CA2266042C - Dna polymerases with enhanced thermostability and enhanced length and efficiency of primer extension - Google Patents

Abstract

A DNA polymerase having an amino acid sequence comprising substantially the same amino acid sequence as that of Thermus aquaticus or Thermus flavus DNA polymerase, excluding the N-terminal 280 amino acid residues of Thermus aquaticus DNA polymerase or the N-terminal 279 amino acid residues of Thermus flavus DNA polymerase, recombinant DNA sequences encoding said DNA polymerases, vectors comprising said DNA sequences, and host cells containing such vectors. A formulation of thermostable or other DNA polymerases comprising a majority component comprised of at least one thermostable or other DNA polymerase of the type described above, wherein the DNA polymerase lacks 3'-exonuclease activity, and a minority component comprised of at least one thermostable DNA polymerase exhibiting 3'-exonuclease activity, and an improved method for enzymatic extension of DNA strands, especially while, but not limited to, amplifying nucleic acid sequences by polymerase chain reaction wherein the above formulation is made and used to catalyse primer extension, are also provided.

Description

DNA POLYMERASES WTTH ENHANCED TSERMOSTABILTTY AND ENHANCED
LENGTH AND EFFICIENCY OF PRIMER EXTENSION
BACKGROUND OF THE INvENTTON
The present invention is directed to DNA polymerises, and more particulariy, to a novel mutation of Thermos anuaticus and Thermos flavus DNA polymerises exhibiting enhanced thermostability over any form of these enzymes now known. The invention is also directed to recom-binant DNA sequences encoding such DNA polymerises, and vector plasmids and host cells suitable for the expression of these recombinant DNA sequences. The invention is also directed to a novel formulation of the DNA polymerises of the present invention and other DNA
polymerises, which formulation of enrymes is capable of efficiently catalyzing the amplification by PCR (the polymerise chain reaction) of unusually long and faithful produce.
DNA polymerise obtained from the hot springs bacterium Thermos aquaticus (Taq DNA polymerise) has been demonstrated to be quite useful in amplification of DNA, in DNA
sequencing, and in related DNA primer extension techniques because it is thermostable. Thermostable is defined herein as having the ability to withstand temperatures up to 95~C
for many minutes without becoming irreversibly denatured, and the ability to polymerize DNA at high temperatures (60° to 75°
C.). The DNA and amino acid sequences described by Lawyer et al., J. Biol.
Chem. 264:6427 (1989), GenBank Accession No. J04639, define the gene encoding Thermos aquaticus DNA
polymerise and the enzyme Thermos aquaticus DNA polymerise as those terms are used in this application. The highly similar DNA polymerise (Tfl DNA polymerise) expressed by the closely related bacterium Therdus flavus is defined by the DNA and amino acid sequences described by Akhmetzjanov, A.A., and Vakhitov, V.A. (1992) Nucleic Acids Research 20:5839, GenBank Accession No. X66105. These enzymes are representative of a family of DNA
polymerises, also including 'Ibermus thermo~hilus DNA polymerise, which are thermostable. These enrymes lack a 3'-exonuclease activity such as that which is effective for editing purposes in DNA polymerises such as E. coli DNA polymerise I, and phages T7, T3, and T4 DNA polymerises.
Gelfand et al., U.S. Patent 4,889,818 describe a wild-type (abbreviation used here:
WTj, native Thermos aquaticus DNA polymerise. Gelfand et al., U.S. Patent 5,079,352 describe a recombinant DNA sequence which encodes a mutein of Thermos aguaticus DNA
polymerise from which the N-terminal 289 amino acids of Thermos aquaticus DNA polymerise have been deleted (claim 3 of '352, commercial name Stoffel Fragment, abbreviation used here:
ST), and a recombinant DNA sequence which encodes a mutein of Thermos aqaaticus DNA polymerise from which the N-terminal 3 amino acids of Thermos aquaticus DNA polymerise have been deleted (claim 4 of '352, trade name AmpliTaq, abbreviation used here: AT). Gelfand et al. report their muteins to be "fully active" in assays for DNA polymerise, but data as to their maximum theimostability is not presented.
The development of other eazymatically active mutein derivatives of Thermos aauaticus DNA polymerise is hampered, however, by the unpredictability of the impact of any particular modification on the structural aid functional characteristics of the protein. Many factors, including potential disruption of critical bonding and folding patterns, must be considered in modifying an enrymr and the DNA for its expression. A significant problem associated with the creation of N-terminal deletion muteins of high-temperature Thermos aauaticus DNA polymerise is the prospect that -the amino-terminus of the new protein may become wildly disordered in the higher temperature ranges, causing unfavorable interactions with the catalytic domains) of the protein, aid resulting in denaturation. In fact, a few deletions have been constructed which appear to leave the identifiable domain for DNA polymerise intact, yet none of these deletions have thermostability at temperatures as high as 99° C. While Thermos aquaticus DNA polymerise has shown remarkable thermostability at much higher temperatures than that exhibited by other DNA polymerises, it loses enrymatic activity when exposed to temperatures above 95-97~C. Moreover, its fidelity at 72~C
(the recommended temperature for DNA synthesis) is limited to an effective error rate of approximately 1/9000 bp.
Gelfand et al.'s mutein ST of Thermos aquaticus DNA polymerise (with an N-terminal 289 a.a.
deletion) is significantly more stable thaw AT, but ST exhibits significantly decreased activity when cycled to 98aC, and much less, if any, activity when cycled to 99~C, during the denaturation phase of PCR cycles.
Amplification of DNA spans by the polymerise chain reaction (PCR) has become an important and widespread tool of genetic analysis since the intro-duction of thermostable Taq DNA
polymerise for its catalysis. Two limitations to prior art methods of PCR are the fidelity of the final product and the size of the product span that can be amplified. The fidelity problem has been partially addressed by the replacement of Taq DNA polymerise by Pfu (Pyrococcus furiosus) DNA
polymerise, which exhibits an integral 3'-(editing) exonuclease that apparently reduces the mutations/bp/cycle from about 10' to about 10''. However, experiments suggest that this enryme is 5 unable to amplify certain DNA sequences in the size range of 1.5 to 2 kb that Klentaq-278 (also known as Kleataql) (N-terminal deletion of Taq DNA polymerise; WMB
unpublished) or AmpliTaq (full-length Taq DNA polymerise; ref. 3) can amplify handily, aid that Pfu is no more able (i.e. not able) to amplify DNA product spans in excess of 5-7 kb than is any form of Taq DNA polymerise.
For full-length Taq DNA Polymerise aid for N-terminally truncated variants Klentaq-278, Kleataq5 and Stoffel Fragment, PCR amplification apparently rapidly becomes inefficient or non-existent as the length of the target spas excuds 5-6 kb. This was shown even when 30 minutes was used during the extension step of each cycle.
Although there ate several reports of inefficient but detectable amplification at 9-10 kb target length and one at 15 kb, most general applications are limited to 5 kb.
Kaiaze et al. (Analytical Biochem. 202:46-49(1992)) report a PCR amplification of over 10 kb: a 10.9 kb aid a 15.6 kb product, utilizing in enryme of unpublished biological source (commercially available as 'Hot Tub' DNA polymerise). Kainze et al. report achieving a barely visible bead at 15.6 kb after 30 cycles, starting with 1 ng of ~ DNA template per 100 ul of reaction volume. The efficiency of this amplification was shown to be relatively low, although a quantitative calculation of the efficiency was not presented. Attempts by Kainze et al. to make WT Thermos a~c,usticus DNA polymerise perform in the 10-15 kb size range were not successful, nor have successful results bean reported by anyone else for any form of Thermos aquaticus DNA polymerise in this size range. There is no t~eport of any longer DNA products smplifiable by PCR.
A DNA polymerise which retains its thermostability at 98° or 99oC
would allow more efficient and convenient DNA analysis in several situations including "colony PCR" (see Figure 5), and/or allow thermal cycler overshoot without inactivation of the enryme activity. A thermostable DNA polymerise or DNA polymerise formulation which exhibits improved fidelity relative to AT or WT Thermos aquaticus DNA polymerise at optimum temperatures for synthesis would be highly desirable for applications in which the target and product DNA is to be expressed rather than merely detected.
A DNA polymerise formulation capable of efficient amplification of DNA spans in excess of 6 kb would significantly expand the scope of applications of PCR.
For instance, whole plasmids, and constructs the size of whole plasmids, could be prepared with this method, which would be especially valuable is cases in which a portion of the DNA in question is toxic or incompatible with plasmid replication when introduced into . co i. If this thermostable DNA
polymerise preparation simultaneously conferred increased fidelity to the PCR amplification, the resulting large products would be much more accurate, active and/or valuable in rrsearch and applications, especially in situations involving expression of the amplifed sequence. If the thermostable DNA polymerise preparation allowed, 'tin addition, more highly concentrated yields of pure product, this would enhance the method of PCR to the point where it could be used more effectively to replace plasmid replication as a mesas to produce desired DNA fragments in quantity.
SUMMARY OF THE INVENTION
Among the several objects of the invention, therefore, may be noted the provision of a DNA polymerise which can survive meaningful repeated exposure to temperatures of 99oC; the provision of a highly thermostable DNA polynxrase which exhibits greater fidelity thaw Thermos aduaticus DNA polymerise when utilized at standard Thermos ac~uaticus DNA
polymerise extension reaction temperatures; the provision of such a DNA polymerise which is useful for PCR amplification techniques from DNA templates and from single colonies of . col', single-stranded (linear) amplification of DNA, nucleic acid sequencing, DNA restriction digest filling, DNA labelling, in vivo footpriating, and primer-dirxted mutigenesis. Further objects of the invention include the provision of recombinant DNA sequences, vectors and host cells which provide for the expression of such DNA
polymerise.
Additional objects include the provision of a formulation of DNA polymerise capable WO 94126766 PCTIL;S94l01867 of efficiently catalyzing primer extension products of greater length thaw permitted by conventional formulations, including lengths up to ac least 35 kilobises, that reduces the mutageniciry generated by the PCR process, particularly in comparison with prior art DNA polymerises and for any target lengths, that maximizes the yield of PCR target fragments and, concomitantly, enhances the intensity aid sharpness of PCR prc~ducx bands, without significant sacrifice is flexiblity, specificity, aid efficiency; aid the provision of as improved process for amplification by PCR
which can be utilized to reliably synthesize nucleic acid sequences of greater length and which can effectively utilize PCR
products as primers.
Briefly, therefore, the preset invention is directed to a novel, rxombiaaat DNA
sequence encoding a DNA polymerise having as amino acid soquence comprising substantially the same amino acid sequence as the Thermos aquaticus or Thermos flavus DNA
polymerise, excluding however the N-terminal 280 amino acid residues of WT Thermos aquaticus or the N-terminal 279 amino acids of '~hermus flavus DNA polymerise.
Additionally, the present invention is directed to a DNA polymerise having as amino acid sequence comprising substantially the same amino acid sequence of the Thermos aquaticus or Thermos flavus DNA polymerise, but lacking the N-terminal 280 amino acid residues of Thermos a9,uaticus DNA polymerise, or the N-terminal 279 amino acids of Thermos flavus DNA polymerise.
In a further embodiment, the present invention is directed to a novel formulation of thermostable DNA polymerises, including s majority component comprised of at least one thermostable DNA polymerise lacking 3'-exonuclease activity and a minority component comprised of at least one thermostable DNA polymerise exhibiting a 3'-(editing) exonuclease activity.
The plesent invention is also directed to a formulation of DNA polymerise which includes at least one DNA polymerise which in wild-type form exhibits 3'-exonuclease activity and which is capable of catalysing a temperature cycle type polymerise chain reaction, wherein the 3'-ezonuclease activity of said at least one DNA polymerise has been reduced to between about 0.2 %
aid about 796, of the 3'-exonuclease activity of the at least one DNA
polymerise in its wild-type form.
1n another aspect, a formulation of DNA polymerise comprising E1 aid E2 is provided. E1 is one or more DNA polymet~es which lack any significant 3'~xonuclease activity, and E2 is one or more DNA polymerises which exhibit significant 3'-exonuclease activity. The mixture provided has s relative DNA polymerise wait ratio of E1 to E2 of at least about 4:1.
The invention is further directed to an improvement in s process for amplification of nucleic acid sequences by ~~'~t wherein the improvement comprises formulating DNA polymerise of the types described above. The formulation thereby created is used to catalyze primer extension during the PCR process, thus extending the applicable size range for efficient PCR amplification.
DNA polymerises such as those discussed in this application are commonly composed of up to throe identifiable and separable domains of enrytnatic activity, in the physical order from N-terminal to C-terminal, of 5'-exonuclease, 3'-exonuclease, DNA
polymerise. Taq DNA
polymerise has never had a 3'-exonuclease, but the invention in the first part is directed to a deletion of its 5'-exonuclease. Other DNA polymerises mentioned, such as Pfu DNA
polymerise, do not have the 5'-exonuclease, but their 3'-exonuclease function is central to the aspect of the invention directed to 5 mixtures of DNA polymerises E1 (lacking significant 3'-exonuclease) and E2 (having 3'-exonuclease).
In these mixtures, the presence of 5'-exonuclease in either El or E2 has not been shown to be essential to the primary advantages of the present invention.
According to an object of an aspect of the present invention there is provided a formulation of thermostable DNA polymerise comprising a thermostable DNA polymerise lacking 3'-5'exonuclease activity and a thermostable DNA polymerise exhibiting 3'-5' exonuclease activity, wherein the ratio of DNA polymerise units of the thermostable DNA polymerise lacking 3'-5' exonuclease activity to the thermostable DNA polymerise exhibiting 3'-5' exonuclease activity is greater than one to one.
According to an object of an aspect of the present invention there is provided a formulation of thermostable DNA polymerises comprising at least one thermostable DNA
polymerise lacking 3'-5' exonuclease activity and at least one thermostable DNA polymerise exhibiting 3'-5' exonuclease activity wherein the ratio of the amounts of the thermostable DNA polymerise lacking 3'-5' exonuclease to the thermostable DNA polymerise exhibiting 3'-5' exonuclease activity is greater than 1: I by DNA polymerise units or greater than 1 :1 by protein weight.
According to an object of an aspect of the present invention there is provided a kit for the synthesis of a polynucleotide, the kit comprising a first thermostable DNA
polymerise, wherein the first polymerise possesses 3'-5' exonuclease activity and; a second thermostable DNA polymerise, wherein the second polymerise lacks 3'-5' exonuclease activity; and instructions for using said polymerises at a ratio of said second polymerise to said first polymerise of greater than one to one.
According to an object of an aspect of the present invention there is provided a kit for the synthesis of a polynucleotide, the kit comprising:
(a) a first DNA polymerise, wherein the first polymerise possesses 3'-5' exonuclease activity selected from the group consisting of Pyrococcus furiosus DNA
polyrnerase, Thermotoga maritima DNA polymerise, Thermococcus litoralis DNA polymerise, and Pyrococcus GB-D DNA
polymerise, (b) a second DNA polymerise, wherein the second polymerise lacks 3'-5' exonuclease activity selected from the group consisting of Thermus aguaticus DNA
polymerise, (exo-) Thermococcus literalis DNA polymerise, (exo-) Pyrococcus furiosus DNA
polymerise, and (exo-) Pyrococcus GB-D DNA polymerise; and (c) instructions for using said polymerises at a ratio of said second polymerise to said 5a first polymerise of greater than one to one.
According to an object of an aspect of the present invention there is provided a method of amplifying a polynucleotide sequence, the method comprising: the steps of mixing a composition with a synthesis primer, and a synthesis template, the composition comprising:
(a) a minority thermostable DNA polymerise possessing 3'-5' exonuclease activity selected from the group consisting of Pyrococcus furiosus DNA polymerise, Thermotoga maritima DNA polymerise, Thermococcus litoralis DNA polymerise, and Pyrococcus GB-D DNA
polymerise, and (b) a majority thermostable DNA polymerise, wherein the polymerise lacks 3'-5' exonuclease activity selected from the group consisting of Thermus aguaticus DNA polymerise, (exo-) Thermococcus litoralis DNA polymerise, (exo-) Pyrococcus furiosus DNA
polymerise, and (exo-) Pyrococcus GB-D DNA polymerise.
According to an object of an aspect of the present invention there is provided a formulation comprising El wherein El is a reverse transcriptase which lacks any significant 3'-5' exonuclease activity, and E2 wherein E2 is a DNA polymerise which exhibits significant 3'-5' exonuclease activity, and wherein the ratio of the amounts of El to E2 is greater than 1 to 1 by polymerise units or by weight.
According to an object of an aspect of the present invention there is provided a formulation comprising E 1 wherein E 1 is a mutant or chemical modification of T7 or T3 DNA polymerise which lacks any significant 3'-5' exonuclease activity, and E2 wherein E2 is a wild-type T7 or T3 DNA
polymerise, and wherein the ratio of the amounts of El to E2 is greater than 1 to 1 by polymerise units 2$ or by weight.
Other objects and features will be in part apparent and in part pointed out hereinafter.
SUMMARY OF ABBREVIATIONS
The listed abbreviations, as used herein, are defined as follows:
Abbreviations:
by = base pairs kb = kilobase; 1000 base pairs nt = nucleotides BME = beta-mercaptoethanol PP; = sodium pyrophosphate Pfu = Pvrococcus furiosus Taq = Thermus aquaticus 5b Tfl = Thermus flavus Tli = Thermococcus literalis Klentaq-nnn = N-terminally deleted Thermus aauaticus DNA polymerase that starts with codon nnn + 1, although that start codon and the next codon may not match the WT sequence because of alterations to the DNA sequence to produce a convenient restriction site.
WT = wild-type (full length) or deletion of only 3 as as = amino acids) ST = Stoffel fragment, an N-terminal deletion of Thermus aguaticus DNA
polymerase that could be named Klentaq-288. -LA = Long and Accurate; an unbalanced mixture of two DNA polymerases, at least one lacking significant s'-exonuclease activity and at least one exhibiting significant 3'-exonuclease activity.
PCR = (noun) 1. The Polymerase Chain Reaction 2. One such reaction/amplification experiment. 3.(verb) To amplify via' the polymerase chain reaction.
ul = microliter(s) ATCC = American Type Culture Collection Megaprimer = double-stranded DNA PCR product used as primer in a subsequent PCR stage of a mufti-step procedure.

i ~ i n n i m available firm New Eaglaad Biolabs.
Deep Vent exo- = mutant form of Deep Veat DNA polymerise lacking 3'(editing)-exonuclease.
Vent = DNA polymerise from Thermococcus litoralis; purified enryme is available from New Eaglaad Biolabs.
Vent exo- = mutant form of Vent DNA polymerise lacking 3~(ed;ting)..exonuclease.
Pfu = DNA polymerise from Pyrococcus furiosus lacking 3'(editiag)-exonuclease;
purified enryme is available from Stratagene Cloning Systems, Ins.
Pfu exo- = mutant form of Pfu DNA polymerise ; purified enryme is available from Stratageae Cloning Systems, Ins.
Sequenase = A chemically modified or a mutated form of phage T7 or T3 DNA
polymerise wherein the modification or mutation eliminates the 3'-exonuclease activity.
BRIEF DESCRIPTION OF THE DRAWINGS
Figure 1 depicts the nucleotide sequence of primers that can be used for amplifia..un of the gene for a preferred embodiment of the DNA polymerise of this invention. The bulls of the DNA sequence for the gene (between the primers) aid the resultant amino acid sequence of the enryme, is defined by the indicated GeaBank entry.
Figure 2 depicts the nucleotide sequence of the same primers as in Figurc 1, and shows that these same primers can be used for amplification of the analogous gene from Thermos flavus.
Figure 3 is a photograph of an agarose gel depicting a PCR amplification reaction conducted using the prior art enzyme Thermos aquaticus DNA polymerise (AmpliTaq; AT) aid a preferred embodiment of the DNA polymerise of this invention, tested with differing peals denatur-ation temperatures lasting a fuU 2 min each for 20 cycles. Full activity at 98° and partial but useful activity at 99° is exhibited by the preferred embodiment of this invention, whilst AT is unable to withstand these temperatures. Figure 3 demonstrates that the enryme of the present invention is more thermostable thaw AT in a practical test - PCR amplification.
Figure 4 is a photograph of an agarose gel depicting a PCR amplification reaction conducted using 4 earymes: the prior art enryme Thermos aquaticus DNA
polymerise (AmpliTaq;
AT); the DNA polymerise of this invention (KlenTaq-278); the prior art enryme AmpliTaq Stoffel Fragment (ST); and KleaTaq-291. All were tested with PCR deaaturation steps carried out at 95~C - .
(control standard temperature), aid at 98~C. All were tested at two levels of earyme, the lower level being as close as practicable to the minimum necessary to support the reaction at the control temperature.
Note that both KIenTsq-291 aid ST behave identically, losing most, but not all, of their activity when used at 98° C, yet KlenTaq-278 is at least twice as able to withstand use of the WO 94126766 PCTlUS94101867 higher denaturation temperature. AT is seen to be drastically reduced in effectiveness by exposure to 98 ° C. The behaviour of these earymes is reproducible except for ST, which is at its best in the presented experiment, but performs more poorly when used in the amounts recommended by the manufacturer.
Figure 5 is a photograph of as agarose gel analysis of the products of colony PCR
carried out at the standard peak denaturation temperature of 95° C
compared to the newly available temperature of 98° C allowed by the earyme of the present invention.
Figure 5 demonstrates an application advantage of the use of the newly available peak denaturation temperature.
Figure 6(A-C~ is three photographs, each of as agarose gel on which was loaded a portion of a test PCR experiment. Figure 6 demonstrates the large increase in efficiency of large DNA span PCR achieved by variations of a preferred embodiment of the enzyme formulation of the invention. Although KleaTaq-278 or Pfu DNA polymerise, alone, are shown to catalyze a low level of 6.6 kb PCR product formation, various combinations of the two are seen to be much more efficient.
Lower and lower amounts of Pfu in combination with Klentaq-278 are sees to be effective, down to the minimum presented, 1/640. Of those shown, only a combination of Klentaq-278 and Pfu can catalyze efficient amplification of 6.6 kb. Per 100 ul, the indicated level of each enryme (see Methods, example 8, for unit concentrations) was used to catalyze PCR
reactions templated with 19 ag ~plac5 DNA and primers MBL and MBR. 20 cycles of 94° 2 min., 60°
2 min., 72° 10 min.
Figure 7 is a photograph of an agarose gel on which were analyzed the products of PCR experiments to test the performance of an embodiment of the invention in catalyzing the amplification of fragments even longer than 6.6 kb. Figure 7 demonstrates the ability to amplify 8.4 kb, 12.5 kb, 15 kb, aa~l8 kb with high efficiency and large yield, utiliziing the 11640 ratio embodiment of the enryme formulation of the invention. Target product size is indicated above each lane as kb:. Level of template per 100 ul is indicated as ag ~:. 20 or 30 cycles of PCR were each Z
sec. 94°, 11 min. 70°. These early amplifications were non-optimal in several respects compared to the current optimal procedure (see Methods, example 8): thick-walled tubes were employed instead of thin, catalysis was by 1 ul KlentaqLA~4 (63:1::Kleataq-278:Pfu) instead of KlentaqLA-16, the 27mer primers were used (see Table 1 ) instead of longer primers, the extensionlannealling temperature was 70° instead of 68°, and the Omnigene thermal cycler was used.
Figure 8 is a bar graph enumerating the differences in the number of mutations introduced into a PCR product, the IacZ gene, by the near full-length prior art -3 deletion of ermus _ aquaticus DNA polymerise, compared to the number of mutations introduced by Klentaq-278.
Figure 9 is a photograph of as sgarose gel depicting a PCR amplification attempted using a 384 by megaprimer (double-stranded PCR product) paired with a 43-mer oligonucleotide primer BtVS. Per 100 ul of reaction volume, the following earymes (see Ex. 8, Methods for unit concentrations) were uscd to catalyze amplifications: lane 1, 1 ul Pfu DNA
polymerise; lane 2, 1/16 ul Pfu; lace 3, 1 ul Klentaq-278; lane 4, both earymes together (1 ul Klentaq-278 + 1/16 ul Pfu).

i ~ i i '~ i i '~ m WO 94IZb766 PCT/LTS94101867 The 384 by band near the bottom of the gel is the megaprimer, which was originally amplified using Klentaq-278. aH3 = lambda DNA digested with HindIll. The only successful amplification resulted from the combination of the two enrymes (lane 4). Vent DNA polymerise could substitute for Pfu with the same result (data not shown).
Figure 10 is a photograph of as agarose gel demonstrating that 33mers arc better than 27mers. Per 100 ul of reaction volume, 2 ng (lanes 1-6) or 10 ag (laces 7-12) of lambda transducing phtge template were amplified using 27mer primers (laces I-3, 7-9) or 33mer primers (lanes 4-6, 10-12). Besides being longer, the 33mer lambda primer sequences were situated 100 by to the left of primer MBL and 200 by to the right of primer MBR on the lambda genome. KlentaqLA-16 in the amounts of 1.2, 1.4, and 1.6 ul was used to catalyze the amplifications of 12.5, 15, and 18 kb, respectively. 15 ul aliquots (equivalent to 0.3 or 1.5 ng of J~ template) were analyzed by 0.8 96 agarose electrophoresis.
Figure 1 I is a photograph of as agarose gel showing a CHEF pulse-field analysis (ref. 11, 4 sec. switching time) of large PCR products amplified by KlentaqLA-16 (1.2 ul) under conditions which were suboptimal with respect to pH (unmodified PC2 buffer was used) and therm,;
cycler (Omnigeae). Starting template (see Table 1) was at 0.1 ag/ul and the time at 68° in each cycle was 21 min. for products over 20 kb, 13 min. for laces 4 & 5, and 11 min. for lanes 11-14. The volumes of PCR reaction product loaded were adjusted to result in approximately equal intensity; in ul: 12,12,4,2; 10,10,10; 2,2,4,1. The standard size lanes (S) show full-length ~plac5 DNA (48645 bp) mixed with a Hindlfll digest of 1~ DNA. As for Table 1, the sizes in 5 figures are in base pairs, as predicted from the primer positions on the sequence of ~plac5 DNA, and sizes with decimal points are in kb, as determined from this gel.
Figure 12 is a photograph of an agarose gel depicting 28 kb and 35 kb products without (laces 2,3) cad with (laces 5,6) digestion by restriction enzyme HindIB. Before HindllI
?S digestion, the 28 kb product was amplified with 21 min. extension time per cycle, and the 35 kb product was cycled with 24 min. extension times, both in the Robo~cler at optimum pH (see Ex. 8, Methods). Laces S (1,4,7) contain markers of undigested ~plac5 and HindIII-digested ~plac5 DNA.
Figure 13 is a photograph of an agarose gcl showing the results of a Pfu exo mutant test. PCR amplification of 8.4 kb by 30 units (0.7 ug) of Klentaq-278 alone (laces 1,7) and in combination with a very small admixture (1/16 ul or 1/64 ul, equivalent to 1/6 or 1125 unit) of archacbacterial Pfu wild type exo' DNA polymerise (+; lanes 2,3) or a mutant thereof lacking the 3'-exonucleasc activity (-; laces 4,5). Lane 6 is the result if 1 ul (Z.5 units) of solely Pfu DNA
polymerase (wt, exo*) is employed.
DESCRIP'IZON OF THE PREFERRED EMBODIMENT
Referring now to Figure 1, the primers ind logic for amplification by PCR of the recombinant DNA sequence encoding a preferred embodiment of the DNA polymerise of the invention CVO 94126766 PCTIL'S94l01867 (referred to herein as Klentaq-278), are xt forth. As depicted in Figure 1, an initiator methionine aid a glycine residue occupy the first two N-terminal positions of Klentaq-278, previously occupied by residues 279 aid 280 of WT Thermos aquaticus DNA polymerise, followed by the amino acid sequence of wild-type Thermos aquaiicus DNA polymerise, beginning with the amino acid residue at position 281 as described by I$wyer et al. The codons encoding amino acid residues 1 through 280 of Thermos aquaticus DNA polymerax are therefore deleted, aid the amino acids 1 thru 280 are not prraeat in the resulting geese product. Another preferred embodiment of the DNA polymerise of the invention is depicted in Figure 2. In this embodiment, the same deletion mutation described above is made to the highly analogous enryme Thermos flavus DNA polymerax.
It will be appreciated that minor variations incorporated into the DNA
encoding for, or the amino acid sequence as described herein, which retain substantially the amino acid sequence as xt forth above, and which do not significantly affect the thermostability of the polymerise are included within the scope of the invention.
Surprisingly, the mutant DNA polymerax Klentaq-278 exhibits thermostability at temperatures above thox reported for any previous variant of Thermos aquaticus DNA polymerise and has demonstrated a fidelity in final PCR products which is greater than that of WT Thermos aJc uaticus DNA polymerax, whey both are utilizod ai the 72° C
temperatures recommended for DNA
synthesis. Further, since Klentaq-278 does not have the S'-exonucleax activity associated with Thermos acLuaticus DNA polymera.~e (removed as a consequence of the N-terminal deletion), it is significantly superior to wild-type Thermos iquaticus DNA polymerise for DNA
sequencing.
Mutagenesis results, arid mismatched primer testing, suggest that Klentaq-278 is less processive and is less likely to extend a'~ispaired base than wild-type Thermos aquaticus DNA
polymerise.
Thermostability tests with Klentaq-278, Stoffel Fragment (ST, alternative designation.
Kleataq-288) and Klentaq-291 have bees carried out. The test used involves 20 PCR cycles with a full 2 minutes each at the peak test temperature, such as 97° C, 98° C, or 99° C, and the intensity of the resulting amplified bands is compared to 2 minutes at 97° C, or at a lower control deaaturation temperature, such as 95 ° C (at which all of thex variants are stable).
These data indicate that ST and Kleatsq-291 behave similarly, having thermolability at 98' C that is similar to each other yet distinct from Klentaq-278, which exhibits little detectable thermolability at 98° C in these tests. These data suggest that the number of N-terminal amino acids is important to the enhanced thermostability exhibited by the DNA polymerise of the invention. Evidently deletions ST ind Kleataq-291 are in a class which has removed too many amino acids (10 more and 13 more) for the optimum stability demonstrated by the invention Klentaq-278.
The DNA polymerax from the bacterium sometimes designated 'Ihermus flavus (and sometimes Thermos aduaticus - see ATCC catalog) is highly homologous to the WT
ermus aduaticus DNA polymerise. In the region of the deletions being discussed here, the enrymes and genes are exactly homologous, aid it is believed that the differences between the pair ST, Klentaq-291 i ~ i ii n ~ i WO 94lZ6766 PCTIUS94l01867 aid the superior Klentaq-278 would remain if the analogous deletions were constructed. Indeed, the primers is Figure 2 could be used on Thermos flavus DNA to construct KlenTfl-277 in exactly the manner described here for the conswction aid isolation of Klentaq-278. The Thermos ftavus DNA
polymerise -277 earyme aid variations thereof which exhibit similar thermostability are therefore also 5 within the scope of this invention.
The invention also features a vxtor which includes a recombinant DNA sequence encoding a DNA polymerise comprising the amino acid sequence of Thermos aquaticus or Thermos flavus DNA polymerise, except that it adds a methionine and giycine residue at the N-terminal and excludes the N-terminal 280 amino acids of wild-type Thermos aauaticus DNA
polymerise (see 10 Lwyer et al. , su ra .
In preferred embodiments, the vector is that nucleic acid prrsent as plasmid pWB254b (SEQ ID NO:S) deposited as ATCC No. 69244 or a host cell containing such a vector.
In a related aspect, the invention features a purified DNA polymerise having an amino acid sequence as discussed above. As used herein, 'purified" means that the polymerise of the invention is isolated from a ~:~ajority of host cell proteins normally associated with it. Preferably, the polymerise is at least 1096 (w/w) of the protein of a preparation. Even more preferably, it is provided as a homogeneous pz~eparation, e.g., i homogeneous solution.
In general, the recombinant DNA sequence of the present invention is amplified from a Thermos aquaticus genomic DNA or from a clone of the portion of the Thermos aquaticus DNA
polymerise gene which is larger than the desired span, using the polymerise chain reaction (PCR, Saiki et al., Science 239:487, 1988), employing primers such as those in Figure 2 into which appropriate restriction lltts have been incorporated for subsequent digestion.
The recombinant DNA sequence is then cloned into as expression vector using procedures well known to those in this art. Specific nucleotide sequences in the vector are cleaved by site-specific restriction earymes such as NcoI and Hind>II. Then, after optional alkaline phosphatase treatment of the vector, the vector and target fragment are ligated together with the resulting insertion of the target codoas in place adjacent to desired control aid expression sequences. The particular vector employed will depend in part on the type of host cell chosen for use in gene expression.
Typically, a host-compatible plasmid will be used cont:ining genes for markers such as ampicillin or tetracycline resistance, aid also containing suitable promoter aid terminator sequences.
In a preferred procedure, the recombinant DNA expression sequence of the present invention is cloned into plasmid pWB253 (expreasea KlenTaq-235 deposited as ATCC No. 68431) or pWB250 (expresses luciferase/NPTII fusion), the backbone of which is pTAC2 (J.Majors, Washington University), a pBR322 derivative. The specific sequence of the resulting plasmid, designated pWB254b is SEQ ID NO: 5.
Bacteria, e.g., various steins of E. colt, aid yeast, e.g., Baker's yeast, are most frequently used as host cells for expression of DNA polymerise, although techniques for using more complex cells are known. See, e.g., procedures for using plant cells described by Depicker. A., et al., J. Mol. A~ppl. Gen. (1982) 1:561. . co ' host strain X7029, wild-type F, having deletion X74 covering the ~ operon is utilized in a preferred embodiment of the present invention.
A host cell is transformed using a protocol designed specifically for the particular host cell. For E. coil, a calcium treatment, Cohea, S.N., Proc. Natl. Acid.
Sci. 69:2110 (1972), produces the transformation. Alternatively and more efficiently, electroporation of salt-free E. roll is performed after the method of Dower et al. (1988), Nucleic Acids Research 16:6127fi145. After transformation, the transformed hosts are xlected from other bacteria based on characteristics acquired from the expression vector, such as ampicillin resistance, and then the transformed colonies of bacteria are further screened for the ability to give rix to high levels of isopropylthiogalactoside (IPTG)-induced thermostable DNA polymerise activity. Colonies of transformed E. roll are then grown in large quantity and expression of Klentaq-278 DNA polymerise is induced for isolation and purification.
Although a variety of purification techniques are known, all involve the steps of disruption of the . roll cells, inactivation and removal of native proteins and precipitation of nucleic acids. The DNA polymerise is xparated by taking advantage of such characteristics as its weight (centrifugation), size (dialysis, gel-filtration chromatography), or charge (ion-exchange chroma-tography). Generally, combinations of thex techniques are employed together in the purification process. Ia a preferred process for purifying Klentaq-278 the . roll cells ate weakened using ZO lysoryme and the cells are lysed and nearly all native proteins are denatured by heating the cell suspension rapidly to 80~C and incubating at 80-81 ° C for 20 minutes.
The suspension is then cooled and centrifuged to pr~eCl~itate the denatured proteins. The superflataat (containing Klentaq-278) then undergoes a high-salt polyethylene-amine treatment to precipitate nucleic acids. Centrifugation of the extract removes the nucleic acids. Chromatography, preferably on a heparin-agarox column, results in nearly pure enryme. More detail of the isolation is xt forth below in Example 3.
The novel DNA polymerise of the prexat invention may be uxd in any process for which such an enryme may be advantageously employed. In particular, this enzyme is uxful for PCR
amplification techniques, nucleic acid sequencing, cycle sequencing, DNA
restriction digest labelling and blunting, DNA labelling, ~ vivo DNA footprinting, and primer-directed mutagenesis.
Amplification Polymerise chain reaction (PCR) is a method for rapidly amplifying specific xgments of DNA, in geometric progression, up to a million fold or more. See, e. g. , Mullis U . S.
Patent No. 4,683,202, which is incorporated herein by reference. The technique relies on repeated cycles of DNA polymersx~atalyzed extension from a pair of primers with homology to the 5' end and to the complement of the 3' end of the DNA xgmeat to be amplified. A key step in the process is the heat denaturing of the DNA primer extension products from their templates to permit another round of amplification. The operable temperature range for the denaturing step generally ranges from i ~ i n n i i WO 94/26766 PC'T/US941018b7 about 93aC to about 95oC, which irnwersibly denatures most DNA polymerises, necessitating the addition of more polymerise after each denaturation cycle. However, no additional DNA polymerise nods to be added if thermostable DNA polymerises such as Thermos aq_uaticus DNA polymerise are used, since they are able to retain their activity at temperatures which denature double-stranded nucleic acids. As described in Example 4, below, Klentaq-278 has demonstrated the ability to survive meaningful reputed exposure to temperatures of 99oC, higher than for nay previously known DNA
polymerise.
Klentaq-278 has also been demonstrated to have s higher fidelity than wild-type Thermos acLuaticus DNA polymerise at 72oC, the recommended synthesis temperature. The data for this has been gathered by a method involving the PCR amplification of a lacZ
DNA gene flanked by two selectable markers [Barnes, W.M. (1992) Geae 112, 29-25]. Representative data comparing the prefen~ed embodiment of this invention Klentaq-278 to AT and another analogous N-terminal deletion.
Klentaq-235, is shown in Figure 8, which demonstrates that different N-terminal deletions reproducibly exhibit differing fidelities as measured is the final PCR product.
Similar fidelity data for the earyme ST is not available, since it is difficult for the commercial preparation of this enryme to catalyze PCR of the long test fragment (4.8 kb) used for this assay. It is not yet known whether the difficulty with S'T for these experiments is caused merely by formulation (its concentration is less, such that 10-15 times mote volume is necessary for a 2 kb PCR
amplification, and for these deletions more enryme is needed for longer target DNAs), or whether ST
may be intrinsically unable to catalyze such a long-target PCR amplification.
DNA Sequencing Particular DNA sequences may be elucidated by the Singer Method (Saager. F., Nicklen, S. and Coulson, A.R., DNA sequencing with chain-terminating inhibitors, Proc.Nat.Acad.Sci.USA, 74 (1977) 54b3-5467), using dideozy analogs. DNA
polymerises are used in these methods to catalyze the extension of the nucleic acid chains.
However, in its natural form, Thermos aguaticus DNA polymerise (like many other polymerises) includes a domain for 5'~xonuclease activity. This associated exonuclease activity can, under certain conditions including the presence of a slight excess of enryme or if excess incubation time is employed, remove 1 to 3 nucleotides from the 5' end of the sequencing primer, causing each bead in as alpha-labelled sequencing gel to appear more or less as a multiplet. If the Iabel of the sequencing gel is 5', the exonuclease would not be able to cause multiplets, but it would instead reduce the signal. As a result of the deletion of the N-terminal 280 amino acid residues of Thermos aquaticus DNA polymerise, Klentaq-2?8 has no exonuclesse activity and it avoids the sequencing hazards caused by 5'-exonuclease activity.
Kleataq-278 can be used effectively in thermostable DNA polymerise DNA sequen-cing. There are basically two types of dideoxy DNA sequencing that Kleataq-278 is good for -original dideoxy (Saager et al. supra; Innis et al., Proc. Natl. Acid. Sci.
USA 85:9436, 1988) and WO 9426766 PCTlCTS94I01867 cycle sequencing.
lnnis et al. describe a good procedure for dideoxy sequencing, but when the WT
~hermus acLuaticus DNA polymersse is used this procedure is prone to doubled or tripled bands on the sequencing gel, as demonstrated in the patent application no. 0'7/594,637 which should be available to the examiner and which is incorporated herein by reference. Klentaq-2?8 is as effective in curing this problem as the subject of that patent application, Klentaq-235, a.k.a.
DeltaTaq.
The procedure recommended for orignal-type (non-cycled, Inais et al. dideoxy sequencing with Kleataq-278 is that in the USB Taquence 2.0 dideoxy sequencing kit, the title page of which is appended to this application (Appendix 1) and the article is wholly incorporated by reference.
The procedure recommended for cycle sequencing is that in the USB Cycle Sequencing Kit. The title page of this procedure is appended to this application (Appendix 2) and the article is wholly incorporated by reference.
Other Uses Klentaq-278 has also been used succeufully for primer-directed mutagenesis, in vivo footprintiag, DNA labelling and for preparation of non-sticky Lambda DNA
fragment size standards.
These procedures ue discussed below.
Klentiq-278, especially in the formulation Kleataq-LA (discussed below), can be used to extend site-specific mutagenic primers) which are aanealled to single-stranded templates. It substitutes for Klenow earyme (the large fragment of . coli DNA polymerise I) and T7 DNA poly-merase in this process, showing mote primer selectivity at 60~SoC thaw Klenow enryme at 37oC, and working to completio)~or sufficient incorporation in 12 mina., as compared to the one hour or more r~oquired for Klenow enzyme.
Klentasq-278 has also been shown to be useful (and superior to wild-type Thermus aquiticus DNA polymerise) for the post-PCR labelling steps with the third (second nested) primer in ?.5 ligase-mediated, PCR-assisted, in vivo footprinting. I am indebted to I.
G6attas, Washington University, St. Louis, MO for this information. These studies are similar to those of Garritty & Wold (Garrity, P.A., and Wold, B.J. (1992) Effects of differ~t DNA polymerises in ligation-mediated PCR: enhanced genomic sequencing and in vivo footprinting. Proc Natl Aced Sci U S A 89, 1021-1025) Klentaq-278 is also useful for DNA labelling. For random primers, a length of at - least 9 at is recommended, and preferably the reaction is warmed slowly (over 20-30 mina.) from 37 to 65~C. Most preferably, a programmable heat block, using procedures well-known to those in this - art, is utilized for the DNA labelling.
Another use of Kleataq-278 is for the preparation of Lambda DNA restriction digests chit do not have the sticky cads partially stuck together. As a result of including Klentiq-278 and the four DNA dNTPs in with a HindIlz digest performed at SSaC, beads 1 and 4 are not partially attached i i i ii n i i WO 94!26766 PCT/US94101867 to each other.
sit Strain pWB254b/X7029 was deposited with the American Type Culture Collection, Maryland, on February 18, 1993 and assigned the number ATCC 69244. Applicant acknowledges his responsibility to replace this culture should it die before the end of the term of a patent issued hereon, 5 years after the last request for a culture, or 30 years, whichever is the longer, tad its responsibiIiry to notify the depository of the issuance of such a patent, at which time the deposits will be made available to the public. Until that time the deposits will be made available to the Commissioner of Patents under the terms of 37 C.F.R. Section 1-14 nad 35 U.S.C. ~112.
In a further aspect of :.~e invention a target length limitation to PCR
amplification of DNA has been identified cad addressed. Concomitantly, the base pair fidelity, the ability to use PCR
products as primers, cad the maximum yield of target fragment were increased.
These improvements were achieved by the combination of a DNA polymerise lacking significant 3'-exonuclease activity, preferably, Kleataq-278, with a low level of a DNA polymerise exhibiting significant 3'-exonuclease activity (for example, Pfu, Vent, or Deep Vent). Surprisingly, target fragments of at least 35 kb can be amplified to high yields from, for example, 1 ng lambda DNA template with this system.
Moroover, products in the range 6.6 to 8.4 kb can be efficiently amplified by a formulation of thermostable DNA polymerises consisting of a majority component comprised of at least one thermostable DNA polymerise lacking 3'~xonuclease activity cad a minority component comprised of at least one thermostable DNA polymerise exhibiting 3'-exonuclease activity.
The prior art technology only allowed relatively inefficient and sporadic amplification of fragments in this sise range, resulting in only relatively faint product bawds or no detectable product at a11. In Iight of the current discovery, I believe I understand (without limiting myself to any particular theory) the reason for the inefficiency of the prior art. It is believed that Thermus aouaticus DNA polyme~ase cad its variants are slow to extend a mismatched base pair (which they cannot remove since they lack any 3'-exonuclesse). A couple of companies (New England Biolabs and Str3tagene) have introduced thermostable enzymes which exhibit a 3'-(editing) exonuclease which should, one would think, allow the re~val of mismatched bases to result in both efficient extension and more accurately copied products. In practice. these two enrymes (Vent cad Pfu DNA
polymerise) are unreliable and much less efficient thaw expected. One possible explanation for the unreliability of these enrymes for PCR is that the 3'-exonucletse often apparently attacks and partially degrades the primers so that little or no PCR is possible. This primer attack problem is worse for some primers thaw others. It has been reported (Anonymous, The NEB Transcript, New England Biolabs, (March, 1991) p. 4.) that the Vent DNA polymera9e leaves the S' 15 at intact, so that if the annealling conditions allow that 15 at to prime, PCR could presumably proceed.
This would of course only allow aanealliag at lower, non-selective temperatures, and the 5' 15 at of the primers must be exactly homologous to the template.

I have discoverod that the beneficial effects of a 3'~xonuclease can be obtained with as unexpectedly minute pre~ce of one or more DNA polymerises which exhibit significant (defined as being biochemically assayible) 3'-exonuclease activity (herein called "E2") such as certain Archaebacterial DNA polymerises, whilst efficient extension is being catalyzed by a large amount of 5 one or more DNA polymerises which lack any significant 3'-exonuclease activity, such as Klentaq-278 or AT (herein called "E1 "). As a minority component of a formulation or mixture of DNA
polymerises, the unreliability and inefficiency of the 3'-exonuclease DNA
polymerise, discussed above, is substantially reduced or eliminated. Moreover, since it is believed that the 3'-exonuclease is removing mismatches to eliminate pausing at the mismatches, the resulting DNA
exhibits fewer bast 10 pair changes, which is a valuable dxrease in the mutageaicity of PCR
without sacrificing flexibility, specificity, aid efficiency. In fact, the combination, even for KlenTaq-278IPfu units ratios as high as 2000, exhibited greatly increased efficiency of amplification. For most applications, the mixture of DNA polymerises must be at s relative DNA polymerise unit ratio of E1 to E2 of at least about 4:1.
before enhanced product length aid yield can be achieved. When Pfu DNA
polymerise was used in 15 the formulation, the ratio preferably is in the range 80 to 1000 parts KlenTaq-278 per part (unit) Pfu, morn preferably from about 150 to about 170:1, and most preferably, is about 160:1, depending somewhat on the primer-template combination. Similar ratios are preferred for mixtures of Pfu and Kleataq-291.
If Deep Vent is substituted for Pfu for use in combination with Klentaq-278 or -291, the most preferred ratios for most applications increases to from about 450 to about 500:1 E1 to E2; if full-length (W'I~ Taq or Amplitaq is included as E1, the most preferred ratio to Pfu or other E2 component is between !Pout 10 and shout 15:1 of E1 to E2.
E2 of the invention includes, but is not limited to, DNA polymerise encoded by genes from Pfu, Vent, Deep Vent, T7 coliphage, Tma, or a combination ther~f.
E1 of the invention includes, but is not limited to, a mutant, 3'~xonuclease negative form of as E2 DNA polymerise, or alternatively, a DNA polymerise which, in unmutated form, does not exhibit significant 3'-exoouclease activity, such as the DNA polymerises encoded by genes from Taq, Tfl, or Tth, or a combination thereof,.
As discussed below, the formulation of DNA polymerises of the present invention also includes formulations of DNA polymerise wherein El comprises a reverse traascriptase such as Sequenase.
Additional examples of the formulations of the present invention include mixtures wherein E1 comprises or consists of a mutant or chemical modification of T7 or T3 DNA polymerise aid E2 comprises or consists of a wild-type T7 or T3 DNA polymerise, or, in another variation, E1 comprises or consists of a Veat DNA polymerise lacking nay significant 3'~xonuclease activity (sold by New England Biolabs as Vent exo-) and E2 comprises or consists of Vent.
The principal here discovered, namely the use of low levels of 3' exonuclease during primer extension by a DNA polymerise lacking 3' exonuclease, is applicable to general DNA
polymerise primer extensions, including normal temperature incubations (i.e.
using ion-thermostable DNA polymerises) and including reverse traascriptase enrymes, which are known to lack a 3'-(editing) exonuclease (Battula & Loeb, 1976). An example of the former is the use of Sequeaase (exo-) as the majority enryme, gad wild-type T7 DNA polymerise (exo+) or Klenow fragment as the minority compon~t. An example of the latter is AMV (Avian Myobisstosis Virus) or MLV (Murine Leukemia Virus) Reverse Tranacriptase as the major component, aid Kleaow fragment, T7 DNA
polymerise, or a thermostable DNA polymerise such as Pfu or Deep Vent as the minor component.
Because of the lower activity of thermosrable DNA polymerises at the temperatures of 37 degrres and 42 degrees used by these reverse traascriptases, higher levels are likely to be required than are used in PCR. Although Klenow fragment DNA polymerse is not a preferred DNA polymerise using RNA as a template, it does function to recognize this template (Karkas, 1973; Gulati, Kacian & Spiegelmaa, 1974), particularly in the presence of added Ma ion. Added Mn ion is routinely used to achieve reverse transtriptioa by thermostsble DNA polymerise Tth. unfortunately (in the prior art) without the benefit of an exo+ component. It must be stressed that for the use of the exo+
component for reverse transcriptase rractions, extra care must be taken to ensure that the exo+ component is entirely free of contaminating RNAse.
The following references describe methods known in the art for using reverse traascriptases, aid are hereby incorporated by reference.
Battula N. Loeb LA. On the fidelity of DNA replication. Lack of exodeoxyribonuclesse activity and error-correcting function in avian myeloblastosis virus DNA
polymcrase. Journal ~f' Biological Chemistry. 251(4):982-6, 1976 Feb 25.
Gulati SC. Kaciaa DL. Spiegelmaa S. Conditions for using DNA polymerise I as an RNA-dependent DNA polymerise. Proceedings of the National Academy of Sciences of the United States of America. 71(4):1035-9, 1974 Apr.
Karkas JD. Reverse transcription by Fscherichia cola DNA polymerise I. Proc Natl Acad Sci U S A. 70(12):3834-8, 1973 Dec.
DNA Polymerise with no polymerise activity, only 3'-exonuclease activity:
While not limiting himself to a particular theory, applicant believes that the carymatic activity of value in the minor (E2) component is the 3'-exonuclesse activity, not the DNA
polymerise activity. In fact, it is further believed that this DNA polymerise activity is potentially -troublesome. leading to unwanted synthesis or less accurate synthesis under conditions optimized for the majority (E1) DNA polymerise component, not the minority one. As taught by [Bernad, Blanco aid Sales (1990) Site-dirxted mutagenesis of the YCDTDS amino acid motif of the phi 29 DNA
polymerise, Gene 94:45-51.] who mutated the "Region I" DNA conserved DNA
polymerise motif of phi 29 DNA polymerise, either Region III or Region I of the Pfu DNA polymerise gene are mutated, l7 which has been sequenced by [Uemori,T., Ishino,Y., Toh,H., Asada.F. and Kato.I. Orgaaizatioa and nucleotide sequence of the DNA polymerise gene from the archaeon Pyrococcus furiosus, Nucleic Acids Res. 21, 259-265 (1993)].
Ia a further embodiment of the present invention, a formulation of DNA
polymerise is provided including or consisting of at least one DNA polymerise which, in wild-type form, exhibits 3'-exonuclease activity and wtlich is capable of catalysing a temperature cycle type polymerise chain reaction in which the 3'-exonuclease activity of the one or more DNA
polymerises discussed above has been reduced substantially, but not eliminated. The diminished 3'-exonuclease activity is obtained by mutation, or by chemical or other mesas known to those is this art. This formulation of DNA
polymerise may then be used to catalyze primer extension in PCR amplification.
The Spanish researchers [Soengas, M.S., Esteban. J.A., Lazaro, J.M. Bernad, S., Blasco, M.
A.,.l Sales, M., sad Blaaco, L., Embo Journal 11:4227-4237 (1992)], studying a distantly related DNA polymerise of the alpha class which includes Pfu, Veat and Doep Vent DNA polymerises, also identified and demonstrated mutation of the 3'-exonuclease domain as well separated sad easily avoided while one is mutating the DNA polymersse motif(s). 1n this same report, they demonstrate that the exonuclease can be reduced to 4-7 96 activity by a change of the conserved Tyr residue to a Phe or a Cys, whilst a reduction to only 0.196 activity is obtained by replacing the conserved Asp with Ala. For long sad accurate PCR, the optimum exo- (3'-exonuclease negative) mutation to create in a thermostable DNA
polymerise such as Pfu. Vent or Deep Vent, is one that reduces but does not eliminate the exonuclease, for instance a reduction to 0.2-796, preferably, 0.5-796, and most preferably, 1-796 of the 3'-exonuclease activity of the wild-type DNA polymerise.
As a~alteroative way to introduce the mutations (sad as demonstrated for the Bt CryV gene example above) Klentaq-LA, the current iwvewtion, is used to introduce the changes into a small PCR product spanning the DNA sequence coding for the two homologies REGION III and REGION I. The changes are chosen to change conserved amino acids in REGION III
andlor REGION I, using as a guide the conserved motifs displayed below with the aid of the MACAW
computer program.
I (data details not shown, but analogous to Example 1 above aid readily carried out by one skilled in the art) have PCR-amplified the ORF of the Pfu DNA
polymerise gene from Pfu DNA, using the sequence published by Uemori et al (1993) as a guide.
Analogously to Example 2 above, I have cloned this ORF into the same expression vector as used for expression of Kleataq-278, - sad I Gave shown that the DNA polymerise can be purified by the same procedure as described here for Klentaq-278 in Example 3 above.
As as alternative way (alternative to Soengas et. al, suoral to introduce the mutations (aid as demonstrated for the Bt CryV gene example above) Klentaq-LA, the current invention, would be used to introduce the changes into a small PCR product spawning the DNA
sequence coding for the two homologies REGION III wad REGION I. The changes would be chosen to change conserved i ~ i ii n i m amino acids in REGION III aadlor REGION I, using as a guide the conserved motifs displayed below with the aid of the MACAW computer program.
The following is numbered output from the computer program MACAW, demonstrating two of the DNA polymerise conserved motifs. A useful preseatatioa of these and other DNA polymerise motifs can also be found is Perler et sl (1992) P.N.A.S. 89, 5577-5581.
SEQ ID N0:30 REGION III
Phi29 KLMLNSLYGkfasnpdvtgkvpylkengalgfrlgocetkdpvytpmgvfITA 435 Pfu dyrqkaiIQ.LANSFYGyygyakarwyckccaa VTA 516 SEQ ID N0:31 SEQ ID N0:32 REGION I
Phi29 WARyttitaaqacyd-RIIYCDTDSIHLTgteipdvikdivdpkklgywah 485 Pfu WGRkyielvwkeleakfgfKVLYIDTDGLYATipggeseeikkkalefvkyinsklpgll 576 SEQ ID N0:33 The following examples illustrate the invention.

Construction of an Expressible Gene for Kleataq-278 In order to construct the Kltataq-278 DNA polymerise gene having a rxombinaat DNA sequeace shown as the nucleotide sequence of Figure 1, the following procedure was followed.
The mutated gene was amplified from 0.25 ug of total Thermos aquaticus DNA
using the polymersse chain reaction (PCR, Saiki et al., Science 239:487, 1988) primed by the two synthetic DNA primers of Figure 1. Primer KTl, SEQ ID NO:1, has homology to the wild-type DNA starting at colon 280; this primer is designed to incorporate a NcoI site into the product amplified DNA.
Primer Klentaq32, SEQ ID N0:3, a 33mer spawning the stop colon on the other afraid of the wild-type gene encoding Thermos aquaticus DNA polymerise, wad incorporating a HindIll site aid a -double stop colon into the product DNA.
The buffer for the PCR reaction was 20 mM Tris HC( pH 8.55, 2.5 mM MgCIZ, 16 mM (NH,~SO" 150 ug/ml BSA, wad 200 u11~ each dNTP. The cycle parameters were 2' 95a, 2' 650, 5' 72a.
In order to minimize the mutations introduced by PCR (Saiki et al., ~), only WO 94/26766 PCT/L;S94101867 cycles of PCR were performed before phenol extraction, ethanol precipitation, and digestion with the restriction enrymes NcoI and -I~'mdlB.
Preparation of an Ez~ression Vector The product NcoI and ~dIII fragment was cloned into plasmid pWB254b which had been digested with ,~I, ~dIII, and calf intestine alkaline phosphatase.
The backbone of this plasmid, previously designated pTAC2 and obtained from 1. Majors, carries the following elements in counter-clockwise direction from the PvuII site of pBR322 (an apostrophe ' designates that the direction of expression is clockwise instead of counter clockwise): a partial LZ' sequence, lacI', lacPUVS (orientation not known), two copies of the tic promoter from PL
Biochemicals Pharmacia-LKB; catalog no. 27-4883), the T7 gene 10 pro~ter and start colon modified to consist of a NcoI site, a HinidIII site, the ~A terminator (PL no. 27884-01), as M13 origin of replication, and the ~R gene of pBR322. Expression of the cloned gene is expected to be induced by 0.1 mM
IPTG.
Ampicillin-resistant colonies arising from the cloning were assayed by the single colony thermostable DNA polymerise assay of Signer et al. (1991) [GENE 97:119-23] and 4 strong positives were sized by the toothpick assay (Barnes, Science 195:393, 1977).
One of these, number 254.7, was of the expected size except for a small proportion of double insert. This plasmid was further purified by electroporation into . coli X7029 and screened for size by the toothpick assay, and one plasmid of the expected size with no double insert contamination was designated pWB254b.
This plasmid was usedlbr the production of Klentaq-278 described herein.

Purification of IsrQe Amounts of Klentag-278 Plasmid pWB254 has a double (tandem repeat) tic promoter and the T7 gene 10 leader sequence, an ATG start colon, a giycine colon and then colons 280-832 of Thermos aquaticus DNA polymerise, then a tandem pair of stop colons followed by the ttp transcription terminator. The pBR322-based plasmid vector (pTac2 from John Majors) is ampicillin resistant.
The cells are grown on very rich medium (see below). Bacterial host X7029 is wild-type F . coli except for deletion X74 of the lac operon.
Medium: Per liter water, 100 mg ticarcillin (addod when cool), 10 g Y.E., 25 g.
Tryptone, 10 g. glucose, 1XM9 salts with no NaCI (42 m11~ Ns=PO" 22 m~
KHzPO"19 m~ NH,CI).
Do not autoclave the glucose and the lOXM9 together; instead, autoclave one of them separately and mix in later. Adjust pH to 8 with 5 ~i NaOH (about 1 ml). Add IPTG to 0.1 mM
at ODD = 1 or 2, and stoke well at 30° C. From OD = 2 up to 8 or 10, every half hour or so do the following:

i ~ i ii n i m WO 9x126766 PCTIUS94J01867 1. Read the pH with pH sticks 5-10. Adjust to pH 8.5 with 5 M NaOH and swirling (2 to 5 ml per liter) whenever the pH falls below 8.
2. Read and record the ODs, usually as a 1110 or 1/50 dilution.
3. This addition of glucox is optional and not necessarily of any value (evaluation of 5 this question is incomplete at this time.) Read the glucox level with glucox sticks, and add as additional 0.596 (10 ml of 5096) if the level falls below 0.296.
If it is late, the cells can shake at 30° C all night after the last pH
adjustment.
Alternatively, xt them in the cold room if they have not grown much in $ few hours.
Concentrate the cells e.g. by centrifugation in a GS3 rotor for 8 minutes at 8 krpm.
10 Pour off the supernatant and add culture to spin more down onto the same pellets.
Lysis:
Resuspend the cells in milliliters of TMN buffer equal to twice the packed cell weight in grams: (50 mM Tris-HCl pH 8.55, 10 mM MgClz, 16 mM (NH,)=SO,).
To each 300 ml of cell suspension add 60 mg lysoryme and incubate the cells at 15 5-10° C. with occasional swirling for 15 minutes. Then add NP40 or Triton X100 to 0.196, and Tween 20 to 0.196, by adding 1/100 volume of a solution of 1096 in each. Then heat the cell suspension rapidly to 80° C. by swirling it in a boiling water bath, then maintain the cells (fast becoming an extract) at 80-81 ° C. for 20 minutes. Ux a clean thermometer in the cells to measure temperature. Be sure the flask and bath are covered, so that even the lip of the flask gets the full heat 20 treatment. After this treatment, which is expectod to have inactivated all but a handful of enrymes, cool the extract to 37° C. or lower in an ice bath and add 2 ml of protease inhibitor (100 mM PMSF
in isopropanol). From~this point forward; try not to contact the preparation with any flask, stir bar, or other object or solution that has not bean autoclaved. (Detergents and BME are not sutoclavable. The PEI and ammonium sulfate are also not autoclaved.) The purpose of the autoclaving is not only to avoid microbial contamination, but also to avoid contamination with DNA or nucleases.
Distribute into centrifuge bottles and centrifuge at 2° C. (for instance, 30 minutes at 15 krpm in a Sorval SS-34 rotor or 14 h at 4 krpm in a GS3 rotor). The supernatant is designated fraction I, and can be assayed for DNA polymerase activity.
High-salt PEI precipitation After rendering fraction I 0.25 M in NaCI (add 14.6 g per liter), add five percent Polymin-P (PEI, polyethylene-imine, Sigma) dropwix with stirring on ice to precipitate nucleic acids.
To determine that adequate Polymin-P has been added, and to avoid addition of more than the minimum amount necessary, test 1/2 ml of centrifuged extract by adding a drop of Polymin-P, and only if more precipitate forms, add more Polymin-P to the bulk extract, mix and retest. Put the test aliquots of extract back into the bulk without contaminating it.
To confirm that enough PEI has been added, centrifuge 3 ml and aliquot the supernatant into 1/2 ml aliquots. Add 0, 2, 4, 6 or 10 ul of 5 96 PEI. Shake, let sit on ice, and WO 94!26766 PCT/US94I01867 centrifuge in the cold. Load 15 ul of these aliquot superaataats onto an agarox gel containing ethidi-um bromide and elxtrophorese until the blue dye has tnvelied 2 cm. Inspect the gel on a UV light box for detectable DNA or RNA in the superaataat. For the bulk extract, use about 11100 volume (i.e. 2-3 ml for a 300 ml extt~ct) excess 596 PEI over the minimum necessary to remove all DNA by the agarox gel test.
Stir in the cold for at least 15 minutes. Centrifugation of the extract then removes most of the nucleic acids. Keep the supernatant, avoiding iay trace of the pellet.
Dilute the PEI supernatant with KTA buffer until the conductivity is reduced to at or below the conductivity of KTA buffer with added 22 mM ammonium sulfate. (Check conductivity of 1/40 dilution compared to similar dilution of genuine 22 mM A.S. in KTA.) Usually this is about a 5-fold dilution.
Chromatography with Bio-Rex 70 (used by Joyce & Grindley) (Joyce, C.M. &
Grindley, N.D.E. (1983) Construction of a pissmid that overproduces the large proteolytic fragment (Klenow fragment) of DNA polymerise I of . coli, Pros. Natl. Aced. Sci. U.S.A.
80, 1830-1834) is IS unsuccessful (no binding), but unavoidable, since without it, the next column (heparin agarose) will not work efficiently. We believe that the important function of the Bio-Rex 70 step is to remove all excess PEI, although it is possible that some protein is removed as well.
~CM~ellulose does not substitute for Bio-Rex 70.
Pass the dilutod PEI supernatant through equilibrated Bio-Rex 70 ( 10 ml per 100 g.
cells). The polymerise activity flows through. Rinx the column with 2 column volumes of 22 mM
A.S. / KTA. Our procedure is to set up the following heparin agarox column so that the effluent from the Bio-REX 70 column flows directly onto it.
Heparin Agarose Chromatography (room temperature, but put fractions on ice as they come off.) Load the Bio-Rex flow-through slowly onto heparin agarox (Sigma; 10 ml per 100 grams of cells [this could be too little heparin agarox].) Wash with xveral column volumes of KTA
+ 22 mM A. S. , then three column volumes of KTA + 63 96 glycerol + 11 m~I A.
S. , then elute the pure earyme with KTA + 6396 glycerol + 222 mM A.S. + 0.596 Thesit (this is more Thesit for the final eluate.) Pool the peak of polymerise activity or OD~/(stuts about at 2/3 of one column volume after 222 mM starts, and is about 2 column volumes wide). Store pool at -20° C.
The storage buffer is a hybrid of, and a slight variation of, AmpliTaq storage buffer as recommended by Perkin-Elmer Cetus aid Taq storage buffer used by Boehringer-Maaaheim: 50 %
glycerol (v/v; 63 96 w/v), 222 mI~ ammonium sulfite (diluted to about 50 mM
for beach-strength sam-plea), 20 mM Tris-HCl pH 8.55,0.1 mIv~ EDTA, 10 mM meraptoethaaol, 0.596 Thesit).
The Thesit cause some thickening aid cloudiness below -10° C. This seems to caux no harm, but we suggest you warm the enryme to 0° C. on ice before aliquoting for use.

i ~ i ii n i m Thesit replaces the combination of 0.596 Triton-X100, 0.596 Twetn 20, which you may want to consider as as siternative.
We have had sporadic reports that freezing can inactivate the enzyme.
Exercise caution in this regard. This question is under current investigation.
Storage at -80°
(after quick-cooling with liquid nitrogen) is being tested and looks promising, but more thaw one freeze-thaw cycle has been deleterious to the enzyme preparation on some occasions.
Our final yield of enzyme from 7 liters (100 g cells) was once 28 ml at a concentration of 120,000 units per ml (4 x beach-strength).
I/4 ul of beach-strangth enzyme will support the PCR of a 2 kb span of DNA in a 100 ul reaction. Template is 5-10 ag of plasmid DNA. Each cycle consists of 1 min 98° C, 1 min 65° C, 6 min 72° C. Cycle number is 16-20. Less enryme is noeded for smaller-sized products ( 1/8 ul for 500 bp) and more enzyme is needed for larger products ( 1 ul for 5 kb).
IOTA Buffer per liter 20 mM Tris 8.55 10 ml of 2 I~v 10 mM BME 0.7 m1 neat 1096 w/v Glycerol 100 g.
0.1 mM EDTA 0.2 ml of .5 M
0.19b wlv Thesit 10 ml of 109fo Rough Incorpondon Assay 1 X PC2 Buffer (20 m~,i Tris-HCl pH 8.55, 2.5 mM MgClz, 16 mM (NH,)zSO,, 100 ug/ml BSA) 200-250 ug/ml activated salmon sperm DNA
40 uI~ each dNTP + (0-50 uCi a-'zP-dATP per ml To 25 ul assay mix oa ice add 0.2 ul of enzyme fraction, undiluted, or diluted in 8 ul of 1XPC2 buffer (or a 1/5 or 1125 dilution thereof.) Prepare standard Klentaq or Amplitaq, zero enzyme and total input samples, also. Incubate 10 min. at 72° C., then chill. Spot 5 or 8 ul onto filter paper and wash twice for 5 - 10 min. with 5 96 TCA, 196 PP;.
If pieces of paper were used, count each using Cereakov radiation or head monitor. If a single piece of 3 MM paper was used, autoradiograph for 60'.
PCR Assay to gioe 2 kb product.
Make up 1 ml of PCR reaction containing 50 ag of plasmid pl,c (a clone of as R color control cDNA from maize. PNAS 86:7092; Science 247:449), 200 pmoles each of primers Lc5 (SEQ ID NO:11) and Lc3 (SEQ ID N0:12), PC2 buffo and 200 uM dNTPs, but no enry~.
Distribute 100 ul into tube one, and 50 ul into the rest of 8-10 tubes. Add 1 ul of final pool of KlenTaq to tube one and mix. They remove 50 ul to tube two and mix that, and so on down the series, which will then contain decreasing amounts of enryme in two-fold steps. Cover each SO ul reaction with a drop of mineral oil, spin, and PCR 16 cycles at 2' 95 ° C, 2' 65 ° C, 5' 72 ° C.
Fnal Bench-Str~gth KleaTaq-278 Enzytae Using 6396 glycerol I KTA (.59G Thesis) buffer with 222 mM ammonium sulfate, dilute the pool conservatively so that 1/4 ul should easily catalyze the amplification the 2 kb span by PCR. Do not decrease the ammonium sulfate concentration below 50 mM.
Store at -20° C.

DNA Amplification As reported in Figure 3, a PCR amplification assay to produce 2 kb of DNA
product was conducted using Thermos aquaticus DNA polymerise (AmpliTaq) (prior art DNA polym~ts~e) and Klentaq-278. To test polymerise thermostability it elevated temperatures, the DNA deaaturation step of the PCR amplification reactions were conducted for 2 min. at 97oC, 98~C and 99oC, respectively, using graduated concentrations of DNA
polymerise.
The amplification procedures used followed approximately the protocol for amplifying nucleic acid sequences outlined by Saiki et ., Science 239:487, 1988. A 1 ml reaction mixture was prepared containing 100 ag of plasmid pLC, 200 pmoles each of primers La5 (SEQ ID NO:11) and L,c3 (SEQ ID N0:12), reaction buffer (20 mM
Tris-HCl pH 8.55, 16 mM ammonium sulfate, 2.5 mM MgCI= and 150 ugJml BSA), 200 uM
dNTPs, but no earytae. 100 ul of the reaction mixture was placed into tubes. Aliquots of AmpliTaq and Kleataq-278 were then added and 20 cycles of PCR were undertaken.
Figure 3 shows the results of the experim~t to compare the practical thermostability limits. The only change between the 3 panels shown is the temperature of the 2 min. denaturatioa step: 9?° C, 98° C, or 99° C. A range of enzyme concentrations was used in order to be able to detact small effects on the effective PCR
catalysis activity. The template was 10 ag of pLc (a clone of is R color control eDNA from maize. PNAS
86:7092, Science 24?:449). The primers were Lc5 (SEQ ID NO:11) and Lc3 (SEQ ID N0:12).
Other details of the reactions are given in the assay section of Example 3.
It can be seen in this experiment that 98° C was not delectably detrimental to KlenTaq-2?8, yet AT was nearly completely inactivated by this temperature.

i ~ i ii n i m WO 94126766 PCT/L?S94I01867 In the experiment shown in Figure 4, each of four enrymes (AT, KlenTaq-278, ST, and KlenTaq-291 ) was tested for thermostability at 98 ° C.
Each was tested in pairs of two concentrations differing by a factor of 2. The volumes of actual enryme preparation are indicated above each lane in ul. The amount used was adjusted from previous titratioas (conducted as described for the 2 kb PCR assay in Example 3 and the legend to Figure 3) so that a 2-fold drop-off in activity would be detectable. Note the large amount of ST necessary to function at the 95 ° C control PCR. A previous attempt at this experiment (data not shown) used only 1l4 these volumes of ST (which would have been equivalent standard DNA
polymerise incorporation units compared to KT-291 and KT-278), and no product was obtained.

Single Colony PCR
The analysis of single E.E. roll colonies by PCR is a convenient screen for the presence andlor orientation of desired DNA fragments during a cloning or recioning procedure. In the prior srt, the bacteria may not be simply added to a complete PCR
reaction, since they evidently do not lyre efficiently enough to release the plasmid DNA that is to be the template for the PCR. Instead, and cumbersomely, since it requires a complete extra set of labelled test tubes, bacteria must first be suspended in water, not buffer, in the optional but recommended (Riggs et al. presence of chelating resin, and heated to 100° C for several (such as 10) minutes. Then 1-10 ul of the heated bacterial suspension is added to an otherwise complete P~R reaction, which is then cycled and analyzed normally.
The imprnvement here is that, since Klentaq-278 can withstand 98-99° C.
during the denaturation step of each PCR cycle, the bacteria can be added directly and conveniently to a complete (including Klentaq-278 earyme) PCR reaction and then the PCR
cycling can begin without further pretreatment. 'I3e only difference from a normal PCR
cycling is that the full 98° C (2 min.) or 99° C (1 min.) temperature is used during each denaturation step (or at least the first 5-10 steps) of the PCR. The experiment in Figure 5 used 2 min. at 98° C for all 25 cycles, and demonstrates that this method gives rise to a more intense and reliably distinguished product band even thaw the prior art method which utilizes a 10' 100° C separate treatment. This improvement is not possible with AT
enzyme, since AT
enzyme is inactivated at 98 ° C (as shown in figures 3 and 4).
Figure 5 is a photograph of an agarose get of a demonstration of the advantage of a 98° C denaturation step in colony PCR, compared to the standard 95° C
temperature. Lanes 1 and 3 employed the prior art pre-treatment of the bacteria in distilled water at 100° C for 10 minutes before addition to the PCR reaction.
Laces 2 and 4 conveniently dispensed with this step cad the same amount of bacterial suspension (about 2 to WO 94/26766 PCT/L'S94I01867 4 X 10' cells, but the identical volume of the same bacterial suspension) was simply introduced into the complete PCR reaction (including buffer, triphosphates, primers and enryme KleaTaq-278. ) Lines 1 and 2 employed the standard 95 ° C, and lanes 3 and 4 employed the newly possible 98° C denaturatioa/cell-disruption temperature. The cycle 5 conditions were 2 min. at 98 ° C or 95 ° C, 2 min. a 65 ° C, and 5' at 72 ° C. , for 25 cycles.
The primers used were KT2 (37mer GAG CCA TGG CCA ACC TGT GGG GGA GGC TTG
AGG GGG A) and KlenTaq32 (see Figure 1). The bacterial cells were X7029 containing plasmid pWB319, a broad-host range piasmid containing the coding region of the gene for KlenTaq-278.
10 Lace 4 is the most convenient and the most effective method, and it takes advantage of the new stability of KlenTaq-278.

Efficent and Accurate PCR AmoIification of Long DNA Targets: (Part A) 15 A preferred embodiment of the above formulation (designated KlenTaq-L.A):
Starting with the purified earymes in storage buffer, mix 1 ul of Pfu DNA
polymeiase at 2.5 u./ul with 64 ul of KleaTaq-278 at 25 u./ul. Store at -20° C.
Larger amounts of Pfu are detrimental to some PCR amplifications, perform equally for some, and are beneficial for some. For testing of the optimum level of Pfu, 20 several reactions compete with KltnTaq-278 are aliquoted in the amount left to right of 75 ul, 25 ul, 25 ul, and as many additional 25 ul aliquots as desired. Then 3/8 ul of Pfu (equivalent to 0.5 ul per 100 ul - this is about the most that one would ever want) is added to the leftmost, 75 ul reaction and mixed. Serial, two-fold dilutioas are then made as 25 ul + ZS ul left to right along the row of tubes, adding no Pfu to the Last one, as a control of KlenTaq-25 278 alone. A reaction of ll2 or 1 ul (per 100 ul) of Pfu alone should also be run.
Reaction buffer is PC2 as above, supplemented with 200 uM of each dNTP
and 800 uM of MgClz (total Mg** 3.3 mM), and per 100 ul of reaction volume, 20 pmoles of each primer MBL (SEQ ID N0:7) and MBR (SEQ ID N0:8), and 30 ag of aplac5 intact phage. Per 100 ul of reaction volute, 1 or 1/2 ul of KTLA are effective levels of enryme.
Suitable PCR cycling conditions are two-temperature: ZO seconds at 94°
C, 11 minutes at 70° C, for 20 cycles. Alternate cycling conditions include two-temperature PCR with 1 minute at 98° C sad 10 minutes at 65° C. 10 to 16 ul are loaded onto an agarose gel for product analysis by staining with ethidium bromide. See Figure 6 for other details and variations. The template was ~plac5, which carries a portion of the lac operon region of the E. coli genome. Thirty ag of phage DNA were included in each 100 ul of reaction volume, WO 94!26766 PCTIUS94101867 introduced as intact phage puticles. The primers are homologous to wild-type lambda DNA
and amplify ~ DNA, not the lac DNA. Primer MBL No. 8757 (5' nucleotide matches base pair 27914 of ~ DNA) is GCT TAT C'TG CTT CTC ATA GAG TCT TGC (SEQ ID N0:7).
Primer MBR No. 8835 (5' nucleotide matches by 34570 of ~ DNA) is ATA ACG ATC
ATA
TAC ATG GT'T CTC TCC (SEQ ID N0:8). The size of the amplified product is therefore predicted to be 6657 bp.
As shown in Figure 6A and 6B, each DNA polymerase earyme (KlenTaq-278 or Pfu) alone gives rise to a flint prod:::t band (except for some reactions, when Pfu alone does not work at all), but the combinations all give rise to product bands that are 20 to 50 times more intense thaw either enryme can catalyze on its own.
Figure 6C, second lane from the right, shows the surprising result of adding as little as 1/64 ul of Pfu to 1 ul of KIenTaq-278 (a units ratio of 11640).
Not shown are data that as little as 1/200 ul (1/2000 in units) of Pfu contributed a noticeable improvement to the efficiency of this test amplification.
Vent DNA polymerise required 10-fold higher amounts (yet still minority amounts) for similar functionality.
An additional, b~eficial, and unexpected attribute to the PCR reactions catalyzed by Klen'Taq-LA was a phenomenal, never previously observed intensity and sharpness to the PCR product beads. In part, this increased yield is manifested by a dark area in the middle of the bawds as photographed. This darker arse in the ethidium flouresceace is believed to be due to UV absorbance by the outside portions of the band, reducing the potential UV-activated flourescence. The system apparently allowed a much greater yield of product then did the prior art, which leaded to create a broad smear of product, and increasing amounts of side product, when amplification was allowed to proceed to this extent.

Efficent and Accurate PCR Amplification of Long DNA Targets: (Part Bl Efficient amplification of 8.4 kb, 12.5 kb, 15 kb, wad 18 kb was demonstrated by the experiment depicted in Figure 7. This experiment extended the demonstrated performance of the a preferred embodiment of the invention, 1/640 KlenTaq-LA, eves further. The amplificstioa was highly successful for the size range 8.4 to 15 kb, delectably successful for 18 kb, but not successful for an attempted 19.7 kb.
Eight different PCR reactions were run in this experiment, differing from each other in the template or amount of template or in the primer pair employed, as shown in the legend on Figure 7. Esch reaction was divided 3 ways and cycled differently in parts A, 2?
B, and C. Between parts A and B, this experiment compared 20 cycles to 30 cycles at 94 °
denaturation phase. In parts B and C, this experiment compared 94° to 93° for 30 cycles.
This experiment utilized 1.3 ul of Kleataq-LA (at a Klentaq-278/Pfu ratio of 640) per 100 ul of reaction. 'Ibis may have been a little too much earyme, since high enryme has been associated in previous experiments with the cstaStrophic synthesis of product which cannot enter the gel, as occurred here for the reaction products in channels 2B and 6C. At the current stage of development of long PCR using the invention, this poor outcome occurs about 1096 of the time.
Comparing conditions B and C, it is apparent that somewhat lower denaturation temperature is desirable. This is consistent with similar experiments comparing time at 94° C., in which yield of long PCR products was found to be diseased as the deauutstion time increased in the order 2, 20, 60, and 180 seconds at 94° C for the denaturation step of each cycle. These data indicate that there was at least one weak link, i.e. least thermostable component, in the reactions which is subject to inactivation at 94°. Since 94° is below the temper9ture known to damage the DNA
IS polymerise activity and the DNA, it is believed that it is not the thermolabile element. In an alternative embodiment of this aspect of the invention Pfu DNA polymerise is replaced as the minority component with a more thermostable 3'-exonuclease of a DNA polymerise such as, but not limited to.
that from the Archaebacterium strain ES4, which can grow at temperatures up to 114° C [Pledger, R.J. and Baross, J.A., J. Gen. Microbiol. 137 (1991)], which maximum gmwth temperature exceeds that of the source of the Pfu DNA polymerise (103° C.; Blumentals, LI.
et al. (1990) Annals of the N.Y. Acid. Sci. 589:301-314.) In thilexperiment in Figure 7 the final intensity of the 15 kb bawd matched in only 20 cycles the yield obtained by Kainzt et .su in 30 cycles for a bawd of similar size and from similar aDNA template amounts. 'Ibis was a measure of the improved efficiency provided by the invention, and the further rrsult was that the yield catalyzed by the invention in 30 cycles greatly exceeded the yield reported by these authors for 30 cycles. Accurate quantitation has not yet been carried out to measure the efficiency of the two methods, but inspection of Figure 7 compared to the figure published by Kainze et al. shows a yield for the IS kb fragment that is estimated to be some 100 times higher. This corresponds approximately to a doubled efficiency of PCR extension.
~AMph~E 8 Efficent and Accurate PCR Amplification of Lone DNA Targets: (Part C) Materials and Methods DNA Polyma~sa. DNA polymerises Vent and Deep Vent were supplied by New England Biolabs. Pfu DNA polymerise and its exo' mutant were supplied by Stratagcae at 2.5 i ~ i i '~ i i i m units/ul. Klentaq-278 is as N-terminal deletion variant of Taq DNA polymenase (WMB, unpublished).
The deletion endpoint is between that of Klentaq5 (10) and Stoffel Fragment (3). Purified Kleataq-278 was as supplied by Ab Peptides, St. Louis, MO, USA at 25-35 units/ul (a protein concentration of about 0.7 ug/ul). One wait of DNA polymerise activity incorporates 10 amoles of nucleotide in 30 min. at 72° C., utilizing activated (partially degraded) calf thymus DNA as template. Since activated calf thymus DNA is a somewhat undefined substrate and is structurally different from PCR reaction substrate, this assay was routinely eschewed in favor of a PCR-based assay to set the above stock concentration of Klentaq-278: the concentration of Klentaq-278 stock was adjusted so that 0.25 ul effectively (but .12 ul less effectively) catalyzes the amplification of a 2 kb target span from 10 ag of plasmid substrate with cycling conditions including 7 min. of annealing /
extension at 65°. The mixture of 15/16 ul Klentaq-278 + 1/16 ul Pfu DNA polymerises is designated KlentaqLA-16.
Agarose gd electrophoresis employed 0.796 to 196 agarose in 1XGGB (TEA) buffer [40 mM Tris acetate pH 8.3, 20 mM sodium acetate, 0.2 mM EDTA] at 2-3 v/cm, with 3 96 ficoll instead of glycerol in the loading dye. Figure 11 employed 196 agarose pulsed-field CHEF (11) with a switching time of 4 sec. Standard DNA fragment sizes in every figure are, in kilobases (kb): 23. ~ , 9.4, 6.6, 4.4, 2.3, 2.0, and 0.56. Figure 11 and 12 also have a full-length ~plac5 standard band, 48645 bp.
All agarose gels were run or stained in ethidium bromide at 0.5 ug/ml and photographed (35 mm ASA 400 black and white film) or vidcographed (Alpha Innotech or Stratagene Eagle Eye) under UV illumination. While printing the gel photographs, the left halves of Figure 7 and 10 werc exposed 5096 Less than the right halves.
DNA primers are listed in Table 1 and in the Sequence Listing.
Lambda DNA templates. wacA, a gift fmm S. Phadnis, is a aEMBLr4-vectored clone of the cytotoxin gene region of HelicobactergYlori DNA. This DNA was extracted and stored frozen. 'Ibe other phage template DNAs ~plac5 (12) and ~IC138 (13) were added as intact phage particles that had been purified by CsCI equlibrium centrifugation, dialyzed, and diluted in 1X PC2 buffer.
Long and Acxurate PCR. PC2 Reaction buffer (10) consisted of 20 mM Tris-HCl pH 8.55 at 25°, 150 ug/ml BSA, 16 mM (NH,,~rSO,, 3.5 mM MgClz, 250 uM
each dNTP. For success above 28 kb (at 35 kb), 1.5 ul of 2 M Tris base was added to each reaction, corresponding to pH 9.1 measured for the Tris-HCl component only at 20 mM in water at 25° C. Contact with a pH
probe was detrimental to the reactions, so pH was only measured on separate aliquots, and found to be 8.76 in the final reaction at 25 ° C. Each 100 ul of reaction volume contained 20 pmoles of each primer, and 0.1 to 10 ag of phage DNA template. 0.8 or 1.2 ul of KleataqLA-16 was appropriate for wader 20 kb and over 20 kb, respectively. Reaction volumes per tube were 33-50 ul, under 40 ul of mineral oil in thin-walled (PGC or Stratagene) plastic test tubes.
PCR reactions utilizing the primers at the ends of ~ required a preincubation of 5 WO 94!26766 PCTIUS94/01867 min. at 68°-72° to disrupt the phage particles and to allow fill-in of the ~ sticky ends to complete the primer homology. Optimal cycling conditions were in a multiple-block instrument (Robe Cycler.
Stratagcne) programmed per cycle to 30 sec. 99°, 30 sec. 67°, and 11 to 24 min. at 68°, depending on targei length over the range shown in Table 1. The sxond-best cycler was the Omnigene (HybAid), programmed under tube control per cycle to 2 sec. at 95°, then 68° for similar anneal ing/extension times. Unless otherwise stated, all of the experiments reported here used 24 cycles.
For reported results of comparison of conditions such as cycling temperatures and times, thermal cycler machines, thick and thin-walled tubes, etc., reactions were made up as 100 ul complete and then split into identical aliquots of 33 ul before subjecting to PCR cycling.
Table 1. Primer and template combinations.
Product Left Right Template Size Primer Primer DNA
SEQ ID SEQ ID
5.8 25 MBL101 28 MSA1933 ~IC138 6657 7 MBL 8 MBR ~plac5 8386 9 MBL-1.7 8 MBR ~plac5 8.7 26 MBR001 29 ~R36 aIC138 12.1 22 lacZ333 27 MBR202 ~IC138 12.5 7 MBL 27mer 8 MBR 27mer waeAI
or 25 or MBL101 27 MBR202 33mer 33mer 15560 10 MSA19 28mer 27 MBR202 ~plac5 28 or MSA1933 33mer 18.0 25 MBL101 ~ 27 MBR202 ~IC138 19.8 20 ~L36 24 MBL002 ~IC138 20707 25 MBL101 29 ~R36 36mer ~plac5 19584 20 ~L36 22 lacZ333 ~plac5 13971 26 MBR00133mer 29 ~R36 ~plac5 22.0 20 aL36 21 lacZ'S33 ~IC138 24.6 20 ~L36 28 MSA1933 ~IC138 22495 20 ~L.36 23 IacZ536 ~plac5 26194 21 lacZ'S33 29 ~R.36 ~plac5 28083 ZO ~L36 24 MBL002 ~plsc5 34968 20 ~L36 27 MBR202 aplac5 Legend to Table 1.
Product sizes in integer base pairs are as predicted from the sequence sad structure of ~ and ~plac5 as documented in Geabaak accession no. 102459 and ref. (21). Product sizes with decimal points in kb wen determined by comparison with these products and with the ~+HindBI size standards labelled ~H3. The sequence of the primers is given in the Sequence Listing.
Megaprimer consisted of gel-purified 384 by PCR product DNA homologous to the region between the BamHl site and EcoRI site of the gene coding for the CryV
ICP of Bacillus i ~ i n n i m thuriagieasis (14), and primer-modified to remove these restriction sites. The PCR reactions in Figure 10 each employed megaprimer (300 ag) , primer BtVS and 2r ng of genomic DNA
from Bacillus thurin 'oasis strain NRD12 (15). ~d earyme as indicated in the dexripitoa above of Figure 9.
Cycling conditions were 30 sec. 95°, 7 min. 60°, for 20 cycles.
5 HindIlQ digestion. Unfractioaated, total PCR reactions for 28 and 35 kb targets were supplemented with 1/10 volume of IOXNaTMS (1X = SO mM NaCI, 10 mM Tris-HCl pH 7.7, 10 mM MgC>z, 10 mM mercaptoethaaol) and 2 ul (10 units) of restriction earyme HindllI, and incubated at 55 ° C. for 90 min.
Test of aco- Pfu. Each 100 ul of reaction (incubated as 33 ul under 40 ul of oil) 10 contained 2 ng 7~p1sc5 DNA as purified phage particles, 20 pmoles each of primers MBL-1.7 and MBR , reaction buffer PC2 and 1 ul of Klentaq-2?8 (0.7 ug), except for reaction 6, which contained 1 ul Pfu DNA polymerise (2.5 u.) alone. Other details are is the description of Fig. 12. Thermal conditions were 24 cycles of 2 sec.at 94°, 11 min. at 70°.
The dixovery leading to the DNA polymerise mixture of the present invention was 15 made during attempts to utilize in PCR a primer with a mismatched A-A base-pair at its 3' end. In fact the primer was itself a PCR product "megaprimer" of 384 bp, and the mismatched A had been added by Klentaq-278 using non-templated terminal transferase activity common to DNA polymerises I ?6). Neither Klentaq-278 (Figure 9, Lane 3) nor Pfu DNA polymerise (Figure 9, Lanes 1 & 2 and other levels of enzyme not shown) could catalyze amplification of the 1500 by target that lay between 20 the PCR-product megaprimer and a 42mer oligonucleotide primer. The combination of the two earymes, however, was well able to catalyze amplification of the desired target fragment (Fig 9, lane 4). Evidently, the Pfu~DNA polymerise removed the presumed 3' A-A mismatch, allowing Kleataq-278 catalysis to proceed efficiently for each step of the PCR. The same result was obtained with Vent DNA polymerise substituted for Pfu (data not shown).
25 I hypothesized that mismatched 3'-ends are a general cause of inefficient primer extension during PCR of targets larger than a few kb. As a test system I
employed a 6.6 kb lambda DNA target which was amplified delectably but poorly by AmpliTaq, Kleataq-278 or Pfu DNA
polymerise in a variety of standard conditions. Per 100 ul reaction volume, 1 ul of Klentaq-278 was combined with various amounts of Pfu DNA polymerise, from 1/2 ul down to as little as 1/200 ul of 30 Pfu. Since the Pfu stock (2.5 units/ul) was at least 10 times less concentrated than the Klentaq-278 stock (25-30 units/ul), the actual ratios tested were 1/20 to 1/2000 in DNA
polymerise units.
Representative results of thex tests are shown in Figure 6B. A high yield of target band was observed for all tested combinations of the two enzymes, yet several levels of each enryme on its own failed to catalyze more than faintly detectable amplification. The lowest level of Pfu tested, 1/200 ul, exhibited only a slight beneficial effect. The appsu~ent broad optimum ratio of Klentaq-278:Pfu1 was 16 or 64 by volume, which is about 160 or 640 on the basis of DNA polymerise incorporation units.
When tested at 6-8 kb (dal, not shown), other combinations of 3'-exo' and 3'-exo' thcrmostable DNA

WO 9412b766 PCTIL'594101867 polymerases also showed the effect, including Amplitaq/Pfu, Klentaq-278/Veat, Klentaq5 (DeltaTaq, USB) / Pfu, Stoffel FragmeatJPfu, Klentaq-278/Deep Veat (our second choice), and Pfu exo- / Pfu exo+. Although comparatively few trials and optimiutions were carried out, no other combination tried was as effective as Klentaq-278/Pfu.
A very short heat step is preferred. I next attempted to amplify DNA in the size range 8.4 to 18 kb from lambda traasducing phage template. Our early cycling protocol employed a denaturation step of 1 or 2 minutes at 95° or 98° C, but no useful product in excess of 8.4 kb was obtained until the parameters of this heat step were reduced to 2 sec. or 20 sec. at 93° or 94° C. In an experiment with the denaturation step at 94° for 20, 60, or 180 sec, the 8.4 kb product exhibited decreasing yield with increased length of this heat step (data not shown).
Apparently, a component of the reaction is at its margin of theraiostability. Figure 7 shows that, using the short 2 sec.
denaturation step, target fragment was obtained for some reactions at all sizes in the range 8.4 to 18 kb, with very high product yields up to 15 kb if 30 PCR cycles were employed.
Figure 7 also shows sonic failed reactions which I cannot explain. The failure mode that gives rise to massive ethidium staining in the sample well (30-cycle lace 2) was particularly common, especially at high enryme levels.
Longer Primers. A change in primer length from 27 to 33 greatly reduced the frequency of failed reactions. Figure 10 demonstrates improved reliability for amplification of 12.5, 15 and 18 kb with the longer 33mer primers, under conditions of otherwise optimally high enryme levels in which the 27mer primers failed to give rise to desirable target product. This result does not represent an extensive survey of primer length, and it has not yet been repeated with the improvements below. Therefore the optimum primer length for long PCR remains to be determined. Some of the amplifications analyzed in Figure 11 utilized 36mer primers from the very ends of ~. A 2-5 min.
preincubation at 68-72° (22) was nxessary to release the template DNA
from the phage particles and to fill in the sticky ends of lambda to complete the template homology with primers ~L36 and ~R36.
Rapid cycling. A change to thin-walled tubes, which have lower heat capacity and conduct heat more efficiently, further improved the reactions. Figure 11 shows a CHEF pulse-field agarose gel analysis of successful amplifications of DNA spans 6-26 kb in size. The target of 28 kb was not amplifisble in the Omnigene thermal cycler (data not shows), but did appear (Figure 12, lane 2) when the RoboCycler was employed.
Several models of thermal cycler have been employed, sad although not all have been optimized, some arc preferable to others for long PCR. As may be concluded from the advantage of thin-walled tubes noted above, success seems to be positively correlated with a high speed of temperature change made possible by the design of the thermal cycler.
The RoboCycler achieves rapid temperature change by moving tubes from block to block, sad observations with a thermistor temperature probe indicate that it rises the reactions to 93-95° for only 5 sec. under the denaturation conditions employed (30 sec. in the 99° block), before rapidly (within 30 sec) returning i ~ i ii n i m the reaction to 68 ° .
higher pH. The current record 35 kb (Figure 12, lane 3) was only amplifiable if the pH was increased. A preliminary scan of higher pH was carried out (data not shown), and this resulted in the appearance of the 35 kb band at pH 8.8 to 9.2, with the optimum at 9.1 as described in Methods (above). Further improvement to a high yield of the 35 kb product was achieved by lengthening the extension time to 24 min. Other than the higher pH, the long PCR procedure has not yet realized any pot~tial benefits from changes in buffer conditions from those optimized for 8.4 kb.
For Targets over 20 kbs extension times exceeding 20 min, are preferred and the extension temperature is preferably below 69° C.
, Identity of long PCR products. It can be seen in Figures 7, 10 and 11 that the mobilities of the successful large DNA products agree with those predicted in Table 1 from the known map positions of the primers used.
HindI>Z restriction enzyme digestion of the unpurified 28 and 35 kb products (Figure 12, lanes 6 and 7) resulted in the expected left arm of lambda (23 kb) and 2.3 kb band from both, and the predictable bands terminated by the right PCR primer. 447 by (barely visible) from the 28 kb product and 7331 by from the 35 kb product.
Exonuclease mutant. The available mutant of Pfu DNA polymerise (8) which is defective in the 3'-exonuclease activity was t. Figure 13 shows that the 3'-exo' mutant of Pfu DNA polymerise fails to promote efficient amplification of a long DNA target.
This supports our hypothesis that the 3'-exonuclease activity is important for the efficiency of PCR amplification in this size range.
Ftdehty test. Since the biological purpose of 3'-exonuclease is to edit base pair mismatches for high replication fidelity, we tested the fidelity of the PCR
product using an assay involving the amplification and molecular cloning of an entire lacZ (/3-galactosidase) gene flanked by two selectable markers (10). Heretofore the highest reported fidelity of PCR
amplification is that catalyzed by Pfu DNA polymerise (2). Table 2 shows that the fidelity of the product amplified by the 640:1 mixture of Klentaq-278 and Pfu DNA polymerise at least matches that obtained for Pfu DNA
polymerise, alone, when each are used for 16 cycles of PCR. Our desigaatior of the enryme mixture as Klentaq-LA (KleaTaq Long and Accurate) reflects this high fidelity performance.

PCT/L'S94l01867 Table 2. Non-silent mutations introduced into the IacZ gene by 16 cycles of PCR (10).
LacZ+ LacZ- 96 EffectiveErrors Fold Improve-Earyme Blue Ligbt Blue mutant cycle per meat over no. lOs or White (c) by (b) full-length Taq KTLA-64 571 34 5.6 12 1.05 12.7 Pfu 528 37 6.5 8 1.9 6.9 Klentaq5' 442 85 16.1 8 S.I 2.6 Kleataql3225 985 26.4 8 9.0 1.5 Amplitaq 525 301 36.4 8 13.4 1.0 (a) Klentaqs is the N-texatinal deletion of Taq DNA polymerise described in ref. 10. (b) Equation 1 of reference 10 was rearranged to be as follows to solve for errors per bp: X = -(ln(2F"'~" - 1 ) )/1000, where X is the errors per by incorporated, 1000 is the effective target size in the lacZ gene (10), F is the fractiori of blue colonies, and m is the effective cycle number. (c) As in ref. 10, the effective cycle number was estimated at less than the machine cycles to reflect the actual efficiency of the reaction, yet higher than the minimum calculated from the fold-amplification. Strand loss due to incomplete synthesis of pr : uct strands is a probable cause of lower than ideal amplification efficiency. Therefore successful (not lost) product molecules are judged to have undergone more than the calculated minimum number of replications. KTLA-64 (Klentaq-278:Pfu::64:1 by volume) was assigned a higher effective cycle number since its reactions started with 10 times less DNA (1.5 ng vs. 15 ng plasmid pW8305) to result in comparable levels of product.
DISCUSSION
The previous length limitation for PCR amplification is postulated to have been caused by low efficiency of extension at the sites of incorporation of mismatched base pairs. Although it would have seemed that the cure for these mismatches would be to employ enzymes with 3'-(editing)-exonucleases, I believe that when Pfu and Vent DNA polymerise are used to catalyze our amplifications on their own, their failure is due to degradation of the PCR primers by their 3'-exonucleases, especially during the required long synthesis times and at optimally high DNA polymerise levels. 8vidently, low levels of 3'-exonuclease are sufficient and optimal for removal of the mismatches to allow the Klentaq-278 and amplification to proceed. It has been demonstrated that the optimally low level of 3'-exonuclease can be set i ~ i i n i m WO 94/26766 PC'TlUS94101867 effectively, conveniently, and flexibly by mixing and dilution.
Preferably the ratio of exo-/exo+ enzyme is high. If equal levels of the two types of enzymes are used (or where the E2 component is in excess), or if the ratio of exo-/exo+ is 4 or less, the effectiveness of the long PCR, even under optimal cycling conditions discussed below, is non-existent or much reduced.
It is preferred, and for certain applications, important that the length and temperature of the heat denaturation step of the PCR be kept to a minimum. Further, the improvement obtained by increasing the pH slightly may correspond to a decrease in template depurination. If so, further improvements may result if depurination can be reduced, or if a majority DNA polymerase component can be found which is able to bypass depurination sites.
The short denaturation time found to be optimal, preferably less than 2~ sec., and most preferably, 5 sec. or less in the reaction itself at 95°, is surprisingly effective for the amplification of 35 kb, whereas it might have been expected that longer PCR targets would need longer denaturation time to become completely denatured. If complete denaturation is required for PCR, and if longer DNA requires more time to unwind at 95°, the required unwinding time may eventually become significantly more than 5 seconds. This could limit the size of amplifiable product because of the increased depurination caused by longer denaturation times.
These amplifications were successful with several different target sequences, with several primer combinations, and with product sizes up to neaz3y twice the maximum size of inserts cloned into t.
whole viruses and plasmids up to 35 kb in length should now be amplifiable with this system. Should this method prove applicable to DNA of higher complexity than ~l, it could prove a boon to genomic mapping and sequencing applications, since in vitro amplification is convenient and avoids the DNA rearrangement and gene toxicity pitfalls of in vivo cloning.
In view of the above, it will be seen that the several objects of the invention are achieved and other advantageous results attained.
As various changes could be made in the above methods and products without departing from the scope of the invention, it is intended that all matter contained in the above description shall be interpreted as illustrative and not in a limiting sense.

WO 94/26766 PCTlZ,TS94/01867 Referen 1. Saiki, R.K., Gelfand, D.H., Stoffel, S., Scharf, S.J., Higuchi, R., Horn, G.T., Mullis, K.B., and Erlich, H.A.
(1988) i nce 239, 487-491.

2. Lundberg, K.S., Shoemaker, D.D., Adams, M.W.W., Short, J.M.
Sorge , 5 J.A., and Mathur, E.J.
(1991) Gene 108, 1-6.

3. Lawyer, F.C., Stoffel, S., Saiki, R.K., Chang, S-Y., Landre, P.A., Abramson, R.D., and Gelfand, D.H.
(1993) PCR
Methods and ADOlications 2, 275-287.

4. Jeffreys, A.J., Wilson, V., Neumann, R., and Keyte, J. (1988) 10 Nuc leic Acids Res. 16. 10953-10971.

5. Krishnan, B.R., Kersulyte, D., Brikun, I., Berg, C.M. & Berg, D.E.

(1991) Nucleic Acids Res.
19.
6177-6182.

6. Maga, E.A., & Richardson, T. (1991) BioTechnicues 11: 185-186.

7. Ohler, L.D. ~ Rose, E. A. (1992) PCR Methods and Aa~lications 2, 51-.

e. Rychlik, W., Spencer, W.J., and Rhoads, R.E. (1990) Nucleic Acids Res.
18:
6409.

9. Kainz, P. Schmiedlechner, A., ~ Strack, H.B. (1992) Analytical Biochem.
202.
46-49.

20 10. Barnes, W.M. (1992) Gene 112, 29-35.

11. Chu, G.D., Vollrath, D. and Davis, R.W. (1986) Science 234, 1582-.

12. Ippen, K., Shapiro, J.A., and Beckwith, J.R. (1971) J.Bact.
108, 5-9.

13. Kohara, Y. (1990) pp 2942 in The Bacterial Chromosome, eds Drlica , 25 K. ~ Riley, M., : M Washington D.C.

14. Tailor, R., Tippett, J., Gibb, G., Pells, S., Pike, D., Jordan, L., Ely, S.
(1992) Mol.
Microbiol.
6, 1211-1217.

15. Dubois, N.R. Reardon, R.C., Kolodny-Hirsh, D.M. J.Econ.Entomol.

81, 1672 (1988)],18.

30 16. Clark, J.M. (1988) Nucleic Acids Res. 16, 9677-.

17. Brewer, A.C., Marsh, P.J and Patient, R.K. (1990) Nucleic Acids Res . 18, 5574.

18. Lindahl, T. (1993) N ur 362: 709-715.

19. Lindahl, T. & Nyberg, B. (1972) Biochemistry 11: 3611-3618.

35 20. Sigma Chemical Co. Technical Bulletin No. 106B.
21. Shpakovski, G.V., Akhrem, A.A., and Berlin, Y.A. (1988) Nucleic Acids Res 16, 10199 (1988).

i ~ i i' ii i WO 94I2b766 PCTIUS94101867 Table of Contents of Sequence Listing SEQ IDNO:1: PCR primer KT1.

SEQ IDN0:2: N-terminus of Klentaq-278.

SEQ IDN0:3: PCR primer Klentaq32.

S SEQ IDN0:4: C-terminus of Klentaq-278 and Taq DNA
polymerase.

SEQ IDN0:5: pW8254b plasmid expression vector.

SEQ IDN0:6: Amino acid sequence of Klentaq-278, complete.

SEQ IDN0:7: PCR primer ILL on left side of lambda EI~L4 inserts.

SEQ IDN0:8: PCR primer ~R on right side of lambda ~L4 inserts .
SEQ IDN0:9: PCR primer ILL-1.7, 1729 by to left of 1~L.

SEQ IDN0:10:PCR primer MSA19, at C-terminus of lacZ.

SEQ IDNO:11:PCR primer Lc5 SEQ IDN0:12:PCR primer Lc3 SEQ IDN0:13:PCR primer KT2 SEQ IDN0:14:Taq DNA polymerase gene, KT1 end SEQ IDN0:15:Taq DNA polymerase gene, 3' end SEQ IDN0:16:Tfl DNA polymerase gene, KT1 end SEQ IDN0:17:Tfl DNA polymerase gene, 3' end SEQ IDN0:18:PCR primer BtV3 SEQ IDN0:19:PCR primer BtVS

SEQ IDN0:20:PCR primer ~1L36 SEQ IDN0:21:PCR primer lacZ'S33 SE IDN0:22:Q primer lacZ333 PCR

SEQ IDN0:23:PCR primer lacZ536 SEQ IDN0:24:PCR primer 1~L002 SEQ IDN0:25:PCR primer I~L101 SEQ IDN0:26:PCR primer I~R001 SEQ IDN0:27:PCR primer I~R202 SEQ IDN0:28:PCR primer MSA1933 SEQ IDN0:29:PCR primer LR36 SEQ IDN0:30:Phi 29 fragment 1, Region III

SEQ IDN0:31:Pfu fragment 1, Region III

SEQ IDN0:32:Phi 29 fragment 2, Region I

SEQ IDN0:33:Pfu fragement 2, Region I

wo 9ans~ss Pc~r~s9s;ois67 SBQDBNCE LISTING
(1) GENERAL INFORMATION:
(i) APPLICANT: Barnes Ph.D., Wayne M
(ii) TITLE OF INVENTION: DNA polymerases with enhanced thermostability and enhanced length and efficiency of primer extension '~.ii) NUMSER OF SEQUENCES: 33 (iv) CORRESPONDENCE ADDRESS:
(A) ADDRESSEE: Senniger, Powers, Leavitt & Roedel (B) STREET: One Metropolitan Square (C) CITY: St. Louie (D) STATE: Missouri (E) COUNTRY: USA
(F) ZIP: 63102 (v) COMPUTER READABLE FORM:
(A) MEDIUM TYPE: Floppy disk (B) COMPUTER: IBM PC compatible IC) OPERATING SYSTEM: PC-DOS/MS-DOS
(D) SOFTWARE: Patentln Release #1.0, Version #1.25 (vi) CURRENT APPLICATION DATA:
(A) APPLICATION NUMBER:
(B) FILING DATE: 22-FEB-1994 (C) CLASSIFICATION:
(viii) ATTORNEY/AGENT INFORMATION:
(A) NAME: Blosser, G.Harley (B) REGISTRATION NUMBER: 33,650 (C) REFERENCE/DOCKET NUMBER: WN84903 (ix) TELECOMMUNI~ ION INFORMATION:
(A) TELEPHONE: (314) 231-5400 (B) TELEFAX: (314) 231-4342 (C) TELEX: 6502697583 MCI
(2) INFORMATION FOR SEQ ID NO: l:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 36 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) (iii) HYPOTHETICAL: NO
(iv) ANTI-SENSE: NO
(v) FRAGMENT TYPE: N-terminal (vi) ORIGINAL SOURCE:
(A) ORGAN:SM: Thermos aquaticus (B) STRAIN: YTl (vii) IMMEDIATE SOURCE:
(A) LIBRARY: synthetic (B) CLONE: KT1 i ~ i i ~~ i i ~~ m WO 94l2676G PC'T/US94101867 (ix) FEATURE:
(A) NAME /KEY : CDS
(B) LOCATION: 6..35 (xi) SEQUENCE DESCRIPTION: SEQ ID NO:1:
GAGCC ATG GGC CTC C'TC CAC GAG TTC GGC CTT CTG G 36 Met Gly Leu Leu His Glu Phe Gly Leu Leu (2) INFORMATION FOR SEQ ID N0:2:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 10 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID N0:2:
Met Gly Leu Leu His Glu Phe Gly Leu Leu (2) INFORMATION FOR SEQ ID N0:3:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 35 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) (iii) HYPOTHETICAL: NO
(iv) ANTI-SENSE: YES
(v) FRAGMENT TYPE: C-terminal (vi) ORIGINAL SOURCE:
(A) ORGANISM: Thermus aquaticus (B) STRAIN: YT1 (vii) IMMEDIATE SOURCE:
(A) LIBRARY: synthetic (B) CLONE: Klentaq32 (ix) FEATURE:
(A) NAMfi/KEY: CDS
(B) LOCATION: complement (8..34) (xi) SEQUENCE DESCRIPTION: SEQ ID N0:3:

(2) INFORMATION FOR SEQ ID N0:4:
(i) SEQDENCE CHARACTERISTICS:
(A) LENGTH: 9 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID N0:4:
Asp Txp Leu Ser Ala Lys Glu (2) INFORMATION FOR SEQ ID N0:5:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 6714 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: circular (ii) MOLECULE TYPE: DNA (genomic) (iii) HYPOTHETICAL: NO
(iv) ANTI-SENSE: NO
(vi) ORIGINAL SOURCE:
(A) ORGANISM: Expression vector (vii) IMMEDIATE SOURCE:
(B) CLONE: pW8254b (ix) FEATURE:
(A) NAME/KEY: CDS
(B) LOCATION: 1..1665 (xi)SEQUENCE ID
DESCRIPTION: N0:5:
SEQ

TTC

MetGlyLeu LeuHisGly~ Gly Leu.LeuGlu SerProLys AlaLeu Phe CCG

GluGluAla ProTzpPro Pro GluGlyAla PheValGly PheVal Pro ATG

LeuSerArg LysGluPro Txp AlaAspLeu LeuAlaLeu AlaAla Met CAC

AlaArgGly GlyArgVal Arg AlaProGlu ProTyrLys AlaLeu His CGG

ArgAspLeu LysGluAla Gly LeuLeuAla LysAspLeu SerVal Arg CTT

LeuAlaLeu ArgGluGly Gly LeuProPro GlyAspAsp ProMet Leu GAC

LeuLeuAla TyrLeuLeu Pro SerAsnThr ThrProGlu GlyVal Asp GAG

AlaArgArg TyrGlyGly Trp ThrGluGlu AlaGlyGlu ArgAla Glu I 1 I II II I I n WO 94126766 PCTlUS94101867 TCC AGG AGG

AlaLeuSerGlu ArgLeu PheAlaAsn LeuTrpGly ArgLeuGlu Gly GluGluArgLeu LeuTrp LeuTyrArg GluValGlu ArgProLeu Ser AlaValLeuAla HisMet GluAlaThr GlyValArg LeuAspVal Ala TyrLeuArgAla LeuSer LeuGluVal AlaGluGlu IleAlaArg Leu GluAlaGluVal PheArg LeuAlaGly HisProPhe AsnLeuAsn Ser CGGGACCAGCTG GAAAGG GTCCTCTTT GACGAGCTA GGGCT'TCCC GCC 672 ArgAspGlnLeu GluArg ValLeuPhe AspGluLeu GlyLeuPro Ala ZleGlyLysThr GluLys ThrGlyLys ArgSerThr SerAlaAla Val LeuGluAlaLeu ArgGlu AlaHisPro IleValGlu LysIleLeu Gln TyrArgGluLeu ThrLys LeuLysSer ThrTyrIle AspProLeu Pro GACCTCATCCAC CCCA,GGACGGGCCGC CTCCACACC CGCTTCAAC CAG 864 AspLeuIleHis Pro1~g ThrGlyArg LeuHisThr ArgPheAsn Gln ThrAlaThrAla ThrGly ArgLeuSer SerSerAsp PzoAsnLeu Gln AsnIleProVal ArgThr ProLeuGly GlnArgIle ArgArgAla Phe IleAlaGluGlu GlyTrp LeuLeuVal AlaLeuAsp TyrSerGln Ile GluLeuArgVal LeuAla HisLeuSer GlyAsp(:luAsnLeuIle Arg Val Phe Gln Glu Gly Arg Asp Ile His Thr Glu Thr Ala Ser Trp Met Phe Gly Val Pro Arg Glu Ala Val Asp Pro Leu Met Arg Arg Ala Ala Lys Thr Ile Asn Phe Gly Val Leu Tyr Gly Met Ser Ala His Arg Leu WO 94/26766 PCTlUS94101867 CCT TAC GAG

Ser Gln Glu Leu Ala Zle Glu Glu Ala Gln Ala Phe Ile Pro Tyr Glu CCC AAG ACC

Arg Tyr Phe Gln Ser Phe Val Arg Ala Trp Ile Glu Lys Pro Lys Thr CGG GGG CGC

Leu Glu Glu Gly Arg Arg Tyr Val Glu Thr Leu Phe Gly Arg Gly Arg CTA GAG GAG

Arg Arg Tyr Val Pro Asp Ala Arg Val Lys Ser Val Arg Leu Glu Glu TTC AAC GCC

Ala Ala Glu Arg Met Ala Met Pro Val Gln Gly Thr Ala Phe Asn Ala ATG GTG GAA

Asp Leu Met Lys Leu Ala Lys Leu Phe Pro Arg Leu Glu Met Val Glu CTT CAG GAG

Met Gly Ala Arg Met Leu Val His Asp Glu Leu Val Leu Leu Gln Glu GAG GCC GTC

Ala Pro Lys Glu Arg Ala Val Ala Arg Leu Ala Lys Glu Glu Ala Val CTG GCC GGG

Met Glu Gly Val Tyr Pro Val Pro Leu Glu Val Glu Val Leu Ala Gly TCC GCC

Ile Gly Glu Asp Trp Lei Lys Glu Ser Ala GGAAGAGTAT GAGTATTCAA CATTTCCGTGTCGCCCTTAT TCCC'ITITrT GCGGCATTTT2462 I 1 I I I I I I I n ATCTCAACAG
CGGTAAGATC

TTCGCCCCGAAGAACGTTTTCCAATGATGAGCACTTrTAA AGTTCTGCTATGTGGCGCGG2642 CAACGATCGGAGGACCGAAGGAGCTAACCGCTTI'ITTGCA CAACATGGGGGATCATGTAA2882 CTCGc:CTTGATCGTTGGGAACCGGAGCTGAATGAAGCCAT ACCAAACGACGAGCGTGACA2942 CTC".-_;,CTTCCCGGCAACAATTAATAGACTGGATGGAGGC GGATAAAGTTGCAGGACCAC3062 TTA'.:~ACACGACC,GGGAGTCAGGCAACTATGGATGAACG AAATAGACAGATCGCTGAGA3242 AGATTGATTTAAAACTTCATTTTTAATTTAAAAGGATCTA GGTGAAGATCCTITI'rGATA3362 ATC"'~_ATGACCAAAATCCCTTAACGTGAGTTTTCGTTCCA CTGAGCGTCAGACCCCGTAG3422 AA:. '.TCAAAGGATCTTCTTGAGATCCTTTTTTTCTGCG CGTAATCTGCTGCTTGCAAA3482 CAG~AGAGCGCACG~AGGGAGCTTCCAGGGGGAAACGCCTG GTATCTITATAGTCCTGTCG3962 WO 94126766 PCT/LTS94l01867 TTCTCCGTGG

i ~ i ii ii ~ m (2) IN"'ORMATION FOR SEQ ID N0:6:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 554 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID N0:6:
Met Gly Leu Leu His Glu Phe Gly Leu Leu Glu Ser Pro Lys Ala Leu Glu Glu Ala Pro Txp Pro Pro Pro Glu Gly Ala Phe Val Gly Phe Val Leu Ser Arg Lys Glu Pro Met Tzp Ala Asp Leu Leu Ala Leu Ala Ala Ala Arg Gly Gly Arg Val His Arg Ala Pro Glu Pro Tyr Lys Ala Leu Arg Asp Leu Lys Glu Ala Arg Gly Leu Leu Ala Lys Asp Leu Ser Val Leu Ala Leu Arg Glu Gly Leu Gly Leu Pro Pro Gly Asp Asp Pro Met Leu Leu Ala Tyr Leu Leu Asp Pro Ser Asn Thr Thr Pro Glu Gly Val Ala Arg Arg Tyr Gly G1~ Glu Tzp Thr Glu Glu Ala Gly Glu Arg Ala Ala Leu Ser Glu Arg Leu Phe Ala Asn Leu Trp Gly Arg Leu Glu Gly Glu Glu Arg Leu Leu Tip Leu Tyr Arg Glu Val Glu Arg Pro Leu Ser Ala Val Leu Ala His Met Glu Ala Thr Gly Val Arg Leu Asp Val Ala Tyr Leu Arg Ala Leu Ser Leu Glu Val Ala Glu Glu Ile Ala Arg Leu Glu Ala Glu Val Phe Arg Leu Ala Gly His Pro Phe Asn Leu Asn Ser Arg Asp Gln Leu Glu Arg Val Leu Phe Asp Glu Leu Gly Leu Pro Ala _ Ile Gly Lys Thr Glu Lys Thr Gly Lys Arg Ser Thr Ser Ala Ala Val 225 230 235 240 ' Leu Glu Ala Leu Arg Glu Ala His Pro Ile Val Glu Lys Ile Leu Gln Tyr Arg Glu Leu Thr Lys Leu Lys Ser Thr Tyr Ile Asp Pro Leu Pro Asp Leu Ile His Pro Arg Thr Gly Arg Leu His Thr Arg Phe Asn Gln Thr Ala Thr Ala Thr Gly Arg Leu Ser Ser Ser Aep Pro Asn Leu Gln Asn Ile Pro Val Arg Thr Pro Leu Gly Gln Arg Ile Arg Arg Ala Phe Ile Ala Glu Glu Gly Trp Leu Leu Val Ala Leu Asp Tyr Ser Gln Ile Glu Leu Arg Val Leu Ala His Leu Ser Gly Asp Glu Asn Leu Ile Arg Val Phe Gln Glu Gly Arg Asp Ile His Thr Glu Thr Ala Ser Trp Met Phe Gly Val Pro Arg Glu Ala Val Asp Pro Leu Met Arg Arg Ala Ala Lys Thr Ile Asn Phe Gly Val Leu Tyr Gly Met Ser Ala His Arg Leu Ser Gln Glu Leu Ala Ile Pro Tyr Glu Glu Ala Gln Ala Phe Ile Glu Arg Tyr Phe Gln Ser Phe Pro Lys Val Arg Ala Trp Ile Glu Lys Thr Leu Glu Glu Gly Arg Arg Arg Gly Tyr Val Glu Thr Leu Phe Gly Arg Arg Arg Tyr val Pro Asp Leu Glu Ala Arg Val Lys Ser Val Arg Glu Ala Ala Glu Arg Met Ala Phe Asn Met Pro Val Gln Gly Thr Ala Ala 4 65 4'7A 475 480 Asp Leu Met Lys Leu Ala Met Val Lys Leu Phe Pro Arg Leu Glu Glu Met Gly Ala Arg Met Leu Leu Gln Val His Asp Glu Leu Val Leu Glu Ala Pro Lys Glu Arg Ala Glu Ala Val Ala Arg Leu Ala Lys Glu Val Met Glu Gly Val Tyr Pro Leu Ala Val Pro Leu Glu Val Glu Val Gly Ile Gly Glu Asp Trp Leu Ser Ala Lys Glu (2) INFORMATION FOR SEQ ID N0:7:
(i) SEQQENCE CHARACTERISTICS:
(A) LENGTH: 27 base pairs (B) TYPE: nucleic acid (C) STR.ANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) (vi) ORIGINAL SOORCE:
(A) ORGANISM: bacteriophage lambda i ~ i ii n i m ~~ i WO 94126766 PCTlUS94101867 (B) STRAIN: Papa (vii) IMMEDIATE SOURCE:
(B) CLONE: MBL
(viii) POSITION IN GENOME:
(B) MAP POSITION: 27940 (xi) SEQUENCE DESCRIPTION: SEQ ID N0:7:
GCTTaTCTGC TTCTCATAGA GTCTTGC 27 (2) INFORMATION FOR SEQ ID N0:8:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 27 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) (vi) ORIGINAL SOURCE:
(A) ORGANISM: bacteriphage lambda (B) STRAIN: Papa (vii) IMMEDIATE SOURCE:
(B) CLONE: MBR
(xi) SEQUENCE DESCRIPTION: SEQ ID N0:8:

(2) INFORMATION FOR SEQ ID N0:9:
(i) SEQUENCE CH1~ACTERISTICS:
(A) LENGTH: 27 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) (vi) ORIGINAL SOURCE:
(A) ORGANISM: bacteriophage lambda (vii) IMMEDIATE SOURCE:
(B) CLONE: MBL-1.7 (xi) SEQUENCE DESCRIPTION: SEQ ID N0:9:

(2) INFORMATION FOR SEQ ID NO:10:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 28 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) (v) FRAGMENT TYPE: C-terminal WO 94126766 PCTlUS94101867 (vi) ORIGINAL SOURCE:
(A) ORGANISM: E.coli (B) STRAIN: K12 (vii) IMMEDIATE SOURCE:
(B) CLONE: MSA19 (viii) POSITION IN GENOME:
(B) MAP POSITION: lacZ
'xi) SEQUENCE DESCRIPTION: SEQ ID NO:10:
GGAAGCTTAT TTTTGACACC AGACCAAC 2g (2) INFORMATION FOR SEQ ID NO:11:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 37 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: cDNA to mRNA
(v) FRAGMENT TYPE: N-terminal (vi,) ORIGINAL SOURCE:
(A) ORGANISM: Zea maize (vii) IMMEDIATE SOURCE:
(B) CLONE: Lc5 (viii) POSITION IN GENOME:
(B) MAP POSITION: 5' end of color control gene Lc (xi) SEQUENCE DESCitIPTION: SEQ ID NO:11:
GTGATGGATC CTTCAGCTTC CCGAGTTCAG CAGGCGG 3~
(2) INFORMATION FOR SEQ ID N0:12:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 37 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: cDNA to mRNA
(iv) ANTI-SENSE: YES
(v) FRAGMENT TYPE: C-terminal (vi) ORIGINAL SOURCE:
(A) ORGANISM: Zea maize (vii) IMMEDIATE SOURCE:
(B) CLONE: Lc3 (vi i i ) POS ITION IN GENOME
(B) MTaP POSITION: 3' end of color control gene Lc (xi) SEQUENCE DESCRIPTION: SEQ ID N0:12:

ii ii i m GGTCTCGAGC GAAGCTTCCC TATAGCTTTG CGAAGAG 3~
(2) INFORMATION FOR SEQ ID N0:13:
(i) SEQUENCE CHARACTERISTICS: _ (A) LENGTH: 37 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear ( i i ) MOLfiCULfi TYPE : DNA ( genomi c ) (v) FRAGMENT TYPE : internal (vi) ORIGINAL SOURCE:
(A) ORGANISM: Thermus aquaticus (B) STRAIN: YT1 (vii) II~DIATE SOURCE:
(B) CLONE: KT2 (xi) SEQUENCE DESCRIPTION: SEQ ID N0:13:
GAGCCATGGC CAACCTGTGG GGGAGGCTTG AGGGGGA 3~
(2) INFORMATION FOR SEQ ID N0:14:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 36 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) (vi) ORIGINAL SOURCE:
(A) ORGANISM! Thetznus aquaticus (B) STRAIN: YT1 (vii ) I1~DIATfi SOURCE
(B) CLONE: Genbank Accession no. J04639 (viii) POSITION IN GENOME:
(A) CHROMOSOME/SEGMENT: DNA polymerase gene (B) MAP POSITION: 950 (xi) SEQUENCfi DESCRIPTION: SEQ ID N0:14:

(2) INFORMATION FOR SEQ ID N0:15:
(i) SEQUENCfi CHARACTERISTICS:
(A) LENGTH: 32 base pairs _ (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) (vi) ORIGINAL SOURCE:
(A) ORGANISM: Thermus aquaticus (B) STRAIN: YT1 (vii ) II~DIATE SOURCE

(B) CLONE: Genbank Accession No. J04639 (viii) POSITION IN GENOME:
(A) CHROMOSOME/SEGMENT: DNA polymerise gene (B) MAP POSITION: 2595 (xi) SEQUENCE DESCRIPTION: SEQ ID N0:15:

(2) TNFORMATION FOR SEQ ID N0:16:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 36 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) (vi) ORIGINAL SOURCE:
(A) ORGANISM: Thermus flavis (vii) IMMEDIATE SOURCE:
(B) CLONE: Genbank Accession No. X66105 (viii) POSITION IN GENOME:
(A) CHROMOSOME/SEGMENT: DNA polymerise (B) MAP POSITION: 1378 (xi) SEQUENCE DESCRIPTION: SEQ ID N0:16:

(2) INFORMATION FOR SEQ ID N0:17:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 35 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) (vi) ORIGINAL SOURCE:
(A) ORGANISM: Thermus flavis (vii) IMMEDIATE SOURCE:
(B) CLONE: Genbank Accession No. X66105 (viii) POSITION IN GENOME:
(A) CHROMOSOME/SEGMENT: DNA polymerise gene IB) MAP POSITION: 3023 (xi) SEQUENCE DESCRIPTION: SEQ ID N0:17:
GGACTGGCTC TCCGCCAA~GG AGTAGGGGGG TCCTG 35 (2) INFORMATION FOR SEQ ID N0:18:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 39 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) (iv) ANTI-SENSE: YES
(v) FRAGMENT TYPE : internal (vi) ORIGINAL SOURCE:
(A) ORGANISM: Bacillus thuri__~_giensis (B) STRAIN: CryV
(C) INDIVIDUAL ISOLATE: NRD12 (vii) I~DIATE SOURCE:
(B) CLONE: BtV3 (xi) SEQUENCE DESCRIPTION: SEQ ID N0:18:
GCCAAGCTTC TCGAGTTACG CTCAATATGG AGTTGCTTC 3 g (2) INFORMATION FOR SEQ ID N0:19:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 43 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) (iv) ANTI-SENSE: NO
(v) FRAGMENT TYPE : internal (vi) ORIGINAL SOURCE:
(A) ORGANISM: Bacillus thuringiensis (B) STRAIN: lIRDl2 (vii) II~DIATE SOURCE:
(B) CLONE: BtVS
(xi) SEQUENCE DESCRIPTION: SEQ ID N0:19:
CCGAGATCTC CATGGATCCA AAGAATCI~AG ATAAGCATCA AAG 43 (2) INFORMATION FOR SEQ ID N0:20:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 36 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) _ (vi) ORIGINAL SOURCE:
(A) ORGANISM: bacteriophage lambda (B) STRAIN: Papa (vii) IMMEDIATE SOURCE:
(B) CLONE: L36 (viii) POSITION IN GENOME:
(B) MAP POSITION: left end WO 94/26766 PCT/US94l01867 (xi) SEQUENCE DESCRIPTION: SEQ ID N0:20:

(2) INFORMATION FOR SEQ ID N0:21:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 33 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) (iv) ANTI-SENSE: YES
(v) FRAGMENT TYPE: N-terminal (vi) ORIGINAL SOURCE:
(A) ORGANISM: E.coli (B) STRAIN: K12 (vii) IMMEDIATE SOURCE:
(B) CLONE: lacZ'S33 (xi) SEQUENCE DESCRIPTION: SEQ ID N0:21:

(2) INFORMATION FOR SEQ ID N0:22:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 33 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE~ DNA (genoanic) (v) FRAGMENT TYPE: C-terminal (vi) ORIGINAL SOURCE:
(A) ORGANISM: E.coli (B) STRAIN: K12 (vii) IMMEDIATE SOURCE:
(B) CLONE: lacZ333 (viii) POSITION Il~ GENOME:
(B) MAP POSITION: lacZ
(xi) SEQUENCE DESCRIPTION: SEQ ID N0:22:

(2) INFORMATION FOR SEQ ID N0:23:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 36 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) i ~ i ii n i m (iv) ANTI-SENSE: NO
(v) FRAGMfiNT TYPE: N-terminal (vi) ORIGINAL SOURCE:
(A) ORGANISM: E.coli (B) STRAIN: K12 (vii) IMMEDIATE SOURCfi:
(B) CLONE: lacZ536 (v~ii) POSITION IN GENOME:
(B) MAP POSITION: lacZ
(xi) SEQUENCE DESCRIPTION: SEQ ID N0:23:

(2) INFORMATION FOR SEQ ID N0:24:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 33 base pairs (H) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) (vi) ORIGINAL SOURCE:
(A) ORGANISM: bacteriophage lambda (B) STRAIN: Papa (vii) IMMEDLATE SOURCE:
(B) CLONE: MBL002 (xi) SEQUENCE DESCitZPTION: SEQ ID N0:24:

(2) INFORMATION FOR SEQ ID N0:25:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 33 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (generic) (vi) ORIGINAL SOURCE:
(A) ORGANISM: bacteriophage lambda (B) STRAIN: Papa (vii) IMMEDIATE SOURCE: _ (B) CLONE: MBL101 (viii) POSITION IN GENOME:
(B) MAP POSITION: 27840 (xi) SEQUENCE DESCRIPTION: SEQ ID N0:25:

(2) INFORMATION FOR SEQ ID N0:26:

(i) SEQQENCE CHARACTERISTICS:
(A) LENGTH: 33 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) (vi) ORIGINAL SOURCE:
(A) ORGANISM: bacteriophage lambda (B) STRAIN: Papa vii) IMMEDIATE SOURCE:
(B) CLONE: MBR001 (viii) POSITION IN GENOME:
(B) MAP POSITION: 34576 (xi) SEQUENCE DESCRIPTION: SEQ ID N0:26:

(2) INFORMATION FOR SEQ ID N0:27:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 33 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear ( i i ) MOLECULE TYPE : DNA ( genomi c ) (vi) ORIGINAL SOURCE:
(A) ORGANISM: bacteriophage lambda (B) STRAIN: Papa (vii ) IMMEDIATE SOL3itCE
(B) CLONE: MBR202 (viii) POSITION IN GENOME:
(B) MAP POSITION: 34793 (xi) SEQUENCE DESCRIPTION: SEQ ID N0:27:

(2) INFORMATION FOR SEQ ID N0:28:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 33 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) (v) FRAGMENT TYPE: C-terminal (vi) ORIGINAL SOURCE:
(A) ORGANISM: E.coli (B) STRAIN: K12 ( vi i ) IMMEDIATE SOURCE
(B) CLONE: MSA1933 ~ ~ i ii ii i m '' (viii) POSITION IN GENOME:
(B) MAP POSITION: lacZ
(xi) SEQUENCE DESCRIPTION: SEQ ID N0:28: _ CCCGGTTATT ATTATZTI'TG ACACCAGACC AAC 3 3 (2) INFORMATION FOR SEQ ID N0:29:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 36 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) (vi) ORIGINAL SOURCE:
(A) ORGANISM: bacteriophage lambda (B) STRAIN: Papa (vii) II~DIATE SOURCE:
(B) CLONE: R36 (viii) POSITION IN GENOME:
(B) MiIP POSITION: right end (xi) SEQUENCE DESCRIPTION: SEQ ID N0:29:

(2) INFORMATION FOR SEQ ID N0:30:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 53 amino acids (B) TYPfi: amy~o acid (D) TOPOLOGY: linear (ii) MOLECULE TYPE: protein (v) FRAGMENT TYPE : internal (vi) ORIGINAL SOURCE:
(A) ORGANISM: phi 29 (viii) POSITION IN GENOME:
(A) CHROMOSOME/SEGMENT: DNA polymerase (B) MAP POSITION: ending at 435 (xi) SEQUENCE DESCRIPTION: SEQ ID N0:30:
Lys Leu Met Leu Asn Ser Leu Tyr Gly Lys Phe Ala Ser Asn Pro Asp Val Thr Gly Lys Val Pro Tyr Leu Lys Glu Asn Gly Ala Leu Gly Phe Arg Leu Gly Glu Glu Glu Thr Lys Asp Pro Val Tyr Thr Pro Met Gly Val Phe Ile Thr Ala (2) INFORMATION FOR SEQ ID N0:31:

WO 94126766 PCTlUS94101867 ( i ) SfiQUENCfi CFiARACTfiRISTICS
(A) LfiNGTH: 36 amino acids (B) TYPfi: amino acid (D) TOPOLOGY: linear (ii) MOLfiCULE TYPfi: protein (v) FRAGMENT TYPfi : internal (vi) ORIGINAL SOURCfi:
(A) ORGANISM: Pyrococcus furiosus ( vi i i ) POS ITION IN GENOME
(A) CHROMOSOMfi/SfiGMfiNT: DNA polymerise (8) M31P POSITION: ending at 516 (xi) SEQUENCE DESCRIPTION: SfiQ ID N0:31:
Asp Tyr Arg Gln Lys Ala Ile Lys Leu Leu Ala Asn Ser Phe Tyr Gly Tyr Tyr Gly Tyr Ala Lys Ala Arg Trp Tyr Cys Lys Glu Cys Ala Glu Ser Val Thr Ala (2) INFORMATION FOR SEQ ID N0:32:
(i) SfiQUENCE CHARACTERISTICS:
(A) LENGTH: 50 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) MOLECULE TYPfi: protein (v). FRAGMENT TYpH~ internal (vi) ORIGINAL SOURCE:
(A) ORGANISM: phi 29 (viii) POSITION IN GfiNOME:
(A) CHROMOSOMfi/SfiGMENT: DNA polymerise (B) MAP POSITION: ending at 485 (xi) SEQUENCE DESCRIPTION: SEQ ID N0:32:
Trp Ala Arg Tyr Thr Thr Ile Thr Ala Ala Gln Ala Cys Tyr Asp Arg Ile Ile Tyr Cys Asp Thr Asp Ser Ile His Leu Thr Gly Thr Glu Ile Pro Asp Val Ile Lys Asp Ile Val Asp Pro Lys Lys Leu Gly Tyr Trp Ala His (2) INFORMATION FOR SEQ ID N0:33:
(i) SfiQUENCfi CHARACTERISTICS:
(A) LENGTH: 60 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear 1 1 I I I I 1 I I II ', ..

WO 94/26766 PCTlUS94/01867 (ii) MOLECULE TYPE: protein (v) FRAGMENT TYPE : internal (vi) ORIGINAL SOURCE:
(A) ORGANISM: Pyrococcus furiosus (viii) POSITION IN GENOME:
(A) CHROMOSOME/SEGMENT: DNA polymerase (B) MAP POSITION: ending at 576 (xi)SEQUENCE DESCRIPTION:
SEQ ID N0:33:

TrpGly Arg Lys Ile Leu Trp GluLeu Glu Glu Tyr Glu Val Lys Lys PheGly Phe Lys Leu Ile Thr GlyLeu Tyr Ala Val Tyr Asp Asp Thr IlePro Gly Gly Ser Glu Lys LysAla Leu Glu Glu Glu Ile Lys Phe ValLys Tyr Ile Ser Leu Gly Leu Asn Lys Pro Leu TAQuence°
Version 2.0 Taq DNA Polymerase Sequencing System Step-By-Step Protocols f=or DNA Sequencing With TAQuence~ Version 2.0 t st EdBio~
USB~

Revision: 3/419 t i ~ i ii n i m OTaq..
Cycle-Sequencing Kit Cycle Sequencingt System Featuring ~ Taq' Version 2.0 DNA Polymerase and the Cycled Labeling Step Protocol Step-By-Step Protocols For Cycle Sequencing ~.

lJnited States Biochemical

Claims (20)

CLAIMS:

1. A formulation of thermostable DNA polymerase comprising a thermostable DNA polymerase lacking 3'-5' exonuclease activity and a thermostable DNA polymerase exhibiting 3'-5' exonuclease activity, wherein the ratio of DNA polymerase units of the thermostable DNA
polymerase lacking 3'-5' exonuclease activity to the thermostable DNA polymerase exhibiting 3'-5' exonuclease activity is greater than one to one.

2. A formulation of thermostable DNA polymerase as claimed in claim 1 wherein the thermostable DNA
polymerase lacking 3'-5' exonuclease activity is Klentaq-278.

3. A formulation of thermostable DNA polymerase as claimed in claim 2 wherein the thermostable DNA
polymerase exhibiting 3'-5' exonuclease activity is selected from the group consisting of Pfu DNA polymerase from Pyrococcus furiosus, the Tli DNA polymerase from Thermococcus litoralis, or a variant of the Pfu DNA
polymerase or the Tli DNA polymerase wherein the DNA
polymerase activity of said DNA polymerase has been diminished or inactivated.

4. A formulation of thermostable DNA polymerases comprising at least one thermostable DNA polymerase lacking 3'-5' exonuclease activity and at least one thermostable DNA polymerase exhibiting 3'-5' exonuclease activity wherein the ratio of the amounts of the thermostable DNA polymerase lacking 3'-5' exonuclease to the thermostable DNA polymerase exhibiting 3'-5' exonuclease activity is greater than 1:1 by DNA polymerase units or greater than 1:1 by protein weight.

5. A kit for the synthesis of a polynucleotide, said kit comprising a first thermostable DNA polymerase, wherein said first polymerase possesses 3'-5' exonuclease activity; a second thermostable DNA polymerase, wherein said second polymerase lacks 3'-5' exonuclease activity; and instructions for using said polymerases at a ratio of said second polymerase to said first polymerase of greater than one to one.

6. A kit for the synthesis of a polynucleotide, said kit comprising:
(a) a first DNA polymerase, wherein said first polymerase possesses 3'-5' exonuclease activity selected from the group consisting of Pyrococcus furiosus DNA polymerase, Thermotoga maritima DNA polymerase, Thermococcus litoralis DNA
polymerase, and Pyrococcus GB-D DNA polymerase;
(b) a second DNA polymerase, wherein said second polymerase lacks 3'-5' exonuclease activity selected fron the group consisting of Thermus aquaticus DNA polymerase, (exo-) Thermococcus literalis DNA polymerase, (exo-) Pyrococcus furiosus DNA polymerase, and (exo-) Pyrococcus GB-D DNA
polymerase; and (c) instructions for using said polymerases at a ratio of said second polymerase to said first polymerase of greater than one to one.

7. A method of amplifying a polynucleotide sequence, said method comprising: the steps of mixing a composition with a synthesis primer, and a synthesis template, said composition comprising:

(a) a minority thermostable DNA polymerase possessing 3'-5' exonuclease activity selected from the group consisting of Pyrococcus furiosus DNA polymerase, Thermotoga maritima DNA polymerase, Thermococcus litoralis DNA polymerase, and Pyrococcus GB-D DNA
polymerase, and (b) a majority thermostable DNA polymerase, wherein said polymerase lacks 3'-5' exonuclease activity selected from the group consisting of Thermus aquaticus DNA
polymerase, (exo-) Thermococcus litoralis DNA polymerase, (exo-) Pyrococcus furiosus DNA polymerase, and (exo-) Pyrococcus GB-D DNA polymerase.

8. A method according to claim 7, wherein said first DNA polymerse is Pyrococcus furiosus DNA polymerase.

9. A method according to claim 7, wherein said second DNA polymerase is Thermus aquaticus DNA polymerase.

10. A method according to claim 8, wherein said second DNA polymerase is Thermus aquaticus DNA polymerase.

11. A kit according to claim 6, wherein said first DNA
polymerase is Pyrococcus furiosus DNA polymerase.

12. A kit according to claim 6, wherein said second DNA
polymerase is Thermus aquaticus DNA polymerase.

13. A kit according to claim 11, wherein said second DNA
polymerase is Thermus aquaticus DNA polymerase.

14. A kit according to claim 6, said kit further comprising DNA primers.

15. A kit according to claim 13, said kit further comprising DNA primers.

16. A formulation comprising E1 wherein E1 is a reverse transcriptase which lacks any significant 3'-5' exonuclease activity, and E2 wherein E2 is a DNA
polymerase which exhibits significant 3'-5' exonuclease activity, and wherein the ratio of the amounts of E1 to E2 is greater than 1 to 1 by polymerase units or by weight.

17. The formulation as claimed in claim 16 wherein the ratio is at least about 4 to 1 by polymerase units or by weight.

18. The formulation as claimed in claim 16 or 17 wherein E2 is selected from the group consisting of DNA
polymerase encoded by the genes from Pyrococcus furiosus, Thermococcus literalis, Thermococcus species GB-D, T7 coliphage, Thermotoga maritima, or a combination thereof.

19. A formulation comprising E1 wherein E1 is a mutant or chemical modification of T7 or T3 DNA polymerase which lacks any significant 3'-5' exonuclease activity, and E2 wherein E2 is a wild-type T7 or T3 DNA polymerase, and wherein the ratio of the amounts of E1 to E2 is greater than 1 to 1 by polymerase units or by weight.

20. The formulation as claimed in claim 19 wherein the ratio of the amounts of E1 to E2 is at least about 4 to 1 by polymerase units or by weight.