247.832. CAREZYME~ and CELLUZYME~(Novo) are especially usefi.rl. See also WO 9117243 to Novo.
Suitable lipase enzymes for detergent usage include those produced by microorganisms of the Pseudomonas group, such as Pseudomonas stutzeri ATCC
l9.154, as disclosed in GB 1,372,034. See also lipases in Japanese Patent Application 53?0487, laid open Feb. 24, I978. This lipase is available from Amano Pharmaceutical Co. Ltd., Nagoya. Japan, under the trade name Lipase P "Amano,"
or "Amano-P." Other suitable commercial lipa.ses include Amano-CES, lipases ex Chromobacter viscosum, e.g. Chromobacter viscosum var. lipolyticum NRRLB
3673 from Toyo Jozo Co., Tagata, Japan; C.'hromobacter viscosum lipases from U.S.
Biochemical Corp., U. S.A. and Disoynth Co., The Netherlands, and lipases ex Pseudomonas gladioli. LIPOLASE~ enzyme derived from Humicola lanuginosa and commercially available from Novo, see also EP 341,947, is a preferred lipase for use herein. Lipase and amylase variants stabilized against peroxidase enzymes are described in WO 941495l A to Novo. See also WO 9205249 and RD
94359044.
In spite of the large number of publications on lipase enzymes, only the lipase derived from Humicola lanuginosa and produced in Aspergillus orvzae as host has so far found widespread application as additive for fabric washing products.
It is available from Novo Nordisk under the tradename LipolaseT'~, as noted above.
In order to optimize the stain removal performance of Lipolase, Novo Nordisk have made a number of variants. As described in WO 92I05249, the D96L variant of the native Humicola lanuginosa lipase improves the lard stain removal efficiency by a factor 4.4 over the wild-type lipase (enzymes compared in an amount ranging from 0.075 to 2.5 mg protein per liter). Research Disclosure No. 35944 published on March 10, 1994, by Novo Nordisk discloses that the lipase variant (D96L) may be added in an amount corresponding to 0.(101-100- mg (5-500,000 LU/liter) lipase variant per liter of wash liquor. The present invention provides the benefit of improved whiteness maintenance on fabrics using low levels of D96L variant in detergent compositions containing the isopeptidase enzymes in the manner disclosed SUBSTITUTE SHEET (RULE 26) herein, especially when the D96L is used at levels in the range of about ~0 LU
to about 8500 LU per Iiter of wash solution.
Cutinase enzymes suitable for use herein are described in WO 8809357 A to Genencor.
Peroxidase enzymes may be used in combination with oxygen sources. e.g., percarbonate, perborate, hydrogen peroxide, etc., for "solution bleaching" or prevention of transfer of dyes or pigments removed from substrates during the wash to other substrates present in the wash solution. Known peroxidases include horseradish peroxidase, ligninase, and haloperoxidases such as chloro- or bromo-peroxidase. Peroxidase-containing detergent compositions are disclosed in WO
89099813 A, October 19. 1989 to Novo and WO 8909813 A to Novo.
A range of enzyme materials and means for their incorporation into synthetic detergent compositions is also disclosed in WO 9307263 A and WO 9307260 A to Genencor International. WO 8908694 A to Novo, and U.S. 3,y3,139, January ~, 1971 to McCarty et al. Enzymes are further disclosed in U.S. 4,101,457, Place et al, July I8, 1978, and in U.S. 4,507.219, Hughes. March 26, 1985. Enzyme materials useful for liquid detergent formulations, and their incorporation into such formulations, are disclosed in U.S. 4.26l,868, Hora et al, April 14, 1981.
Enzymes for use in detergents can be stabilised by various techniques. Enzyme stabilisation techniques are disclosed and exemplified in U.S. 3,600,319. August 17, 1971, Gedge et al, EP 199,40 and EP 200,586, October 29, 1986, Venegas. Enzyme stabilisation systems are also described, for example, in U.S. 3,519,570. A
useful Bacillus, sp. AC 13 giving proteases, xylanases and cellulases, is described in WO
9401532 A to Novo.
Enzyme Stabilizing System - The enzyme-containing compositions herein may optionally also comprise from about 0.00l % to about 10%, preferably from about 0.005% to about 8%, most preferably from about 0.01 % to about 6%, by weight of an enzyme stabilizing system. The enzyme stabilizing system can be any stabilizing system which is compatible with the detersive enzyme. Such a system may be inherently provided by other formulation actives, or be added separately, e.g., by the formulator or by a manufacturer of detergent-ready enzymes. Such stabilizing systems can, for example, comprise calcium ion, boric acid.
propylene glycol, short chain carboxylic acids, boronic acids, and mixtures thereof, and are designed to address different stabilization problems depending on the type and physical form of the detergent composition.
One stabilizing approach is the use of water-soluble sources of calcium and/or magnesium ions in the finished compositions which provide such ions to the SUBSTITUTE SHEET (RULE 26) .) , enzymes. Calcium ions are generally more effective than magnesium ions and are prefeKred herein if only one type of cation is being used. Typical detergent compositions, especially liquids, will comprise from about I to about 30, preferably from about 2 to about 20. more preferably from about 8 to about 12 millimoles of calcium ion per liter of finished detergent composition, though variation is possible depending on factors including the multiplicity, type and levels of enzymes incorporated. Preferably water-soluble calcium or magnesium salts are employed, including for example calcium chloride, calcium hydroxide, calcium formate, calcium malate, calcium maleate, calciurn hydroxide and calcium acetate; mare generally, calcium sulfate or magnesium salts corresponding to the exemplified calcium salts may be used. Further increased levels of Calcium and/or Magnesium may of course be useful, for example for promoting the grease-cutting action of certain types of surfactant.
Another stabilizing approach is by u,se of borate species. See Severson, U.S.
a537,706. Borate stabilizers, when used, ,;nay be at levels of up to 10% or more of the composition though more typically, levels of up to about 3% by weight of boric acid or other borate compounds such as borax or orthoborate are suitable for liquid detergent use. Substituted boric acids such as phenylboronic acid, butaneboronic acid, p-bromophenylboronic acid or the like can be used in place of boric acid and reduced levels of total boron in detergent compositions may be possible though the use of such substituted boron derivatives.
Stabilizing systems of certain cleaning compositions, for example automatic dishwashing compositions, may further comprise from 0 to about 10%, preferably from about 0.01 % to about 6% by weight, of chlorine bleach scavengers, added to prevent chlorine bleach species present in many water supplies from attacking and inactivating the enzymes, especially under alkaline conditions. While chlorine levels in water may be small, typically in the range from about 0.5 ppm to about 1.75 ppm, the available chlorine in the total volume of water that comes in contact with the enzyme, for example during dish- or fabric-washing, can be relatively large;
accordingly, enzyme stability to chlorine in-use is sometimes problematic.
Since perborate or percarbonate, which have the ability to react with chlorine bleach, may present in certain of the instant compositions in amounts accounted for separately from the stabilizing system, the use of additional stabilizers against chlorine, may, most generally, not be essential, thoughimproved results may be obtainable from their use. Suitable chlorine scavenger anions are widely known and readily available, and, if used, can be salts containing ammonium cations with sulfite, bisulfate, thiosuifite, thiosulfate, iodide, etc. Antioxidants such as carbamate, SUBSTITUTE SHEET (RULE 26) WO 98l16604 PCT/US97/18426 ascorbate, etc., organic amines such as ethylenediaminetetracetic acid {EDTA) or alkali metal salt thereof, monoethanolamine (MEA), and mixtures thereof can likewise be used. Likewise, special enzyme inhibition systems can be incorporated such that different enzymes have maximum compatibility. Other conventional scavengers such as bisulfate, nitrate, chloride, sources of hydrogen peroxide such as sodium perborate tetrahydrate, sodium perborate monohydrate and sodium percarbonate, as well as phosphate, condensed phosphate, acetate, benzoate, citrate, formate, lactate, malate, tartrate, salicylate, etc., and mixtures thereof can be used if desired. In general, since the chlorine scavenger function can be performed by ingredients separately listed under better recognized functions, (e.g., hydrogen peroxide sources), there is no absolute requirement to add a separate chlorine scavenger unless a compound performing that function to the desired extent is absent from an enzyme-containing embodiment of the invention; even then, the scavenger is added only for optimum results. Moreover, the formulator will exercise a chemist's normal skill in avoiding the use of any enzyme scavenger or stabilizer which is majorly incompatible, as formulated, with other reactive ingredients.
In relation to the use of ammonium salts, such salts can be simply admixed with the detergent composition but are prone to adsorb water and/or liberate ammonia during storage. Accordingly, such materials, if present, are desirably protected in a particle such as that described in US 4,b52,392, Baginski et al.
Builders - Preferred builders for use in the present invention compositions, especially in granular form, are detergent builders selected from aluminosilicates and silicates are preferably included in the compositions herein, for example to assist in controlling mineral, especially Ca and/or Mg, hardness in wash water or to assist in the removal of particulate soils from surfaces.
Suitable silicate builders include water-soluble and hydrous solid types and including those having chain-, layer-, or three-dimensional- structure as well as amorphous-solid or non-structured-liquid types. Preferred are alkali metal silicates, particularly those liquids and solids having a SiO~ :Na20 ratio in the range 1.6:1 to 3.2:1, including, particularly for automatic dishwashing purposes. solid hydrous 2-ratio silicates marketed by PQ Corp. under the tradename BRITESIL~, e.g., BR.ITESIL H20; and layered silicates, e.g., those described in U.S. 4,664,839, May 12, 1987, H. P. Rieck. NaSKS-6, sometimes abbreviated "SKS-6", is a crystalline layered aluminium-free b-Na2Si05 morphology silicate marketed by Hoechst and is preferred especially in granular laundry compositions. See preparative methods in German DE-A-3,417,649 and DE-A-3,742,043. Other layered silicates, such as those having the general formula NaMSix02x+1'YH20 wherein M is sodium or SUBSTITUTE SHEET (RULE 26) hydrogen, x is a number from 1.9 to 4, preferably 2, and y is a number from 0 to 20, preferably 0, can also or alternately be used herein. Layered silicates from Hoechst also include NaSKS-~, NaSKS-7 and Na,SKS-11, as the a, ~ and y layer-silicate forms. . Other silicates may also be useful, such as magnesium silicate, which can serve as a crispening agent in granules, a~~ a stabilising agent for bleaches, and as a component of suds control systems.
Also suitable for use herein are synthesized crystalline ion exchange materials or hydrates thereof having chain structure and a composition represented by the following general formula in an anhydride form: xM20~ySi02.zM'O wherein M is Na and/or K, M' is Ca and/or Mg; y/x is 0.5 to 2.0 and z/x is 0.005 to 1.0 as taught in U.S. 5,427,71 l, Sakaguchi et al, .June 27, 1995.
Aluminosilicate builders are especially useful in granular detergents, but can also be incorporated in liquids, pastes or gels. Suitable for the present purposes are those having empirical formula: [Mz(AlO2)z(Si02)v]~xH~O wherein z and v are integers of at least 6, the molar ratio of z to v is in the range from 1.0 to 0.5, and x is an integer from 15 to 264. Aluminosi licates can be crystalline or amorphous, naturally-occurring or synthetically derived. An aluminosilicate production method is in U.S. 3,985,669, Krummel, et al, October 12, l976. Preferred synthetic crystalline aluminosilicate ion exchange rr~aterials are available as Zeolite A, Zeolite P (B), Zeolite X and, to whatever extent this differs from Zeolite P, the so-called Zeolite MAP. Natural types, including clinoptilolite, may be used. Zeolite A
has the formula: Nal2[(A102)12(Si02)12]~xH:~O wherein x is from 20 to 30, especially 27. Dehydrated zeolites (x = 0 - 10) may also be used. Preferably, the aluminosilicate has a particle size of 0.1-10 microns in diameter.
Detergent builders in place of or in addition to the silicates and aluminosilicates described hereinbefore can optionally be included in the compositions herein, for example to assist in controlling mineral, especially Ca andlor Mg, hardness in wash water or to assist in the removal of particulate soils from surfaces. Builders can operate via a variety of mechanisms including forming soluble or insoluble complexes with hardness ions, by ion exchange, and by offering a surface more favorable to the precipitation of hardness ions than are the surfaces of articles to be cleaned. Builder level can vary widely depending upon end use and physical form of the composition. Built detergents typically comprise at least about 1% builder. Liquid formulations typically comprise about 5% to about 50%, more typically 5% to 35% of builder. Granular formulations typically comprise from about 10% to about 80%, more typically 15% to 50% builder by weight of the SUBSTITUTE SHEET (RULE 26) i i detergent composition. Lower or higher levels of builders are not excluded.
For example, certain detergent additive or high-surfactant formulations can be unbuilt.
Suitable builders herein can be selected from the group consisting of phosphates and polyphosphates, especially the sodium salts; carbonates, bicarbonates, sesquicarbonates and carbonate minerals other than sodium carbonate or sesquicarbonate; organic mono-, di-, tri-, and tetracarboxylates especially water-soluble nonsurfactant carboxylates in acid, sodium, potassium or alkanolatnmonium salt form, as well as oligomeric or water-soluble low molecular weight polymer carboxylates including aliphatic and aromatic types; and phytic acid. 'These may be complemented by borates, e.g., for pH-buffering purposes, or by sulfates, especially sodium sulfate and any other fillers or carriers which may be important to the engineering of stable surfactant and/or builder-containing detergent compositions.
Builder mixtures, sometimes termed "builder systems" can be used and typically comprise two or more conventional builders. optionally complemented by chelants, pH-buffers or fillers, though these latter materials are generally accounted for separately when describing quantities of materials herein. In terms of relative quantities of surfactant and builder in the present detergents, preferred builder systems are typically formulated at a weight ratio of surfactant to builder of from about 60:1 to about 1:80. Certain preferred laundry detergents have said ratio in the range 0.90:1.0 to 4.0:l .0, more preferably from 0.95:1.0 to 3.0:1Ø
P-containing detergent builders often preferred where permitted by legislation include, but are not limited to, the alkali metal, ammonium and alkanolammonium salts of polyphosphates exemplified by the tripolyphosphates, pyrophosphates, glassy polymeric meta-phosphates; and phosphonates.
Suitable carbonate builders include alkaline earth and alkali metal carbonates as disclosed in German Patent Application No. 2,32l.001 published on November 15, 1973, although sodium bicarbonate, sodium carbonate, sodium sesquicarbonate, and other carbonate minerals such as trona or any convenient multiple salts of sodium carbonate and calcium carbonate such as those having the composition 2Na2C03.CaC03 when anhydrous, and even calcium carbonates including calcite, aragonite and vaterite, especially forms having high surface areas relative to compact calcite may be useful, for example as seeds or for use in synthetic detergent bars.
Suitable organic detergent builders include polycarboxylate compounds, including water-soluble nonsurfactant dicarboxylates and tricarboxylates. More typically builder polycarboxylates have a plurality of carboxylate groups, preferably at least 3 carboxylates. Carboxylate builders can be formulated in acid, partially SUBSTITUTE SHEET (RULE 26) neutral, neutral or overbased form. When in salt form, alkali metals. such as sodium, potassium. and lithium, or alkanolammonium salts are preferred.
Polycarboxylate builders include the ether polycarboxylates, such as oxydisuccinate, see Berg, U.S.
3,128.287, April 7, 1964, and Lamberti et al, U.S. 3,635,830, January 18, 1972;
"TMS/TDS" builders of U.S. 4,663,071, Bush et al, May 5, 1987; and other ether carboxylates including cyclic and alicyclic: compounds, such as those described in U.S. Patents 3,923,679; 3,835,163; 4,158,635; 4,120,874 and 4,102,903.
Other suitable builders are the ether hydroxypolycarboxylates, copolymers of malefic anhydride with ethylene or vinyl methyl ether; 1, 3, 5-trihydroxy benzene-2, 4, 6-trisulphonic acid; carboxymethyloxysuccinic acid; the various alkali metal, ammonium and substituted ammonium salts of polyacetic acids such as ethylenediamine tetraacetic acid and nitrilotriacetic acid; as well as mellitic acid, succinic acid, polymaleic acid, benzene 1,3,5-tricarboxylic acid. carboxy-methyloxysuccinic acid. and soluble salts t'hereo~
Citrates, e.g., citric acid and soluble salts thereof are important carboxylate builders e.g., for heavy duty liquid detergents) due to availability from renewable resources and biodegradability. Citrates c,an also be used in granular compositions, especially in combination with zeolite and/or layered silicates.
Oxydisuccinates are also especially useful in such compositions and combinations.
Where permitted, and especially in the formulation of bars used for hand-laundering operations, alkali metal phosphates such as sodium tripolyphosphates, sodium pyrophosphate and sodium orth~aphosphate can be used. Phosphonate builders such as ethane- I -hydroxy-1,1-diphosphonate and other known phosphonates, e.g., those of U.S. 3,159,581; 3.213,030; 3,422,021; 3,400,148 and 3,422,137 can also be used and may have desirable antiscaling properties.
Certain detersive surfactants or their short-chain homologs also have a builder action. For unambiguous formu:~a accounting purposes, when they have surfactant capability, these materials ar~~ summed up as detersive surfactants.
Preferred types for builder functionality we illustrated by: 3,3-dicarboxy-4-oxa-1,6-hexanedioates and the related compounds disclosed in U.S. 4,566,984, Bush, January 28, 1986. Succinic acid builders include the CS-C20 alkyl and alkenyl succinic acids and salts thereof. Succinate builders also include:
laurylsuccinate, myristylsuccinate, palmityisuccinate, 2-dodecenylsuccinate (preferred), 2-pentadecenylsuccinate, and the like. Lau,ryl-succinates are described in European Patent Application 86200690.5/0,200,26=s, published November ~, l986. Fatty acids, e.g., C 12-C 1 g monocarboxylic acids, can also be incorporated into the compositions as surfactant~builder materials alone or in combination with the SUBSTITUTE SHEET (RU~.E 26) i i aforementioned builders, especially citrate and/or the succinate builders. to provide additional builder activity. Other suitable polycarboxylates are disclosed in U.S.
4,144.226, Crutchfield et al. March 13, 1979 and in U.S. 3,308,067. Diehl, March 7, t967. See also Diehl, U.S. 3,723,322.
Other types of inorganic builder materials which can be used have the formula (Mx)i Cay (C03)z wherein x and i are integers from 1 to I ~, y is an integer from I
to 10, z is an integer from 2 to 25, Mi are cations, at least one of which is a water-soluble, and the equation Ei = 1-I5(xi multiplied by the valence of Mi) + 2y =
2z is satisfied such that the formula has a neutral or "balanced" charee. These builders are referred to herein as "Mineral Builders". Waters of hydration or anions other than carbonate may be added provided that the overall charge is balanced or neutral.
The charge or valence effects of such anions should be added to the right side of the above equation. Preferably, there is present a water-soluble canon selected from the group consisting of hydrogen, water-soluble metals, hydrogen. boron. ammonium, silicon, and mixtures thereof, more preferably, sodium, potassium, hydrogen, lithium, ammonium and mixtures thereof, sodium and potassium being highly preferred. Nonlimiting examples of noncarbonate anions include those selected from the group consisting of chloride, sulfate, fluoride. oxygen, hydroxide, silicon dioxide, chromate, nitrate. borate and mixtures thereof. Preferred builders of this type in their simplest forms are selected from the group consisting of Na2Ca(C03)2, K2Ca(C03)2, Na~Ca2(C03)3, NaKCa(C03)2, NaKCa2(C03)3, K~Ca2(C03)3, and combinations thereof. An especially preferred material for the builder described herein is Na2Ca(C03)2 in any of its crystalline modifications. Suitable builders of the above-defined type are further illustrated by, and include, the natural or synthetic forms of any one or combinations of the following minerals: Afghanite, Andersonite, AshcroftineY. Beyerite. Borcarite, Burbankite, Butschliite, Cancrinite, Carbocemaite, Carletonite. Davyne, DonnayiteY, Fairchildite) Ferrisurite, Franzinite, Gaudefroyite) Gaylussite, Girvasite, Gregoryite, Jouravskite, KamphaugiteY, Kettnerite, Khanneshite, LepersonniteGd, Liottite, MckelveyiteY, Microsommite, Mroseite, Natrofairchildite, Nyerereite, RemonditeCe, Sacrofanite, Schrockingerite, Shortite, Surite, Tunisite, Tuscanite, Tyrolite, Vishnevite, and Zemkorite. Preferred mineral forms include Nyererite, FairchiIdite and Shortite.
Polymeric Soil Release Agent - Known polymeric soil release agents, hereinafter "SRA" or "SRA's", can optionally be employed in the present detergent compositions. If utilized) SRA's will generally comprise from 0.0l% to l0.0%, typically from 0.1% to 5%, preferably from 0.2% to 3.0% by weight, of the composition.
SUBSTfTUTE S!-IEET (RULE 26) _ Preferred SRA's typically have hydrophilic segments to hydrophilize the surface of hydrophobic fibers such as F>olyester and nylon, and hydrophobic segments to deposit upon hydrophobic fibers and remain adhered thereto through completion of washing and rinsing cycles. thereby serving as an anchor for the hydrophilic segments. This can enable stains occurring subsequent to treatment with SRA to be more easily cleaned in later washing procedures.
SRA's can include a variety of charged, e.g., anionic or even cationic (see U.S. 4,956,447), as well as noncharged monomer units and structures may be linear, branched or even star-shaped. They may include capping moieties which are especially effective in controlling molecular weight or altering the physical or surface-active properties. Structures and charge distributions may be tailored for application to different fiber or textile types and for varied detergent or detergent additive products.
Preferred SRA's include oligomeric terephthalate esters, typically prepared by processes involving at least one transesterification/oligomerization, often with a metal catalyst such as a titanium(IV) alkoxide. Such esters may be made using additional monomers capable of being incorporated into the ester structure through one, two, three, four or more positions, without of course forming a densely crosslinked overall structure.
Suitable SRA's include: a sulfonated product of a substantially linear ester oligomer comprised of an oligomeric ester backbone of terephthaloyl and oxyalkyleneoxy repeat units and allyl-derived sulfonated terminal moieties covalently attached to the backbone, for e:rcample as described in U.S.
4,968,451, November 6, 1990 to J.J. Scheibel and E.P, Gosselink: such ester oligomers can be prepared by (a) ethoxylating allyl alcohoi~, (b) reacting the product of (a) with dimethyl terephthalate ("DMT") and 1,2-yropylene glycol ("PG") in a two-stage transesterification/ oligomerization procedure and (c) reacting the product of (b) with sodium metabisulfite in water; the nonionic end-capped 1,2-propylene/polyoxyethylene terephthalate polyesters of U.S. 4,711,730, December 8, 1987 to Gosselink et al, for example those produced by transesterif cation/oligomerization of poly(ethyleneglycol) methyl ether, DMT, PG
and poly(ethyleneglycol) ("PEG"); the partly- and fully- anionic-end-capped oligomeric esters of U.S. 4,721,580, January 26, 1988 to Gosselink, such as oligomers from ethylene glycol ("EG"), PG, DMT and Na-3,6-dioxa-8-hydroxyoctanesulfonate; the nonionic-capped block polyester oligomeric compounds of U.S. 4,702,857, October 27, 1987 to Gosselink, for example produced from DMT, Me-capped PEG and EG and/or PG, or a combination of SUBSTITUTE SHEET (RULE 26) i i DMT, EG and/or PG, Me-capped PEG and Na-dimethyl-~-sulfoisophthalate: and the anionic. especially sulfoaroyl, end-capped terephthalate esters of U.S.
4.877,896, October 31, 1989 to Maldonado, Gosselink et al, the latter being typical of SRA's useful in both laundry and fabric conditioning products, an example being an ester composition made from m-sulfobenzoic acid monosodium salt. PG and DMT
optionally but preferably further comprising added PEG, e.g., PEG 3400.
SRA's also include simple copolymeric blocks of ethylene terephthaiate or propylene terephthalate with polyethylene oxide or polypropylene oxide terephthalate. see U.S. 3,959,230 to Hays, May 25, 1976 and U.S. 3,893,929 to Basadur, July 8, l975; cellulosic derivatives such as the hydroxyether cellulosic polymers available as METHOCEL from Dow; and the C 1-C4 alkylcelluloses and C4 hydroxyalkyl celluloses; see U.S. 4,000,093, December 28, 1976 to Nicol, et al.
Suitable SRA's characterised by polyvinyl ester) hydrophobe segments include graft copolymers of polyvinyl ester), e.g., CI-C6 vinyl esters, preferably polyvinyl acetate), grafted onto polyalkylene oxide backbones. See European Patent Application 0 219 048, published April 22, 1987 by Kud, et al. Commercially available examples include SOKALAN SRA's such as SOKALAN I-IP-22, available from BASF, Germany. Other SR.A's are polyesters with repeat units containing IO-I S% by weight of ethylene terephthalate together with 90-80% by weight of polyoxyethylene terephthalate, derived from a polyoxyethylene glycol of average molecular weight 300-5,000. Commercial examples include ZELCON ~ 126 from Dupont and MILEASE T from ICI.
Another preferred SRA is an oligomer having empirical formula (CAP)Z(EG/PG)5(T)5(SIP)~ which comprises terephthaloyl (T), sulfoisophthaloyl (SIP), oxyethyleneoxy and oxy-1,2-propylene (EG/PG) units and which is preferably terminated with end-caps (CAP), preferably modified isethionates, as in an oligomer comprising one sulfoisophthaloyl unit, 5 terephthaloyl units, oxyethyleneoxy and oxy-1,2-propyleneoxy units in a defined ratio, preferably about 0.5:1 to about 10:1, and two end-cap units derived from sodium 2-(2-hydroxyethoxy)-ethanesulfonate. Said SRA preferably fZtrther comprises from 0.5%
to 20%, by weight of the oligomer, of a crystallinity-reducing stabiliser, for example an anionic surfactant such as linear sodium dodecvlbenzenesulfonate or a member selected from xylene-, cumene-, and toluene- sulfonates or mixtures thereof, these stabilizers or modifiers being introduced into the synthesis pot, all as taught in U.S.
5,415,807, Gosselink, Pan, Kellett and Hall, issued May 16, 1995. Suitable monomers for the above SRA include Na 2-(2-hydroxyethoxy)-ethanesulfonate, DMT, Na- dimethyl 5-sulfoisophthalate, EG and PG.
SUBSTITUTE SHEET (RULE 26) - Yet another group of preferred SRA's are oligomeric esters comprising: ( 1 ) a backbone comprising (a) at least one unit selected from the group consisting of dihydroxysulfonates, polyhydroxy sulfonates, a unit which is at least trifunctional whereby ester linkages are formed resulting in a branched oligomer backbone, and combinations thereof; (b) at least one unit which is a terephthaloyl moiety;
and (c) at least one unsulfonated unit which is a 1,2-oxyalkyleneoxy moiety; and (2) one or more capping units selected from nonionic: capping units, anionic capping units such as alkoxylated, preferably ethoxylated, isethionates, alkoxyiated propanesulfonates, alkoxylated propanedisulfonates, aIkoxylated phenolsulfonates, sulfoaroyl derivatives and mixtures thereof. Preferred of such esters are those of empirical formula:
{ (CAP)x(EG/PG}y'(DEG)y"(P1~G)y"'(T)z{SIP)z'(SEG)q(B)m }
wherein CAP, EGIPG, PEG, T and SIP are as defined hereinabove, (DEG) represents di(oxyethylene)oxy units; (SEG) represents units derived from the sulfoethyl ether of glycerin and related m~aiety units; (B) represents branching units which are at least trifunctional whereby ester linkages are formed resulting in a branched oligomer backbone; x is from about 1 to about 12; y' is from about 0.5 to about 25; y" is from 0 to about 12; y"' is from 0 to about 10; y'+y"+y"' totals from about 0.5 to about 25; z is from about 1.5 0o about 25: z' is from 0 to about 12; z + z' totals from about 1.5 to about 25; q is from about 0.05 to about 12; m is from about 0.01 to about 10; and x, y', y", y"', z, z', q and m represent the average number of moles of the corresponding units per nnole of said ester and said ester has a molecular weight ranging from about 500 to about 5,000.
Preferred SEG and CAP monomers for the above esters include Na-2-(2-,3-dihydroxypropoxy)ethanesulfonate {"SECi"), Na-2- { 2-{2-hydroxyethoxy) ethoxy }
ethanesulfonate ("SE3") and its homologs and mixtures thereof and the products of ethoxylating and sulfonating allyl alcohol. Preferred SRA esters in this class include the product of transesterifying and oligomerizing sodium 2-{2-(2-hydroxyethoxy)ethoxy}ethanesulfonate and/or sodium 2-[2-{2-(2-hydroxyethoxy)-ethoxy}ethoxy]ethanesulfonate, DMT, sodium 2-(2,3-dihydroxypropoxy) ethane sulfonate, EG, and PG using an appropriate Ti(IV) catalyst and can be designated as (CAP)2(T)5(EG/PG)1.4{SEG)2.5(B)0.13 wherein CAP is (Na+ -03S[CH2CH20]3.5)- and B is a unit from glycerin and the mole ratio EG/PG is about 1.7:1 as measured by conventional gas chromatography after complete hydrolysis.
Additional classes of SRA's include (I) nonionic terephthalates using diisocyanate coupling agents to link up polymeric ester structures, see U.S.
SUBSTITUTE SH~,ET (RULE 26) i 4;201,824, Violland et al. and U.S. 4,240,918 Lagasse et al; (II) SRA's with carboxylate terminal groups made by adding trimellitic anhydride to known SRA's to convert terminal hydroxyl groups to trimellitate esters. With a proper selection of catalyst, the trimellitic anhydride forms linkages to the terminals of the polymer through an ester of the isolated carboxylic acid of trimellitic anhydride rather than by opening of the anhydride linkage. Either nonionic or anionic SRA's may be used as starting materials as long as they have hydroxyl terminal groups which may be esterified. See U.S. 4,525,524 Tung et al.; (III) anionic terephthalate-based SRA's of the urethane-linked variety, see U.S. 4,201,824, Violland et al; (IV) polyvinyl caprolactam) and related co-polymers with monomers such as vinyl pyrrolidone and/or dimethylaminoethyl methacrylate, including both nonionic and cationic polymers, see U.S. 4,579.681, Ruppert et al.; (V) graft copolymers, in addition to the SOKALAN types from BASF made, by grafting acrylic monomers on to sulfonated polyesters; these SRA's assertedly have soil release and anti-redeposition activity similar to known cellulose ethers: see EP 279,134 A. 1988, to Rhone-Poulenc Chemie; (VI) grafts of vinyl monomers such as acrylic acid and vinyl acetate on to proteins such as caseins, see EP 457,205 A to BASF ( 199l ); (VII) polyester-polyamide SRA's prepared by condensing adipic acid, caprolactam, and polyethylene glycol, especially for treating polyamide fabrics, see Bevan et al, DE
2,335,044 to Unilever N. V., l974. Other useful SRA's are described in U.S.
Patents 4.240,918, 4,787,989, 4,525,524 and 4,877,896.
Clav Soil Removal/Anti-redeposition A ents - The compositions of the present invention can also optionally contain water-soluble ethoxylated amines having clay soil removal and antiredeposition properties. Granular detergent compositions which contain these compounds typically contain from about 0.0l %
to about 10.0% by weight of the water-soluble ethoxylates amines; liquid detergent compositions typically contain about 0.01% to about 5%.
The most preferred soil release and anti-redeposition agent is ethoxylated tetraethylenepentamine. Exemplary ethoxylated amines are further described in U.S. Patent 4,597,898, VanderMeer, issued July 1, 1986. Another group of preferred clay soil removal-antiredeposition agents are the cationic compounds disclosed in European Patent Application i I 1,965, Oh and Gosselink, published June 27, 1984. Other clay soil removal/antiredeposition agents which can be used include the ethoxylated amine polymers disclosed in European Patent Application 111,984, Gosselink, published June 27, 1984; the zwitterionic polymers disclosed in European Patent Application 112,592, Gosselink, published July 4, 1984; and the amine oxides disclosed in U.S. Patent 4,548,744, Connor, issued October 22, 1985.
SUBSTITUTE SHEET (RULE 26) Other clay soil removal and/or anti redeposition agents known in the art can also be utilized in the compositions herein. See U.S. :Patent 4,891,1b0. VanderMeer, issued January ?, 1990 and WO 9/32272, published November 30, 1995. Another tvpe of preferred antiredeposition agent includes the carboxy methyl cellulose (CMC) materials. These materials are well known in the art.
Polymeric Disp-ersine .Agents - Polymeric dispersing agents can advantageously be utilized at levels from about 0.1 % to about 7%, by weight, in the compositions herein, especially in the presence of zeolite and/or layered silicate builders. Suitable polymeric dispersing agents include polymeric polycarboxylates and polyethylene glycols, although others known in the art can also be used.
It is believed, though it is not intended to be limited by theory, that polymeric dispersing agents enhance overall detergent builder performance, when used in combination with other builders (including lower molecular weight polycarboxylates) by crystal growth inhibition, particulate soil release pepti:zation, and anti-redeposi.tion.
Polymeric polycarboxylate materials c:an be prepared by polymerizing or copolymerizing suitable unsaturated monomers, preferably in their acid form.
Unsaturated monomeric acids that can be polymerized to form suitable polymeric polycarboxylates include acrylic acid, malefic acid (or malefic anhydride), fumaric acid, itaconic acid, aconitic acid, mesacconic acid, citraconic acid and methyienemalonic acid. The presence in thepolymeric polycarboxylates herein or monomeric segments, containing no carboxylate radicals such as vinylmethyl ether, styrene, ethylene, etc. is suitable provided that such segments do not constitute more than about 40% by weight.
Particularly suitable polymeric polycarboxylates can be derived from acrylic acid. Such acrylic acid-based polymers which are useful herein are the water-soluble salts of polymerized acrylic acid. Tlce average molecular weight of such polymers in the acid form preferably ranges from about 2,000 to 10,000, more preferably from about 4,000 to 7,000 and most preferably from about 4,000 to a000.
Water-soluble salts of such acrylic acid polymers can include, for example, the alkali metal, ammonium and substituted ammonium salts. Soluble polymers of this type are known materials. Use of polyacrylates of this type in detergent compositions has been disclosed, for examplie, in Diehl, U.S. Patent 3,308,067, issued march 7, 1967.
Acrylic/maleic-based copolymers may also be used as a preferred component of the dispersing/anti-redeposition agent. Sucih materials include the water-soluble salts of copolymers of acrylic acid and malefic acid. The average molecular weight of such copolymers in the acid form preferably ranges from about 2.000 to 100,000, SUBSTITUTE SHEI=T (RULE 26) i more preferably from about a000 to p,000, most preferably from about 7,000 to 6a000. The ratio of acrylate to maleate segments in such copolymers will generally range from about 30:1 to about 1:1, more preferably from about 10:1 to 2:1.
Water-soluble salts of such acrylic acid/maleic acid copolymers can include, for example, the alkali metal, ammonium and substituted ammonium salts. Soluble acrylate/maleate copolymers of this type are known materials which are described in European Patent Application No. 66915, published December 1 ~, 1982, as well as in EP l93,360, published September 3, l986, which also describes such polymers comprising hydroxypropylacrylate. Still other useful dispersing agents include the maleic/acryiic/vinyl alcohol terpolymers. Such materials are also disclosed in EP
193,360, including, for example, the 45/45/10 terpolymer of acrylic/maleic/vinyl alcohol.
Another polymeric material which can be included is polyethylene glycol (PEG). PEG can exhibit dispersing agent performance as well as act as a clay soil removal-antiredeposition agent. Typical molecular weight ranges for these purposes range from about ~ 00 to about 100.000, preferably from about i ,000 to about Q0,000, more preferably from about 1.500 to about 10,000.
Polyaspartate and polyglutamate dispersing agents may also be used, especially in conjunction with zeolite builders. Dispersing agents such as polyaspartate preferably have a molecular weight (avg.) of about l0,000.
Brightener - Any optical brighteners or other brightening or whitening agents known in the art can be incorporated at levels typically from about 0.01 % to about 1.2%, by weight, into the detergent compositions herein. Commercial optical brighteners which may be useful in the present invention can be classified into subgroups, which include) but are not necessarily limited to, derivatives of stilbene, pyrazoline, coumarin, carboxylic acid, methinecyanines, dibenzothiophene-~,5-dioxide, azoles, ~- and 6-membered-ring heterocycles, and other miscellaneous agents. Examples of such brighteners are disclosed in "The Production and Application of Fluorescent Brightening Agents", M. Zahradnik, Published by John Wiley & Sons, New York ( 1982).
Specific examples of optical brighteners which are useful in the present compositions are those identified in U.S. Patent 4,790,856, issued to Wixon on December 13, 1988. These brighteners include the PHORWHITE series of brighteners from Verona. Other brighteners disclosed in this reference include:
Tinopal UNPA, Tinopal CBS and Tinopal SBM; available from Ciba-Geigy; Artic White CC and Artic White CWD, the 2-(4-styryl-phenyl)-2H-naptho[1,2-d]triazoles;
4,4'-bis-(1,2,3-triazol-2-yl)-stilbenes; 4,4'-bis(styryl)bisphenyls; and the amino-SUBSTITUTE SHEET (RULE 26) coumarins. Specific examples of these bril;hteners include 4-methyl-7-diethyl-amino coumarin; l,?-bis(benzimidazol-2-yl)ethylene; I,3-diphenyl-pyrazolines;
2,5-bis(benzoxazol-2-yl)thiophene; 2-styryl-naptho[ 1,2-d]oxazole; and 2-(stilben-=1-yl)-2H-naphtho[ 1,2-d]triazole. See also U.S. Patent 3,646,01 S, issued February 29, 1972 to Hamilton.
Dye Transfer Inhibitine Agents - The compositions of the present invention may also include one or more materi~~ls effective for inhibiting the transfer of dyes from one fabric to another during the cleaning process. Generally, such dye transfer inhibiting agents include polyvinyl pyrrolidone polymers, polyamine N-oxide polymers, copolymers of N-vinylpyrrolidone and N-vinylimidazole, manganese phthalocyanine, peroxidases) and mixtures thereof. If used, these agents typically comprise from about 0.01 % to about. 10% by weight of the composition, preferably from about 0.01 % to about 5%, and more preferably from about 0.05%
to about 2%.
More specifically, the polyamine N-oxide polymers preferred for use herein contain units having the following structural formula: R-Ax-P; wherein P is a polymerizable unit to which an N-O group can be attached or the N-O group can form part of the polymerizable unit or the N-O group can be attached to both units; A
is one of the following structures: -NC(O)-, -C(O)O-, -S-, -O-, -N=; x is 0 or 1; and R is aliphatic, ethoxylated aliphatics, aromatics, heterocyclic or alicyclic groups or any combination thereof to which the nitrogen of the N-O group can be attached or the N-O group is part of these groups. Preferred polyamine N-oxides are those wherein R is a heterocyclic group such as pyridine, pyrrole, imidazole, pyrrolidine) piperidine and derivatives thereof.
The N-O group can be represented by the following general structures:
O O
I I
(Rt?x-N WR2?y; =N -(Rt )x (R3)z wherein R1, R2, R3 are aliphatic, aromatic) heterocyclic or alicyclic groups or combinations thereof; x, y and z are 0 or 1; and the nitrogen of the N-O group can be attached or form part of any of the aforementioned groups. The amine oxide unit of the polyamine N-oxides has a pKa < 10, preferably pKa <7, more preferred pKa <6.
Any polymer backbone can be used as long as the amine oxide polymer formed is water-soluble and has dye transfer inhibiting properties. Examples of suitable polymeric backbones are polyvinyls, polyalkylenes, polyesters, polyethers, polyamide, polyimides, polyacryiates and mixtures thereof. These polymers include SUBSTITUTE SHEET (RULE 26) random or block copolymers where one monomer type is an amine N-oxide and the other monomer type is an N-oxide. The amine N-oxide polymers typically have a ratio of amine to the amine N-oxide of 10:1 to 1:1,000,000. However, the nc:mber of amine oxide groups present in the polyamine oxide polymer can be varied by appropriate copolymerization or by an appropriate degree of N-oxidation. The polyamine oxides can be obtained in almost any degree of polymerization.
Typically, the average molecular weight is within the range of 500 to 1,000,000;
more preferred 1,000 to ~ 00,000; most preferred i.000 to i 00,000. This preferred class of materials can be referred to as "PVNO".
The most preferred polyamine N-oxide useful in the detergent compositions herein is poly(4-vinylpyridine-N-oxide) which as an average molecular weight of about Q0,000 and an amine to amine N-oxide ratio of about 1:4.
Copolymers of N-vinylpyrrolidone and N-vinylimidazole polymers (referred to as a class as "PVPVI") are also preferred for use herein. Preferably the PVPVI
has an average molecular weight range from a000 to 1,000,000, more preferably from a000 to 200,000, and most preferably from 10,000 to 20,000. (The average molecular weight range is determined by light scattering as described in Barth, et al., Chemical Analysis, Vol 113. "Modern Methods of Polymer Characterization", the disclosures of which are incorporated herein by reference.) The PVPVI
copolymers typically have a molar ratio of N-vinylimidazole to N-vinylpyrrolidone from 1:1 to 0.2:1, more preferably from 0.8:1 to 0.3 :1, most preferably from 0.6:1 to 0.4:1.
These copolymers can be either linear or branched.
The present invention compositions also may employ a polyvinylpyrrolidone ("PVP"} having an average molecular weight of from about a000 to about 400.000.
preferably from about 5,000 to about 200.000. and more preferably from about 5,000 to about 50,000. PVP's are known to persons skilled in the detergent field;
see) for example, EP-A-2b2,897 and EP-A-256,696, incorporated herein by reference.
Compositions containing PVP can also contain polyethylene glycol ("PEG") having an average molecular weight from about 500 to about 100,000, preferably from about 1,000 to about 10,000. Preferably, the ratio of PEG to PVP on a ppm basis delivered in wash solutions is from about 2:1 to about 50:1, and more preferably from about 3:1 to about 10:l.
The detergent compositions herein may also optionally contain from about 0.005% to ~% by weight of certain types of hydrophilic optical brighteners which also provide a dye transfer inhibition action. If used, the compositions herein will preferably comprise from about 0.0l % to 1 % by weight of such optical brighteners.
SUBSTITUTE SHEET (RULE 26) :17 - The hydrophilic optical brighteners useful in the present invention are those having the structural formula:
R~ R
N H H N
N ~>--N O C= C_ O N--~~ N
~N H H N
R~ S03M S~3M Rt wherein R1 is selected from anilino, N-2-bis-hydroxyethyl and NH-2-hydroxyethyl;
R~ is selected from N-2-bis-hydroxyethyl, N-2-hydroxyethyl-N-methylamino, motphilino, chloro and amino; and M is a salt-forming canon such as sodium or potassium.
When in the above formula, R 1 is anilin~o. R~ is N-2-bis-hydroxyethyl and M
is a canon such as sodium, the brighten~~r is 4,4',-bis[(4-anilino-6-(N-2-bis-hydroxyethyl)-s-triazine-2-yl)amino]-2.?'-stilbenedisulfonic acid and disodium salt.
This particular brightener species is commercially marketed under the tradename Tinopal-L1NPA-GX by Ciba-Geigy Corporation. Tinopal-L1NPA-GX is the preferred hydrophilic optical brightener useful in the detergent compositions herein.
When in the above formula, R1 is anilino) R~ is N-2-hydroxyethyl-N-2-methylamino and M is a canon such as sodium., the brightener is 4,4'-bis[(4-anilino-6-(N-2-hydroxyethyl-N-methylamino)-s-triazin~e-2-yl)amino]2,2'-stilbenedisulfonic acid disodium salt. This particular brightenex species is commercially marketed under the tradename Tinopal ABM-GX by Ciba-Geigy Corporation.
When in the above formula, R 1 is anilino, R~ is motphilino and M is a cation such as sodium. the brightener is 4,4'-bis[(4-anilino-6-morphilino-s-triazine-yl)amino]2,2'-stilbenedisulfonic acid. sodium salt. This particular brightener species is commercially marketed under the tradenam~e Tinopal AMS-GX by Ciba Geigy Corporation.
The specific optical brightener species selected for use in the present invention provide especially effective dye transfer inhibition performance benefits when used in combination with the selected polymeric dye transfer inhibiting agents hereinbefore described. The combination of such selected polymeric materials (e.g., PVNO and/or PVPVI) with such selected optical brighteners (e.g., Tinopal LTNPA-GX, Tinopal SBM-GX and/or Tinopal AMS-CiX) provides significantly better dye transfer inhibition in aqueous wash solutions than does either of these two detergent composition components when used alone. Without being bound by theory, it is believed that such brighteners work this way because they have high affinity for fabrics in the wash solution and therefore deposit relatively quick on these fabrics.
SUBSTITUTE SHEf:T (RULE 26) i The extent to which brighteners deposit on fabrics in the wash solution can be defined by a parameter called the "exhaustion coefficient". The exhaustion coefficient is in general as the ratio of a) the brightener material deposited on fabric to b) the initial brightener concentration in the wash liquor. Brighteners with relatively high exhaustion coeff eients are the most suitable for inhibiting dye transfer in the context of the present invention.
Of course. it will be appreciated that other, conventional optical brightener types of compounds can optionally be used in the present compositions to provide conventional fabric "brightness" benefits, rather than a true dye transfer inhibiting effect. Such usage is conventional and well-known to detergent formulations.
Chelatin~ Agents - The detergent compositions herein may also optionally contain one or more iron and/or manganese chelating agents. Such chelating agents can be selected from the Group consisting of amino carboxylates. amino phosphonates, polyfunctionally-substituted aromatic chelating agents and mixtures therein, all as hereinafter defined. Without intending to be bound by theory, it is believed that the benefit of these materials is due in part to their exceptional ability to remove iron and manganese ions from washing solutions by formation of soluble chelates.
Amino carboxylates useful as optional chelating agents include ethylenediaminetetracetates, N-hydroxyethylethylenediaminetriacetates, nitrilotri-acetates, ethylenediamine tetraproprionates, triethylenetetraaminehexacetates, diethylenetriaminepentaacetates) and ethanoldiglycines, alkali metal.
ammonium, and substituted ammonium salts therein and mixtures therein.
Amino phosphonates are also suitable for use as chelating agents in the compositions of the invention when at lease low levels of total phosphorus are permitted in detergent compositions, and include ethylenediaminetetrakis (methylenephosphonates) as DEQUEST. Preferred, these amino phosphonates to not contain alkyl or alkenyi groups with more than about 6 carbon atoms.
Polyfunctionally-substituted aromatic chelating agents are also useful in the compositions herein. See U.S. Patent 3,8l2,044, issued May 21, l974, to Connor et al. Preferred compounds of this type in acid form are dihydroxydisulfobenzenes such as 1,2-dihydroxy-3,5-disulfobenzene.
A preferred biodegradable chelator for use herein is ethylenediamine disuccinate ("EDDS"), especially the [S,S] isomer as described in U.S. Patent 4,704,233, November 3. 1987, to Hartman and Perkins.
SUBSTITUTE SHEET (RULE 26) - The compositions herein may also contain water-soluble methyl giycine diacetic acid (MGDA) salts (or acid form) as z~ chelant or co-builder useful with, for example. insoluble builders such as zeolites, layered silicates and the like.
If utilized, these cheiating agents will generally comprise from about 0.1% to about 1 ~% by weight of the detergent compositions herein. More preferably, if utilized, the chelating agents will comprise from about 0.1 % to about 3.0% by weight of such compositions.
Suds Suppressors - Compounds for reducing or suppressing the formation of suds can be incorporated into the compositions of the present invention. Suds suppression can be of particular importance in the so-called "high concentration cleaning process" as described in U.S. 4,489,4:m and 4,489,574 and in front-loading European-style washing machines.
A wide variety of materials may be used as suds suppressors, and suds suppressors are well known to those skilled in the art. See, for example. Kirk Othmer Encyclopedia of Chemical Technology, Third Edition, Volume 7, pages 430-447 (John Wiley & Sons, Inc., l979). One category of suds suppressor of particular interest encompasses monocarboxyl:ic fatty acid and soluble salts therein.
See U.S. Patent 2,954.347, issued September 27, 1960 to Wayne St. John. The monocarboxylic fatty acids and salts thereof used as suds suppressor typically have hydrocarbyl chains of 10 to about 24 carbon atoms, preferably 12 to 18 carbon atoms. Suitable salts include the alkali metal salts such as sodium, potassium, and lithium salts. and ammonium and alkanolammonium salts.
The detergent compositions herein may also contain non-surfactant suds suppressors. These include, for example: high molecular weight hydrocarbons such as paraffin, fatty acid esters (e.g., fatty acid triglycerides), fatty acid esters of monovaient alcohols, aliphatic C 1 g-C40 keto:nes (e.g., stearone), etc. Other suds inhibitors include N-alkylated amino triazines :~,uch as tri- to hexa-alkylmelamines or di- to tetra-alkyldiamine chlortriazines formed as products of cyanuric chloride with two or three moles of a primary or secondary amine containing 1 to 24 carbon atoms, propylene oxide, and monostearyl phosphates such as monostearyl alcohol phosphate ester and monostearyl di-alkali metal (e.g., K, Na, and Li) phosphates and phosphate esters. The hydrocarbons such His paraffin and haloparaffin can be utilized in liquid form. The liquid hydrocarbons will be Eiquid at room temperature and atmospheric pressure, and will have a pour point in the range of about -40~C and about ~0~C, and a minimum boiling point not less than about 110~C (atmospheric pressure}. It is also known to utilize waxy hydrocarbons, preferably having a melting point below about 100~C. The hydroc,~rbons constitute a preferred category SUBSTITUTE SHEIcT (RULE 26) i o~ suds suppressor for detergent compositions. Hydrocarbon suds suppressors are described, for example, in U.S. Patent 4.265,779. issued May ~, 1981 to Gandolfo et al. The hydrocarbons, thus, include aliphatic. alicyclic, aromatic, and heterocvclic saturated or unsaturated hydrocarbons having from about 12 to about 70 carbon atoms. The term "paraffin," as used in this suds suppressor discussion, is intended to include mixtures of true paraffins and cyclic hydrocarbons.
Another preferred category of non-surfactant suds suppressors comprises silicone suds suppressors. This category includes the use of polyorganosiloxane oils, such as polydimethylsiloxane, dispersions or emulsions of polyorganosiloxane oils or resins, and combinations of polyorganosiloxane with silica particles wherein the polyorganosiloxane is chemisorbed or fused onto the silica. Silicone suds suppressors are well known in the art and are, for example) disclosed in U.S.
Patent 4.26a779, issued May ~, l981 to Gandolfo et al and European Patent Application No. 8930785l.9, published February 7, 1990, by Starch, M. S.
Other silicone suds suppressors are disclosed in U.S. Patent 3,4~,839 which relates to compositions and processes for defoaming aqueous solutions by incorporating therein small amounts of polydimethylsiloxane fluids.
Mixtures of silicone and silanated silica are described) for instance, in German Patent Application DOS 2,124,526. Silicone defoamers and suds controlling agents in granular detergent compositions are disclosed in U.S.
Patent 3,933,672, Bartolotta et al, and in U.S. Patent 4,652,39?. Baginski et al, issued March 24, l987.
An exemplary silicone based suds suppressor for use herein is a suds suppressing amount of a suds controlling agent consisting essentially of:
(i) polydimethylsiloxane fluid having a viscosity of from about 20 cs. to about l,500 cs. at 25~C;
(ii) from about ~ to about 50 parts per 100 parts by weight of (i) of siloxane resin composed of (CH3)3Si01~2 units of Si02 units in a ratio of from (CH3)3 Si01~2 units and to Si02 units of from about 0.6:1 to about 1.2:1; and (iii) from about 1 to about 20 parts per l00 parts by weight of (i) of a solid silica gel.
In the preferred silicone suds suppressor used herein, the solvent for a continuous phase is made up of certain polyethylene glycols or polyethylene-polypropylene glycol copolymers or mixtures thereof (preferred), or polypropylene glycol. The primary silicone suds suppressor is branched/crosslinked and preferably not linear.
SUBSTITUTE SHEET (RULE 26) - To illustrate this point further. typical liquid laundry detergent compositions with controlled suds will optionally comprise from about 0.001 to about 1, preferably from about 0.01 to about 0.7, most. preferably from about 0.05 to about 0.5, weight % of said silicone uds suppressor, which comprises ( i ) a nonaqueous emulsion of a primary antifoam agent which is a mixture of (a) a polyorganosiloxane) (b) a resinous siloxane or a silicone resin-producing silicone compound, (c) a finely divided filler material, and (d) a catalyst to promote the reaction of mixture components (a), (b) and (c), to form silanolates; (2) at least one nonionic silicone surfactant; and (3) polyethylene glycol or a copolymer of polyethylene-polypropylene glycol having a solubility in water at room temperature of more than about 2 weight ~.'~; and without polypropylene glycol. Similar amounts can be used in granular compositions, gels, etc. See also U.S. Patents 4,978,47I, Starch, issued December 18, 1990, and 4,983..316, Starch, issued January 8.
199l , a288.431. Huber et al.. issued February 22, 1994. and U.S. Patents 4.639,489 and 4,749,740, Aizawa et al at column 1, line 46 through column 4, line 35.
The silicone suds suppressor herein preferably comprises polyethylene' glycol and a copolymer of polyethylene glycol/polypropylene glycol. all having an average molecular weight of less than about 1,000, preferably between , bout and 800. The polyethylene glycol and pol yethylene/polypropylene copolymers herein have a solubility in water at room temperature of more than about 2 weight %, preferably more than about ~ weight %.
The preferred solvent herein is polyethylene glycol having an average molecular weight of less than about l.000, more preferably between about 100 and 800, most preferably between 200 and 400.. and a copolymer of polyethylene glycoUpolypropylene glycol, preferably PPG 200/PEG 300. Preferred is a weight ratio of between about 1:1 and l:10, most preferably between 1:3 and I:6, of polyethylene glycol:copolymer of polyethylene-polypropylene glycol.
The preferred silicone suds suppre~~sors used herein do not contain polypropylene glycol. particularly of 4,000 molecular weight. They also preferably do not contain block copolymers of ethylene oxide and propylene oxide, like PLURONIC L 1 O I .
Other suds suppressors useful herein comprise the secondary alcohols (e.g., 2-alkyl alkanols) and mixtures of such alcohols with silicone oils, such as the silicones disclosed in U.S. 4,798,679, 4,0p,118 and EP I 50,872. The secondary alcohols include the C6-C 16 alkyl alcohols h~~ving a C 1-C 16 chain. A
preferred alcohol is 2-butyl octanol, which is available from Condea under the trademark ISOFOL 12. Mixtures of secondary alcohols are available under the trademark SUBSTITUTE SHE13T (RULE 26) ISALCHEM l23 from Enichem. Mixed suds suppressors typically comprise mixtures of alcohol + silicone at a weight ratio of 1:~ to ~:1.
For any detergent compositions to be used in autornatic laundry washing machines, suds should not form to the extent that they overflow the washing machine. Suds suppressors, when utilized, are preferably present in a "suds suppressing amount. By "suds suppressing amount" is meant that the formulator of the composition can select an amount of this suds controlling agent that will sufficiently control the suds to result in a low-sudsing laundry detergent for use in automatic laundry washing machines.
The compositions herein will generally comprise from 0% to about 10% of suds suppressor. When utilized as suds suppressors, monocarboxylic fatty acids, and salts therein, will be present typically in amounts up to about 5%, by weight) of the detergent composition. Preferably, from about 0.5% to about 3% of fatty monocarboxylate suds suppressor is utilized. Silicone suds suppressors are typically utilized in amounts up to about 2.0%, by weight, of the detergent composition, although higher amounts may be used. This upper limit is practical in nature, due primarily to concern with keeping costs minimized and effectiveness of lower amounts for effectively controlling sudsing. Preferably from about 0.0l % to about 1 % of silicone suds suppressor is used, more preferably from about 0.25% to about 0.5%. As used herein, these weight percentage values include any silica that may be utilized in combination with polyorganosiloxane, as well as any adjunct materials that may be utilized. Monostearyl phosphate suds suppressors are generally utilized in amounts ranging from about 0.1 % to about 2%, by weight, of the composition.
Hydrocarbon suds suppressors are typically utilized in amounts ranging from about 0.01 % to about 5.0%, although higher levels can be used. The alcohol suds suppressors are typically used at 0.2%-3% by weight of the finished compositions.
Alkoxvlated Polvcarboxvlates - Alkoxyiated polycarboxylates such as those prepared from polyacrylates are useful herein to provide additional grease removal performance. Such materials are described in WO 91/08281 and PCT 90/0l815 at p. 4 et seq., incorporated herein by reference. Chemically, these materials comprise polyacrylates having one ethoxy side-chain per every 7-8 acrylate units. The side-chains are of the formula -(CH2CH20)m(CH2)nCH3 wherein m is 2-3 and n is 6-12. The side-chains are ester-linked to the polyacrylate "backbone" to provide a "comb" polymer type structure. The molecular weight can vary, but is typically in the range of about 2000 to about 50,000. Such alkoxylated polycarboxylates can comprise from about 0.05% to about 10%, by weight, of the compositions herein.
SUBSTITUTE SHEET (RULE 26) - Fabric Softeners - Various through-the-wash fabric softeners. especially the impalpable smectite clays of U.S. Patent 4.062,647, Storm and Nirschl, issued December 13, 1977, as well as other softener clays Imown in the art, can optionally be used typically at levels of from about 0.5% to about 10% by weight in the present compositions to provide fabric softener benefits concurrently with fabric cleaning.
Clay softeners can be used in combination v~rith amine and cationic softeners as disclosed, for example, in U.S. Patent 4,375,E16, Crisp et al, March I, 1983 and U.S. Patent 4.291,07I, Harris et al, issued SeptE:mber 22, l981.
Perfumes - Perfumes and perfumery ingredients useful in the present compositions and processes comprise a wide variety of natural and synthetic chemical ingredients. including, but not limited to) aldehydes, ketones, esters, and the like. Also included are various natural extracts and essences which can comprise complex mixtures of ingredients, such as orange oil, lemon oil, rose extract) lavender, musk, patchouli, balsamic essence, sandalwood oil, pine oil. cedar, and the Like. Finished perfumes can comprise extremely complex mixtures of such ingredients. Finished perfumes typically comprise from about 0.01 % to about 2%, by weight, of the detergent compositions herein, and individual perfumery ingredients can comprise from about 0.0001% to about 90% of a finished perfume composition.
Several perfume formulations are set forth in Example XXI) hereinafter.
Non-limiting examples of perfume ingredients useful herein include: 7-acetyl-1.2,3,4,5,6,7,8-octahydro-1,l,6,7-tetramethyl naphthalene; ionone methyl;
ionone gamma methyl; methyl cedrylone; methyl dihydrojasmonate; methyl 1.6,10-trimethyl-2.5,9-cyclododecatrien-1-yl ketone~; 7-acetyl-1.1,3,4,4,6-hexamethyl tetralin; 4-acetyl-6-tent-butyl-1,1-dimethyl indane; para-hydroxy-phenyl-butanone;
benzophenone; methyl beta-naphthyl ketone; 6-acetyl-1,1,2,3,3a-hexamethyl indane; 5-acetyl-3-isopropyl-1,1,2,6-tetramethyl indane; I-dodecanal, 4-(4-hydroxy-4-methylpentyl)-3-cyclohexene-1-carboxaldehyde; 7-hydroxy-3,7-dimethyl ocatanal; 10-undecen-1-al; iso-hexenyl cyclohexyl carboxaldehyde; formyl trieyclodecane; condensation products of hydroxycitronellal and methyl anthranilate, condensation products of hydroxycitronellal and indol, condensation products of phenyl acetaldehyde and indol; 2-methyl-3-(para-tert-butylphenyl)-propionaIdehyde; ethyl vanillin; heliotropin; hexyl cinnamic aldehyde; amyl cinnamic aidehyde; 2-methyl-2-(para-iso-propylphenyl)-propionaldehyde;
coumarin; decalactone gamma; cyclopentadec~inolide; 16-hydroxy-9-hexadecenoic acid lactone; 1,3,4,6,7,8-hexahydro-4,6,6,7,f1,8-hexamethylcyclopenta-gamma-2-benzopyrane; beta-naphthoi methyl ether; ambroxane; dodecahydro-3a,6,6,9a-tetra-SUBSTITUTE SHEET (RULE 26) rxiethylnaphtho[2,1 b]furan; cedrol, ~-(?.2,3-trimethylcyclopent-3-enyl)-3-methyipentan-2-ol; 2-ethyl-4-(2,2,3-trimethyl-3-cyclopenten-1-yl)-?-buten-1-ol;
caryophyllene alcohol: tricyclodecenyl propionate: tricyclodecenyl acetate;
benzyl salicylate: cedryl acetate; and para-(tert-butyl) cyclohexyl acetate.
Particularly preferred perfume materials are those that provide the largest odor improvements in finished product compositions containing cellulases.
These perfumes include but are not limited to: hexyl cinnamic aldehyde; 2-methyl-3-(para-tert-butylphenyl)-propionaldehyde; 7-acetyl-1,2,3,4,5,6,7.8-octahydro-1,1,6,7-tetramethyl naphthalene; benzyl saiicylate; 7-acetyl-1.l,3,4,4,6-hexamethyl tetralin;
para-tert-butyl cyclohexvl acetate; methyl dihydro jasmonate; beta-napthol methyl ether; methyl beta-naphthyl ketone; 2-methyl-2-(para-iso-propylphenyl)-propionaidehyde; 1,3,4,6,7,8-hexahydro-4,6,6,7,8.8-hexamethyl-cyclopenta-gamma-2-benzopyrane; dodecahydro-3a,6,6,9a-tetramethylnaphtho[2,1b]furan;
anisaldehyde; coumarin: cedrol; vanillin; cyclopentadecanolide;
tricyclodecenyl acetate; and tricyclodecenv! propionate.
Other perfume materials include essential oils, resinoids, and resins from a variety of sources including, but not limited to: Peru balsam, Olibanum resinoid, styrax, labdanum resin, nutmeg, cassia oil, benzoin resin, coriander and lavandin.
Still other perfume chemicals include phenyl ethyl alcohol, terpineol, linalool, Iinalyl acetate, geraniol. nerol, 2-( I ,1-dimethylethyl)-cyclohexanol acetate, benzyl acetate, and eugenol. Garners such as diethylphthalate can be used in the finished perfume compositions.
Other Ingredients - A wide variety of other ingredients useful in detergent compositions can be included in the compositions herein. including other active ingredients, carriers, hydrotropes, processing aids, dyes or pigments, solvents for liquid formulations, solid fillers for bar compositions. etc. If high sudsing is desired, suds boosters such as the C 1 p-C 16 alkanolamides can be incorporated into the compositions, typically at 1 %-10% levels. The C I O-C 14 monoethanol and diethanol amides illustrate a typical class of such suds boosters. Use of such suds boosters with high sudsing adjunct surfactants such as the amine oxides, betaines and sultaines noted above is also advantageous. If desired, water-soluble magnesium and/or calcium salts such as MgCI~, MgS04, CaCl2, CaS04 and the like, can be added at levels of, typically, 0.1 %-2%, to provide additional suds and to enhance grease removal performance.
Various detersive ingredients employed in the present compositions optionally can be further stabilized by absorbing said ingredients onto a porous hydrophobic substrate, then coating said substrate with a hydrophobic coating.
SUBSTITUTE SHEET (RULE 26) WO 98/16604 PCTlUS97/18426 P-referably, the detersive ingredient is admired with a surfactant before being absorbed into the porous substrate. In use, the detersive ingredient is released from the substrate into the aqueous washing liquor. where it performs its intended detersive function.
To illustrate this technique in more detail, a porous hydrophobic silica (trademark SIPERNAT D 10, DeGussa) is admixed with a . proteolytic enzyme solution containing 3%-5% of C 13-1 S ethoxylated alcohol (EO 7) nonionic surfactant. Typically, the enzyme/surfactant solution is 2.5 X the weight of silica.
The resulting powder is dispersed with stirring in silicone oil (various silicone oil viscosities in the range of 500-l2,500 can be used). The resulting silicone oil dispersion is emulsified or otherwise added to the final detergent matrix. By this means, ingredients such as the aforementioned enzymes, bleaches, bleach activators, bleach catalysts, photoactivators. dyes, flzxorescers, fabric conditioners and hydrolyzable surfactants can be "protected" for use in detergents, including liquid laundry detergent compositions.
Liquid detergent compositions can curtain water and other solvents as carriers. Low molecular weight primary or secondary alcohols exemplified by methanol, ethanol, propanol) and isopropanoi tire suitable. Monohydric alcohois are preferred for solubilizing surfactant, but polyo:ls such as those containing from 2 to about 6 carbon atoms and from 2 to about 6 h;ydroxy groups (e.g., 1,3-propanediol, ethylene glycol, glycerine, and 1,2-propanediol) can also be used. The compositions may contain from ~% to 90%, typically 10% to ~0% of such carriers.
The detergent compositions herein will preferably be formulated such that, during use in aqueous cleaning operations, the wash water will have a pH of between about 6.~ and about 1 l, preferably between about 7.5 and 10.5. Liquid dishwashing product formulations preferably have a pH between about 6.8 and about 9Ø Laundry products are typically at pH 9- I 1. Techniques for controlling pH at recommended usage levels include the u.se of buffers, alkalis, acids, etc., and are well known to those skilled in the art.
Form of the compositions The compositions in accordance with the invention can take a variety of ghysical forms including granular, tablet, bar arid liquid forms. The compositions are particularly the so-called concentrated granular detergent compositions adapted to be added to a washing machine by means of a dispensing device placed in the machine drum with the soiled fabric load.
The mean particle size of the components of granular compositions in accordance with the invention should preferably be such that no more that 5%
of SUBSTITUTE SHEET (RULE 26) particles are greater than 1.7mm in diameter and not more than ~% of particles are less than 0.1 ~mm in diameter.
The term mean particle size as defined herein is calculated by sieving a sample of the composition into a number of fractions (typically ~ fractions) on a series of Tyler sieves. The weight fractions thereby obtained are plotted against the aperture size of the sieves. The mean particle size is taken to be the aperture size through which 50% by weight of the sample would pass.
The bulk density of granular detergent compositions in accordance with the present invention typically have a bulk density of at least 600 g/litre, more preferably from 650 g/litre to 1200 g/litre.Bulk density is measured by means of a simple funnel and cup device consisting of a conical funnel moulded rigidly on a base and provided with a flap valve at its lower extremity to allow the contents of the funnel to be emptied into an axiallv aligned cylindrical cup disposed below the funnel. The funnel is 130 mm high and has internal diameters of 130 mm and 40 mm at its respective upper and lower extremities. It is mounted so that the lower extremity is 140 mm above the upper surface of the base. The cup has an overall height of 90 mm, an internal height of 87 mm and an internal diameter of 84 mm.
Its'nominal volume is Q00 ml.
To carry out a measurement, the funnel is filled with powder by hand pouring, the flap valve is opened and powder allowed to overf 11 the cup. The filled cup is removed from the frame and excess powder removed from the cup by passing a straight edged implement eg; a knife, across its upper edge. The filled cup is then weighed and the value obtained for the weight of powder doubled to provide a bulk density in g/litre. Replicate measurements are made as required.
A~~lomerate particles The cleaning systems herein are preferably present in granular compositions in the form of agglomerate particles) which may take the form of flakes, prills, marumes, noodles, ribbons, but preferably take the form of granules. The most preferred way to process the particles is by agglomerating powders (e.g.
altuninosilicate, carbonate) with high level of surfactant pastes and to control the particle size of the resultant agglomerates within specified limits. Such a process involves mixing an effective amount of powder with a high surfactant active paste in one or more agglomerators such as a pan agglomerator, a Z-blade mixer or more preferably an in-line mixer such as those manufactured by Schugi (Holland) BV, Chroomstraat 8211 AS, Lelystad, Netherlands, and Gebruder Lodige Maschinenbau GmbH, D-4790 Paderborn 1, Elsenerstrasse 7-9, Postfach 2050, Germany. Most preferably a high shear mixer is used. such as a Lodige CB (Trade Name).
SUBSTITUTE SHEET (RULE 26) _ A high surfactant active paste comprising from ~0% by weight to 95% by weight, preferably 70% by weight to 85% by weight of surfactant is typically used.
The paste may be pumped into the agglomerator at a temperature high enough to maintain a pumpable viscosity, but low enough to avoid degradation of the surfactants used. An operating temperature of the paste of 50~C to 80~C is typical.
SUBSTITUTE SHElET (RULE 2fi) L~undrv washing method Machine laundry methods herein typically comprise treating soiled laundry with an aqueous wash solution in a washing machine having dissolved or dispensed therein an effective amount of a machine laundry detergent composition in accord with the invention. By an effective amount of the detergent composition it is meant from 40g to 300g of product dissolved or dispersed in a wash solution of volume from ~ to 65 litres, as are typical product dosages and wash solution volumes commonly employed in conventional machine laundry methods.
As noted, the isopeptidase enzyme is used herein in cleaning compositions, preferably in combination with detersive surfactants. at levels which are effective for achieving at least a directional improvement in cleaning performance. In the context of a fabric laundry composition, such "usage levels" can vary depending not only on the type and severity of the soils and stains, but also on the wash water temperature.
the volume of wash water and the type of washing machine.
For example, in a top-loading, vertical axis U.S.-type automatic washing machine using about 45 to 83 liters of water in the wash bath, a wash cycle of about to about 14 minutes and a wash water temperature of about 10~C to about 50~C, it is preferred to include from about 2 ppm to about 625 ppm, preferably from about 2 ppm to about 550 ppm, more preferably from about 10 ppm to about 235 ppm, of surfactant in the wash liquor. On the basis of usage rates of from about 50 ml to about 150 ml per wash load, this translates into an in-product concentration (wt.) of the surfactant of from about 0.1 % to about 40%) preferably about 0.1 % to about 35%, more preferably from about 0.5% to about 15%, for a heavy-duty liquid laundry detergent. On the basis of usage rates of from about 30g to about 950g per wash load, for dense ("compact") granular laundry detergents (density above about 650 g11) this translates into an in-product concentration (wt.) of the surfactant of from about 0.1 % to about 50%) preferably from about 0.1 % to about 3 5%, and more preferably from about 0.5% to about 15%. On the basis of usage rates of from about 80 g to about l00 g per load for spray-dried granules (i.e., "fluffy"; density below about 650 g/1), this translates into an in-product concentration (wt.) of the surfactant of from about 0.07% to about 35%, preferably from about 0.07 to about 25%, and more preferably from about 0.35% to about 11%.
For example, in a front-loading, horizontal-axis European-type automatic washing machine using about 8 to 15 liters of water in the wash bath, a wash cycle of about 10 to about 60 minutes and a wash water temperature of about 30~C to about 95~C, it is preferred to include from about 3 ppm to about 14,000 ppm, preferably from about 3 ppm to about 10.000 ppm, more preferably from about 15 SUBSTITUTE SHEET (RULE 26) WO 98l16604 PCTIUS97/18426 ppm to about 4200 ppm, of surfactant in the wash liquor. On the basis of usage rates of from about 45 ml to about 270 ml per wash load. this translates into an in-product concentration (wt.) of surfactant of from about 0.1 % to about 50%, preferably about 0.1 % to about 35%, more preferably from about 0.5% to about 15%, for a heavy-duty liquid laundry detergent. On the basis of usage rates of from about 40 g to about 2I0 g per wash load) for dense ("connpact") granular laundry detergents (density above about 650 g/1) this translates into an in-product concentration (wt.) of surfactant of from about 0.12% to about 53%, preferably from about 0.l2% to about 46%, and more preferably from about 0.6% to~ about 20%. On the basis of usage rates of from about 140 g to about 400 g per load for spray-dried granules (i.e., "fluffy"; density below about 650 gll), this translates into an in-product concentration (wt.} of surfactant of from about 0.03% to about 34%, preferably from about 0.03% to about 24%, and more preferably from about 0.15% to about 10%.
For example, in a top-loading, vertical-axis Japanese-type automatic washing machine using about 26 to 52 liters of water in the wash bath, a wash cycle of about 8 to about 15 minutes and a wash water temperature of about 5~C to about 25~C, it is preferred to include from about 0.67 ppm to about 270 ppm, preferably from about 0.67 ppm to about 236 ppm, more preferably from about 3.4 ppm to about ppm, of surfactant in the wash liquor. On the basis of usage rates of from about 20 mi to about 30 ml per wash load, this transl;3tes into an in-product concentration (wt.) of surfactant of from about 0.1% to about 40%, preferably about 0.1% to about 35%, more preferably from about 0.5% to about 15%. for a heavy-duty liquid laundry detergent. On the basis of usage rates of from about 18 g to about 35 g per wash load, for dense ("compact") granular laundry detergents (density above about 650 g/1) this translates into an in-product concentration (wt.) of surfactant of from about 0.1 % to about 50%, preferably from about 0.1 % to about 35%, and more preferably from about 0.5% to about 15%. On the basis of usage rates of from about 30 g to about 40 g per load for spray-dried granules (i.e., "fluffy"; density below about 650 g/I), this translates into an in-product: concentration (wt.) of surfactant of from about 0.06% to about 44%, preferably from about 0.06% to about 30%, and more preferably from about 0.3% to about 13%.
As can be seen from the foregoing, the ~unount of isopeptidase enzyme used in a machine-wash laundering context can vary, depending on the habits and practices of the user, the type of washing machine, and the Like. In this context, however, one heretofore unappreciated advantage of the isopeptidase enzymes is their ability to provide at least directional improvements in performance over a SU6ST1TUTE SHEET (RULE 26) spectrum of soils and stains even when used at relatively low levels in the finished compositions.
In a preferred use aspect a dispensing device is employed in the washing method. The dispensing device is charged with the detergent product, and is used to introduce the product directly into the drum of the washing machine before the commencement of the wash cycle. Its volume capacity should be such as to be able to contain sufficient detergent product as would normally be used in the washing method.
Once the washing machine has been loaded with laundry the dispensing device containing the detergent product is placed inside the drum. At the commencement of the wash cycle of the washing machine water is introduced into the drum and the drum periodically rotates. The design of the dispensing device should be such that it permits containment of the dry detergent product but then allows release of this product during the wash cycle in response to its agitation as the drum rotates and also as a result of its contact with the wash water.
To allow for release of the detergent product during the wash the device may possess a number of openings through which the product may pass.
Alternatively, the device may be made of a material which is permeable to liquid but impermeable to the solid product, which will allow release of dissolved product.
Preferably, the detergent product will be rapidly released at the start of the wash cycle thereby providing transient localised high concentrations of product in the drum of the washing machine at this stage of the wash cycle.
Preferred dispensing devices are reusable and are designed in such a way that container integrity is maintained in both the dry state and during the wash cycle.
Especially preferred dispensing devices for use with the composition of the invention have been described in the following patents; GB-B-2, 157, 7l7) GB-B-2, l57, 718, EP-A-0201376, EP-A-0288345 and EP-A-0288346. An article by J.Bland published in Manufacturing Chemist, November 1989, pages 41-46 also describes especially preferred dispensing devices for use with granular laundry products which are of a type commonly know as the "granulette". Another preferred dispensing device for use with the compositions of this invention is disclosed in PCT
Patent Application No. W094/11562.
Especially preferred dispensing devices are disclosed in European Patent Application Publication Nos. 0343069 & 0343070. The latter Application discloses a device comprising a flexible sheath in the form of a bag extending from a support ring defining an orifice, the orifice being adapted to admit to the bag sufficient product for one washing cycle in a washing process. A portion of the washing SUBSTITUTE SHEET (RULE 26) medium flows through the orifice into the bag, dissolves the product, and the solution then gasses outwardly through the orifice into the washing medium.
The support ring is provided with a masking arrans,;emnt to prevent egress of wetted, undissolved, product. this arrangement typically comprising radially extending walls extending from a central boss in a spoked wheel configuration. or a similar structure in which the walls have a helical form.
Alternatively, the dispensing device m;ay be a flexible container, such as a bag or pouch. The bag may be of fibrous construction coated with a water impermeable protective material so as to retain the contents, such as is disclosed in European published Patent Application No. 00A 8678. Alternatively it may be formed of a water-insoluble synthetic polymeric material provided with an edge seal or closure designed to rupture in aqueous medi~;a as disclosed in European published Patent Application Nos. 0011500, 001150l , 0t111502, and 0011968. A convenient form of water frangible closure comprises a w<~ter soluble adhesive disposed along and sealing one edge of a pouch formed of a water impermeable polymeric film such as polyethylene or polypropylene.
Preferably, the liquid compositions according to the present invention are in "concentrated form"; in such case, the liquid detergent compositions according to the present invention will contain a lower amour,,t of water, compared to conventional liquid detergents. The level of water is less than 50%, preferably less than 30% by weight of the detergent compositons.
Said concentrated products provide advantages to the consumer. who has a product which can be used in lower amounts and to the producer) who has lower shipping costs.
The liquid compositions are especially effective when applied directly to soils and stains in a pretreatment step before washing the fabrics.
The detergent compositions of the present invention can also be used as detergent additive products. Such additive products are intended to supplement or boast the performance of conventional detergent compositions.
The detergent compositions according to the present invention include compositions which are to be used for cleaning; of substrates, such as fabrics, fibers, hard surfaces, ete., for example hard surface cleaning compositions (with or without abrasives), laundry detergent compositions, automatic and non-automatic dishwashing compositions.
Packa~ing_for the compositions Commercially marketed executions of t:he bleaching compositions can be packaged in any suitable container including those constructed from paper, SUBSTITUTE SHEIET (RULE 26) WO 98I16604 PCTlUS97/18426 cardboard, plastic materials and any suitable laminates. A preferred packaging execution is described in European Application No. 9492I~0~.7.
In the following Examples, the abbreviations for the various ingredients used for the compositions have the following meanings.
LAS : Sodium linear C 12 alkyl benzene sulfonate Isopeptidase : Isopeptidase enzyme known as "destabilase" (SEQ ID
No. 7) C45AS : Sodium C 14-C 15 linear alkyl sulfate CxyEzS : Sodium C 1 x-C 1 y branched alkyl sulfate condensed with z moles of ethylene oxide CxyEz : A C 1 x-1 y branched primary alcohol condensed with an average of z moles of ethylene oxide QAS : R~.N+(CH3)2(C~H40H) with R~ = C12 TFAA : C 16-C 1 g alkyl N-methyl glucamide STPP : Anhydrous sodium tripolyphosphate Zeolite A : Hydrated Sodium Aluminosilicate of formula Nal2(A102Si02)12. 27H20 having a primary particle size in the range from 0.1 to 10 micrometers NaSKS-6 : Crystalline layered silicate of formula 8 -Na2Si205 Carbonate : Anhydrous sodium carbonate with a particle size between 200m and 900m Bicarbonate : Anhydrous sodium bicarbonate with a particle size distribution between 400m and 1200m Silicate : Amorphous Sodium Silicate (SiO~:Na~O: 2.0 ratl0) Sodium sulfate : Anhydrous sodium sulfate MA/AA : Copolymer of 1:4 maleic/acrylic acid, average molecular weight about 70,000.
CMC : Sodium carboxymethyl cellulose Protease : Proteolytic enzyme of activity 4KNPU/g sold by NOVO Industries A/S under the tradename Savinase SUBSTITUTE SHEET (RULE 26) - Cellulase : Cellulytic enzym~: of activity l000 CEVU/g sold by NOVO Industries A/S under the tradename Carezyme Amylase : Amylolvtic enzyrne of activity 60KNU/g sold by NOVO Industries A/S under the tradename Termamvl 60T
Lipase : Lipolvtic enzyme of activity 100kLU/g sold by NOVO Industries A/S under the tradename Lipoiase PB4 : Sodium perborate tetrahydrate of nominal formula NaB0~.3H~O.H~O~
PB 1 : ,Anhydrous sodium perborate bleach of nominal formula NaBO~.H~O?
Percarbonate : Sodium Percarbonate of nominal formula ?Na~C03.3H~0~
NaDCC : Sodium dichloroi:>ocvanurate NOBS : Nonanoyloxyben~:ene sulfonate in the form of the sodium salt.
TAED : Tetraacetviethvlenediamine DTPMP : Diethyiene triamine penta (methylene phosphonate), marketed by Monsanto under the Trade name bequest Photoactivated Sulfonated Zinc Phthlocyanine encapsulated : in bleach dextrin soluble poiymer Br~ightener Disodium 4,4'-bis(2-sulphostyryl)biphenyl 1 :

Brightener 2 Disodium 4,4'-bis~;4-anilino-6-morpholino-1.3.5-:

triazin-2-yl)amino) stilbene-2:2'-disulfonate.

HEDP : 1,1-hydroxyethane: diphosphonic acid SRP 1 : Sulfobenzoyl end capped esters with oxyethylene oxy and terephtale~yl backbone Silicone antifoamPolydimethylsiloxane foam controller : with siloxane-oxyalkylene copolymer as dispersing agent with a ratio of said foam controller to said dispersing agent of 10:1 to 100:l.
DTPA : Diethylene triamir~e pentaacetic acid SUBSTITUTE SHEI=T (RULE 26) WO 98/16604 PCT/US97l18426 In the following Examples all levels are quoted as % by weight of the composition.
The following examples are illustrative of the present invention, but are not meant to limit or otherwise define its scope. All parts, percentages and ratios used herein are expressed as percent weight unless otherwise specified.
Example 1 The following laundry detergent compositions A to F are prepared in accord with the invention. These compositions may be used in a machine or hand laundering process, including use as a pre-soak prior to a machine laundering process.
A B C D E F

Isopeptidase 0.26 0.26 0.26 0.26 0.26 0.26 ~

C25E3 3.4 3.4 3.4 3.4 3.4 3.4 QAS - - 0.8 - - 0.8 Zeolite A 18.1 18.1 18.1 18.1 18.1 18.1 Carbonate 13.0 13.0 i 3.0 27.0 27.0 27.0 Silicate 1.4 1.4 1.4 3.0 3.0 3.0 Sodium sulfate 26.1 26.I 26.1 26.1 26.1 26.l PB4 --- --- --- 9.0 9.0 9.0 TAED --- -- . --- I.5 1.5 I.5 DETPMP 0.2S 0.25 0.25 0.25 0.25 0.2S

HEDP 0.3 0.3 0.3 0.3 0.3 0.3 SUBSTITUTE SHEET (RULE 26) Protease 0.26 0.26 0.26 0.26 0.26 0.26 Amylase 0.1 O.l 0.1 0.1 0.1 0.1 MA/AA 0.3 0.3 0.3 0.3 0.3 0.3 CMC 0.2 0.2 0.2 0.2 0.2 0.2 Photoactivated 15 ppm 1 ~ 15 ppm I 5 15 ppm 1 ~
bleach ppm ppm ppm ~PPm) Briehtener I 0.09 0.09 0.09 0.09 0.09 0.09 ~

Perfume 0.3 0.3 0.3 0.3 0.3 0.3 Silicone antifoam0.5 0.5 0.5 0.5 0.5 0.5 Misciminors to 100%

Density in tJlitre850 850 850 850 8S0 850 SUBSTITUTE SHE!=T (RULE 26) ~xamnle 2 The following granular laundry detergent compositions G to I of bulk density g/litre are prepared in accord with the invention:
G H I

Isopeptidase 0.26 0.85 0.85 C45AS - 2.24 3.89 C25AE3 S - 0.76 1.18 C45E7 3.25 - 5.0 C25E3 - 5.5 -QAS 0.8 2.0 2.0 STPP 10.7 - -Zeolite A 10.7 19.5 19.S

SKS-6 - l0.6 ~ 10.6 Carbonate 6.1 2 I .4 2 I .4 Bicarbonate - 2.0 2.0 Silicate 6.8 -Sodium sulfate 39.8 - 14.3 PB4 5.0 12.7 8.0 TAED 0.5 3.1 -SUBSTITUTE SHEET (RULE 26) WO 98/16604 PCT/fJS97/18426 DETPMP 0.25 0.2 0.2 HEDP - 0.3 0.3 Protease 0.2 6 0.85 0.85 Lipase 0.15 0.15 0.15 Cellulase 0.28 0.28 0.28 Amylase 0.1 0.1 0.1 MA/AA 0.8 ~ 1.6 1.6 C MC 0.2 0.4 0.4 Photoactivated bleach l5 ppm 27 ppm 27 ppm (ppm) Brightener 1 0.08 0.19 0.19 Brightener 2 - 0.04 0.04 Perfume 0.3 0.3 0.3 Silicone antifoam 0.5 2.4 2.4 Minors/misc to 100%

SUBSTITUTE SHEI_T (RULE 26) example 3 The following detergent formulations, according to the present invention are prepared:
J K L M

LAS 15.0 14.0 14.0 18.0 Isopeptidase 0.8 1.0 0.5 0.5 TFAA - 1.0 - -C25E5/C45E7 - 2.0 - 0.5 C45E3S - 2.5 - -Zeolite A 30.0 18.0 30.0 22.0 Silicate 9.0 5.0 l0.0 8.0 Carbonate 13.0 7.5 - 5.0 Bicarbonate - 7.5 - -DTPMP 0.7 1.0 - -SRP I 0.3 0.2 - 0.1 MA/AA 2.0 1.5 2.0 I .0 CMC 0.8 0.4 0.4 0.2 Protease 0.8 I.0 0.5 0.5 Amylase 0.8 0.4 - 0.25 Lipase 0.2 0.1 0.2 0.1 Cellulase 0.15 0.05 - -Photoactivated70ppm 45ppm - lOppm bleach (ppm) Brishtener 0.2 0.2 0.08 0.2 PB 1 6.0 2.0 5.0 3.0 NOBS 2.0 1.0 - -Polyethylene - 0.2 - 0.2 oxide of MW 5,000,000 Bentonite clay- - - 10.0 Balance (MoistureI00 I00 100 I00 and Miscellaneous) SUBSTITUTE SHEET (RULE 26) Example 4 The following high density detergent formulations. according to the present invention are prepared:
N O

Agglomerate C45AS I 1.0 l4.0 isopeptidase l.4 1.4 Zeolite A 15.0 10.0 Carbonate 4.0 8.0 MA/AA 4.0 2.0 CMC 0.5 0.5 DTPMP 0.4 0.4 Sprav On C25E5 5.0 5.0 Perfume 0.5 0.5 Drv Adds C~0 SADS 6.0 3.0 HEDP 0.5 0.3 SKS-6 l3.0 6.0 Citrate 3.0 1.0 TAED 5.0 7.0 Percarbonate 20.0 20.0 SRP 1 0.3 0.3 Protease 1.4 1.4 Lipase 0.4 0.4 Cellulase 0.6 0.6 Amylase ~ 0.6 0.6 Silicone antifoam 5.0 5.0 Brightener 1 0.2 0.2 Brightener 2 0.2 -Balance (Moisture and l00 100 Miscellaneous) Density (g/litre) 850 850 Liquid detergent compositions are made according to the following.
by weight of the detergent compositions A B C D

C~S~AE3S 2 8 7 5 Isopeptidase 0.5 0.5 0.5 0.5 SUBSTITUTE SHEIE:T (RULE 26) i C 1 ~-C 14 alkyldimethyl amine - - - 2 oxide C24 N-methyl glucamide 5 4 3 3 C 1 ~-C 1 g fatty acid 11 4 4 3 Citric acid 1 3 3 2 DTPMP 1 1 l 0.5 NaOH 1 2.5 1 1.5 PG l4.5 13.l 10.0 8 EtOH 1.8 4.7 5.4 1 Amylase (300KNU/g) 0.1 0.1 0.1 0.1 Lipase D96/L ( 1 OOKNU/g) 0.1 0.1 0.1 0.15 S S ~
~

Protease (35g/1) 0.5 0.5 0.5 0.5) Endolase 0.05 0.05 0.05 0.5 Cellulase 0.09 0.09 0.09 0.9 Terephthalate-based polymer 0.5 - 0.3 0.3 Boric acid 2.4 2.8 2.8 2.4 Sodium xylene sulfonate - 3 - -2-butyl-octanol 1 1 1 1 Branched silicone 0.3 0.3 0.3 0.3 Water & minors Up to 100%

* SEASA is the isethionate ethoxylated ester of alpha-sulfonated C 16/C 1 g fatty acid.
The above liquid detergent compositions (A-D) are found to be very efficient in the removal of a wide range of stains and soils from fabrics under various usage conditions.

The following are heavy duty liquid laundry detergent compositions according to the present invention.

Example #: 6 7 8 9 10 1 I

Isopeptidase 0.6 0.6 0.9 0.9 1.2 1.2 C25 AS . 10 8.0 - - 5.0 5.0 C35AE3S/C25AE3S 2.0 9.0 - - 7.0 7.0 C24 N-Me Glucamide 6.0 5.0 4.5 3.7 4.0 4.0 C35 E7 6.0 1.0 - - - -SUBSTITUTE SHEET (RULE 26) C25 AE2.5S - - 12.0 l2.0 - -C23 E9 - - 2.0 1.0 5.0 5.0 C 10 APA - 1.5 - 2.0 - 2.5 C24 Fatty Acid 7.5 1.1 2.0 4.0 5.0 5.0 C48 Fatty Acid 3.0 3.5 - - -Citric Acid 1.0 3.5 3.0 3.0 3.0 3.0 Protease (34 g/#) 0.6 0.6 0.9 0.9 1.2 1.2 Lipase 0.1 0.1 0.1 0.1 0.2 0.2 Amylase (300KMU/g) 0.1 0.1 0.1 0.1 - 0.1 Cellulase 0.03 0.03 0.0S 0.05 0.2 0.2 Endolase 0.1 0.1 - - - -Brightener 2 0.1 0.1 -Boric Acid 3.0 3.0 3.5 3.5 4.0 4.0 MEA 8.0 4.0 1.0 1.5 7.0 7.0 NaOH 1.0 4.0 3.0 2.5 1.0 1.0 PG 12.0 12.0 7.5 7.5 7.0 - 7.0 EtOH 1.0 1.0 3.5 3.5 6.0 6.0 Na TS - - 2.5 2.5 - -Minors ___________________..___galance-______________________ The manufacture of heavy duty liquid detergent compositions, especially those designed for fabric laundering, which comprise a non-aqueous carrier medium can be conducted in the manner disclosed in more detail hereinafter. In an alternate mode, such non-aqueous compositions can be prepared according to the disclosures of U.S. Patents 4.753,570; 4,767,558; 4,772,413; 4,889,652;
4,892,673; GB-A-2,158,838; GB-A-2,195,125; GB-A-2,195,649; U.S. 4,988,462;
U.S. 5,266,233; EP-A-225,654 (6/16I87); EP-A-510,7G2 ( 10/28/92); E;P-A-540,089 (5I5/93); EP-A-540,090 (5/5I93); U.S. 4,615,820; EP-A-565,017 (10/13/93);
EP-A-030,096 (6/10/8l ), incorporated herein by reference. Such compositions can contain various particulate detersive ingredients (including the b:feaching agents, as disclosed hereinabove) stably suspended therein. Such non-aqueous compositions thus comprise a LIQUID PHASE and, optionally but prefE:rably, a SOLID PHASE, all as described in more detail hereinafter and in the cited references.
The isopeptidase enzyme is incorporated in the compositions at the levels and in the manner described hereinabove for the manufacture of other laundry detergent compositions.

LIOUID PHASE

The liquid phase will generally comprise fronn about 35%
to 99% by weight of the detergent compositions herein. More pre;Ferably, the liquid phase will SUBSTITUTE SHEET (RULE 26) WO 98l16604 PCT/US97/18426 7?
comprise from about ~0% to 9~% by weight of the compositions. Most preferably, the liquid phase will comprise from about 4~% to 75% by weight of the compositions herein. The liquid phase of the detergent compositions herein essentially contains relatively high concentrations of a certain type anionic surfactant combined with a certain type of nonaqueous, liquid diluent.
(A) Essential Anionic Surfactant The anionic surfactant essentially utilized as an essential component of the nonaqueous liquid phase is one selected from the alkali metal salts of alkylbenzene sulfonic acids in which the alkyl group contains from about 10 to 16 carbon atoms, in straight chain or branched chain configuration. (See U.S. Patents 2.220.099 and 2,477,383, incorporated herein by reference.) Especially preferred are the sodium and potassium linear straight chain alkylbenzene sulfonates (LAS) in which the average number of carbon atoms in the alkyl group is from about 11 to 14.
Sodum C 11-C 14 LAS is especially preferred.
The alkylbenzene sulfonate anionic surfactant will be dissolved in the nonaqueous liquid diluent which makes up the second essential component of the nonaqueous phase. To form the structured liquid phase required for suitable phase stability and acceptable rheology, the alkylbenzene sulfonate anionic surfactant is generally present to the extent of from about 30% to 65% by weight of the liquid phase. More preferably, the alkylbenzene sulfonate anionic surfactant will comprise from about 35% to 50% by weight of the nonaqueous liquid phase of the compositions herein. Utilization of this anionic surfactant in these concentrations corresponds to an anionic surfactant concentration in the total composition of from about 15% to 60% by weight, more preferably from about 20% to 40% by weight.
of the composition.
(B) Nonaqueous Liquid Diluent To form the liquid phase of the detergent compositions, the hereinbefore described alkylbenzene sulfonate anionic surfactant is combined with a nonaqueous liquid diluent which contains two essential components. These two components are a liquid alcohol alkoxylate material and a nonaqueous, low-polarity organic solvent.
i) Alcohol Alkoxylates One essential component of the liquid diluent used to forth the compositions herein comprises an alkoxylated fatty alcohol material. Such materials are themselves also nonionic surfactants. Such materials correspond to the general formula:
R ! ~CmH2m0)nOH
SUBSTITUTE SHEET (RULE 26) wherein R1 is a Cg - C16 alkyl group. m is from 2 to 4. and n ranges from about 2 to 12. Preferably R1 is an alkyl group, which may be primary or secondary, that contains from about 9 to 1 ~ carbon atoms, more preferably from about 10 to 14 carbon atoms. Preferably also the alkoxylated fatty alcohols will be ethoxylated materials that contain from about 2 to 12 ethylene oxide moieties per molecule, more preferably from about 3 to 10 ethylene oxide moieties per molecule.
The alkoxylated fatty alcohol component of the liquid diluent will frequently have a hydrophilic-lipophilic balance (HLB) which ranges from about 3 to 17.
More preferably, the HLB of this material will range from about 6 to 15, most preferably from about 8 to 15.
Examples of fatty alcohol alkoxylates useful as one of the essential components of the nonaqueous liquid diluent in the compositions herein will include those which are made from alcohols of 12 to 15 carbon atoms and which contain about 7 moles of ethylene oxide. Such materials have been commercially marketed under the trade names Neodol 25-7 and Neodol 23-6.5 by Shell Chemical Company.
Other useful Neodols include Neodol 1-5, an ethoxylated fatty alcohol averaging 1 I
carbon atoms in its alkyl chain with about 5 moles of ethylene oxide; Neodol 23-9.
an ethoxylated primary C 12 - C 13 alcohol having about 9 moles of ethylene oxide and Neodol 91-I0, an ethoxylated Cg - C11 primary alcohol having about 10 moles of ethylene oxide. Alcohol ethoxylates of this type have also been marketed by Shell Chemical Company under the Dobmoi tradename. Dobanol 91-5 is an ethoxylated Cg-C 11 fatty alcohol with an a~rerage of 5 moles ethylene oxide and Dobanol 25-7 is an ethoxylated C 1 ~-C 15 fatty alcohol with an average of 7 moles of ethylene oxide per mole of fatty alcohol.
Other examples of suitable ethoxylated alcohois include Tergitol 15-S-7 and Tergitol 15-S-9 both of which are linear secondary alcohol ethoxylates that have been commercially marketed by Union Carbide Corporation. The former is a mixed ethoxylation product of C 11 to C 15 linear secondary alkanol with 7 moles of ethylene oxide and the latter is a similar product but with 9 moles of ethylene oxide being reacted.
Other types of alcohol ethoxylates useful in the present compositions are higher molecular weight nonionics, such ~~s Neodol 45-11, which are similar ethylene oxide condensation products of higher fatty alcohols, with the higher fatty alcohol being of 14-15 carbon atoms and the number of ethylene oxide groups per mole being about 11. Such products have also been commercially marketed by Shell Chemical Company.
SUBSTITUTE SHEI=T (RULE 26) The alcohol alkoxylate component which is essentially utilized as part of the liquid diluent in the nonaqueous compositions herein will generally be present to the extent of from about 1 % to 60% of the liquid phase composition. More preferably, the alcohol alkoxylate component will comprise about 5% to 40% of the liquid phase. Most preferably, the essentially utilized alcohol alkoxylate component will comprise from about 5% to 30% of the detergent composition liquid phase.
Utilization of alcohol alkoxylate in these concentrations in the liquid phase corresponds to an alcohol alkoxylate concentration in the total composition of from about 1 % to 60% by weight, more preferably from about 2% to 40% by weight, and most preferably from about 5% to 25% by weight, of the composition.
ii) Nonaqueous Low-Polarity Organic Solvent A second essential component of the liquid diluent which forms part of the liquid phase of the detergent compositions herein comprises nonaqueous, low-polarity organic solvent(s). The term "solvent" is used herein to connote the non-surface active carrier or diluent portion of the liquid phase of the composition.
While some of the essential and/or optional components of the compositions herein may actually dissolve in the "solvent"-containing liquid phase, other components will be present as particulate material dispersed within the "solvent"-containing liquid phase. Thus the term "solvent" is not meant to require that the solvent material be capable of actually dissolving all of the detergent composition components added thereto.
The nonaqueous organic materials which are employed as solvents herein are those which are liquids of low polarity. For purposes of this invention, "low-polarity" liquids are those which have little, if any, tendency to dissolve one of the preferred types of particulate material used in the compositions herein. i.e., the peroxygen bleaching agents, sodium perborate or sodium percarbonate. Thus relatively polar solvents such as ethanol should not be utilized. Suitable types of low-polarity solvents useful in the nonaqueous liquid detergent compositions herein do include non-vicinal C4-Cg alkylene glycols, alkylene glycol mono lower alkyl ethers, lower molecular weight polyethylene glycols, lower molecular weight methyl esters and amides, and the like.
A preferred type of nonaqueous, low-polarity solvent for use in the compositions herein comprises the non-vicinal C4-Cg branched or straight chain alkylene glycols. Materials of this type include hexylene glycol (4-methyl-2,4-pentanediol), 1,6-hexanediol, 1,3-butylene glycol and 1,4-butylene glycol.
Hexylene glycol is the most preferred.
SUBSTITUTE SHEET (RULE 26) Another preferred type of nonaqueous, low-polarity solvent for use herein comprises the mono-, di-, tri-, or tetra- C?-C ~ alkylene glycol mono C2-C6 alkyl ethers. The specific examples of such compounds include diethyIene glycol monobutyl ether, tetraethylene glycol monobutyl ether, dipropylene glycol monoethyl ether, and dipropylene glycol rr.~onobutyl ether. Diethylene glycol monobutyl ether and dipropylene glycol mon~butyl ether are especially preferred.
Compounds of the type have been commercially marketed under the tradenames Dowanol, Carbitoi, and Celiosolve.
Another preferred type of nonaqueous, low-polarity organic solvent useful herein comprises the lower molecular weight polyethylene glycols (PEGs). Such materials are those having molecular weigh~a of at least about l50. PEGS of molecular weight ranging from about 200 to 600 are most preferred.
Yet another preferred type of non-polar., nonaqueous solvent comprises lower molecular weight methyl esters. Such materials are those of the general formula:
R I -C(O)-OCH3 wherein R 1 ranges from 1 to about 18. Examples of suitable lower molecular weight methyl esters include methyl acetate) methyl propionate, methyl octanoate, and methyl dodecanoate.
The nonaqueous, low-polarity organic solvents) employed should, of course, be compatible and non-reactive with other composition components, e.g., bleach and/or activators, used in the liquid detergent compositions herein. Such a solvent component will generally be utilized in an amount of from about 1 % to 70% by weight of the liquid phase. More preferably, vUhe nonaqueous, low-polarity organic solvent will comprise from about 10% to 60~/. by weight of the liquid phase, most preferably from about 20% to 50% by weight, of the liquid phase of the composition. Utilization of this organic solvent in these concentrations in the liquid phase corresponds to a solvent concentration in the total composition of from about 1% to 50% by weight, more preferably from ahout ~% to 40% by weight, and most preferably from about 10% to 30% by weight, of the composition.
iii) Alcohol Alkoxvlate To Solvent :EZatio The ratio of alcohol alkoxylate to organic solvent within the liquid diluent can be used to vary the theological properties of the detergent compositions eventually formed. Generally, the weight ratio of alcohol alkoxylate to organic solvent will range from about 50:1 to 1:50. ~~Iore preferably, this ratio will range from about 3:1 to 1:3.
iv) Liquid Diluent Concentration As with the concentration of the alkvlbenzene sulfonate anionic surfactant mixture, the amount of total liquid diluent in the nonaqueous liquid phase herein will SUBSTITUTE SHEI_T (RU4E 26) be determined by the type and amounts of other composition components and by the desired composition properties. Generally, the liquid diluent will comprise from about 35% to 70% of the nonaqueous liquid phase of the compositions herein.
More preferably, the liquid diluent will comprise from about ~0% to 6~% of the nonaqueous liquid phase. This corresponds to a nonaqueous liquid diluent concentration in the total composition of from about I S% to 70% by weight, more preferably from about 20% to ~0% by weight, of the composition.
SOLID PHASE
The nonaqueous detergent compositions herein also essentially comprise from about I% to 65% by weight, more preferably from about 5% to ~0% by weight, of a solid phase of particulate material which is dispersed and suspended within the liquid phase. Generally such particulate material will range in size from about O.I to 1500 microns. More preferably such material will range in size from about 5 to 200 microns.
The particulate material utilized herein can comprise one or more types of detergent composition components which in particulate form are substantially insoluble in the nonaqueous liquid phase of the composition. The types of particulate materials which can be utilized are described in detail as follows:
COMPOSITION PREPARATION AND USE
The nonaqueous liquid detergent compositions herein can be prepared by combining the essential and optional components thereof in any convenient order and by mixing, e.g., agitating, the resulting component combination to form the phase stable compositions herein. In a typical process for preparing such compositions, essential and certain preferred optional components will be combined in a particular order and under certain conditions.
In the first step of such a typical preparation process. an admixture of the alkylbenzene sulfonate anionic surfactant and the two essential components of the nonaqueous diluent is formed by heating a combination of these materials to a temperature from about 30~C to 100~C.
In a second process step, the heated admixture formed as hereinbefore described is maintained under shear agitation at a temperature from about 40~C
to 100~C for a period of from about 2 minutes to 20 hours. Optionally, a vacuum can be applied to the admixture at this point. This second process step serves to completely dissolve the anionic surfactant in the nonaqueous liquid phase.
In a third process step, this liquid phase combination of materials is cooled to a temperature of from about 0~C to 35~C. This cooling step serves to form a SUBSTITUTE SHEET (RULE 2fi) structured. surfactant-containing liquid base into which the particulate material of the detergent compositions herein can be added and dispersed.
Particulate material is added in a fourth process step by combining the particulate material with the liquid base which is maintained under conditions of shear agitation. When more than one type of particulate material is to be added, it is preferred that a certain order of addition be observed. For example, while shear agitation is maintained, essentially a11 of any optional surfactants in solid particulate form can be added in the form of particles ranging in size from about 0.2 to l,000 microns. After addition of any optional surfactant particles, particles of substantially all of an organic builder. e.g., citrate andlor fatty acid, and/or an alkalinity source, e.g., sodium carbonate, can be added while continuing to maintain this admixture of composition components under shear agitation. Other solid form optional ingredients can then be added to the composition at this point. Agitation of the mixture is continued, and if necessary, can be increased at this point to form a uniform dispersion of insoluble solid phase particulates within the liquid phase.
After some or all of the foregoing solid materials have been added to this agitated mixture, the particles of the bleaching agent can be added to the composition, again while the mixture is maintained under shear agitation. By adding the bleaching agent material last, or after a11 or most of the other components, and especially after alkalinity source particles, have been added, desirable stability benefits for the bleach can be realized. If enzyme prills are incorporated, they are preferably added to the nonaqueous liquid matrix last.
As a final process step, after addition of all of the particulate material, agitation of the mixture is continued for a period of time sufficient to form compositions having the requisite viscosity and phase stability characteristics.
Frequently this will involve agitation for a period of from about 1 to 30 minutes.
As a variation of the composition preparation procedure hereinbefore described, one or more of the solid components may be added to the agitated mixture as a slurry of particles premixed with a minor portion of one or more of the liquid components. Thus a premix of a small fraction of the alcohol alkoxylate and/or nonaqueous, low-polarity solvent with particles of the organic builder material and/or the particles of the inorganic alkalinity source and/or particles of a bleach activator may be separately formed and added as a slurry to the agitated mixture of composition components. Addition of such slurry premixes should precede addition of bleaching agent and/or enzyme particles which may themselves be part of a premix slurry formed in analogous ~:ashion.
SUBSTITUTE SHEET (RULE 26) The compositions of this invention, prepared as hereinbefore described, can be used to form aqueous washing solutions for use in the laundering and bleaching of fabrics. Generally, an effective amount of such compositions is added to water, preferably in a conventional fabric laundering automatic washing machine, to form such aqueous laundering/bleaching solutions. The aqueous washing/bleaching solution so formed is then contacted, preferably under agitation, with the fabrics to be laundered and bleached therewith.
An effective amount of the liquid detergent compositions herein added to water to form aqueous laundering/bleaching solutions can comprise amounts sufficient to form from about 500 to 7,000 ppm of composition in aqueous solution.
More preferably, from about 800 to 3,000 ppm of the detergent compositions herein will be provided in aqueous washing/bleaching solution.
EXAMPLE 1 ~
A non-limiting example of bleach-containing nonaqueous liquid laundry detergent is prepared having the composition as set forth in Table I.
T~L.I,~ 1 Component Wt. % Range (% wt.) Liquid Phase Na C 12 Linear alkylbenzene sulfonate25.3 18-35 (LAS) Isopeptidase 0.4 0.01-1 C 12-14. EOS alcohol ethoxylate 13.6 10-20 Hexylene glycol 27.3 20-30 Perfume 0.4 0-1.0 Solids Protease enzyme 0.4 0-1.0 Na3 Citrate, anhydrous 4.3 3-6 Sodium perborate 3.4 2-7 Sodium nonanoyloxybenzene sulfonate8.0 2-12 (HOBS) Sodium carbonate 13.9 5-20 Diethyl triamine pentaacetic acid 0.9 0-1.5 (DTPA) Brightener 0.4 0-0.6 Suds Suppressor 0.1 0-0.3 Minors Balance ----SUBSTITUTE SHEET (RULE 26) The resulting composition is a stable anhydrous heavy duty liquid laundry detergent which providest stain and excellen soil removal performance when used in normal fabric laundering operations.

The following Example further illustrates the invention herein with respect to a hand dishwashing liquid.

Ineredient I wt. Range~% wt.) Isopeptidase 0.5 0.01-1 Ammonium CI2-13 alkyl 7.0 2-35 sulfate C I 2-C I 4 ethoxy ( 20.5 5-35 1 ) sulfate Coconut amine oxide 2.6 2-5 Betaine/Tetronic 704** 0.87-0.10 0-2 (mix) Alcohol Ethoxylate CBEI5.0 2-10 Ammonium xvlene sulfonate4.0 i-6 Ethanol 4.0 0-7 Ammonium citrate 0.06 0-1.0 Magnesium chloride 3.3 0-4.0 Calcium chloride 2.5 0-4.0 Ammonium sulfate 0.08 0-4.0 Hydrogen peroxide 200 ppm I O-300 ppm Perfume 0.18 0-0.5 Maxatase~ protease 0.50 0-1.0 Water and minors ----------Balance--------------------**Cocoalkvl betaine SUBSTITUTE SHEI=T (RULE 26) i WO 98/16604 PCT/(TS97/18426 SEQUENCE LISTING
(1) INFORMATION FOR SEQ ID NO:1:
(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 557 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS:
single (D) TOPOLOGY: linear iii)MOLECULE TYPE: DNA ) (genomic (iii) SEQUENCE DESCRIPTION:ID
SEQ NO:1:

TCTTAATATC
TCACTA
ATG
AAT

Met Asn TyrValIlePheValValLeu GTA GCG

ValAla Leu Tyr Val Ile Glu LysCysThrValProSerAsp Val Ala GTA GAG

CysLeu Arg Cys Ile Cys Gln GlyCysAsnAsnGIuIleGly Val Glu AGT CTG

ArgCps Gly Met Asp Ala Gly SerCysGlyProTyrGlnIle Ser Leu TGT GGA

LysGlu Pro Tyr Arg Ile Asp ArgProGlyGlyGlyTyrGIn Cys Gly TGT TCT

GlnCys Thr Lys Glu Lys Ala GluArgCysValHisAlaTyr Cys Ser TGT ACT

MetAsp Arg Tyr Ala Arg Arg GlyGlyArgGlnProThrCys Cys Thr AAC ATG

GlnAsp Tyr Ala Lys Ile His GlyProAsnGlyCysGlnSer Asn Met AAT GTC

SerAsn Asn His Tyr Trp Asp ArgArgCysLeuGlyf Asn Val AGGAACAACA CTGCTGTTGA
TTGCCTCAAG
GTCGGCCATT

TCTAAATTAA CAAATGATAA
AGAAAAGNCA
TTTTTAAATT

(2) INFORMATION FOR SEQ ID N0:2:
SUBSTITUTE SHEET (RULE 26) (i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 136 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) MOLECULE TYPE: protein (iii) SEQUENCE DESCRIPTION: SEQ ID N0:2:
Met Asn Tyr Val Ile Phe Val Val Leu Val Ala Leu Tyr Val Ile Glu Val Ala Lys Cys Thr Val Pro Ser Asp Cys heu Arg Cys Ile Cys Gln Val Glu Gly Cys Asn Asn Glu Ile Gly Arg C:ys Gly Met Asp Ala Gly Ser Leu Ser Cps Gly Pro Tyr Gln Ile Lys C~lu Pro Tyr Arg Ile Asp Cys Gly Arg Pro Gly Gly Gly Tyr Gln Gln C:ys Thr Lys G1u Lys Ala Cys Ser Glu Arg Cps Val His Ala Tyr Met F,sp Arg Tyr Ala Arg Arg Cys Thr Gly Gly Arg Gln Pro Thr Cys Gln P.sp Tyr Ala Lys Ile His Asn Met Gly Pro Asn Gly Cys Gln Ser Ser A.sn Asn His Tyr Trp Asp Asn Val Arg Arg Cys Leu Gly (3) INFORMATION FOR SEQ ID N0:3:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 571 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) (iii) SEQUENCE DESCRIPTION: SEQ ID N0:3:

Met Asn Tyr Val Ile Phe GTG GTC TTA GTG GCA CTT TAC GTC ATC GAG G'TA GCG AAG TGC ACC GTT 100 Val Val Leu Val Ala Leu Tyr Val Ile Glu Val Ala Lys Cys Thr Val CCA TCC GAC TGC TTG AGT TGC ATT TGC GAG G'TA GAG GGA TGT GAC AAA l48 Pro Ser Asp Cys Leu Ser Cys Ile Cys Glu vat Glu Gly Cys Asp Lys GAG ATT GGA AGG TGC GGC GAT GAC GCA GGA At3T CTG AGC TGT GGT CCT 196 Glu Ile Gly Arg Gds Gly Asp Asp Ala Gly S~~r Leu Sez.Cys Gly Pro SUBSTITUTE SHEET (RULE 26) i Tyr Gln Ile Lys Glu Pro Tyr Trp Ile Asp Cys Gly Ser Pro Gly Ala Gly Tyr Gln Glu Cys Thr Lys Glu Lys Ala Cys Ser Glu Thr Cys Val Xaa Xaa Tyr Met Asp Arg Tyr Xaa Thr Arg Cys Thr Arg Gly Xaa Xaa Pro Thr Cys Gln Asp Tyr Ala Lys Ile His Asn Met Gly Pro Asn Gly Cys Arg Arg Thr Ser Asn Thr Tyr Trp Asn Lys Ala Asn Ala Cys Leu Asn (4) INFORMATION FOR SEQ ID N0:4:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 135 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) MOLECULE TYPE: protein (iii) SEQUENCE DESCRIPTION: SEQ ID N0:4:
Met Asn Tyr Val IIe Phe Val Val Leu Val Ala Leu Tyr Val Ile Glu Val Ala Lys Cys Thr Val Pro Ser Asp Cys Leu Ser Cys Ile Cys Glu Val Glu Gly Cars Asp Lys Glu Ile Gly Arg Cys Gly Asp Asp Ala Gly Ser Leu Ser Cys Gly Pro Tyr Gln Ile Lys Glu Pro Tyr Trp Ile Asp Cys Gly Ser Pro Gly Ala Gly Tyr Gln Glu Cys Thr Lys Glu Lys Ala Cys Ser Glu Thr Cys Val Xaa Xaa Tyr Met Asp Arg Tyr Xaa Thr Arg SUBSTITUTE SHEET (RULE 26) Cys Thr Arg Gly XaaProThr GlnAspTyrAlaLysIleHis Xaa Cys Asn Met Gly Pro GlyCysArg ThrSerAsnThrTyrTrpAsn Asn Arg Lys Ala Asn Ala LeuAsn Cys (5) INFORMATION SEQID O:
FOR N S:

(i) SEQUENCE STICS:
CHARACTERI

(A) LENGTH: 0 se 63 ba pairs (B) TYPE: nucleicacid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE DNA(genomic) TYPE:

(iii) SEQUENCE ON: ID
DESCRIPTI SEQ N0;5:

AGTAATGAAA ATCA'TTGCAATTTATGTTTCC 53 ATTCACCTTT
CGGACAAGG
ATG

Met IleIleAlaIleTyrValSer CTA GCT CTT CTA GCCTCTGTG GTGA.4TAGCCAATTCACTGAT 101 ATC GAG

Leu Ala Leu Leu AlaSerVal ValA.snSerGlnPheThrAsp Ile Glu TCT TGC CT.T ATTTGCAAG GAAGGATGTGACAGTCAAATT 149 CGG TGT GTG

Ser Cys Leu Arg IIeCysLys GluGLyCysAspSerGlnIle Cys Val GGA AAA TGT GGA GATGTTGGA TTGAGTTGCGGACCATACC~1G 197 ATG AGC

Gly Lys Cys Gly AspValGly LeuSerCysGlyProTyrG1n Met Ser ATT AAG AAA CCG TGGATTGAT GGAA~~ACCAGGGGGAGGTTAC 295 TAC TGT

Ile Lys Lys Pro TrpIleAsp GlyL~,rsProGlyGlyGlyTyr Tyr Cys GAA TCA TGC ACA AATAAAGCC TCAGiaGACTTGTGTGAGAGCT 293 AAA TGT

Glu Ser Cys Thr AsnLysAla SerG:LuThrCarsValArgAla Lys Cys TAT TGC

Tyr Met Lys Arg GlyThrPhe ThrG:LyGlyArgThrProThr Tyr Cys GCT AAC

Cys Gln Asp Tyr ArgIleHis GlyG:LyProArgGlyCysLys Ala Asn 105 110 1:L5 120 AGT TCT GCT ACT GGTTACTGG AAGG'CACAGAAATGTTTGAGA 437 GTT AAC

Ser Ser Ala Thr GlyTyrTrp LysValGlnLysCysLeuArg Val Asn ATCTTTGAGT AATT
AGCNCCTGTC
TTACATTTCsA

ATCNAATGAT
TTTAAACATT
TATTTGAAAT

SUBSTITUTE SHEET (RULE 26) i i TATAAATTGC TCCAAGAATT GTATAATCAT GAAGTGT':TG AAAGCTGTTT TCTGAAATAA 517 (6) INFORMATION FOR SEQ ID N0:6:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 136 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) MOLECULE TYPE: protein (iii) SEQUENCE DESCRIPTION: SEQ ID N0:6:
Met Ile Ile Ala Ile Tyr Val Ser Leu Ala Leu Leu Ile Ala Ser Val Glu Val Asn Ser Gln Phe Thr Asp Ser Cys Leu Arg Cys Ile Cys Lys Val Glu Gly Cys Asp Ser Gln Ile Gly Lys C~ys Gly Met Asp Val Gly Ser Leu Ser Cys Gly Pro Tyr Gln Ile Lys Lys Pro Tyr Trp Ile Asp Cys Gly Lys Pro Gly Gly Gly Tyr Glu Ser Cys Thr Lys Asn Lys Ala Cys Ser Glu Thr Cys Val Arg Ala Tyr Met Lys Arg Tyr Gly Thr Phe Cys Thr Gly Gly Arg Thr Pro Thr Cys Gln Asp Tyr Ala Arg Ile His Asn Gly Gly Pro Arg Gly Cys Lys Ser Ser Ala Thr Val Gly Tyr Trp Asn Lys Val Gln Lys Cys Leu Arg (71 INFORMATION FOR SEQ ID N0:7:
{i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 11S amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) MOLECULE TYPE: protein (iii) SEQUENCE DESCRIPTION: SEQ ID N0:7:
Thr Val Pro Ser Asp Cys Leu Arg Cys Ile Cys Gln Val Glu Gly Cys Asn Asn Glu Ile Gly Arg Cys Gly Met Asp Ala Gly SUBSTITUTE SHEET (RULE 26) WO 98l16604 PCTiUS97i18426 8~
Ser Leu Ser Cys Gly Pro Tyr Gln Ile Lys Giu Pro Tyr Trp I_e Asp Cys Gly Arg Pro Gly Gly Gly Tyr Gln Gln Cy:; Thr Lys Glu Lys Ala 45 50 5~_~ 60 Cys Ser Glu Thr Cys Val His Ala Tyr Met AsF> Arg Tyr Ala Arg Arg Cys Thr Gly Gly Arg Gln Pro Thr Cys Gln Asp Tyr Ala Lys Ile His Asn Met Gly Pro Asn G1y Cys Gln Ser Ser Asr; Asn His Tyr Trp Asp Asn Val Arg Arg Cys Leu Gly SUBSTITUTE SHEET (RULE 26)

Claims (10)

What is claimed is:

1. A cleaning composition comprising an isopeptidase active amount of isopeptidase enzyme.

2. A laundry detergent compositions comprising:
a) from 0.0001% to 5%, preferably from 0.001% to 2%, by weight of an isopeptidase enzyme; and b) from 95% to 99.9999% by weight of detergent composition adjunct ingredients.

3. A laundry detergent composition comprising:
a) from 0.1 % to 80%, preferably from 1 % to 50%, by weight of detersive surfactant;
b) from 0.0001 % to 5%. preferably from 0.001 % to 2%, by weight of an isopeptidase enzyme; and c) from 0.1% to 99.8% by weight of detergent composition adjunct ingredients.

4. A laundry detergent compositions comprising:
a) from 0.0001 % to 2% by weight of active detersive enzyme, preferably selected from the group consisting of proteases, cellulases, lipases.
amylases, peroxidases, and mixtures thereof;
b) from 0.0001% to 5%, preferably from 0.001% to 2%, by weight of an isopeptidase enzyme; and c) from 0.1% to 99.8% by weight of detergent composition adjunct ingredients, preferably selected from detersive surfactants, builders, and mixtures thereof.

5. A granular detergent compositions comprising:
a) from 0.1% to 50% by weight of a bleaching agent;
b) from 1 % to 80% by weight of a builder selected from the group consisting of aluminosilicates, silicates, and mixtures thereof;
c) from 0.0001 % to 2% by weight of active detersive enzyme selected from the group consisting of proteases. amylases, lipases, cellulases, and mixtures thereof;
d) from 0.0001% to 5%, preferably from 0.001% to 2%, by weight of an isopeptidase enzyme; and e) from 0.1% to 99.8% by weight of detergent composition adjunct ingredients.

6. A laundry detergent composition according to any of Claims 1-5 comprising a builder, detersive surfactant, or mixtures thereof, wherein the builder is selected from the group consisting of aluminosilicates, silicates, phosphates, phosphonates, and mixtures thereof; and wherein further the surfactant is selected from the group consisting of alkyl alkoxylated sulfates, alkyl sulfates, linear alkyl benzenesulfonate surfactants, cationic surfactants, nonionic surfacants, amphoteric surfactants, zwiterionic surfactants, and mixtures thereof.

7. A laundry detergent composition according to any of Claims 1-6 in granular form.

8. A method for laundering fabrics, said method comprising contacting in a laundry machine a fabric in need of cleaning with an aqueous solution comprising an isopeptidase active amount of an isopeptidase enzyme.

9. A method for laundering fabrics, said method comprising contacting in a laundry machine a fabric in need of cleaning with an aqueous solution comprising an isopeptidase enzyme-containing composition according to any of Claims 1-7.

10. A method for hand laundering fabrics, said method comprising soaking a fabric in need of cleaning in an aqueous solution comprising an isopeptidase active amount of an isopeptidase enzyme.