CA2264481A1 - Materials and methods for increasing corn seed weight - Google Patents

Abstract

The subject invention pertains to novel variants of the maize gene, Shrunken2(Sh2) and a method of using that gene. The variant gene, Sh2-m1Rev6, encodes a subunit of the ADP-glucose pyrophosphorylase (AGP) enzyme that has additional amino acids inserted in or near the allosteric binding site of the protein. Corn seed expressing the Sh2-m1Rev6 gene has a 15 % weight increase over wild type seed. The increase in seed weight is not associated simply with an increase in percentage starch content of the seed.

Description

CA 02264481 1999-03-03W0 93/10032 PCT/US96/142441DESCRIPTIONMATERIALS AND METHODS FORINCREASING CORN SEED WEIGHT5202530This invention was made with government support under National Science Foundation grantnumber 93052818. The government has certain rights in this invention.Cross-Reference to a Related ApplicationThis application is a continuation-in-part of co-pending application Serial No. 08/299,675,filed September 1, 1994.Backgound of the InventionADP-glucose pyrophosphorylase (AGP) catalyzes the conversion of ATP and oc-glucose-1-phosphate to ADP-glucose and pyrophosphate. ADP-glucose is used as a glycosyl donor in starchbiosynthesis by plants and in glycogen biosynthesis by bacteria. The importance of ADP-glucosepyrophosphorylase as a key enzyme in the regulation of starch biosynthesis was noted in the studyof starch deficient mutants of maize (Zea mays) endosperm (Tsai and Nelson, 1966; Dickinson andPreiss, 1969). AGP enzymes have been isolated from both bacteria and plants. Bacterial AGPconsists of a homotetramer, while plant AGP from photosynthetic and non-photosynthetic tissuesis a heterotetramer composed of two different subunits. The plant enzyme is encoded by twodifferent genes, with one subunit being larger than the other. This feature has been noted in anumber of plants. The AGP subunits in spinach leaf have molecular weights of 54 kDa and 51 kDa,as estimated by SDS-PAGE. Both subunits are immunoreactive with antibody raised againstpurified AGP fiom spinach leaves (Copeland and Preiss, 1981; Morell er al., 1987). Immunologicalanalysis using antiserum prepared against the small and large subunits of spinach leaf showed thatpotato tuber AGP is also encoded by two genes (Okita et al., 1990). The cDNA clones of the twosubunits of potato tuber (50 and 51 l<Da) have also been isolated and sequenced (Muller-Rober etal., 1990; Nakata er al., 1991).As Hannah and Nelson (Hannah and Nelson, 1975 and 1976) postulated, both Shrunken-2(Sh2) (Bhave er al., 1990) and Brittle-2 (Bt2) (Bae er al., 1990) are structural genes of maizeendosperm ADP-glucose pyrophosphorylase. Sh2 and Bt2 encode the large subunit and smallsubunit of the enzyme, respectively. From cDNA sequencing, S722 and Bt2 proteins have predictedmolecular weight of 57,179 Da (Shaw and Hannah, 1992) and 52,224 Da, respectively. TheW0 98/ 1008220CA 02264481 1999-03-03PCT/U S96/ 142442endosperm is the site of most starch deposition during kernel development in maize. Sh2 and bt2maize endosperm mutants have greatly reduced starch levels corresponding to deficient levels ofAGP activity. Mutations of either gene have been shown to reduce AGP activity by about 95% (Tsaiand Nelson, 1966; Dickinson and Preiss, 1969). Furthermore, it has been observed that enzymaticactivities increase with the dosage of functional wild type Sh2 and Bt2 alleles, whereas mutantenzymes have altered kinetic properties. AGP is the rate limiting step in starch biosynthesis inplants. Stark et al. placed a mutant form of E. coli AGP in potato tuber and obtained a 35% increasein starch content (Stark, 1992).The cloning and characterization of the genes encoding the AGP enzyme subunits have beenreported for various plants. These include Sh2 cDNA (Bhave et al., 1990), Sh2 genomic DNA(Shaw and Hannah, 1992), and BL? cDNA (Bae er al., 1990) from maize; small subunit cDNA(Anderson et al., 1989) and genomic DNA (Anderson et al., 1991) from rice; and small and largesubunit cDNAs from spinach leaf (Morell et al., 1987) and potato tuber (Muller-Rober et al., 1990;Nakata er al., 1991). In addition, cDNA clones have been isolated from wheat endospenn and leaf' tissue (Olive et al., 1989) and Arabidopsis thaliana leaf (Lin er al., 1988).AGP ftmctions as an allosteric enzyme in all tissues and organisms investigated to date. Theallosteric properties of AGP were first shown to be important in E. coli. A glycogen-overproducingE. coli mutant was isolated and the mutation mapped to the structural gene for AGP, designated asglyC. The mutant E. coli, known as glyC-16, was shown to be more sensitive to the activator,fructose 1,6 bisphosphate, and less sensitive to the inhibitor, cAMP (Preiss, 1984). Although plantAGP's are also allosteric, they respond to different effector molecules than bacterial AGP's. Inplants, 3-phosphoglyceric acid (3-PGA) functions as an activator while phosphate (P04) serves asan inhibitor (Dickinson and Preiss, 1969).In view of the fact that endospenn starch content comprises approximately 70% of the dryweight of the seed, alterations in starch biosynthesis correlate with seed weight. Unfortunately, theundesirable effect associated with such alterations has been an increase in the relative starch contentof the seed. Therefore, the development of a method for increasing seed weight in plants withoutincreasing the relative starch content of the seed is an object of the subject invention.Brief Summary of the InventionThe subject invention concerns a novel variant of the Shrunken-2 (Sh2) gene from maize.The Sh2 gene encodes ADP-glucose pyrophosphorylase (AGP), an important enzyme involved instarch synthesis in the major part of the corn seed, the endospenn. In a preferred embodiment, thenovel gene of the subject invention encodes a variant AGP protein which has two additional aminoW0 98/ 10082202530CA 02264481 1999-03-03PCT/US96/ 142443acids inserted into the sequence. The variant gene described herein has been termed the Sh2-m1Rev6gene. Surprisingly, the presence of the Sh2-m1Rev6 gene in a corn plant results in a substantialincrease in corn seed weight when compared to wild type seed weight, but does so in the absence ofan increase in the relative starch content of the kernel.The subject invention further concerns a method of using the variant sh2 gene in maize toincrease seed weight. The subject invention also concerns plants having the variant Sh2 gene andexpressing the mutant protein in the seed endosperm.As described herein, the Sh2 variant, Sh2-m1Rev6, can be produced using in vivo, site-specific mutagenesis. A transposable element was used to create a series of mutations in thesequence of the gene that encodes the enzyme. As a result, the Sh2-m1Rev6 gene encodes anadditional amino acid pair within or close to the allosteric binding site of the protein.Brief Description of the SeguencesSEQ ID NO. 1 is the genomic nucleotide sequence of the Sh2-m1Rev6 gene.SEQ ID N O. 2 is the nucleotide sequence of the Sh2-m1Rev6 cDNA.SEQ ID NO. 3 is the amino acid sequence of the protein encoded by nucleotides 87 through1640 of SEQ ID NO. 2.SEQ ID NO. 4 is a nucleotide sequence encoding the amino acid sequence shown in SEQID NO. 5.SEQ ID NO. 5 is the amino acid sequence of an ADP-glucose pyrophosphorylase (AGP)enzyme subunit containing a single serine insertion.Detailed Disclosure of the InventionThe subject invention provides novel variants of the Shrunken-2 (Sh2) gene and a methodfor increasing seed weight in a plant through the expression of the variant sh2 gene. The Sh2 geneencodes a subunit of the enzyme ADP-glucose pyrophosphorylase (AGP) in maize endosperm. Onevariant gene, denoted herein as Sh2-m1Rev6, contains an insertion mutation that encodes anadditional tyrosinezserine or serineztyrosine amino acid pair that is not present in the wild typeprotein. The sequences of the wild type DNA and protein are disclosed in Shaw and Harmah, 1992.The in vivo, site-specific mutation which resulted in the tyrosinezserine or serineztyrosine insertion,was generated in Sh2 using the transposable element, dissociation (Ds), which can insert into, andbe excised from, the Sh2 gene under appropriate conditions. Ds excision can alter gene expressionthrough the addition of nucleotides to a gene at the site of excision of the element.W0 98/ 10082I0202530CA 02264481 1999-03-03PCT/US96/ 142444In a preferred embodiment, insertion mutations in the Sh2 gene were obtained by screeningfor germinal revertants after excision of the Ds transposon from the gene. The revertants weregenerated by self-pollination of a stock containing the Ds-Sh2 mutant allele, the Activator (Ac)element of this transposable element system, and appropriate outside markers. The Ds element cantranspose when the Ac element is present. Wild type seed were selected, planted, self-pollinated andcrossed onto a tester stock. Results from this test cross were used to remove wild type alleles dueto pollen contamination. Seeds homozygous for each revertant allele were obtained from the self-progeny. Forty-four germinal revertants of the Ds-induced sh2 mutant were collected.Cloning and sequencing of the Ds insertion site showed that the nucleotide insertion residesin the area of the gene that encodes the binding site for the AGP activator, 3-PGA (Morrell, 1988).Of the 44 germinal revertants obtained, 28 were sequenced. The sequenced revertants defined 5isoalleles of M2: 13 restored the wild type sequence, ll resulted in the insertion of the amino acidtyrosine, two contained an additional serine (inserted between amino acid residues 494 and 495,respectively, of the native protein sequence), one revertant contained a two amino acid insertion,tyrosine:tyrosine, and the last one, designated as Sh2-m1Rev6, contained the two amino acidinsertion, tyrosinezserine or serinettyrosine. The Sh2-m1Rev6 variant encodes an AGP enzymesubunit that has either the serineztyrosine amino acid pair inserted between the glycine and tyrosineat amino acid residues 494 and 495, respectively, of the native protein, or the serineztyrosine aminoacid pair inserted between the two tyrosine residues located at position 495 and 496 of the nativeprotein sequence. Due to the sequence of the amino acids in the area of the insertions, the Sh2-m1Rev6 variant amino acid sequences encoded by each of these insertions are identical to each other.Surprisingly, the expression of the Sh2-m1Rev6 gene in maize resulted in a significantincrease in seed weight over that obtained fi'om maize expressing the wild-type Sh2 allele.Moreover, seeds from plants having the Sh2-m1Rev6 gene contained approximately the samepercentage starch content relative to any of the other revertants generated. In a preferredembodiment, the Sh2-m1Rev6 gene is contained in homozygous form within the genome of a plantseed.The subject invention further concerns a plant that has the Sh2-m1Rev6 gene incorporatedinto its genome. Other alleles disclosed herein can also be incorporated into a plant genome. In apreferred embodiment, the plant is a monocotyledonous species. More preferably, the plant may beZea mays. Plants having the Sh2-m1Rev6 gene can be grown from seeds that have the gene in theirgenome. In addition, techniques for transforming plants with a gene are known in the art.Because of the degeneracy of the genetic code, a variety of different polynucleotidesequences can encode the variant AGP polypeptide disclosed herein. In addition, it is well withinWO 98/100821015202530CA 02264481 1999-03-03PCT/U S96/ 142445the skill of a person trained in the art to create alternative polynucleotide sequences encoding thesame, or essentially the same, polypeptide of the subject invention. These variant or alternativepolynucleotide sequences are within the scope of the subject invention. As used herein, referencesto “essentially the same” sequence refers to sequences which encode amino acid substitutions,deletions, additions, or insertions which do not materially alter the functional activity of thepolypeptide encoded by Sh2—m1Rev6 or the other alleles. The subject invention also contemplatesthose polynucleotide molecules having sequences which are sufficiently homologous with the wildtype Sh2 DNA sequence so as to permit hybridization with that sequence under standard high-stringency conditions. Such hybridization conditions are conventional in the art (see, e.g., Maniatiset al., 1989).The polynucleotide molecules of the subject invention can be used to transform plants toexpress the .S‘h2-m1Rev6 allele, or other alleles of the subject invention, in those plants. In addition,the polynucleotides of the subject invention can be used to express the recombinant variant AGPenzyme. They can also be used as a probe to detect related enzymes. The polynucleotides can alsobe used as DNA sizing standards.The polypeptides encoded by the polynucleotides of the subject invention can be used tocatalyze the conversion of ATP and or-glucose-1-phosphate to ADP-glucose and pyrophosphate, orto raise an irnmunogenic response to the AGP enzymes and variants thereof. They can also be usedas molecular weight standards, or as an inert protein in an assay.The following are examples which illustrate procedures and processes, including the bestmode, for practicing the invention. These examples should not be construed as limiting, and are notintended to be a delineation of all possible modifications to the technique. All percentages are byweight and all solvent mixture proportions are by volume unless otherwise noted.Example 1 - Expression of Sh2-m1Rev6 Gene in Maize Endosperm.Homozygous plants of each revertant obtained after excision of the D3 transposon werecrossed onto the F1 hybrid corn, “Florida Stay Sweet.” This sweet corn contains a null allele for theSh2 gene, termed sh2-R Resulting endosperms contained one dose of the fimctional allele from arevertant and two female-derived null alleles, denoted by the following genotype Sh2-m1RevX/sh2-R/sh2-R, where X represents one of the various isoalleles of the revertants. Crosses were madeduring two growing seasons.. _.-.._.........m...»..-.u..............t..........,.. .. . , .. .....,....l.... .. .... .. .W0 98/ 10082202530CA 02264481 1999-03-03PCT/US96/ 142446Resulting seed weight data for each revertant and wild type seed are shown in Table 1. Thefirst column shows the amino acid insertion in the AGP enzyme obtained after the in vivo, site-specific mutagenesis.Table 1.Sequence # of revertants Average Seed weight Standard deviationalterationwild type 13 0.250 grams 0.015tyrosine l 1 0.238 grams 0.025serine 2 0.261 grams 0.014tyr, tyr 1 0.223 grams nd*tyr, ser 1 0.289 grams 0.0223 Rev6 :*nd = not delerminedThe data shown in Table 1 represents the average kernel seed weight for each revertant overthe course of two growing seasons. The expression of the Sh2-m1Rev6 gene to produce the Rev6mutant AGP subunit gave rise to an almost 16% increase in seed weight in comparison to the wildtype revertant. The revertants having the single serine insertion also showed an increase in averageseed weight over wild type seed weight.In addition, starch content was determined on the kernels analyzed above using variousmethodologies. The analysis showed that Sh2-m1Rev6 containing kernels were no higher inpercentage starch relative to kernels expressing the other alleles shown in the table above. Therefore,it appears that the increase in seed weight is not solely a function of starch content.Corn seeds that contain at least one functional S112-m1Rev6 allele (the tyrosine, serineinsertion) have been deposited with the American Type Culture Collection (ATCC), 12301 ParklawnDrive, Rockville, Maryland 20852 USA, on May 20, 1996 and assigned ATCC accesion numberATCC 97624. Seeds having at least one functional Sh2-m1Rev20 allele (serine insertion) have alsobeen deposited with ATCC on May 20, 1996 and assigned ATCC accession number ATCC 97625.The seeds have been deposited under conditions that assure that access to the biologicalmaterial will be available during the pendency of this patent application to one determined by theCommissioner of Patents and Trademarks to be entitled thereto under 37 CFR 1.14 and 35 U.S.C.122. The deposit will be available as required by foreign patent laws in countries whereincounterparts of the subject application, or its progeny, are filed. However, it should be understoodWO 9811008220CA 02264481 1999-03-03PCT/U S96/ 142447that the availability of a deposit does not constitute a license to practice the subject invention inderogation of patent rights granted by governmental action. IFurther, the subject seed deposit will be stored and made available to the public in accordwith the provisions of the Budapest Treaty for the Deposit of Microorganisms, i.e. , it will be storedwith all the care necessary to keep it viable and uncontaminated for a period of at least five yearsafter the most recent request for the furnishing of a sample of the deposit, and in any case, for aperiod of at least thirty (30) years after the date of deposit or for the enforceable life of any patentwhich may issue disclosing the seed. The depositor acknowledges the duty to replace the depositshould the depository be unable to furnish a sample when requested, due to the condition of thedeposit. All restrictions on the availability to the public of the subject seed deposit will beirrevocably removed upon the granting of a patent disclosing it.As would be apparent to a person of ordinary skill in the art, seeds and plants that arehomozygous for the S112-m1Rev6 or the Sh2-m1Rev20 allele can be readily prepared fromheterozygous seeds using techniques that are standard in the art. In addition, the Sh2—m1Rev6 andSh2-m1Rev20 genes can be readily obtained fiom the deposited seeds.The skilled artisan, using standard techniques known in the art, can also preparepolynucleotide molecules that encode additional amino acid residues, such as serine, at the locationof the insertions in the subject revertants. Such polynucleotide molecules are included within thescope of the subject invention.It should be understood that the examples and embodiments described herein are forillustrative purposes only and that various modifications or changes in light thereof will be suggestedto persons skilled in the art and are to be included within the scope and purview of this applicationand the scope of the appended claims.CA 02264481 1999- 03 - 03W0 93,1003; PCT/US96/142448ReferencesAnderson, J.M., J. Hnilo, R Larson, t.W. Okita, M. Morell, J. Preiss (1989) “The encoded primarysequence of a rice seed ADP-glucose pyrophosphorylase subunit and its homology to thebacterial enzyme,” J. Biol. Chem. 264: 12238-12242.Anderson, J.M., R Larson, D. Landencia, W.T. Kim, D. Morrow, T.W. Okita, J. Preiss (1991)“Molecular characterization of the gene encoding a rice endosperm-specific ADP-glucosepyrophosphorylase subunit and its developmental pattern of transcription,” Gene 97: 199-205.Bae, J .M., M. Giroux, L.C. Hannah (1990) “Cloning and characterization of the Brittle-2 gene ofmaize,” Maydica 35:317-322.Bhave, MR, S. Lawrence, C. Barton, L.C. Hannah (1990) “Identification and molecularcharacterization of Shrunken-2 cDNA clones of maize,” Plant Cell 2:581-588.Copeland, L., J . Preiss (1981) “Purification of spinach leaf ADP- glucose pyrophosphorylase,” PlantPhysiol. 682996-1001.Dickinson, D.B., J . Preiss (1969) “Presence of ADP-glucose pyrophosphorylase in Shrunken-2 andBrittle-2 mutants of maize endosperm,” Plant Physiol. 44: 1058-1062.Hannah, L.C., O.E. Nelson (1975) “Characterization of adenosine diphosphate glucosepyrophosphorylase from developing maize seeds,” Plant Physiol. 55:297-302.Hannah, L.C., O.E. Nelson (1976) “Characterization of adenosine diphosphate glucosepyrophosphorylase from Shrunken-2 and Brittle-2 mutants of maize,” Biochem. Genet.14:547-560.Lin, T., T. Caspar, C. Somerville, J . Preiss (1988) “A starch deficient mutant of Arabidopsisthaliana with low ADP-glucose pyrophosphorylase activity lacks one of the two subunitsof the enzyme,” Plant Physiol. 88: 1 175-1 181.Maniatis, T., E.F. Fritsch, J . Sambrook (1989) Molecular Cloning: A Laboratory Manual, 2dEdition, Cold Spring Harbor Laboratory, Cold Spring Harbor, New York.Morell, M., M. Bloon, V. Knowles, J . Preiss (1988) “Subunit structure of spinach leaf ADP-glucosepyrophosphorylase,”J. Bio. Chem. 263:633.Muller-Rober, B.T., J . Kossmann, L.C. Hannah, L. Willmitzer, U. Sounewald (1990) “One of thetwo different ADP-glucose pyrophosphorylase genes from potato responds strongly toelevated levels of sucrose,”Mol. Gen. Genet. 2242136-146.Nakata, P.A., T.W. Greene, J.M. Anderson, B.J. Smith-White, T.W. Okita, J. Preiss (1991)“Comparison of primary sequences of two potato tuber ADP-glucose pyrophosphorylasesubunits,” PIantMol. Biol. 1721089-1093.Okita, T.W., P.A. Nakata, J .M. Anderson, J . Sowokinos, M. Morell, J . Preiss (1990) “The subunitstructure of potato tuber ADP-glucose pyrophosphorylase,” Plant Physiol. 93:785-790.CA 02264481 1999-03-03W0 93,1093; PCTIUS96/142449Olive, M.R., R]. Ellis, W.W. Schuch (1989) “Isolation and nucleotide sequences of cDNA clonesencoding ADP-glucose pyrophosphorylase polypeptides from wheat leaf and endoosperm,”Plant Physiol. Mol. Biol. 12:525-538.Preiss, J. (1984) “Bacterial glycogen synthesis and it regulation,” Ann. Rev. Microbiol. 419-458.Shaw, J R, L.C. Hannah (1992) “Genomic nucleotide sequence of a wild type Shrunken-2 allele ofZea mays,” PlantPhysio1. 98:l2l4-1216.Starke, er al. (1992) “Regulation of the amount of starch in plant tissues by ADP-glucosepyrophosphorylase,” Science 2582287.Tsai, C., O.E. Nelson (1966) “Starch-deficient maize mutant lacking adenosine diphosphate glucosepyrophosphorylase activity,” Science 15 11341-343.CA 02264481 1999-03-03W0 93,1003; PCT/US96/142441 0NOT FURNISHED UPON FILINGW0 98/ 10082(A)(B)(C)(9)TYPE:CA11LENGTH: 7745 base pairsnucleic acidSTRANDEDNESS: singleTOPOLOGY: linear(ii) MOLECULE TYPE: DNA (genomic)(xi) SEQUENCE DESCRIPTION: SEQ ID NO:1:TAAGAGGGGT GCACCTAGCA TAGATTTTTT GGGCTCCCTGGAAAACAACCCAGGGAGAGCGATCTTTGTTTGACAGCTCATGTTGCCAACTGTCTAAAACATCATCTATAGCTTCAACACTATTCACCTAAAGAGTTTGCCATCTTCCTACGTATACAGTTGAGAGTATTCAAAATCGGATGAACCTTTGTTGCACTTGCATCCAGGCTTCCTCATACTCGGCAAGTGTGCTTACCATCTAGATGCTATCATTTGAATTGTACATGGATATATGAGACGTACTTCATCATGAAAAAAGTTTCAAACACCTTATGAACGGGGATGTCTGTTACAGTTGTCTTCTCTCGTGCAAACATGCATCTCTTTACTTACCAATGCATTTTCAAAATTACACTAATGATTTCTGTGCGAAGAAATGTGTTTCATGGTTTATATAAACAATTTCGACCTTTATCTGTTAATCTATGTACCTCCATTCTTCATCTGCAACATGTCCTCAAGCATGAACATATCTCTGAAATCAATATGTTTTACAGAAAGGAGGGGAAAGGCTTTATGATCTGTTTATTTAGGCATATCATATTTATTGTCTTCATTAAAAATTAGCGGCTGGTTGGTTGTGGGCATAAAAACTCCTTTTGTTGATGTCTCATCAACAGCTGCAGCCACCGTTTAATTTGTCTGCAAATGGCCGACAATACAGAGGGAGTAGCCACTTTGTTGTGGAAACGGTTTCATGTGTTTGCAGGCGTATAAACCACCGTACGCCAGGCATCTCCATCTTGCCCTTATATGCTCATTTGAAAAATATGTGAATTTCTTCTATTATGCATGAGTCTGACAAACAGCTCATTTCTGTATTACACAGTTATCGCAATTATTTTTTTGTTTAATTGGGAACATCTGACGTTATTGCAAGG02264481 1999-03-03GCCTCTCCTTATCTGATGCTCATTGTGTGATACTAGCTTAGTACCGTGGGAAACTCTTCTCGGCTGTGCAACGTTATTTACCCAGGCACCTCTGATCATATTATTAATTTTGTCCTGCACAGAAAGGAAGTTTATAGCAATCGATTACTTTCTAGCCTCTTGTGGACATACATCTCCACCGCCACAAGATCTGTTGTAAGGTATTAGTGGTATATGGGCTTATATGCCTAPCT/US96/14244TCTTCCGCCT 60TTTTCCTGGG 120AACCAATATC 180CAAGCATTAG 240AAATGAGAAA 300GGAAGAAAGG 360TTTTGGAAGT 420CTCAGAAACA 480CACCATCACC 540AAAAATCATT 600GCTAGCAGAT 660CTAGGGAGCT 720TAGGAACCTA 780AGGCCAAGGG 840GCAAGAAATG 900TTTACGGTAC 960ATGCCAAAGC 1020AGTATGCCCT 1080CACTTCGGGA 1140TATACTTTCC 1200AAAGAGGATG 1260GCTTCATATA 1320GTTCCATCAA 1380CA 02264481 1999-03-03W0 93,1003; PCT/US96/1424412AAGTTCTGTT TTTTCATTCT AAAAGCATTT TAGTGGCACG CAATTTTGTC CATGAGGGAA 1440AGGAAATCTG TTTTGGTTAC TTTGCTTGAG GTGCATTCTT CATATGTCCA GTTTTATGGA 1500AGTAATAAAC TTCAGTTTGG TCATAAGATG TCATATTAAA GGGCAAACAT ATATTCAATG 1560TTCAATTCAT CGTAAATGTT CCCTTTTTGT AAAAGATTGC ATACTCATTT ATTTGAGTTG 1620CAGGTGTATC TAGTAGTTGG AGGAGATATG CAGTTTGCAC TTGCATTGGA CACGAACTCA 1680GGTCCTCACC AGATAAGATC TTGTGAGGGT GATGGGATTG ACAGGTTGGA AAAATTAAGT 1740ATTGGGGGCA GAAAGCAGGA GAAAGCTTTG AGAAATAGGT GCTTTGGTGG TAGAGTTGCT 1800GCAACTACAC AATGTATTCT TACCTCAGAT GCTTGTCCTG AAACTCTTGT AAGTATCCAC 1860CTCAATTATT ACTCTTACAT GTTGGTTTAC TTTACGTTTG TCTTTTCAAG GGAAATTTAC 1920TGTATTTTTT GTGTTTTGTG GGAGTTCTAT ACTTCTGTTG GACTGGTTAT TGTAAAGATT 1980TGTTCAAATA GGGTCATCTA ATAATTGTTT GAAATCTGGG AACTGTGGTT TCACTGCGTT 2040CAGGAAAAAG TGAATTATTG GTTACTGCAT GAATAACTTA TGGAAATAGA CCTTAGAGTT 2100GCTGCATGAT TATCACAAAT CATTGCTACG ATATCTTATA ATAGTTCTTT CGACCTCGCA 2160TTACATATAT AACTGCAACT CCTAGTTGCG TTCAAAAAAA AAAATGCAAC TCTTAGAACG 2220CTCACCAGTG TAATCTTTCC TGAATTGTTA TTTAATGGCA TGTATGCACT ACTTGTATAC 2280TTATCTAGGA TTAAGTAATC TAACTCTAGG CCCCATATTT GCAGCATTCT CAAACACAGT 2340CCTCTAGGAA AAATTATGCT GATGCAAACC GTGTATCTGC TATCATTTTG GGCGGAGGCA 2400CTGGATCTCA GCTCTTTCCT CTGACAAGCA CAAGAGCTAC GCCTGCTGTA AGGGATAACA 2450CTGAACATCC AACGTTGATT ACTCTATTAT AGTATTATAC AGACTGTACT TTTCGAATTT 2520ATCTTAGTTT TCTACAATAT TTAGTGGATT CTTCTCATTT TCAAGATACA CAATTGATCC 2580ATAATCGAAG TGGTATGTAA GACAGTGAGT TAAAAGATTA TATTTTTTGG GAGACTTCCA 2640GTCAAATTTT CTTAGAAGTT TTTTTGGTCC AGATGTTCAT AAAGTCGCCG CTTTCATACT 2700TTTTTTAATT TTTTAATTGG TGCACTATTA GGTACCTGTT GGAGGATGTT ACAGGCTTAT 2760TGATATCCCT ATGAGTAACT GCTTCAACAG TGGTATAAAT AAGATATTTG TGATGAGTCA 2820GTTCAATTCT ACTTCGCTTA ACCGCCATAT TCATCGTACA TACCTTGAAG GCGGGATCAA 2880CTTTGCTGAT GGATCTGTAC AGGTGATTTA CCTCATCTTG TTGATGTGTA ATACTGTAAT 2940TAGGAGTAGA TTTGTGTGGA GAGAATAATA AACAGATGCC GAGATTCTTT TCTAAAAGTC 3000TAGATCCAAA GGCATTGTGG TTCAAAACAC TATGGACTTC TACCATTTAT GTCATTACTT 3060WO 98/10082TGCCTTAATGTAATTGTTCATTCCAGGGTATTCTCGTTTATTCTCCTGTAGAGTGGCGATTGTTCCTCATTTATTTCCAGTGAGAGGTAACAGGATGCATAAATGGGCTAGGGTGCTGATCTTTOTTTCTTATTCAGAAAGTTGCAGAGAATACCTTGCAGTAATCACTTATTCTTAGGTGTACTAGATCTAAATTCTTCATGTATTTTCCATGCATTTTACTTGGCCCTGAATTCAATGTTATCATTTATTCAGCCTTCGCTTGCCTCCCCTGAGCAAGTTCCATTGAATCCTGCAGGTCAGCAGACTCTGAATGTCCATTTCTTTAGGCAGCTTTATCGTTTCACGTAAAACATGTCGTCAGTTGTTTATGGTCTAATGTGAAGATTGTTGAATTCTATGAGATGAACTGATTTTCTAGTTGAGACCATCAATGGGCATCCTGTGACTCAAAATATACATAGTGTGCAATGTCAAAAAGCTTCCATGCTACGGGCTATCACTGAGCAGCATAGAATGTATAGTTGTTGCAAGTTTGATGACGCAATTGATTTTGTGTACATGGGGCAAATATTAGCGGCTTATCAGAAAATTCACTCATTATTATTACAGGGATGAATTAATGTCCTGATAGGACGATGCATATCATCCTCTGCTTTCCTATCATACTGGTGGTTAGAAACCCTCTTTTATTTTGCTGTAACTTCCTGAGTTTATGTCTTTATTTCTATCTCAATTACATGGTAAGTCTGGTTGTTTTTGATCATACATATGGGAGGATGGTACTCTGTCGTTAGACCATGCTAGAATTTTTTTACGATCGACAAGTGCACTTGACTTGT13TATTGATTCTACACAAATGCTTTATCTGGGCCTGTAGCATTCACAAATCCCATGGAACTTTTTGGATTAATGATATCACTAATATGAATATTTTTTTCCCACGTGTACTTTTCCTTGTGTGTTATTTCCAGAATCTGACACTATGCTATACAAGAAAGATCAACTCCTAGGACTTTGGATATCTGTCTGGTTTCCAGTTTCTAACAATACTTGGAACAATATGTATTCTGCTTAGTTCCAAAACACAAATCAAAAACACCAGGTATATGTTCTCCTCCAC02264481 1999-03-03ACAAGTGTTTCTGAAGAGCCTACTCGAGGTTGTTTCTTTGATTGACAACAGTGCAGGTATCCAACTACTTATATCATGTGTGTCATCTTGTTCGGAAGCCCAATTCTTTGAATCCAATTCTGGATAACCTCTAAAGCTAAGATGATGCACGCACTTTTAGTTTACCTTCTCTGAAATCCTAGTATGTGTTCCACTACCAAATTTTACGTACAAATCATTCTACTGCATATTCCTGTTTTCTTACCTAATATTTCTTCACTCTTACTGAGCAGATGAAATAPCT/U S96/ 14244AATTAAAAAC 3120AGCTGGATGG 3180AGTTGATATT 3240TAATTTTGAG 3300TTGTAATCTT 3360GGTGTTCTCT 3420TTGGCATGCA 3480CTCCTGTTGA 3540TTATCCAACA 3600GAGCTTCTAA 3660AAAAACCAAA 3720TTTTGTTTTC 3780GTACTTGACT 3840TAGCACTGAT 3900AGAAATATCC 3950ACCTTCTCAA 4020AACAGTGTCA 4080CCCAAGAGCT 4140CTGTAAACTG 4200TGCACGATTT 4260TTGTGTTAGG 4320TTTGATGCAA 4380ATATTACCTG 4440TTCAATTAGC 4500TGTTTCTCTC 4560GCACCCCGAT 4620ACAATTGTTA 4680TGCATTTATC 4740W0 98/ 10082TCAGATGGTTCGTGTCAGCTATACCATTTCGTTCCAAGCAATCACGTGGAATCCATTTAACTTAAGATCACTCAATCGGTTCATCGTTTCATGCAACATTATGTAGCATGTGCCACTTAGTAACATCTTCTCTTTCTGGGAGTAGTACCGTCCCCCTCAGCTCTCGGGGAGATCGGCTCGCGGTCTCTTAACCGAGTCTATATTTACTTCAATGTAATCCTCAAAGTTGATTGTTCGAACTCCTTGATATTTTGTTCCTTTTTTGGCATGGAGGTTTGATGCTTACTGAGCTGGATGTGAAACACCAAGCATTTAGGGTATAGTTGTTTTTTATTGTTTTTACTACGCACGTTGGACAAGAAACTCGATCTATCTGTTGATCTAATCATCAACACCATATATTAATATCCCACTACTTGAAAGTCACATCGGGTGAATTTTCGATATCCTTTAGTGATGGATATAATGCCAAACCTTTGGTACCTAGCGTCCTTGTATGTCTTTTGATATACTAGTCACATTTGTCATAAATACTGCTCCAAACAAAATCCTAAGGAATCCAAGAATGCAACACTCAAGGTAATCACCAAATGCCTAGAGTTCCATGCACTCATTGCTTCTTTAGTGTCTTTTTTTTCTTGACTTCCTGTATACATGTCATCATCCTATAAAGCTTGATGCCTCGCCTCTCTCCTTCCAAACTCATATATTCCGGGCTTGGTGCGCGCCACCGGAGCGGGGTGGGAGGGCAGACTCTAGAGTTTATTAATGACCCTTGTAATAGTCCTATTCAAATTTTTTGGCCCTCATCAATCACTTGTCACACAGAAGTTGGATCCCTG14ATCGAGCATTCATACTCTGCCACACAGAACGAAATCTAACTTATTTAAGCCCCTTTGCCTAGAGGTCTCTATTTGTGCTACATCATAAATTTTTTGTAGGATTTACATTTATTTCATCCAGTATCATTGGTAACGTCTCCGGTTTTAGTTAAAAAAAATCCTCCGGCTGGTCAAGGGTTTTCTTTCCCTCCCCCTGTCACTCACTATATCATTATCCATCTAATCGAGAATACATGTTCTAGTCAATGAATCATTAAGAATGTTTCCTTTACAGGTTTAT02264481 1999-03-03CTGTGATTGGCAATGTATCTAATAGCAACAAAAACAAAAGTAATTTTTTGTTCCCCCATTGGTGGACATGCACCTAACCTCCAATGCAACTTAACATTATTAGCTTATGTCCCTGCTTTGTCCTAAATATTTTGCTCCTTCTACTAAGTCCCCTCGCTGTGCATTGCAGATCTCGGCCGGCCCGGTCGAGAACTCACAACGTCTGTAAAAACAAGAAAAAGTCATCTGTATAATGAGTCCAATCACGTGTAATCTCTCTCTTTTAAGATCCAAAATCCTTPCT/US96/ 14244AGTCTGCTCA 4800ACTCTTGAGT 4860AAGCCTTTTA 4920TCAAAGCTCT 4980GGTATACTAC 5040ACTATCGCGT 5100TTCAAACCAT 5160ATCACGTATG 5220ATACGCATTT 5280GCACCATACA 5340GGTATCCTCT 5400ATTCTATGGC 5460GGAAATACAT 5520TCTTGTGTGT 5580CCGGGTTCGA 5640GTCCCGCCCG 5700GTGAGCAGTT 5760GACCATGTTT 5820TTTTAGTTCT 5880TCTAGTTTTC 5940AGCATACACC 6000AAGGTAAGGC 6060TCTTCGTCTC 6120AACGTAATAT 6180AGGTCCTTCA 6240ATAGTTAACC 6300CCACACAAAA 6360TGTGTTTTTC 6420W0 98/ 10082TTAAAACTGATGAACACCTTATTACCACGAAAAATCGGTGATGGGAGCGGGTCCCAGTTGTTAGTTCCCACTGTATCATTGAGCGAGCGCTCCTATCCAGCAAGAGGCTGAICTTGAAGATACAAAACAAGAGCCGCTTGTGACCATTTGTTTTATGAACTATTACTAAAGACCGCTCGATAAATTTTGTTTTTGCATAGAAATTATAAGTTATTTATGTCGATAATATTCCTCCGGTTCTTGTTCATGAATACAACAATTCATTACACCTATGAGAATAGGAAGAAAATATCACGACATGAATGACCTACATGGCGCTAGTCTTATCACCCGGAATGCAACCATGAACCTACAAACAGAAAGTCTGCTGCTAGTCTTTGTATTTTTTTTACGTGCCCTGGGCCAATTAGATACGTGCAGGGGTTTATTAAATATAATTAGTTTTCAAGCTTCTAGTGTTACTGTACAGAATATTGATTGTTATTGCAACTGAAGAAGAACACAAAGTCACTGATACCTAGGATTGGGTGCAGAATCGTGACCATGGAGAAGGGTACCAACGATGGGTGGTATTGCAGAGCGTTCGGATGTACTGTTCCATTACCTGTTTTTCTAATTTGGTTCAGCAAGGACTTCAGTAGACTTGTATATTTAATTAAAAATAGAC(2) INFORMATION FOR SEQ ID NO:2:15ATTGATGTAACCCCCCCCCCACCCAGATCTGCTTTCTGATGAAGCTTCAAATAAGGTGAGCTGATGGTATGAAGAACGTGTTGTGTGCTCGGCATGGGTTTCGTACTACATCTGTCATATTCGATGGATCGCAAGATGCGATAAGCTGCCCTTTGGATCATCGGTGCTGCTCTGTTCCTTGCCGTGTATGAGCCCTTGTTAGGTTAACAACTATATTTCA(i) SEQUENCE CHARACTERISTICS:1919 base pairs(A) LENGTH:(B) TYPE:(C)(D)nucleic acidSTRANDEDNESS: singleTOPOLOGY: linear(ii) MOLECULE TYPE: CDNA02264481 1999-03-03TATTCAATCTCCCCCCCCCCAGAGTTTGTTAACGACAGGAAGCTACTGTTTATGGATGTGCCTCTGATTAGTGATCACAAATCTATCCTACGACTCTGTGTAAGGTCTGGAGATCGGCTGGTGTAACCTTTAGTCTGGCACTAGAAGTTGACTATATCTGTTTTGGGATCAGAGCAACTCTCGTCCTCACTAAAGAGGAAATTTGGCTCGATACGAAATAPCT/US96/14244GTTTAGCAAG 6480CGAGGCCCAG 6540TGTACTGTTG 6600CTCCGTGATG 6660AGCTGGGAAG 6720GAACCACCGG 6780TTTTCAGGAA 6840ACAGTAAGGT 6900ATTCGGTAAT 6960ACAGGGCATC 7020AATCGTGGTG 7080CGTGTGCGTC 7140GGTATGGTAA 7200TGCTGTTCCT 7260CAGCAAACCT 7320TCATCCTATA 7380TGGCTTCGAT 7440CAAGGAGTCC 7500CAAACGCTCT 7560TTTGAATATC 7620TTTTTAGTCT 7680TCATTAACAT 77407745W0 98/ 10082CA16(xi) SEQUENCE DESCRIPTION: SEQ ID NO:2:ACAAGATCACTTGTGTATCTGTCCTCACCATTGGGGGCAGCAACTACACAAGTCCTCTAGGCACTGGATCGAGGATGTTAAGATATTTGTACCTTGAAGGTGCCTGAAGAGGGTAETCGAATCAGCTTTAATATCACTATAGATTGATCAATTCTATGAGCATACCTTGCAGTCAAAATAATCATAGTGTCATTCTTTGACAAAAACACCAGATGAAATACTGTGATTGGTGGGAGCGGATCCCGATTGGGGATTGGGAAAAGAAGGGTATTCGGGAGGCAGTAGTTGGAGATAAGATCTAAAGCAGGAGATGTATTCTTGAAAAATTATTCAGCTCTTTCAGGCTTATTGATGAGTCAGCGGGATCAACGCCAGCTGGAGGATTATTACTCGGATGAATATCATGTGCTTACTGGACGTAGTTGAGACCATCAATGGGCTACTCAATTAGCAGGCATGCTGCAAACTTGTTTCTTCACTTGCATTTATCAGTCTGCTCACATCTATGAAAATAGGAAGGGAACGTGGTGCTCGTACTACAAGTGCGATTGGAGATATGCTGTGAGGGTGAAAGCTTTGAACCTCAGATGGCTGATGCAACCTCTGACAAGATATCCCTATTCAATTCTATTTGCTGATGTGGTTCCAGGAGTCACAAATTACATGGAACCCTGTTGATGGTACTTCAATAACTTCCTGAATTTATGTCTCATGACTTTGATTTTTACGGGCCCTCACTGGCACCCCGATTCAGATGGTTCGTGTCAGCTACTGAAGAAGAACACAAAGAATCACAAACAATAAGGTCTGTTGATCTTGCAGTTTGCACTATGGGATTGAGAAATAGGTGCTTGTCCTGAACCGTGTATCGCACAAGAGCTGAGTAACTGCTTCGCTTAAGATCTGTACAGTACAGCAGACCATTGACAATTGTGCAGAAAGAGCCGAGCTCTTTGAAAAGCTATGCTATTCAAGAAAGAGATCTGAAATGCTATTGGGAAGCAGCCTTCGCTTGCCTCCGCTTACTGAGCTGGATGTGAAAGCTTCAAATAAGGAACTGGTAAGGGCATGAATCGTGGT02264481 1999-03-03AGCCACCTTTTGCATTGGACCAGGTTGGAACTTTGGTGGTAACTCTTCATTGCGATCATTTACGCCTGCTCTTCAACAGTCCGCCATATTGGTATTAGCGCTCTATCAGACATTGTAATCACATGTCGAGTTCTAAAAATACCAAAGGGTAGATGATGCATGCACTTTTACCTCCCAAGAGGATGTTGGACAAGTTTGATGACGCAATTGAGAATGCAACACTCAAGGACGCTACTGTTATATCATTGACCCAAGAGGCTGATCCTGAAGPCT/U S96/ 14244TTTTGTTCTG 60ACGAACTCAG 120AAATTAAGTA 180AGAGTTGCTG 240TCTCAAACAC 300TTGGGCGGAG 360GTACCTGTTG 420GGTATAAATA 4 8 0CATCGTACAT 540GCTACACAAA 600AAATTTATCT 660TTGAGTGGCG 720GACGATGCTG 780GGGCTAGTGA 840GCTGATTTGA 900CAGAAATATC 960GACCTTCTCA 1020GCTGTACTAG 1080ACAATCAAAT 1140TTTTACGATC 1200GACAAGTGCA 1260ATCGAGCATT 1320TCCGTGATGA 1380GCTGGGAAGG 1440ATGAATGCTA 1500GATCACCCGG 1560AATGCAACCA 1620 CA 02264481 1999-03-03W0 93/10032 PCT/US96I1424417TCAACGATGG GTCTGTCATA TAGATCGGCT GCGTTTGCGT CTACAAAACA AGAACCTACA 1680ATGGTATTGC ATCGATGGAT CGTGTAACCT TGGTATGGTA AGAGCCGCTT GACAGGAAGT 1740CGAGCTTCGG GCGAAGATGC TAGTCTGGCA TGCTGTTCCT TGACCATTTG TGCTGCTAGT 1800ATGTACCTGT TATAAGCTGC CCTAGAAGTT GCAGCAAACC TTTTTATGAA CCTTTGTATT 1860TCCATTACCC TGCTTTGGAT CAACTATATC TGTCAGTCCT ATATATTACT AAATTTTTA 1919(2) INFORMATION FOR SEQ ID NO:3:(1) SEQUENCE CHARACTERISTICS:(A) LENGTH: 518 amino acids(B) TYPE: amino acid(C) STRANDEDNESS: single(D) TOPOLOGY: linear(ii) MOLECULE TYPE: protein(xi) SEQUENCE DESCRIPTION: SEQ ID NO:3:Met Gln Phe Ala Leu Ala Leu Asp Thr Asn Ser Gly Pro His Gln Ile1 5 10 15Arg Ser Cys Glu Gly Asp Gly Ile Asp Arg Leu Glu Lys Leu Ser Ile20 25 30Gly Gly Arg Lys Gln Glu Lys Ala Leu Arg Asn Arg Cys Phe Gly Gly35 40 45Arg Val Ala Ala Thr Thr Gln Cys Ile Leu Thr Ser Asp Ala Cys Pro50 55 60Glu Thr Leu His Ser Gln Thr Gln Ser Ser Arg Lys Asn Tyr Ala Asp65 70 75 80Ala Asn Arg Val Ser Ala Ile Ile Leu Gly Gly Gly Thr Gly Ser Gln85 90 95Leu Phe Pro Leu Thr Ser Thr Arg Ala Thr Pro Ala Val Pro Val Gly100 105 110Gly cys Tyr Arg Leu Ile Asp Ile Pro Met Ser Asn Cys Phe Asn Ser115 120 125Gly Ile Asn Lys Ile Phe Val Met Ser Gln Phe Asn Ser Thr Ser Leu130 135 140Asn Arg His Ile His Arg Thr Tyr Leu Glu Gly Gly Ile Asn Phe Ala145 150 155 160Asp Gly Ser val Gln Val Leu Ala Ala Thr Gln Met Pro Glu Glu Pro165 170 175WO 98/10082AlaValLeuLys225AspGlySerGlnAsp305PheAlaPhePhePIG385GlyCysGlyAlaCys465GlyLeuser210HisGluArgMetLys290AlaGlyCysPheTyr370ThrcysSerAlaGly450IleTrpGlu195GlyValSerValArg275TyrLeuS61.‘IleAsp355AspGlnLeuA39Asp435LysIlePhe180AspAspGluArgLeu260ValProLeuGluPhe340AlaProLeuLeuVal420IleValAspGlnTyrGlnAspAla245GlnGluTyrAspIle325ThrAsnLysAspArg405SerTyrProMetCAGlyTyrLeuAsp230SerPheThrLeuLeu310LeuGlyLeuThrLys390GluserGluIleAsn47002264481ThrSerTyr215AlaLysPheAsnAla295LeuProTyrAlaPro375CysCysGlyThrGly455AlaAlaHis200A19AspA31’!GluPhe280serLysArgTrpLeu360PheLysAsnCysGlu440IleArg1999-03-0318Asp185LysMetIleGlyLys265LeuMetSerAlaGlu345ThrPheMetIleGlu425GluGlyIleSe!’serA511ThrLeu250ProSerGlyLysVal330AspGluThrLysGlu410LeuGluArgGlyIleIleTyrIle235ValLysTyrIleTyr315LeuValGlnAlaTyr395HisLysAlaASI1Lys475ArgAspMet220S81‘LysGlyAlaTyr300ThrAspGlyProPIO380AlaSerAspSerThr460AsnPhe190LysAsn Ile205Glu LeuCys AlaIle AspAla Asp270Ile285AspVal PheGln LeuserHisIle350ThrSer365LysArg CysPhe IleVal IleVal430SerLys Leu445Lys IleVal ValPCT/U S96/ 14244IleValValProHis255LeuAspLysHisVal335LysPheLeuSerGly415MetLeuArgIleTrpIleGlnVal240ThrAS!)AlaLyeAsp320GlnserAspPICAsp400ValMetLeuAsnThr480W0 98/10082Asn Ser Lys Gly Ile Gln Glu485CATyr Tyr Ile Arg Ser Gly Ile500Asn Asp Gly Ser Val Ile515(2) INFORMATION FOR SEQ ID NO:4:1902264481 1999-03-03PCT/U S96/ 14244Ala Asp His Pro Glu Glu Gly Tyr Ser490495Val Val Ile Leu Lys Asn Ala Thr505(i) SEQUENCE CHARACTERISTICS:(A)(B)(C)(D)TYPE:(ii) MOLECULE TYPE: CDNALENGTH: 1551 base pairsnucleic acidSTRANDEDNESS: singleTOPOLOGY: linear(Xi) SEQUENCE DESCRIPTION: SEQ ID NO:4:ATGCAGTTTGGGTGATGGGATTGAGAAATAGATGCTTGTCGCAAACCGTGACAAGCACAACCTATGAGTATCTACTTCGCGATGGATCTGCAGGGTACAGAAATCCATTGGAACTTGTGCGATGAGAGCCCAATTCTTTGCTGAGCTATGGTCTTCAAGATTTGGATCTGACGGGCTATTCACTTGCATTTTGACAGGTTGGTGCTTTGGCTGAAACTCTTATCTGCGATGAGCTACGCCACTGCTTCAATTAACCGCCATACAGGTATTCAGACTCTATACAACATTGTAGAAACATGTGAGCTTCTAAAAAAACCAAACTATAGATGAAAGATGCACTAAATCCTCCCGGGAGGATGTGGACACGAACGGAAAAATTATGGTAGAGTTTCATTCTCAACATTTTGGGCTGCTGTACCTCAGTGGTATATATTCATCGTAGCGGCTACACAGAAAATTTAATCTTGAGTCGAGGACGATAAATGGGCTAGGGTGCTGATTGCACAGAAATTTAGACCTTAAGAGCTGTATGGAACAATCTCAGGTCCTCAGTATTGGGGGCTGCAACTAACACAGTCCTGGAGGCACTGGTTGGAGGATAATAAGATATACATACCTTGCAAATGCCTGATCTGGGTACGGCGATCAGCGCTGATATCAGTGAAGATTGTTGAATTCTATATCCATACCCTCAAGTCAACTAGATCATAAAATCATTCTACCAGATAAGGCAGAAAGCACACAATGTATCTAGGAAAAAGATCTCAGCTGTTACAGGCTTTGTGATGAGAAGGCGGGATAAGAGCCAGCTCGAGGATTATTTATCGGATCTATATCATGATCATACTGGTGAGAGTTGATTGCATCAATAATATACTCAGTGTGCAGGCTTGATGCAAA510ATCTTGTGAGGGAGAAAGCTTCTTACCTCATTATGCTGATCTTTCCTCTGTATTGATATCTCAGTTCAATCAACTTTGCTTGGATGGTTCTTACAGTCACGAATTACATGTGCTCCTGTTACGTGTACTTGACCAACTTCGGGCATTTATATTACATGACATGCATTTTTCTTGGCCCTCIle6012018024030036042048054060066072078084090096010201080WO 98110082ACTGAGCAGCCGATGCTTGCGGTTGCTTACAGCTCTGGATGAAGAAGCTTAAGATAAGGAAACAGTAAGGGGAATCGTGGCTTCCAAGTTCTCCGACGCATGAGAGAATGGTGAACTCAACAAAGCTACTACTGTATCATGCATCCAAGATGATCCTGAACATGATTTTTACATTGGACAAGCAACATCGAGGGACTCCGTGGTTAGCTGGGTGACATGAATGGCTGATCACGAATGCAACC(2) INFORMATION FOR SEQ ID NO:5:20GATCCAAAAATGCAAGATGACATTCTGTGAATGATGGGAGAAGGTCCCGAGCTAGGATTGCCGGAAGAAGATCAACGATG(i) SEQUENCE CHARACTERISTICS:(ii)(Xi)MetSerGlyVal(A)(B)(C)(D) TOPOLOGGln Phe AlaGlu20CysArg35LysAla Ala50Glu65AlaLeuGlyGlyThrASHPheCysIleLeu HisArg ValLeu100ProTyr115ArgAsn Lys130Y: linearMOLECULE TYPE: proteinLeu Ala Leu Asp Thr Asn5Gly Asp GlyGln Glu LysGln55Thr ThrGln Thr70SerSer Ala Ile85Thr Ser ThrLeu Ile AspVal135Ile PheLENGTH: 517 amino acidsTYPE: amino acidSTRANDEDNESS: singleSEQUENCE DESCRIPTION: SEQ ID N025:10Ile Asp25Ala40LeuCys IleGln SerIle Leu90Ala105ArgIle120PIOMet SerArgArgLeuSerGlyThrMetGln02264481 1999-03-03CACCTTTCTTAATATGCATTTTGGAGTCTGCGGACATCTATTGGAATAGGGGAAGAACGTGGTCCTACTAGGTCTGTCATSer GlyGluLeuAsn ArgProLyscysPCT/US96/14244CACTGCACCCTATCTCAGATCTCACGTGTCTGAAACTGAAAAGGAACACAGGTGATCACACATAAGGTCTAGln15HisLeu30SerPhe Gly45Thr Ser60Arg75LysGly GlyAlaProSer AsnAspAsnThrValCysAla cysTyr AlaGly Ser95Pro Val110Phe Asn125Phe Asn140SerThr SerIleIleGlyProAsp80GlnGlySerLeu11401200126013201380144015001551CA 02264481 1999-03-03W0 98/10032 PCT/US96/1424421Asn Arg His Ile His Arg Thr Tyr Leu Glu Gly Gly Ile Asn Phe Ala145 150 155 160Asp Gly Ser Val Gln Val Leu Ala Ala Thr Gln Met Pro Glu Glu Pro165 170 175Ala Gly Trp Phe Gln Gly Thr Ala Asp ser Ile Arg Lys Phe Ile Trp180 185 190val Leu Glu Asp Tyr Tyr Ser His Lys Ser Ile Asp Asn Ile Val Ile195 200 205Leu Ser Gly Asp Gln Leu Tyr Arg Met Asn Tyr Met Glu Leu Val Gln210 215 220Lys His Val Glu Asp Asp Ala Asp Ile Thr Ile Ser Cys Ala Pro Val225 230 235 240Asp Glu Ser Arg Ala Ser Lys Asn Gly Leu Val Lys Ile Asp His Thr245 250 255Gly Arg Val Leu Gln Phe Phe Glu Lys Pro Lys Gly Ala Asp Leu Asn260 265 270Ser Met Arg Val Glu Thr Asn Phe Leu Ser Tyr Ala Ile Asp Asp Ala275 280 285Gln Lys Tyr Pro Tyr Leu Ala Ser Met Gly Ile Tyr Val Phe Lys Lys290 295 300Asp Ala Leu Leu Asp Leu Leu Lys Ser Lys Tyr Thr Gln Leu His Asp305 310 315 320Phe Gly Ser Glu Ile Leu Pro Arg Ala Val Leu Asp His Ser Val Gln325 330 335Ala Cys Ile Phe Thr Gly Tyr Trp Glu Asp Val Gly Thr Ile Lys Ser340 345 350Phe Phe Asp Ala Asn Leu Ala Leu Thr Glu Gln Pro Ser Lys Phe Asp355 360 365Phe Tyr Asp Pro Lys Thr Pro Phe Phe Thr Ala Pro Arg Cys Leu Pro370 375 380Pro Thr Gln Leu Asp Lys Cys Lys Met Lys Tyr Ala Phe Ile Ser Asp385 390 395 400Gly Cys Leu Leu Arg Glu Cys Asn Ile Glu His Ser Val Ile Gly Val405 410 415cys Ser Arg Val Ser Ser Gly cys Glu Leu Lys Asp Ser Val Met Met420 425 430Gly Ala Asp Ile Tyr Glu Thr Glu Glu Glu Ala Ser Lys Leu Leu Leu435 440 445W0 98/ 10082AlaCys465AsnTyrAspGly450IleSerIleGlyLysIleLysArgSer515ValAspGlySer500ValCA22Pro Ile Gly Ile Gly455Met Asn Ala Arg Ile470Ile Gln Glu Ala Asp485Gly Ile Val Val Ile505Ile02264481 1999-03-03PCT/U S96] 14244Arg Asn Thr Lys Ile Arg460Gly Lys Asn val Val Ile475His Pro Glu Glu Gly Ser490 495Leu Lys Asn Ala Thr Ile510A51’!Thr480TyrA81’!

Claims (18)

Claims

1. A polynucleotide molecule, comprising a variant of the wild type shrunken-2 (Sh2) gene, wherein said variant codes for the insertion of at least one additional amino acid within or close to the allosteric binding site of the ADP-glucose pyrophosphorylase (AGP) enzyme subunit, whereby a plant expressing said polynuceleotide molecule has increased seed weight relative to the seed weight of a plant expressing the wild type Sh2 gene.

2. The polynucleotide molecule, according to claim 1, wherein said polynucleotide molecule encodes at least one serine residue inserted between amino acids 494 and 495 of the native AGP
enzyme subunit.

3. The polynucleotide molecule, according to claim 1, wherein said polynucleotide molecule encodes the amino acid pair tyrosine: serine, wherein said amino acid pair is inserted between amino acids 494 and 495 of the native AGP enzyme subunit.

4. The polynucleotide molecule, according to claim 1, wherein said polynucleotide molecule encodes the amino acid pair serine: tyrosine, wherein said amino acid pair is inserted between amino acids 495 and 496 of the native AGP enzyme subunit.

5. The polynucleotide molecule, according to claim 1, wherein the AGP enzyme encoded by said polynucleotide molecule consists essentially of an amino acid sequence selected from the group consisting of SEQ ID NO. 5 and SEQ ID NO. 3.

6. The polynucleotide molecule, according to claim 5, wherein the nucleotide sequence encoding SEQ ID NO. 3 comprises nucleotides 87 through 1640 of the sequence shown in SEQ ID
NO. 2 or a degenerate fragment thereof.

7. A method for increasing the seed weight of a plant, comprising incorporating the polynucleotide molecule of claim 1 into the genome of said plant and expressing the protein encoded by said polynucleotide molecule.

8. The method, according to claim 7, wherein said plant is Zea mays.

9. A plant seed comprising the polynucleotide molecule of claim 1 within the genome of said seed.

10. A plant expressing the polynucleotide molecule of claim 1.

11. The plant, according to claim 10, wherein said plant is Zea mays.

12. The plant, according to claim 10, wherein said plant is grown from the seed of claim 9.

13. A variant ADP-glucose pyrophosphorylase (AGP) protein, wherein said protein has at least one additional amino said inserted within or close to the allosteric binding site of the wild-type AGP protein.

14. The variant AGP protein, according to claim 13, wherein said protein has at least one serine residue inserted between amino acids 494 and 495 of the wild type AGP protein sequence.

15. The variant AGP protein, according to claim 11, wherein said protein has the amino acid pair tyrosine: serine inserted between amino acids 494 and 495 of the wild-type AGP protein sequence.

16. The variant AGP protein, according to claim 11, wherein said protein has the amino aeid pair serine: tyrosine inserted between amino acids 495 and 496 of the wild-type AGP protein sequence.

17. The variant AGP protein, according to claim 13, wherein said protein concicts essentially of an amino acid sequence selected from the group consisting of SEQ ID NO. 5 and SEQ
ID NO. 3.

18. The variant AGP protein, according to claim 13, wherein said protein is expressed in the endosperm of a plant during seed development.