CA2256523A1 - Galanin receptor galr2 - Google Patents
Galanin receptor galr2 Download PDFInfo
- Publication number
- CA2256523A1 CA2256523A1 CA002256523A CA2256523A CA2256523A1 CA 2256523 A1 CA2256523 A1 CA 2256523A1 CA 002256523 A CA002256523 A CA 002256523A CA 2256523 A CA2256523 A CA 2256523A CA 2256523 A1 CA2256523 A1 CA 2256523A1
- Authority
- CA
- Canada
- Prior art keywords
- leu
- galr2
- galanin
- ala
- receptor
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Abandoned
Links
Landscapes
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Peptides Or Proteins (AREA)
Abstract
The present invention provides a novel galanin receptor protein, the GalR2 receptor. Also provided are the nucleic acid sequences encoding this novel receptor protein as well as methods for using this protein and its nucleic acid sequence, and methods useful for developing and identifying compounds for the treatment of diseases and disorders in which galanin is implicated. The importance of this discovery is manifested in the effects of galanin, which include antinociceptive activity, smooth muscle contraction, cardiovascular activity, pituitary hormone release, cognition, and increased food intake.
Thus, this receptor protein is useful for screening for galanin agonist and antagonist activity for controlling these conditions.
Thus, this receptor protein is useful for screening for galanin agonist and antagonist activity for controlling these conditions.
Description
GALANIN RECEPTOR GalR2 This application claims priority from U.S. Provisional Application No.
60/019946, filed June 5, 1996.
BACKGROUND OF THE INVENTION
1. Field of the Invention This invention relates to a novel neuropeptide galanin receptor and its nucleic acid sequence.
60/019946, filed June 5, 1996.
BACKGROUND OF THE INVENTION
1. Field of the Invention This invention relates to a novel neuropeptide galanin receptor and its nucleic acid sequence.
2. Description of the Related Art Galanin is a 29 amino acid peptide hormone (30 amino acids in human) which is present in a wide range of central and peripheral tissues. Skofitsch, Peptides 6, 509 (1985);
Merchenthaler, Prog. Neurobiol. 40, 711 (1993). Galanin is involved in many diverse physiological functions. Galanin is known to regulate the secretion of both endocrine and exocrine hormones. Galanin inhibits insulin secretion from pancreatic beta cells, and can inhibit pancreatic amylase secretion; in the stomach, galanin inhibits gastrin and somatostatin secretion. Galanin stimulates VIP (vasoactive intestinal protein) release from the hypothalamus, prolactin and growth hormone release from the pituitary; and inhibits the secretion of ACTH in the hypothalamus. Furthermore, the secretion of neurotransmitters can be modulated. For example, galanin can inhibit the release of histamine and norepinephrine in the hypothalamus. Other secondary messenger systems are also regulated:
galanin can either stimulate or inhibit intracellular cAMP accumulation; is involved in the closure of N-and L-type voltage-sensitive calcium channels, and in the opening of ATP-sensitive and -insensitive potassium channels; and has been shown to stimulate the release of calcium from intracellular stores. Moreover, galanin is involved in the inhibition of acetylcholine release and the inhibition of muscarinic receptor-mediated phosphoinositide turnover.
Bartfai, Crit.
Rev. Neurobiol. 7, 229 ( 1993) Galanin is implicated in the modulation of many cognitive and sensory functions.
Galanin has potent antinociceptive effects, and can impair performance in one-trial learning, t-maze, and swim maze learning and memory paradigms. Its inhibition of the anoxic release of glutamate, as well as its inhibitory actions on cholinergic function suggest a role in neuroprotection, and in the development of Alzheimer's Disease. Crawley, Regulatory Peptides 59, 1 (1995). Galanin is known to induce feeding in rodents and, in contrast with the effects of Neuropeptide Y on feeding, galanin increases preference for fat intake.
Akabayashi, Proc. Natl. Acad. Sci. USA 9I, 10375 (1994). Galanin is also involved in the regulation of gastrointestinal smooth muscle contraction. Because of the important role of galanin in these many physiological processes, there is a strong need to further develop materials and methods for investigating the mechanistic behavior of the receptors and for treating diseased and other abnormal states associated with these physiological processes.
Pharmacological data suggest the existence of several galanin receptor subtypes.
Wynick, Proc. Natl. Acad. Sci. USA 90, 423 I ( 1990); Zen-Fa, J. Pharmacol.
Exp. Ther. 272, 371 (1995). Galanin receptors are known to be linked to the G; proteins, and there is some evidence that certain galanin receptor subtypes may be linked to cholera toxin-sensitive GS
proteins. Gillison, Diabetes 43, 24 ( 1994); Chen, Am. J. Physiol. 266, G 113 ( 1994). One galanin receptor has been cloned and it is a member of the seven transmembrane (7TMD) class of G protein-linked receptors. It has been designated as GaIRI. Habert-Ortoli, Proc.
Natl. Acad. Sci. USA 91, 9780; W095/22608. In addition to this human GalRl receptor, the GalRl receptor has been obtained from rat. Burgevin, J. Mol. Neurosci. b, 33 (1995). The in vivo functions mediated through this cloned GaIR 1 receptor have not yet been elucidated.
EP-0711830-A2 disclose a closely-related GalR1 sequence, differing in that CyslS--~Trp is varied.
SUMMARY OF THE INVENTION
The present invention provides a novel galanin receptor protein, the GalR2 receptor.
Also provided are the nucleic acid sequences encoding this novel receptor protein as well as methods for using this protein and its nucleic acid sequence, and methods useful for developing and identifying compounds for the treatment of diseases anc~
;aisorders in which galanin is implicated. The importance of this discovery is manifested txe effects of galanin, which include antinociceptive activity, smooth muscle contrac~;r~n, cardiovascular activity, pituitary hormone release, cognition, and increased food intake.
Thus, this receptor protein is useful for screening for galanin agonist and antagonist activity for controlling these conditions.
In one aspect of the present invention, we provide isolated nucleic acid sequences for a novel galanin receptor, the GalR2 receptor. In particular, we provide the cDNA sequences encoding the complete rat receptor and partial sequences of the human receptor. These nucleic acid sequences have a variety of uses. For example, they are useful for making vectors and for transforming cells, both of which are ultimately useful for production of the GalR2 receptor protein. They are also useful as scientific research tools for developing nucleic acid probes for determining receptor expression levels, e.g., to identify diseased or otherwise abnormal states. They are useful for developing analytical tools such as antisense oligonucleotides for selectively inhibiting expression of the receptor gene to determine physiological responses. The present invention can also be used to isolate the homologous nucleic acid sequence of other species, such as human, primate, dog, mouse, etc.
In another aspect of the present invention, we provide a homogeneous composition comprising the receptor GalR2 protein. The protein is useful for screening drugs for agonist and antagonist activity, and, therefore, for screening for drugs useful in regulating physiological responses associated with the GaIR2 receptor. Specifically, antagonists to the GalR2 receptor could be used to treat obesity and diabetes by reducing appetite and food consumption, whereas agonists could be used for the treatment of anorexic conditions.
Furthermore, drugs could be used to treat Alzheimer's disease, stroke, neuropathic pain, and/or endocrine disorders. The proteins are also useful for developing antibodies for detection of the protein.
Flowing from the foregoing are a number of other aspects of the invention, including (a) vectors, such as plasmids, comprising the receptor GaIR2 nucleic acid sequence that may further comprise additional regulatory elements, e.g., promotors, (b) transformed cells that express the GalR2 receptor, (c) nucleic acid probes, (d) antisense oligonucleotides, (e) agonists, (f) antagonists, and (g) transgenic mammals. Further aspects of the invention comprise methods for making and using the foregoing compounds and compositions.
The invention includes polynucleotide molecules coding for a rat or human GalR2, or a galanin binding fragment thereof. A polynucleotide molecule comprising SEQ
ID NO:1 or a degenerate variant thereof. A polynucleotide molecule comprising the full-length cDNA, or a degenerate variant thereof, corresponding to the partial sequence shown in SEQ ID NO:S.
A purified and isolated rat or human GalR2 protein. The GaIR2 protein comprising SEQ ID
N0:2. The full-length GaIR2 protein, the partial sequence of which is indicated in SEQ ID
N0:6. A purified and isolated rat or human GalR2 protein or fragment thereof having galanin binding activity. A polynucleotide molecule coding for a variant of rat GalR2 comprising SEQ ID N0:3, or a galanin binding fragment thereof. A polynucleotide molecule comprising SEQ ID N0:3 or a degenerate variant thereof. A purified and isolated variant of a rat or human GalR2 protein or fragment thereof having galanin binding activity. A
purified and isolated variant of rat GalR2 protein comprising SEQ ID N0:4.
The foregoing merely summarize certain aspects of the present invention and is not intended, nor should it be construed, to limit the invention in any manner.
All patents and other publications recited herein are hereby incorporated by reference in their entirety.
BRIEF DESCRIPTION OF THE DRAWINGS
Figure 1 is the polynucleotide sequence of rat GalR2 of the invention.
Figure 2 is the amino acid sequence of rat GalR2.
Figures 3-4 are the polynucleotide sequence of the Y 107 variant of rat GalR2.
Figure S is the amino acid sequence of Y107(omitting putative intron).
Figure 6 is the partial polynucleotide sequence of human GalR2.
Figure 7 is the partial amino acid sequence of human GalR2.
Figure 8 is the representative saturation isotherm of ['ZSI]hGalanin binding to rat GalR2 (clone BMB77) transiently expressed in COS-7 cells. The inset shows the corresponding linear Rosenthal plot. B/F axis on the Rosenthal plot indicates the ratio of Bound to Free radioligand.
DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS
The present invention comprises, in part, a novel galanin receptor protein, the GalR2 receptor. Particularly preferred embodiments of the GalR2 receptor are those having an amino acid sequence substantially the same as SEQ ID NO: 2, 4 or 6. As used herein, reference to the GalR2 receptor is meant as a reference to any protein having an amino acid sequence substantially the same as SEQ ID NO: 2, 4 or 6. The present invention also comprises the nucleic acid sequence encoding the GalR2 protein, which nucleic acid sequence is substantially the same as SEQ ID NO: 1, 3 or 5. Receptors SEQ ID
NO: 1 and SEQ ID NO: 3 are nucleic acid sequences of rat GalR2 receptors but SEQ ID NO:
Merchenthaler, Prog. Neurobiol. 40, 711 (1993). Galanin is involved in many diverse physiological functions. Galanin is known to regulate the secretion of both endocrine and exocrine hormones. Galanin inhibits insulin secretion from pancreatic beta cells, and can inhibit pancreatic amylase secretion; in the stomach, galanin inhibits gastrin and somatostatin secretion. Galanin stimulates VIP (vasoactive intestinal protein) release from the hypothalamus, prolactin and growth hormone release from the pituitary; and inhibits the secretion of ACTH in the hypothalamus. Furthermore, the secretion of neurotransmitters can be modulated. For example, galanin can inhibit the release of histamine and norepinephrine in the hypothalamus. Other secondary messenger systems are also regulated:
galanin can either stimulate or inhibit intracellular cAMP accumulation; is involved in the closure of N-and L-type voltage-sensitive calcium channels, and in the opening of ATP-sensitive and -insensitive potassium channels; and has been shown to stimulate the release of calcium from intracellular stores. Moreover, galanin is involved in the inhibition of acetylcholine release and the inhibition of muscarinic receptor-mediated phosphoinositide turnover.
Bartfai, Crit.
Rev. Neurobiol. 7, 229 ( 1993) Galanin is implicated in the modulation of many cognitive and sensory functions.
Galanin has potent antinociceptive effects, and can impair performance in one-trial learning, t-maze, and swim maze learning and memory paradigms. Its inhibition of the anoxic release of glutamate, as well as its inhibitory actions on cholinergic function suggest a role in neuroprotection, and in the development of Alzheimer's Disease. Crawley, Regulatory Peptides 59, 1 (1995). Galanin is known to induce feeding in rodents and, in contrast with the effects of Neuropeptide Y on feeding, galanin increases preference for fat intake.
Akabayashi, Proc. Natl. Acad. Sci. USA 9I, 10375 (1994). Galanin is also involved in the regulation of gastrointestinal smooth muscle contraction. Because of the important role of galanin in these many physiological processes, there is a strong need to further develop materials and methods for investigating the mechanistic behavior of the receptors and for treating diseased and other abnormal states associated with these physiological processes.
Pharmacological data suggest the existence of several galanin receptor subtypes.
Wynick, Proc. Natl. Acad. Sci. USA 90, 423 I ( 1990); Zen-Fa, J. Pharmacol.
Exp. Ther. 272, 371 (1995). Galanin receptors are known to be linked to the G; proteins, and there is some evidence that certain galanin receptor subtypes may be linked to cholera toxin-sensitive GS
proteins. Gillison, Diabetes 43, 24 ( 1994); Chen, Am. J. Physiol. 266, G 113 ( 1994). One galanin receptor has been cloned and it is a member of the seven transmembrane (7TMD) class of G protein-linked receptors. It has been designated as GaIRI. Habert-Ortoli, Proc.
Natl. Acad. Sci. USA 91, 9780; W095/22608. In addition to this human GalRl receptor, the GalRl receptor has been obtained from rat. Burgevin, J. Mol. Neurosci. b, 33 (1995). The in vivo functions mediated through this cloned GaIR 1 receptor have not yet been elucidated.
EP-0711830-A2 disclose a closely-related GalR1 sequence, differing in that CyslS--~Trp is varied.
SUMMARY OF THE INVENTION
The present invention provides a novel galanin receptor protein, the GalR2 receptor.
Also provided are the nucleic acid sequences encoding this novel receptor protein as well as methods for using this protein and its nucleic acid sequence, and methods useful for developing and identifying compounds for the treatment of diseases anc~
;aisorders in which galanin is implicated. The importance of this discovery is manifested txe effects of galanin, which include antinociceptive activity, smooth muscle contrac~;r~n, cardiovascular activity, pituitary hormone release, cognition, and increased food intake.
Thus, this receptor protein is useful for screening for galanin agonist and antagonist activity for controlling these conditions.
In one aspect of the present invention, we provide isolated nucleic acid sequences for a novel galanin receptor, the GalR2 receptor. In particular, we provide the cDNA sequences encoding the complete rat receptor and partial sequences of the human receptor. These nucleic acid sequences have a variety of uses. For example, they are useful for making vectors and for transforming cells, both of which are ultimately useful for production of the GalR2 receptor protein. They are also useful as scientific research tools for developing nucleic acid probes for determining receptor expression levels, e.g., to identify diseased or otherwise abnormal states. They are useful for developing analytical tools such as antisense oligonucleotides for selectively inhibiting expression of the receptor gene to determine physiological responses. The present invention can also be used to isolate the homologous nucleic acid sequence of other species, such as human, primate, dog, mouse, etc.
In another aspect of the present invention, we provide a homogeneous composition comprising the receptor GalR2 protein. The protein is useful for screening drugs for agonist and antagonist activity, and, therefore, for screening for drugs useful in regulating physiological responses associated with the GaIR2 receptor. Specifically, antagonists to the GalR2 receptor could be used to treat obesity and diabetes by reducing appetite and food consumption, whereas agonists could be used for the treatment of anorexic conditions.
Furthermore, drugs could be used to treat Alzheimer's disease, stroke, neuropathic pain, and/or endocrine disorders. The proteins are also useful for developing antibodies for detection of the protein.
Flowing from the foregoing are a number of other aspects of the invention, including (a) vectors, such as plasmids, comprising the receptor GaIR2 nucleic acid sequence that may further comprise additional regulatory elements, e.g., promotors, (b) transformed cells that express the GalR2 receptor, (c) nucleic acid probes, (d) antisense oligonucleotides, (e) agonists, (f) antagonists, and (g) transgenic mammals. Further aspects of the invention comprise methods for making and using the foregoing compounds and compositions.
The invention includes polynucleotide molecules coding for a rat or human GalR2, or a galanin binding fragment thereof. A polynucleotide molecule comprising SEQ
ID NO:1 or a degenerate variant thereof. A polynucleotide molecule comprising the full-length cDNA, or a degenerate variant thereof, corresponding to the partial sequence shown in SEQ ID NO:S.
A purified and isolated rat or human GalR2 protein. The GaIR2 protein comprising SEQ ID
N0:2. The full-length GaIR2 protein, the partial sequence of which is indicated in SEQ ID
N0:6. A purified and isolated rat or human GalR2 protein or fragment thereof having galanin binding activity. A polynucleotide molecule coding for a variant of rat GalR2 comprising SEQ ID N0:3, or a galanin binding fragment thereof. A polynucleotide molecule comprising SEQ ID N0:3 or a degenerate variant thereof. A purified and isolated variant of a rat or human GalR2 protein or fragment thereof having galanin binding activity. A
purified and isolated variant of rat GalR2 protein comprising SEQ ID N0:4.
The foregoing merely summarize certain aspects of the present invention and is not intended, nor should it be construed, to limit the invention in any manner.
All patents and other publications recited herein are hereby incorporated by reference in their entirety.
BRIEF DESCRIPTION OF THE DRAWINGS
Figure 1 is the polynucleotide sequence of rat GalR2 of the invention.
Figure 2 is the amino acid sequence of rat GalR2.
Figures 3-4 are the polynucleotide sequence of the Y 107 variant of rat GalR2.
Figure S is the amino acid sequence of Y107(omitting putative intron).
Figure 6 is the partial polynucleotide sequence of human GalR2.
Figure 7 is the partial amino acid sequence of human GalR2.
Figure 8 is the representative saturation isotherm of ['ZSI]hGalanin binding to rat GalR2 (clone BMB77) transiently expressed in COS-7 cells. The inset shows the corresponding linear Rosenthal plot. B/F axis on the Rosenthal plot indicates the ratio of Bound to Free radioligand.
DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS
The present invention comprises, in part, a novel galanin receptor protein, the GalR2 receptor. Particularly preferred embodiments of the GalR2 receptor are those having an amino acid sequence substantially the same as SEQ ID NO: 2, 4 or 6. As used herein, reference to the GalR2 receptor is meant as a reference to any protein having an amino acid sequence substantially the same as SEQ ID NO: 2, 4 or 6. The present invention also comprises the nucleic acid sequence encoding the GalR2 protein, which nucleic acid sequence is substantially the same as SEQ ID NO: 1, 3 or 5. Receptors SEQ ID
NO: 1 and SEQ ID NO: 3 are nucleic acid sequences of rat GalR2 receptors but SEQ ID NO:
3 appears to contain an intronic region; therefore, SEQ ID NO: 1 is the preferred embodiment of the rat GaIR2 receptor of this invention. Receptor SEQ ID NO: 5 is the partial nucleic acid sequence of human GalR2. Receptors SEQ ID NO: 2 and 4 are rat GalR2 receptors and appear to be allelic variants. Receptor SEQ ID NO: 6 is the partial amino acid sequence of human GalR2.
As used herein, a protein "having an amino acid sequence substantially the same as SEQ ID NO: x" (where "x" is the number of one of the protein sequences recited herein) means a protein whose amino acid sequence is the same as SEQ ID NO: x or differs only in a way such that ICso[galanin] as determined according to the method detailed in Example 2, infra, are less than or equal to 1 nM. Those skilled in the art will appreciate that conservative substitutions of amino acids can be made without significantly diminishing the protein's affinity for galanin and fragments and analogs thereof. Other substitutions may be made that 5 increase the protein's affinity for these compounds. Making and identifying such proteins is a routine matter given the teachings herein, and can be accomplished, for example, by altering the nucleic acid sequence encoding the protein (as disclosed herein), inserting it into a vector, transforming a cell, expressing the nucleic acid sequence, and measuring the binding amity of the resulting protein, all as taught herein.
As used herein the term "a molecule having a nucleotide sequence substantially the same as SEQ ID NO: y" (wherein "y" is the number of one of the protein-encoding nucleotide sequences listed in the Sequence Listing) means a nucleic acid encoding a protein "having an amino acid sequence substantially the same as SEQ ID NO: y*"
(wherein "y*" is the number of the amino acid sequence for which nucleotide sequence "y" codes) as defined above. This definition is intended to encompass natural allelic variations in the GaIR2 sequence. Cloned nucleic acid provided by the present invention may encode GalR2 protein of any species of origin, including (but not limited to), for example, mouse, rat, rabbbit, cat, dog, primate, and human. Preferably the nucleic acid provided by the invention encodes GalR2 receptors of mammalian, and most preferably, rat or human origin.
The invention also includes nucleotide sequences encoding chimeric proteins comprised of parts of the GalR2 receptor and parts of other related seven-transmembrane receptors.
The BMB77 clone (SEQ ID NO: 1) (see Example 1, infra) has a 1.7-kb cDNA insert with a open reading frame from nucleotides 279 to 1394 that encodes a 372 amino acid protein (SEQ ID NO: 2). Hydrophobicity plot analysis using the PEPPLOT
function of GCG
(Genetics Computer Group, Madison, WI) shows that the GaIR2 receptor has seven transmembrane-like domains, indicating it might be a G-protein-coupled receptor. GaIR2 is 26 amino acids longer in length than GaIRI, the only other published galanin receptor. This extra length of amino acids within GalR2 is due to an extended C-terminal tail sequence.
However, the putative N-terminal extracellular domain of GaIR2 is about 7 amino acids shorter than the corresponding region in GaIRl. It is also important to note that the GalR2 sequence shows only 38% amino acid sequence identity to the GaIRI receptor.
The Y107 clone (SEQ ID NO: 3) (see Example 1, infra) has a 1.9-kb cDNA insert with an open reading frame from nucleotides 17-384, and from nucleotides 874-1621. The sequence between nucleotides 384 and 874 contains multiple STOP codons in all three reading frames. Furthermore, the dinucleotides GT and AG at positions 385-386 and 872-873, respectively, fulfill the criteria for being a splice donor and acceptor site, respectively.
Moreover, when the nucleotide sequences 17-384 and 874-1621 are joined together, an open reading frame is formed which has a cognate translation product nearly identical to that of clone BMB77 (SEQ ID NO: 4). Therefore, it is likely that the region between these two open reading frames is an intron.
There is a single nucleotide change between positions 963 in clone BMB77 (SEQ
ID
NO: 1 ) and 1190 in clone Y 107 (SEQ ID NO: 3). This adenine to cytosine transversion results in a change from Serz29 in clone BMB77 (SEQ ID NO: 2) to Arg229 in clone Y107 (SEQ ID NO: 4). Amino acid 229 is located in the third intracellular loop of GalIZ2. The third intracellular loop of other seven transmembrane domain G protein-coupled receptors is an important domain for effecting coupling of the receptor to its G protein.
Bockaert, Curr.
Op. Neurobiol. 1, 32-42 (1991). This polymorphic amino acid position could change the G
protein binding characterisitics of the GaIR2 receptor variants. Gillison, Diabetes 43, 24 ( 1994); Chen, Am. J. Physiol. 266, G 113 ( 1994).
The partial human GalR2 nucleic acid sequence (SEQ ID NO: 5) contains a 337 amino acid opening reading frame. The initial leucine residue of this partial human GalR2 protein (SEQ ID NO: 6) corresponds to amino acid Leus' in rat GalR2 (SEQ ID
NO: 2 and 4).
Nucleic acid hybridization probes provided by the invention are DNAs consisting essentially of the nucleotide sequences complementary to any sequence depicted in SEQ ID
NOa 1 and 3 that is effective in nucleic acid hybridization. Nucleic acid probes are useful for detecting GalR2 gene expression in cells and tissues using techniques well-known in the art, including, but not limited to, Northern blot hybridization, in situ hybridization, and Southern hybridization to reverse transcriptase - polymerase chain reaction product DNAs. The probes provided by the present invention, including oligonucleotide probes derived therefrom, are also useful for Southern hybridization of mammalian, preferably human, genomic DNA for screening for restriction fragment length polymorphism (RFLP) associated with certain genetic disorders. As used herein, the term complementary means a nucleic acid having a sequence that is sufficiently complementary in the Watson-Crick sense to a target nucleic acid to bind to the target under physiological conditions or experimental conditions which those skilled in the art routinely use when employing probes.
WO 97!46681 PCT/US97/09787 Receptor GalR2 binds various fragments and analogs of galanin with affinities different from that of the known receptors. The rank order of binding affinity of receptor GalR2 was found to be:
galanin = (2-29)galanin > ( I - I S)galanin » (3-29)galanin Table 1, infra, presents a more detailed affinity profile of the GalR2 receptor for galanin and various fragments thereof. As used herein, a protein having substantially the same affinity profile as the GalR2 receptor means a protein in which the ICso of each of the peptides listed in Table I , infra, is no more than an order of magnitude greater than those listed in Table I
for each of the respective peptides as measured according to the methods described in Example 2.
The production of proteins such as receptor GalR2 from cloned genes by genetic engineering means is well known in this art. The discussion which follows is accordingly intended as an overview of this field, and is not intended to reflect the full state of the art.
DNA which encodes receptor GalR2 may be obtained, in view of the instant disclosure, by chemical synthesis, by screening reverse transcripts of mRNA
from appropriate cells or cell line cultures, by screening genomic libraries from appropriate cells, or by combinations of these procedures, as illustrated below. Screening of mRNA or genomic DNA may be carried out with oligonucleotide probes generated from the GalR2 gene sequence information provided herein. Probes may be labeled with a detectable group such as a fluorescent group, a radioactive atom or a chemiluminescent group in accordance with known procedures and used in conventional hybridization assays, as described in greater detail in the Examples below. In the alternative, the GalR2 gene sequence may be obtained by use of the polymerase chain reaction (PCR) procedure, with the PCR
oligonucleotide primers being produced from the GalR2 gene sequence provided herein. See U.S.
Patent Nos.
As used herein, a protein "having an amino acid sequence substantially the same as SEQ ID NO: x" (where "x" is the number of one of the protein sequences recited herein) means a protein whose amino acid sequence is the same as SEQ ID NO: x or differs only in a way such that ICso[galanin] as determined according to the method detailed in Example 2, infra, are less than or equal to 1 nM. Those skilled in the art will appreciate that conservative substitutions of amino acids can be made without significantly diminishing the protein's affinity for galanin and fragments and analogs thereof. Other substitutions may be made that 5 increase the protein's affinity for these compounds. Making and identifying such proteins is a routine matter given the teachings herein, and can be accomplished, for example, by altering the nucleic acid sequence encoding the protein (as disclosed herein), inserting it into a vector, transforming a cell, expressing the nucleic acid sequence, and measuring the binding amity of the resulting protein, all as taught herein.
As used herein the term "a molecule having a nucleotide sequence substantially the same as SEQ ID NO: y" (wherein "y" is the number of one of the protein-encoding nucleotide sequences listed in the Sequence Listing) means a nucleic acid encoding a protein "having an amino acid sequence substantially the same as SEQ ID NO: y*"
(wherein "y*" is the number of the amino acid sequence for which nucleotide sequence "y" codes) as defined above. This definition is intended to encompass natural allelic variations in the GaIR2 sequence. Cloned nucleic acid provided by the present invention may encode GalR2 protein of any species of origin, including (but not limited to), for example, mouse, rat, rabbbit, cat, dog, primate, and human. Preferably the nucleic acid provided by the invention encodes GalR2 receptors of mammalian, and most preferably, rat or human origin.
The invention also includes nucleotide sequences encoding chimeric proteins comprised of parts of the GalR2 receptor and parts of other related seven-transmembrane receptors.
The BMB77 clone (SEQ ID NO: 1) (see Example 1, infra) has a 1.7-kb cDNA insert with a open reading frame from nucleotides 279 to 1394 that encodes a 372 amino acid protein (SEQ ID NO: 2). Hydrophobicity plot analysis using the PEPPLOT
function of GCG
(Genetics Computer Group, Madison, WI) shows that the GaIR2 receptor has seven transmembrane-like domains, indicating it might be a G-protein-coupled receptor. GaIR2 is 26 amino acids longer in length than GaIRI, the only other published galanin receptor. This extra length of amino acids within GalR2 is due to an extended C-terminal tail sequence.
However, the putative N-terminal extracellular domain of GaIR2 is about 7 amino acids shorter than the corresponding region in GaIRl. It is also important to note that the GalR2 sequence shows only 38% amino acid sequence identity to the GaIRI receptor.
The Y107 clone (SEQ ID NO: 3) (see Example 1, infra) has a 1.9-kb cDNA insert with an open reading frame from nucleotides 17-384, and from nucleotides 874-1621. The sequence between nucleotides 384 and 874 contains multiple STOP codons in all three reading frames. Furthermore, the dinucleotides GT and AG at positions 385-386 and 872-873, respectively, fulfill the criteria for being a splice donor and acceptor site, respectively.
Moreover, when the nucleotide sequences 17-384 and 874-1621 are joined together, an open reading frame is formed which has a cognate translation product nearly identical to that of clone BMB77 (SEQ ID NO: 4). Therefore, it is likely that the region between these two open reading frames is an intron.
There is a single nucleotide change between positions 963 in clone BMB77 (SEQ
ID
NO: 1 ) and 1190 in clone Y 107 (SEQ ID NO: 3). This adenine to cytosine transversion results in a change from Serz29 in clone BMB77 (SEQ ID NO: 2) to Arg229 in clone Y107 (SEQ ID NO: 4). Amino acid 229 is located in the third intracellular loop of GalIZ2. The third intracellular loop of other seven transmembrane domain G protein-coupled receptors is an important domain for effecting coupling of the receptor to its G protein.
Bockaert, Curr.
Op. Neurobiol. 1, 32-42 (1991). This polymorphic amino acid position could change the G
protein binding characterisitics of the GaIR2 receptor variants. Gillison, Diabetes 43, 24 ( 1994); Chen, Am. J. Physiol. 266, G 113 ( 1994).
The partial human GalR2 nucleic acid sequence (SEQ ID NO: 5) contains a 337 amino acid opening reading frame. The initial leucine residue of this partial human GalR2 protein (SEQ ID NO: 6) corresponds to amino acid Leus' in rat GalR2 (SEQ ID
NO: 2 and 4).
Nucleic acid hybridization probes provided by the invention are DNAs consisting essentially of the nucleotide sequences complementary to any sequence depicted in SEQ ID
NOa 1 and 3 that is effective in nucleic acid hybridization. Nucleic acid probes are useful for detecting GalR2 gene expression in cells and tissues using techniques well-known in the art, including, but not limited to, Northern blot hybridization, in situ hybridization, and Southern hybridization to reverse transcriptase - polymerase chain reaction product DNAs. The probes provided by the present invention, including oligonucleotide probes derived therefrom, are also useful for Southern hybridization of mammalian, preferably human, genomic DNA for screening for restriction fragment length polymorphism (RFLP) associated with certain genetic disorders. As used herein, the term complementary means a nucleic acid having a sequence that is sufficiently complementary in the Watson-Crick sense to a target nucleic acid to bind to the target under physiological conditions or experimental conditions which those skilled in the art routinely use when employing probes.
WO 97!46681 PCT/US97/09787 Receptor GalR2 binds various fragments and analogs of galanin with affinities different from that of the known receptors. The rank order of binding affinity of receptor GalR2 was found to be:
galanin = (2-29)galanin > ( I - I S)galanin » (3-29)galanin Table 1, infra, presents a more detailed affinity profile of the GalR2 receptor for galanin and various fragments thereof. As used herein, a protein having substantially the same affinity profile as the GalR2 receptor means a protein in which the ICso of each of the peptides listed in Table I , infra, is no more than an order of magnitude greater than those listed in Table I
for each of the respective peptides as measured according to the methods described in Example 2.
The production of proteins such as receptor GalR2 from cloned genes by genetic engineering means is well known in this art. The discussion which follows is accordingly intended as an overview of this field, and is not intended to reflect the full state of the art.
DNA which encodes receptor GalR2 may be obtained, in view of the instant disclosure, by chemical synthesis, by screening reverse transcripts of mRNA
from appropriate cells or cell line cultures, by screening genomic libraries from appropriate cells, or by combinations of these procedures, as illustrated below. Screening of mRNA or genomic DNA may be carried out with oligonucleotide probes generated from the GalR2 gene sequence information provided herein. Probes may be labeled with a detectable group such as a fluorescent group, a radioactive atom or a chemiluminescent group in accordance with known procedures and used in conventional hybridization assays, as described in greater detail in the Examples below. In the alternative, the GalR2 gene sequence may be obtained by use of the polymerase chain reaction (PCR) procedure, with the PCR
oligonucleotide primers being produced from the GalR2 gene sequence provided herein. See U.S.
Patent Nos.
4,683,195 to MuIlis et al. and 4,683,202 to Mullis.
Receptor GalR2 may be synthesized in host cells transformed with a :ecombinant expression construct comprising a nucleic acid encoding the receptor GalR2.
Such a recombinant expression construct can also be comprised of a vector that is a replicable DNA
construct. Vectors are used herein either to amplify DNA encoding GalR2 and/or to express DNA which encodes GaIR2. For the purposes of this invention, a recombinant expression construct is a replicable DNA construct in which a DNA sequence encoding GalR2 is operably linked to suitable control sequences capable of effecting the expression of GalR2 in WO 97/46681 . PCT/US97/0978?
a suitable host. The need for such control sequences will vary depending upon the host selected and the transformation method chosen. Generally, control sequences include a transcriptional promoter, an optional operator sequence to control transcription, a sequence encoding suitable mRNA ribosomal binding sites, and sequences which control the termination of transcription and translation. Amplification vectors do not require expression control domains. All that is needed is the ability to replicate in a host, usually conferred by an origin of replication, and a selection gene to facilitate recognition of transformants. See, Sambrook et al., Molecular Cloning: A Laboratory Manual (2nd Edition, Cold Spring Harbor Press, New York, 1989).
Vectors useful for practicing the present invention include plasmids, viruses (including phage), retroviruses, and integratable DNA fragments (i.e., fragments integratable into the host genome by homologous recombination). The vector replicates and functions independently of the host genome, or may, in some instances, integrate into the genome itself.
Suitable vectors will contain replicon and control sequences which are derived from species compatible with the intended expression host. The vectors may be self replicating. Suitable vectors for the purposes of the present invention include pBluescript, pcDNA3, pSV-SPORT, and, for insect cells, baculovirus. A preferred vector is the plasmid pcDNA3 (Invitrogen, San Diego, CA).
Construction of suitable vectors containing the desired coding and control sequences employs standard ligation and restriction techniques that are well understood in the art.
Isolated plasmids, DNA sequences, or synthesized oligonucleotides are cleaved, tailored, and relegated in the form desired.
Site-specific DNA cleavage is performed by treating with the suitable restriction enzyme (or enzymes) under conditions that are generally understood in the art, and the particulars of which are specified by the manufacturer of these commercially available restriction enzymes. See, e.g., New England Biolabs, Product Catalog. In general, about 1 ,ug of plasmid or DNA sequence is cleaved by one unit of enzyme in about 20 ,ul of buffer solution. Often excess of restriction enzyme is used to ensure complete digestion of the DNA
substrate. Incubation times of about one hour to two hours at about 37°C are workable, although variations are tolerable. After each incubation, protein is removed by extraction with phenoUchloroform, and may be followed by ether extraction. The nucleic acid may be recovered from aqueous fractions by precipitation with ethanol. If desired, size separation of the cleaved fragments may be performed by polyacrylamide gel or agarose gel electrophoresis using standard techniques. A general description of size separations is found in Methods in Enrymology 65, 499-560 ( 1980).
Transformed host cells are cells which have been transformed or transfected with recombinant expression constructs made using recombinant DNA techniques and comprising mammalian GalR2-encoding sequences. Preferred host cells for transient transfection are COS-7 cells. Transformed host cells may ordinarily express GalR2, but host cells transformed for purposes of cloning or amplifying nucleic acid hybridization probe DNA
need not express the receptor. When expressed, the mammalian GalR2 protein will typically be located in the host cell membrane. See, Sambrook et al., ibid.
Cultures of cells derived from multicellular organisms are desirable hosts for recombinant GalR2 protein synthesis. In principal, any higher eukaryotic cell culture is workable, whether from vertebrate or invertebrate culture. However, mammalian cells are preferred, as illustrated in the Examples. Propagation of such cells in cell culture has become a routine procedure. See Tissue Culture (Academic Press, Kruse & Patterson, Eds., 1973).
Examples of useful host cell lines are bacteria cells, insect cells, yeast cells, human 293 cells, VERO and HeLa cells, LMTK' cells, and WI138, BHK, CHO, COS-7, CV, and MDCK
cell lines (American Type Culture Collection, Rockville, MD). CHO cells are preferred.
The invention provides homogeneous compositions of mammalian GalR2 produced by transformed eukaryotic cells as provided herein. Such homogeneous compositions are intended to be comprised of mammalian GalR2 protein that comprises at least 90% of the protein in such homogenous composition. The invention also provides membrane preparation from cells expressing GalR2 as the result of transformation with a recombinant expression construct, as described here.
Mammalian GalR2 protein made from cloned genes in accordance with the present invention may be used for screening compounds for GalR2 agonist or antagonist activity, or for determining the amount of a GalR2 agonist or antagonist drug in a solution (e.g., blood plasma or serum). For example, host cells may be transformed with a recombinant expression construct of the present invention, GalR2 protein expressed in those host cells, the cells lysed, and the membranes from those cells used to screen compounds for GalR2 binding activity. Competitive binding assays in which such procedures may be carried out are well known in the art. By selection of host cells which do not ordinarily express GalR2, pure or crude preparations of membranes containing GalR2 can be obtained. Further, GalR2 agonists and antagonists can be identified by transforming host cells with a recombinant expression construct as provided by the present invention. Membranes obtained from such cells (and membranes of intact cells) can be used in binding studies wherein the drug dissociation activity is monitored.
It is known that the neurotransmitter galanin is a regulator of appetite, cognition, 5 endocrine function, pain, and smooth muscle control. As shown herein, the various galanin analogs/fragments that induce these physiological responses bind with a high affinity to the GalR2 receptor. It is therefore evident that by modulating the activity of the GalR2 receptor, various physiological activities can be regulated. Specifically, antagonists to the GaIIR2 receptor, identified by the methods described herein, could be used to treat obesity, diabetes, 10 hyperlipidemia, stroke, neuropathic pain, Alzheimer's disease, and/or endocrine disorders.
This invention provides a pharmaceutical composition comprising an effective amount of a drug identified by the method described herein and a pharmaceutically acceptable carrier. Such drugs and carrier can be administered by various routes, for example oral, subcutaneous, intramuscular, intravenous or intracerebral. The preferred route of administration would be oral at daily doses of about 0.01-100 mglkg.
This invention provides a method of treating obesity, diabetes, hyperlipidemia, stroke, neuropathic pain, Alzheimer's disease, or endocrine disorders wherein the abnormality is improved by reducing the activity of GalR2 receptor or blocking the binding of ligands to a GalR2 receptor which comprises administering an effective amount of the pharmaceutical composition described above.
The recombinant expression constructs of the present invention are useful in molecular biology to transform cells which do not ordinarily express GaIR2 to thereafter express this receptor. Such cells are useful as intermediates for making cell membrane preparations useful for receptor binding assays, which are in turn useful for drug screening.
Drugs identified from such receptor assays can be used for the treatment of obesity, diabetes, anorexia, hyperlipidemia, stroke, neuropathic pain, Alzheimer's disease, or endocrine disorders.
The recombinant expression constructs of the present invention are also useful in gene therapy. Cloned genes of the present invention, or fragments thereof, may also be used in gene therapy carried out by homologous recombination or site-directed mutagenesis. See generally Thomas & Capecchi, Cell 51, 503-512 (1987); Bertling, Bioscience Reports 7, 107-112 (1987); Smithies et al., Nature 3I7, 230-234 (1985).
. Oligonucleotides of the present invention are useful as diagnostic tools for probing WO 97!46681 PCT/US97/09787 GallZ2 gene expression in tissues. For example, tissues are probed in situ with oligonucleotide probes carrying detectable groups by conventional autoradiographic techniques, as explained in greater detail in the Examples below, to investigate native ' expression of this receptor or pathological conditions relating thereto.
Further, chromosomes can be probed to investigate the presence or absence of the GaIR2 gene, and potential pathological conditions related thereto, as also illustrated by the Examples below. Probes according to the invention should generally be at least about 15 nucleotides in length to prevent binding to random sequences, but, under the appropriate circumstances may be smaller.
The invention also provides antibodies that are immunologically reactive to a mammalian GalR2, preferably rat or human GaIR2. The antibodies provided by the invention are raised in animals by inoculation with cells that express a mammalian GalIZ2 or epitopes thereof, using methods well known in the art. Animals that are used for such inoculations include individuals from species comprising cows, sheep, pigs, mice, rats, rabbits, hamsters, goats and primates. Preferred animals for inoculation are rodents (including mice, rats, hamsters) and rabbits. The most preferred animal is the mouse.
Cells that can be used for such inoculations, or for any of the other means used in the invention, include any cell line which naturally expresses a mammalian GalR2, or any cell or cell line that expresses a mammalian GalR2 or any epitope thereof as a result of molecular or genetic engineering, or that has been treated to increase the expression of a mammalian GaIR2 by physical, biochemical or genetic means. Preferred cells are human cells, most preferably HEK 293 cells that have been transformed with a recombinant expression construct comprising a nucleic acid encoding a mammalian GalR2, preferably a rat or human GaIR2, and that express the mammalian GalR2 gene product.
The present invention provides monoclonal antibodies that are immunologically reactive with an epitope of mammalian GalR2 or fragment thereof and that is present on the surface of mammalian cells, preferably human or mouse cells. These antibodies are made using methods and techniques well known to those of skill in the art.
Monoclonal antibodies provided by the present invention are produced by hybridoma cell lines, that are also provided by the invention and that are made by methods well known in the art. Hybridoma cell lines are made by fusing individual cells of a myeloma cell line with spleen cells derived from animals immunized with cells expressing the GaIR2 receptor, preferably rat or human cells, as described above. The myeloma cell lines used in the invention include lines derived from myelomas of mice, rats, hamsters, primates and humans.
Preferred myeloma cell lines are from mouse. The animals from whom spleens are obtained after immunization are rats, mice and hamsters, preferably mice, most preferably Balb/c mice.
Spleen cells and myeloma cells are fused using a number of methods well known in the art, S including but not limited to incubation with inactivated Sendai virus and incubation in the presence of polyethylene glycol (PEG). The most preferred method for cell fusion is incubation in the presence of a solution of 45% (w/v) PEG-1450. Monoclonal antibodies produced by hybridoma cell lines can be harvested from cell culture supernatant fluids from in vitro cell growth; alternatively, hybridoma cells can be injected subcutaneously and/or into the peritoneal cavity of an animal, most preferably a mouse, and the monoclonal antibodies obtained from blood and/or ascites fluid.
Monoclonal antibodies provided by the present invention are also produced by recombinant genetic methods well known to those of skill in the art, and the present invention encompasses antibodies made by such methods that are immunologically reactive with an epitope of a mammalian GalR2.
The present invention encompasses fragments of the antibody that are immunologically reactive with an epitope of a mammalian GalR2. Such fragments are produced by any number of methods, including but not limited to proteolytic cleavage, chemical synthesis or preparation of such fragments by means of genetic engineering technology. The present invention also encompasses single-chain antibodies that are immunologically reactive with an epitope of a mammalian GalR2 made by methods known to those of skill in the art.
The present invention also encompasses an epitope of a mammalian GalR2 that is comprised of sequences and/or a conformation of sequences present in the mammalian GalR2 molecule. This epitope may be naturally occurring, or may be the result of proteolytic cleavage of the mammalian GaIR2 molecule and isolation of an epitope-containing peptide or may be obtained by synthesis of an epitope-containing peptide using methods well known to those skilled in the art. The present invention also encompasses epitope peptides produced as a result of genetic engineering technology and synthesized by genetically engineered prokaryotic or eukaryotic cells.
The invention also includes chimeric antibodies, comprised of Iight chain and heavy chain peptides immunologically reactive to an epitope that is a mammalian GalR2. The chimeric antibodies embodied in the present invention include those that are derived from naturally occurring antibodies as well as chimeric antibodies made by means of genetic engineering technology well known to those of skill in the art.
Also provided by the present invention are non-human transgenic animals grown from germ cells transformed with the GaIR2 nucleic acid sequence according to the invention and that express the GaLR2 receptor according to the invention and offspring and descendants thereof. Also provided are transgenic non-human mammals comprising a homologous recombination knockout of the native GalR2 receptor, as well as transgenic non-human mammals grown from germ cells transformed with nucleic acid antisense to the GalR2 nucleic acid of the invention and offspring and descendants thereof. Further included as part of the present invention are transgenic animals which the native GalR2 receptor has been replaced with the human homolog. Of course, offspring and descendants of all of the foregoing transgenic animals are also encompassed by the invention.
Transgenic animals according to the invention can be made using well known techniques with the nucleic acids disclosed herein. E.g., Leder et al., U.S.
Patent Nos.
4,736,866 and 5,175,383; Hogan et al., Manipulating the Mouse Embryo, A
Laboratory Manual (Cold Spring Harbor Laboratory (19$6)); Capecchi, Science 244, 1288 (1989); and Zimmer and Gruss, Nature 338, 150 (1989). Such transgenic animals are useful for screening for and determining the physiological effects of GalR2 receptor agonists and antogonist.
Consequently, such transgenic animals are useful for developing drugs to regulate physiological activities in which galanin participates.
. The following Examples are provided for illustrative purposes only and are not intended, nor should they be construed, as limiting the invention in any manner.
EXAMPLES
Example Z: Isolation and Sequencing of Rat GalR2 Receptor An expression cloning strategy was used to clone the novel galanin receptor from a rat hypothalamus cDNA Library. RNA was obtained from 9 frozen rat hypothalami weighing a total of 0.87 grams. Poly(A) RNA was isolated directly from the tissue using the Promega PolyATtract System 1000 kit (Promega (Madison, WI) Z5420). The hypothalami were homogenized in 4 mL of 4M guanidine thiocyanate-25mM sodium citrate, pH 7.1-2%
mercaptoethanol using a Polytron at full-speed for approximately 1 minute. To the . homogenized tissue 8 mL of 4M guanidine thiocyanate-25mM sodium citrate, pH
7.1-1% 13-mercaptoethanol which had been preheated to 70°C was added. After mixing thoroughly, 870 pmol biotinylated oligo(dT) was added; the mixture was incubated at 70°C for 5 minutes.
The homogenate was subjected to centrifugation at 12000 x g for 10 minutes at room temperatwe; the homogenate was transferred to a clean tube and 10.44 mL
Streptavidin MAGNESPHERE~ Paramagnetic Particles (SA-PMPs) which had been prepared as per the published protocol was added. (Promega Corporation (Madison, WI) published protocol TM
228). The homogenate and SA-PMPs were incubated together for 2 minutes at room temperature after which the homogenate was decanted while the SA-PMP-biotinylated oligo(dT)-hypothalamic poly(A) RNA complex was retained in the tube by a magnetic stand.
The complex was washed as per the protocol, after which the RNA was precipitated and resuspended in water. 25 micrograms of this poly(A) RNA was used by Invitrogen (Invitrogen Corporation, San Diego, CA) to prepare a cDNA expression library.
The protocols used by Invitrogen to prepare the cDNA library are essentially based upon the procedures of Okayama and Berg (Molec. Cell. Biol. 2, 161 (1982)) and Gubler and Hoffman (Gene 25, 263 (1983)) (Invitrogen Corporation (San Diego, CA) publications 130813sa and 130928sa). An oligo(dT) anchor primer was used for reverse transcription, and the library was cloned unidirectionally into pcDNA3 vector which contains a CMV
(cytomegalovirus) promoter for eukaryotic expression. The cDNA library had 5.3 x 105 primary recombinants with an average insert size of 2.59 kb.
Isolation o a nove~,galanin recewtor cDNA clone 1. Homology cloning strategy In order to isolate novel receptors) for gal4... an, approximately 2 million phage plaques of a rat small intestine library (Stratagene (La Jolla, CA) 936'08) were screened with rat GalRl coding sequence DNA as probe under low stringency conditions (30%
formamide, 6X SSC (0.9M NaCU0.09M NaCitrate), 0.1% N-lauroyl sarcosine, 0.2% SDS, 3%
blocking reagent.) The probe was prepared by digesting the parent GaIRI plasmid with SacI and AccI, separating the fragments by agarose gel electrophoresis, and purifying the 1-kb SacI-AccI
fragment from the gel. The probe was labeled with digoxigenin dUTP according to the manufacturer's instructions (GENIUS Kit, Boehringer Mannheim, Indianapolis, IN, PN 1093 657). The filter lifts, denaturation, neutralization, hybridization, and washing were done according to the manufacturer's instructions except that hybridization was done at 30°C and the washes were performed twice for 40 minutes each: once at room temperature;
the second at 37°C.
One plaque containing DNA homologous to the probe was purified and subcloned into pBluescript vector (Stratagene (La Jolla, California) 212206) by standard molecular ' biological techniques. This clone, designated SI2I 12, was subjected to sequence analysis and S was found to contain a sequence which had characteristics of a novel, but truncated member of the G-protein-coupled 7TMD receptor family. This clone was later used as probe to detenmine the identity of a novel galanin-binding clone (Y107) found in the expression cloning strategy (see below.) The partial human GalR2 cDNA was obtained by screening approximately two 10 million phage of a human small intestine library (Clontech (Palo Alto, CA) HL 1133a) were screened with a human GalR2 probe obtained by PCR amplification from human genomic DNA. The conditions used were essentially as described for the rat GalR2 isolation.
2. Expression cloning strategy 15 The rat hypothalamus cDNA library was plated on the Luria Broth/Ampicillin (GIBCO) plates in pools of 1,OOO~independent colonies. The plates were incubated at 37°C
for about 20 hours and the bacteria from each plate were scraped in 4-5 ml LB/Ampicillin media. Two ml of the bacteria samples were used for plasmid preparation and one ml of each pool was stored at -80°C in 15% glycerol.
COS-7 cells were grown in Dulbecco's Modified Eagle Medium (DMEM, GIBCO
{Gaithersburg, MD) 11965-092), IO% fetal bovine serum (GIBCO {Gaithersburg, MD) 16000-028), and IX antibiotic/antimycotic solution (GIBCO (Gaithersburg, MD) 039). Cells were maintained by trypsinizing and splitting at 50 to 70%
confluency.
Twenty-four hours before transfection, cells were plated into flaskette chambers (Nunc, Inc. (Naperville, IL) 177453) at 3x105 cells/flaskette (equivalent to 3x104 cells/cmz).
Two ~g of plasmid DNA from each pool was transfected into the cells using 10 ~cl of Lipofectamine (GIBCO (Gaithersburg, MD) 18324-012) according to the manufacturer's protocol.
Forty-eight hours after transfection, the ['Z5I]galanin binding assay was performed in the flaskette chamber. The cells were washed once with 25 mM Tris-HCI, 10 mM
MgCl2, pH
7.4, and blocked for 1 S minutes with 1 ml total binding buffer (25 mM Tris-HCI, 10 mM
MgCl2, 1 % bovine serum albumin, pH 7.4) at room temperature. After aspirating off the blocking solution, 1 ml of binding buffer containing 100 pM 'Z5I-hGalanin (NEN
DuPont (Boston, MA) NEX-333) was added and flasks were incubated at room temperature for 90 minutes. Following the incubation, the labeling buffer was removed and the flaskettes were rinsed (approximately 2 mL per flaskette) four times with ice-cold binding buffer. After a final rinse with ice-cold phosphate buffered saline (PBS)(GIBCO (Gaithersburg, MD) 14190-136), the cells were fixed with ice-cold PBS/1 % glutaraldehyde (Sigma (St.
Louis, MO) G5882). The solution was removed and residual glutaraldehyde rinsed away with one wash of ice-cold PBS/0.5 M Ttis (pH 7.5) followed by one wash of ice-cold PBS.
After separating the slide bases from their tops, the slides were dipped in 0.5% gelatin at 42°C and dried under vacuum. The dried slides were dipped in photographic emulsion (NTB-2) (Kodak (Rochester, NY) 165 4433) diluted 1:1 in 0.02% Aerosol-OT (Sigma (St. Louis, MO) A6627) at 42 °C, dried at room temperature for 1 hour, and exposed in the darkbox for four or five days at 4°C. After sufficient exposure time, the darkbox was brought to room temperature for 1 hour after which the slides were developed in D-19 developer (Kodak (Rochester, NY) 146 4593) for three minutes at 15°C, placed in fixer (Kodak (Rochester, NY) 197 1746) for three minutes at I 5 °C, washed in water, and air dried. Cells were stained with Diff Quik stain set (Baxter (McGaw Park, IL) B4132-I) and air dried. Slides were dipped into xylenes and mounted with DPX mountant (Electron Microscopy Sciences (Fort Washington, PA) 13510). Positive cells were identified using dark field microscopy.
Two positive pools were identified. Since the hypothalamus could express different subtypes of galanin receptor, we analyzed the positive pools for GaIRI
receptors by PCR and homology. Of the 2 positive pools tested as described above, 1 contained GalRl as detenmined by PCR and homology analyses. However, the other pool (Y107) was negative for GalRl by PCR, but homologous to SI2112 probe (see Homology strategy, above).
Because: 1) SI2112 sequence indicated it was likely a novel, albeit truncated and unexpressible, G-protein-coupled receptor; 2) pool YI07 DNA showed homology to the SI2112 probe; and, 3) DNA from pool Y107, when used to transiently transfect COS-7 cells, conferred the ability upon the cells to bind galanin, it was deduced that the clone within pool Y107, which conferred gaIanin-binding ability when expressed, was likely to be an expressible version of the SI2112 clone. Therefore, clones from pool Y107 were probed with radiolabeled DNA prepared from SI2112, and a single clone hybridizing to the SI2112 probe was purified from non-homologous clones. This clone was called Y107.
Sequence analysis of clone Y107 (SEQ ID NO: 3) revealed the presence of one intron of 489-by length, beginning after nucleotide 384 (the second nucleotide of the codon for amino acid 133, an arginine residue). Using Y107 DNA as probe, an intronless version of the Y107 cDNA was obtained from a PCI2 cell cDNA library by homology cloning. The first intronless version of the Y107 was in the pSV-SPORT vector (GIBCO
(Gaithersburg, MD) ' 15386-014); the complete cDNA insert of this clone was subcloned into the pcDNA3 vector (Invitrogen (San Diego, CA) V790-20) in order to maintain, for subsequent pharamacological analyses, common vector and promoter (CMV) backgrounds amongst our clones. The intronless clone in pSV-SPORT was designated BMB77.sv40; the intronless clone contained within pcDNA3 is named BMB77. Clones BMB77 and Y107 differ by one amino acid in sequence. Pharmacological analyses have been performed with both the Y107 (SEQ
ID NO:
3 and 4) and BMB77 {SEQ ID NO: 1 and 2) clones.
DNA and DBDtIdB SPo»y»roc ns~ajy~ls Plasmid DNA was sequenced by Lark Technologies Inc. (Houston, Texas) and Biotechnology Resource Laboratory of Yale University (New Haven, CT) using Sequenase Kit (LJS Biochemical (Cleveland, OH) 70770) or Applied Biosystems' automatic sequencer system (Model 373A). The peptide sequence was deduced from the long open-reading-frame of the nucleotide sequence. DNA and peptide sequences were analyzed using the GCG
program (Genetics Computer Group, Madison, WI). The results are embodied in SEQ ID
NO: 1 (the nucleic acid sequence of'clone BMB77), SEQ ID NO: 2 (the amino acid sequence of clone BMB77), SEQ ID NO: 3 (the nucleic acid sequence of clone Y107), SEQ
ID NO: 4 (the amino acid sequence, omitting the putative intronic region, of clone Y107), SEQ ID NO:
5 (the partial nucleic acid sequence of human GaIR2), and SEQ ID NO: 6 (the partial amino acid sequence of human GalR2).
Example 2: Pharmacological Characterization of the Novel Rat Galanin Receptor Iransient TrancfP~i:~H
Monkey kidney cells (COS-7) were maintained in T-175 cm2 flasks (Nunc, Inc.
(Naperville, IL) 171226) at 37°C with 5% COZ in a humidified atmosphere. Cells were grown in Dulbecco's Modified Eagle Medium (DMEM) (GIBCO (Gaithersburg, MD) 092) supplemented with 2 mM glutamine, 10% fetal bovine serum, 1 mM sodium pyruvate and a antibiotic/antimycotic comprised of pennicillin/streptomycin/amphotericinB (GIBCO, Gaithersburg, MD, PN 15240-013). Cells at 70% confluency were transfected with rat GalR2 DNA using the Lipofectamine reagent (GIBCO (Gaithersburg, MD) 18324-012). I S
pg of DNA and 90 pl of lipofectamine were added to each flask. Media was replaced 24 hours post transfection, and membranes were harvested 24 hours later.
Stable EYbre ctn'ofthe Rat mlR7 Ror ~~lelone BMB77) 293 cells (human embryonic kidney, ATCC) were plated onto a T-25 flask one day prior to transfection, such that they were 50-70% confluent at the time of transfection. 15 ug of rat GalR2 (BMB77) DNA were added to 0.3 ml of Optimem I culture media (GIBCO Life Sciences), and 25 ul of lipofectamine were added to 0.3 ml of Optimem I. The DNA and lipofectamine solutions were combined and incubated at room temperature for 20 minutes.
An additional 2.4 ml of Optimem I was added to the DNA/lipofectamine mixture.
The media was aspirated from T-25 flask containing 293 cells, washed with Optimem I, and the DNA/lipofectamine mixture was added to the 293 cells. After a S-6 hour incubation in a 37°C incubator (5% COZ) for 5-6 hours, the DNA/lipofectamine mixture was replaced with culture media (DMEM, 10% fetal bovine serum, 2 mM glutamine and I S antibiotic/antimycotic.) The day following transfection, the media was replaced with selecting media (culture media with the addition of 350 uglml of Geneticin G-418), and the flask was returned to the 37°C / 5% COZ incubator. When discrete colonies became apparent, cells were pooled.
Growth was monitored, followed by cloning by limited dilution, such that an average of one cell was seeded in each well of a 96-well microtiter culture plate. After about 21 days in culture under selection conditions, those wells containing single colonies were selected and transferred to 24-well culture plates pretreated with poly-1-lysine, following trypsinization.
Each of these clones was propagated until sufficient quantities were available for testing in the ['ZS I]galanin binding assay, from which one particular clone designated 293-rGalR2-1 was selected on the basis of its high level of receptor expression.
Membrane Prey ar ' The media was removed from each flask of transfected cells, and the cells were washed twice with 20 ml ice-cold phosphate buffered saline. The cells were scraped from the flask in S ml of Tris buffer (20 mM Tris-HCI, 5 mM EDTA, pH 7.7), and then transferred to a centrifuge tube. Each flask was rinsed with an additional 5 ml of Tris buffer, and combined in the centrifuge tube. The cells were homogenized in a Polytron PT-3000 (Brinkman Instruments, Mill Valley, New York) for 2 x 10 seconds (12 mM probe, 7000-8000 rpm) and centrifuged at 20,000 x g for 30 minutes at 4°C. The pellet was resuspended in fresh Tris buffer, and centrifuged again at 20,000 x g for 30 minutes at 4°C.
Protein concentration was measured using the Bio-Rad kit according to the standard manufacturer's protocol (Bio-Rad Laboratories (Hercules, CA) S00-0001 ) using bovine IgG as the standard.
LflIGalanin Bindin A av for rat GalRl ar~d.~g~IR2 rln~oc The binding assays were performed on 96-well plates (GF/C Millipore Corp., Bedford, MA PN MAFC NOB 50) pretreated with 0.3% polyethylenimine (PEI) for at least 3 hours prior to use. The PEI was aspirated from the plates on a vacuum manifold, and the wells were rinsed with 200 pl of ice-cold binding buffer (25 mM Tris, 10 mM
MgCl2, 0.1%
BSA, pH 7.4) immediately before samples were added to the wells. For competition assays, increasing concentrations of peptide were incubated with ['ZSI)hGalanin (NEN
DuPont (Boston, MA) NEX333) and membrane. In a final volume of 200 pl, samples consisted of 1.25 pg of protein, 50 pM ['Z3IJhGalanin, and peptide dilution or binding buffer.
Nonspecific binding was defined by 100 nM rat galanin. For saturation experiments, increasing concentrations of ('ZSIjhGalanin were incubated with membrane and 100 nM rat galanin. Samples were incubated for 90 minutes at room temperature with constant shaking.
To terminate the reaction, samples were aspirated on a vacuum manifold and rinsed with 3 x 200 pl ice-cold buffer. Samples were then counted on a gamma counter to quantitate the amount of radioactivity. Rat galanin, fragment peptides (1-15}galanin, (1-12)galanin, (1-10 )galanin, chimeric peptide M40, (2-29)rat galanin, (3-29)rat galanin, (5-29)rat galanin, (9-29)rat galanin, (10-29)rat galanin, (2-30)human galanin, and (3-30)human galanin were synthesized at Bayer Corp. (West Haven, CT}. All other peptides were purchased from either Peninsula (Belmont, CA) or Bachem (Torrance, CA).
In Vitro Pharma oloQv Saturation analysis for rat GalR2 transiently expressed in COS-7 cells yielded a one-component model with an average ICd value of 0.28 nM (n=2) and a receptor density (Bm",~ of 770 fmol/mg protein (Fig. 6). This is very similar to the rat GalR2 receptor stably expressed in 293 cells, which yielded an average IC,~ value of 0.20 nM (n=2) and a receptor density (Bm"~ of 2289 fmoUmg protein (data not shown}.
Table 1 summarizes the ICso values (50% inhibition of specific binding, as determined using nonlinear regression analysis) of various standard peptides, fragments and chimeras for [~ZSI)hGalanin binding to membranes expressing the rGalR2 receptor.
Transiently expressed rat GaIR 1 is included in Table I for comparison of its pharmacological profile to this novel rat GalR2 receptor. The preliminary pharmacological binding profile for rat GalR2 differs from rat GalR1 such that rat galanin itself has about 10-fold lower affinity for GalR2, no 5 matter how it is expressed. When comparing transiently expressed GalRl and GalR2, the chimeric peptide C7 also has about 10-fold lower affinity for GalR2; this difference, however, is not observed with rat GalR2 stably expressed in 293 cells. Rat(I-16)galanin has about S- to 10-fold lower affinity for GalR2 than GaIR 1 (Table 1 ). In addition, the ratio of affinities of ( I - I 2) and ( I - I S)galanin are markedly different for GaIR
I (22-fold difference), 10 while these two peptides have more equivalent binding affinities for GalR2.
The binding profiles for intron-containing (Y107) and intronless (BMB77 clone) GalR2 receptors transiently expressed are very similar, with the possible exceptions of MI5 and (1-12)galanin, which have approximately S- and 3-fold higher amities, respectively, for clone Y107.
WO 97!46681 PCT/US97/09787 Table 1 M40 0.78 (0.75,0.810.77 f 0.03 1.2 t 0.07 ) 0.32 0.10 r(1-16)gaI0.86 (0.97,0.75)1.2 t 0.16 1.1 t 0.15 0.18 0.02 h(2-30)gal0.94 0.65 (0.8,0.5)ND I .9 0.26 (I-IS)gal I.0 (1.1,0.99)1.2 f 0.21 2.4 f 0.98 1.1 0.27 ( 1-12)galI .6 ( I .8, 5.7 f 0.49 4. I t 1.0 24 (22,25) I .4) C7 2.6 3.2 f 0.56 0.4410.06 0.26 0.02 MI5 7.0 38 t 9.8 ND 2.0 (1.5,2.4) (1-10)gal 240 (284,195) 393 t 37 560 t 89 ND
r(3-29)gal> 1000 > I 000 > 1000 > 1000 h(3-30)gal> 1000 ND ND > 1000 r(5-29)gal> 1000 > I 000 ND > 1000 r{9-29)gal> 1000 > I 000 ND > 1000 r( I 0-29)gal> 1000 > I 000 ND > I 000 Table I summarizes the ICso values for various standard peptides for ['2'I)hGalanin binding to rat GalRl and GalR2 clones. The averages _+ standard error of the mean (SEM) represent values from at least three independent experiments. Two independent experiments are represented by the average, followed by the individual values in parentheses.
Remaining values without SEM are from a single experiment. Peptide species are indicated with the following prefixes: r = rat, h = human. ND = not determined Abbreviations of Chimers:
MI5 = (1-13)Galanin + (5-I 1)Substance P = Galantide (see Bartfai, TIPS 13, 312-317 (1992) M35 = (I-13)Galanin + (2-9)Bradykinin (Bartfai, infra) M40 = (I-I3)Galanin + proPro(AIaLeu)ZAIa amide (Bartfai, infra) C7 = (I-13)Galanin + Sp~tide (see Crawley, Brain Research 600, 268-27? (1993) Having now fully described this invention, it will be appreciated by those skilled in the art that the same can be performed with any wide range of equivalent parameters of composition, conditions, and methods of preparing such recombinant molecules, vectors, transformed hosts and proteins without departing from the spirit or scope of the invention or any embodiment thereof.
SEQUENCE LISTING
(1) GENERAL INFORMATION:
(i) APPLICANT: Bloomquist, Brian T. ; McCaleb, Michael L.;
Cornfield, Linda J.; Yoo-Warren, Heeja (ii) TITLE OF INVENTION: GALANIN RECEPTOR GALR2 (iii) NUMBER OF SEQUENCES: 6 (iv) CORRESPONDENCE ADDRESS:
(A) ADDRESSEE: Borden Elliot Scott & Aylen (B) STREET: 1000-60 Queen Street (C) CITY: Ottawa (D) STATE: Ontario (E) COUNTRY: Canada (F) ZIP: K1P 5Y7 (v) COMPUTER READABLE FORM:
(A) MEDIUM TYPE: Diskette, 3.5 inch, 1.44 Mb storage (B) COMPUTER: IBM PC Compatible (C) OPERATING SYSTEM: Windows 95 (D) SOFTWARE: WordPerfect for Windows version 6.1 (vi) CURRENT APPLICATION DATA:
(A) APPLICATION NUMBER: 2,256,523 (B) FILING DATE: 5-JUN-1997 (vii) PRIOR APPLICATION DATA:
(A) APPLICATION NUMBER: 60/019,946 (B) FILING DATE: 5-JUN-1996 (viii) ATTORNEY/AGENT INFORMATION:
(A) NAME: Collard, Christine J.
(B) REGISTRATION NUMBER: 10030 (C) REFERENCE/DOCKET NUMBER: PAT 43573W-1 (ix)TELECOMUNICATION
INFORMATION:
(A) TELEPHONE: (613) 237-5160 (B) TELEFAX: (613) 787-3558 (2) INFORMATION
FOR
SEQUENCE
ID
NO.:
l:
(i) SEQUENCE
CHARACTERISTICS:
(A) LENGTH: 1690 (B) TYPE: Nucleic Acid (C) STRANDEDNESS: Single (D) TOPOLOGY: Linear (vii) IMMEDIATE SOURCE:
(B) CLONE: Clone BMB77 nucleic acid sequence (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 1:
AGTCTAAAGC
ACCCCATCGTTTACGCTCTGGTCTCCAAGCATTTCCGTA,AAGGTTTCCGCAAAATCTGCG 1200 (2) INFORMATION FOR SEQUENCE ID NO. 2:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 372 (B) TYPE: Amino Acid Sequence (C) STR.ANDEDNESS: Single (D) TOPOLOGY: Linear (vii) IMMEDIATE SOURCE:
(B) CLONE: Clone BMB77 amino acid sequence (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 2:
Met Asn Gly Ser Gly Ser Gln Gly Ala Glu Asn Thr Ser Gln Glu Gly Gly Ser Gly Gly Trp Gln Pro Glu Ala Val Leu Val Pro Leu Phe Phe Ala Leu Ile Phe Leu Val Gly Thr Val Gly Asn Ala Leu Val Leu Ala Val Leu Leu Arg Gly Gly Gln Ala Val Ser Thr Thr Asn Leu Phe Ile Leu Asn Leu Gly Val Ala Asp Leu Cys Phe Ile Leu Cys Cys Val Pro Phe Gln Ala Thr Ile Tyr Thr Leu Asp Asp Trp Val Phe Gly Ser Leu Leu Cys Lys Ala Val His Phe Leu Ile Phe Leu Thr Met His Ala Ser Ser Phe Thr Leu Ala Ala Val Ser Leu Asp Arg Tyr Leu Ala Ile Arg Tyr Pro Leu His Ser Arg Glu Leu Arg Thr Pro Arg Asn Ala Leu Ala Ala Ile Gly Leu Ile Trp Gly Leu Ala Leu Leu Phe Ser Gly Pro Tyr Leu Ser Tyr Tyr Arg Gln Ser Gln Leu Ala Asn Leu Thr Val Cys His Pro Ala Trp Ser Ala Pro Arg Arg Arg Ala Met Asp Leu Cys Thr Phe Val Phe Ser Tyr Leu Leu Pro Val Leu Val Leu Ser Leu Thr Tyr Ala Arg Thr Leu Arg Tyr Leu Trp Arg Thr Val Asp Pro Val Thr Ala Gly Ser Gly Ser Gln Ser Ala Lys Arg Lys Val Thr Arg Met Ile Ile Ile Val Ala Val Leu Phe Cys Leu Cys Trp Met Pro His His Ala Leu Ile Leu Cys Val Trp Phe Gly Arg Phe Pro Leu Thr Arg Ala Thr Tyr Ala Leu Arg Ile Leu Ser His Leu Val Ser Tyr Ala Asn Ser Cys Val Asn Pro Ile Val Tyr Ala Leu Val Ser Lys His Phe Arg Lys Gly Phe Arg Lys Ile Cys Ala Gly Leu Leu Arg Pro Ala Pro Arg Arg Ala Ser Gly Arg Val Ser Ile Leu Ala Pro Gly Asn His Ser Gly Ser Met Leu Glu Gln Glu Ser Thr Asp Leu Thr Gln Val Ser Glu Ala Ala Gly Pro Leu Val Pro Pro Pro Ala Leu Pro Asn Cys Thr Ala Ser Ser Arg Thr Leu Asp Pro Ala Cys (2) INFORMATION FOR SEQUENCE ID NO. 3:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 1958 (B) TYPE: Nucleic Acid (C) STRANDEDNESS: Single (D) TOPOLOGY: Linear (vii) IMMEDIATE SOURCE:
(B) CLONE: Clone Y107 nucleic acid sequence (xi) SEQUENCE DESCRIPTION: SEQ ID N0: 3:
AAAAAAAAAPr AAAAAAAAA.A AAAi~AAAA 19 5 8 (2) INFORMATION FOR SEQUENCE ID N0. 4:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 372 (B) TYPE: Amino Acid Sequence (C) STRANDEDNESS: Single (D) TOPOLOGY: Linear (vii) IMMEDIATE SOURCE:
(B) CLONE: Clone Y107 amino acid sequence (omitting putative intron) (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 4:
Met Asn Gly Ser Gly Ser Gln Gly Ala Glu Asn Thr Ser Gln Glu Gly Gly Ser Gly Gly Trp Gln Pro Glu Ala val Leu Val Pro Leu Phe Phe Ala Leu Ile Phe Leu val Gly Thr Val Gly Asn Ala Leu Val Leu Ala Val Leu Leu Arg Gly Gly Gln Ala Val Ser Thr Thr Asn Leu Phe Ile Leu Asn Leu Gly Val Ala Asp Leu Cys Phe Ile Leu Cys Cys Val Pro Phe Gln Ala Thr Ile Tyr Thr Leu Asp Asp Trp Val Phe Gly Ser Leu Leu Cys Lys Ala Val His Phe Leu Ile Phe Leu Thr Met His Ala Ser Ser Phe Thr Leu Ala Ala Val Ser Leu Asp Arg Tyr Leu Ala Ile Arg Tyr Pro Leu His Ser Arg Glu Leu Arg Thr Pro Arg Asn Ala Leu Ala Ala Ile Gly Leu Ile Trp Gly Leu Ala Leu Leu Phe Ser Gly Pro Tyr Leu Ser Tyr Tyr Arg Gln Ser Gln Leu Ala Asn Leu Thr Val Cys His Pro Ala Trp Ser Ala Pro Arg Arg Arg Ala Met Asp Leu Cys Thr Phe Val Phe Ser Tyr Leu Leu Pro Val Leu Val Leu Ser Leu Thr Tyr Ala Arg Thr Leu Arg Tyr Leu Trp Arg Thr Val Asp Pro Val Thr Ala Gly Ser Gly Ser Gln Arg Ala Lys Arg Lys Val Thr Arg Met Ile Ile Ile Val Ala Val Leu Phe Cys Leu Cys Trp Met Pro His His Ala Leu Ile Leu Cys Val Trp Phe Gly Arg Phe Pro Leu Thr Arg Ala Thr Tyr Ala Leu Arg Ile Leu Ser His Leu Val Ser Tyr Ala Asn Ser Cys Val Asn Pro Ile Val Tyr Ala Leu Val Ser Lys His Phe Arg Lys Gly Phe Arg Lys Ile Cys Ala Gly Leu Leu Arg Pro Ala Pro Arg Arg Ala Ser Gly Arg Val Ser Ile Leu Ala Pro Gly Asn His Ser Gly Ser Met Leu Glu Gln Glu Ser Thr Asp Leu Thr Gln Val Ser Glu Ala Ala Gly Pro Leu Val Pro Pro Pro Ala Leu Pro Asn Cys Thr Ala Ser Ser Arg Thr Leu Asp Pro Ala Cys (2) INFORMATION FOR SEQUENCE ID NO. 5:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 1083 (B) TYPE: Nucleic Acid (C) STRANDEDNESS: Single (D) TOPOLOGY: Linear (vii) IMMEDIATE SOURCE:
(B) CLONE: Human GalR2 partial nucleic acid sequence (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 5:
AZ'I' 10 8 3 (2) INFORMATION FOR SEQUENCE ID N0. 6:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 337 (B) TYPE: Amino Acid sequence (C) STRANDEDNESS: Single (D) TOPOLOGY: Linear (vii) IMMEDIATE SOURCE:
(B) CLONE: Human GalR2 partial amino acid sequence (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 6:
Leu Arg Gly Gly Gln Ala Val Ser Thr Thr Asn Leu Leu Ile Leu Asn Leu Gly Val Ala Asp Leu Cys Phe Ile Leu Cys Cys Val Pro Phe Gln Ala Thr Ile Tyr Thr Leu Asp Gly Trp Val Phe Gly Ser Leu Leu Cys Lys Ala Val His Phe Leu Ile Phe Leu Thr Met His Ala Ser Ser Phe Thr Leu Ala Ala Val Ser Leu Asp Arg Tyr Leu Ala Ile Arg Tyr Pro Leu His Ser Arg Glu Leu Arg Thr Pro Arg Asn Ala Leu Ala Ala Ile Gly Leu Ile Trp Gly Leu Ser Leu Leu Phe Ser Gly Pro Tyr Leu Ser Tyr Tyr Arg Gln Ser Gln Leu Ala Asn Leu Thr Val Cys His Pro Ala Trp Ser Ala Pro Arg Arg Arg Ala Met Asp Ile Cys Thr Phe Val Phe Ser Tyr Leu Leu Pro Val Leu Val Leu Gly Leu Thr Tyr Ala Arg Thr Leu Arg Tyr Leu Trp Arg Ala Val Asp Pro Val Ala Ala Gly Ser Gly Ala Arg Arg Ala Lys Arg Lys Val Thr Arg Met Ile Leu Ile Val Ala Ala Leu Phe Cys Leu Cys Trp Met Pro His His Ala Leu Ile Leu Cys Val Trp Phe Gly Gln Phe Pro Leu Thr Arg Ala Thr Tyr Ala Leu Arg Ile Leu Ser His Leu Val Ser Tyr Ala Asn Ser Cys Val Asn Pro Ile Val Tyr Ala Leu Val Ser Lys His Phe Arg Lys Gly Phe Arg Thr Ile Cys Ala Gly Leu Leu Gly Arg Ala Pro Gly Arg Ala Ser Gly Arg Val Cys Ala Ala Ala Arg Gly Thr His Ser Gly Ser Val Leu Glu Arg Glu Ser Ser Asp Leu Leu His Met Ser Glu Ala Ala Gly Ala Leu Arg Pro Cys Pro Gly Ala Ser Gln Pro Cys Ile Leu Glu Pro Cys Pro Gly Pro Ser Trp Gln Gly Pro Lys Ala Gly Asp Ser Ile Leu Thr Val Asp Val Ala
Receptor GalR2 may be synthesized in host cells transformed with a :ecombinant expression construct comprising a nucleic acid encoding the receptor GalR2.
Such a recombinant expression construct can also be comprised of a vector that is a replicable DNA
construct. Vectors are used herein either to amplify DNA encoding GalR2 and/or to express DNA which encodes GaIR2. For the purposes of this invention, a recombinant expression construct is a replicable DNA construct in which a DNA sequence encoding GalR2 is operably linked to suitable control sequences capable of effecting the expression of GalR2 in WO 97/46681 . PCT/US97/0978?
a suitable host. The need for such control sequences will vary depending upon the host selected and the transformation method chosen. Generally, control sequences include a transcriptional promoter, an optional operator sequence to control transcription, a sequence encoding suitable mRNA ribosomal binding sites, and sequences which control the termination of transcription and translation. Amplification vectors do not require expression control domains. All that is needed is the ability to replicate in a host, usually conferred by an origin of replication, and a selection gene to facilitate recognition of transformants. See, Sambrook et al., Molecular Cloning: A Laboratory Manual (2nd Edition, Cold Spring Harbor Press, New York, 1989).
Vectors useful for practicing the present invention include plasmids, viruses (including phage), retroviruses, and integratable DNA fragments (i.e., fragments integratable into the host genome by homologous recombination). The vector replicates and functions independently of the host genome, or may, in some instances, integrate into the genome itself.
Suitable vectors will contain replicon and control sequences which are derived from species compatible with the intended expression host. The vectors may be self replicating. Suitable vectors for the purposes of the present invention include pBluescript, pcDNA3, pSV-SPORT, and, for insect cells, baculovirus. A preferred vector is the plasmid pcDNA3 (Invitrogen, San Diego, CA).
Construction of suitable vectors containing the desired coding and control sequences employs standard ligation and restriction techniques that are well understood in the art.
Isolated plasmids, DNA sequences, or synthesized oligonucleotides are cleaved, tailored, and relegated in the form desired.
Site-specific DNA cleavage is performed by treating with the suitable restriction enzyme (or enzymes) under conditions that are generally understood in the art, and the particulars of which are specified by the manufacturer of these commercially available restriction enzymes. See, e.g., New England Biolabs, Product Catalog. In general, about 1 ,ug of plasmid or DNA sequence is cleaved by one unit of enzyme in about 20 ,ul of buffer solution. Often excess of restriction enzyme is used to ensure complete digestion of the DNA
substrate. Incubation times of about one hour to two hours at about 37°C are workable, although variations are tolerable. After each incubation, protein is removed by extraction with phenoUchloroform, and may be followed by ether extraction. The nucleic acid may be recovered from aqueous fractions by precipitation with ethanol. If desired, size separation of the cleaved fragments may be performed by polyacrylamide gel or agarose gel electrophoresis using standard techniques. A general description of size separations is found in Methods in Enrymology 65, 499-560 ( 1980).
Transformed host cells are cells which have been transformed or transfected with recombinant expression constructs made using recombinant DNA techniques and comprising mammalian GalR2-encoding sequences. Preferred host cells for transient transfection are COS-7 cells. Transformed host cells may ordinarily express GalR2, but host cells transformed for purposes of cloning or amplifying nucleic acid hybridization probe DNA
need not express the receptor. When expressed, the mammalian GalR2 protein will typically be located in the host cell membrane. See, Sambrook et al., ibid.
Cultures of cells derived from multicellular organisms are desirable hosts for recombinant GalR2 protein synthesis. In principal, any higher eukaryotic cell culture is workable, whether from vertebrate or invertebrate culture. However, mammalian cells are preferred, as illustrated in the Examples. Propagation of such cells in cell culture has become a routine procedure. See Tissue Culture (Academic Press, Kruse & Patterson, Eds., 1973).
Examples of useful host cell lines are bacteria cells, insect cells, yeast cells, human 293 cells, VERO and HeLa cells, LMTK' cells, and WI138, BHK, CHO, COS-7, CV, and MDCK
cell lines (American Type Culture Collection, Rockville, MD). CHO cells are preferred.
The invention provides homogeneous compositions of mammalian GalR2 produced by transformed eukaryotic cells as provided herein. Such homogeneous compositions are intended to be comprised of mammalian GalR2 protein that comprises at least 90% of the protein in such homogenous composition. The invention also provides membrane preparation from cells expressing GalR2 as the result of transformation with a recombinant expression construct, as described here.
Mammalian GalR2 protein made from cloned genes in accordance with the present invention may be used for screening compounds for GalR2 agonist or antagonist activity, or for determining the amount of a GalR2 agonist or antagonist drug in a solution (e.g., blood plasma or serum). For example, host cells may be transformed with a recombinant expression construct of the present invention, GalR2 protein expressed in those host cells, the cells lysed, and the membranes from those cells used to screen compounds for GalR2 binding activity. Competitive binding assays in which such procedures may be carried out are well known in the art. By selection of host cells which do not ordinarily express GalR2, pure or crude preparations of membranes containing GalR2 can be obtained. Further, GalR2 agonists and antagonists can be identified by transforming host cells with a recombinant expression construct as provided by the present invention. Membranes obtained from such cells (and membranes of intact cells) can be used in binding studies wherein the drug dissociation activity is monitored.
It is known that the neurotransmitter galanin is a regulator of appetite, cognition, 5 endocrine function, pain, and smooth muscle control. As shown herein, the various galanin analogs/fragments that induce these physiological responses bind with a high affinity to the GalR2 receptor. It is therefore evident that by modulating the activity of the GalR2 receptor, various physiological activities can be regulated. Specifically, antagonists to the GaIIR2 receptor, identified by the methods described herein, could be used to treat obesity, diabetes, 10 hyperlipidemia, stroke, neuropathic pain, Alzheimer's disease, and/or endocrine disorders.
This invention provides a pharmaceutical composition comprising an effective amount of a drug identified by the method described herein and a pharmaceutically acceptable carrier. Such drugs and carrier can be administered by various routes, for example oral, subcutaneous, intramuscular, intravenous or intracerebral. The preferred route of administration would be oral at daily doses of about 0.01-100 mglkg.
This invention provides a method of treating obesity, diabetes, hyperlipidemia, stroke, neuropathic pain, Alzheimer's disease, or endocrine disorders wherein the abnormality is improved by reducing the activity of GalR2 receptor or blocking the binding of ligands to a GalR2 receptor which comprises administering an effective amount of the pharmaceutical composition described above.
The recombinant expression constructs of the present invention are useful in molecular biology to transform cells which do not ordinarily express GaIR2 to thereafter express this receptor. Such cells are useful as intermediates for making cell membrane preparations useful for receptor binding assays, which are in turn useful for drug screening.
Drugs identified from such receptor assays can be used for the treatment of obesity, diabetes, anorexia, hyperlipidemia, stroke, neuropathic pain, Alzheimer's disease, or endocrine disorders.
The recombinant expression constructs of the present invention are also useful in gene therapy. Cloned genes of the present invention, or fragments thereof, may also be used in gene therapy carried out by homologous recombination or site-directed mutagenesis. See generally Thomas & Capecchi, Cell 51, 503-512 (1987); Bertling, Bioscience Reports 7, 107-112 (1987); Smithies et al., Nature 3I7, 230-234 (1985).
. Oligonucleotides of the present invention are useful as diagnostic tools for probing WO 97!46681 PCT/US97/09787 GallZ2 gene expression in tissues. For example, tissues are probed in situ with oligonucleotide probes carrying detectable groups by conventional autoradiographic techniques, as explained in greater detail in the Examples below, to investigate native ' expression of this receptor or pathological conditions relating thereto.
Further, chromosomes can be probed to investigate the presence or absence of the GaIR2 gene, and potential pathological conditions related thereto, as also illustrated by the Examples below. Probes according to the invention should generally be at least about 15 nucleotides in length to prevent binding to random sequences, but, under the appropriate circumstances may be smaller.
The invention also provides antibodies that are immunologically reactive to a mammalian GalR2, preferably rat or human GaIR2. The antibodies provided by the invention are raised in animals by inoculation with cells that express a mammalian GalIZ2 or epitopes thereof, using methods well known in the art. Animals that are used for such inoculations include individuals from species comprising cows, sheep, pigs, mice, rats, rabbits, hamsters, goats and primates. Preferred animals for inoculation are rodents (including mice, rats, hamsters) and rabbits. The most preferred animal is the mouse.
Cells that can be used for such inoculations, or for any of the other means used in the invention, include any cell line which naturally expresses a mammalian GalR2, or any cell or cell line that expresses a mammalian GalR2 or any epitope thereof as a result of molecular or genetic engineering, or that has been treated to increase the expression of a mammalian GaIR2 by physical, biochemical or genetic means. Preferred cells are human cells, most preferably HEK 293 cells that have been transformed with a recombinant expression construct comprising a nucleic acid encoding a mammalian GalR2, preferably a rat or human GaIR2, and that express the mammalian GalR2 gene product.
The present invention provides monoclonal antibodies that are immunologically reactive with an epitope of mammalian GalR2 or fragment thereof and that is present on the surface of mammalian cells, preferably human or mouse cells. These antibodies are made using methods and techniques well known to those of skill in the art.
Monoclonal antibodies provided by the present invention are produced by hybridoma cell lines, that are also provided by the invention and that are made by methods well known in the art. Hybridoma cell lines are made by fusing individual cells of a myeloma cell line with spleen cells derived from animals immunized with cells expressing the GaIR2 receptor, preferably rat or human cells, as described above. The myeloma cell lines used in the invention include lines derived from myelomas of mice, rats, hamsters, primates and humans.
Preferred myeloma cell lines are from mouse. The animals from whom spleens are obtained after immunization are rats, mice and hamsters, preferably mice, most preferably Balb/c mice.
Spleen cells and myeloma cells are fused using a number of methods well known in the art, S including but not limited to incubation with inactivated Sendai virus and incubation in the presence of polyethylene glycol (PEG). The most preferred method for cell fusion is incubation in the presence of a solution of 45% (w/v) PEG-1450. Monoclonal antibodies produced by hybridoma cell lines can be harvested from cell culture supernatant fluids from in vitro cell growth; alternatively, hybridoma cells can be injected subcutaneously and/or into the peritoneal cavity of an animal, most preferably a mouse, and the monoclonal antibodies obtained from blood and/or ascites fluid.
Monoclonal antibodies provided by the present invention are also produced by recombinant genetic methods well known to those of skill in the art, and the present invention encompasses antibodies made by such methods that are immunologically reactive with an epitope of a mammalian GalR2.
The present invention encompasses fragments of the antibody that are immunologically reactive with an epitope of a mammalian GalR2. Such fragments are produced by any number of methods, including but not limited to proteolytic cleavage, chemical synthesis or preparation of such fragments by means of genetic engineering technology. The present invention also encompasses single-chain antibodies that are immunologically reactive with an epitope of a mammalian GalR2 made by methods known to those of skill in the art.
The present invention also encompasses an epitope of a mammalian GalR2 that is comprised of sequences and/or a conformation of sequences present in the mammalian GalR2 molecule. This epitope may be naturally occurring, or may be the result of proteolytic cleavage of the mammalian GaIR2 molecule and isolation of an epitope-containing peptide or may be obtained by synthesis of an epitope-containing peptide using methods well known to those skilled in the art. The present invention also encompasses epitope peptides produced as a result of genetic engineering technology and synthesized by genetically engineered prokaryotic or eukaryotic cells.
The invention also includes chimeric antibodies, comprised of Iight chain and heavy chain peptides immunologically reactive to an epitope that is a mammalian GalR2. The chimeric antibodies embodied in the present invention include those that are derived from naturally occurring antibodies as well as chimeric antibodies made by means of genetic engineering technology well known to those of skill in the art.
Also provided by the present invention are non-human transgenic animals grown from germ cells transformed with the GaIR2 nucleic acid sequence according to the invention and that express the GaLR2 receptor according to the invention and offspring and descendants thereof. Also provided are transgenic non-human mammals comprising a homologous recombination knockout of the native GalR2 receptor, as well as transgenic non-human mammals grown from germ cells transformed with nucleic acid antisense to the GalR2 nucleic acid of the invention and offspring and descendants thereof. Further included as part of the present invention are transgenic animals which the native GalR2 receptor has been replaced with the human homolog. Of course, offspring and descendants of all of the foregoing transgenic animals are also encompassed by the invention.
Transgenic animals according to the invention can be made using well known techniques with the nucleic acids disclosed herein. E.g., Leder et al., U.S.
Patent Nos.
4,736,866 and 5,175,383; Hogan et al., Manipulating the Mouse Embryo, A
Laboratory Manual (Cold Spring Harbor Laboratory (19$6)); Capecchi, Science 244, 1288 (1989); and Zimmer and Gruss, Nature 338, 150 (1989). Such transgenic animals are useful for screening for and determining the physiological effects of GalR2 receptor agonists and antogonist.
Consequently, such transgenic animals are useful for developing drugs to regulate physiological activities in which galanin participates.
. The following Examples are provided for illustrative purposes only and are not intended, nor should they be construed, as limiting the invention in any manner.
EXAMPLES
Example Z: Isolation and Sequencing of Rat GalR2 Receptor An expression cloning strategy was used to clone the novel galanin receptor from a rat hypothalamus cDNA Library. RNA was obtained from 9 frozen rat hypothalami weighing a total of 0.87 grams. Poly(A) RNA was isolated directly from the tissue using the Promega PolyATtract System 1000 kit (Promega (Madison, WI) Z5420). The hypothalami were homogenized in 4 mL of 4M guanidine thiocyanate-25mM sodium citrate, pH 7.1-2%
mercaptoethanol using a Polytron at full-speed for approximately 1 minute. To the . homogenized tissue 8 mL of 4M guanidine thiocyanate-25mM sodium citrate, pH
7.1-1% 13-mercaptoethanol which had been preheated to 70°C was added. After mixing thoroughly, 870 pmol biotinylated oligo(dT) was added; the mixture was incubated at 70°C for 5 minutes.
The homogenate was subjected to centrifugation at 12000 x g for 10 minutes at room temperatwe; the homogenate was transferred to a clean tube and 10.44 mL
Streptavidin MAGNESPHERE~ Paramagnetic Particles (SA-PMPs) which had been prepared as per the published protocol was added. (Promega Corporation (Madison, WI) published protocol TM
228). The homogenate and SA-PMPs were incubated together for 2 minutes at room temperature after which the homogenate was decanted while the SA-PMP-biotinylated oligo(dT)-hypothalamic poly(A) RNA complex was retained in the tube by a magnetic stand.
The complex was washed as per the protocol, after which the RNA was precipitated and resuspended in water. 25 micrograms of this poly(A) RNA was used by Invitrogen (Invitrogen Corporation, San Diego, CA) to prepare a cDNA expression library.
The protocols used by Invitrogen to prepare the cDNA library are essentially based upon the procedures of Okayama and Berg (Molec. Cell. Biol. 2, 161 (1982)) and Gubler and Hoffman (Gene 25, 263 (1983)) (Invitrogen Corporation (San Diego, CA) publications 130813sa and 130928sa). An oligo(dT) anchor primer was used for reverse transcription, and the library was cloned unidirectionally into pcDNA3 vector which contains a CMV
(cytomegalovirus) promoter for eukaryotic expression. The cDNA library had 5.3 x 105 primary recombinants with an average insert size of 2.59 kb.
Isolation o a nove~,galanin recewtor cDNA clone 1. Homology cloning strategy In order to isolate novel receptors) for gal4... an, approximately 2 million phage plaques of a rat small intestine library (Stratagene (La Jolla, CA) 936'08) were screened with rat GalRl coding sequence DNA as probe under low stringency conditions (30%
formamide, 6X SSC (0.9M NaCU0.09M NaCitrate), 0.1% N-lauroyl sarcosine, 0.2% SDS, 3%
blocking reagent.) The probe was prepared by digesting the parent GaIRI plasmid with SacI and AccI, separating the fragments by agarose gel electrophoresis, and purifying the 1-kb SacI-AccI
fragment from the gel. The probe was labeled with digoxigenin dUTP according to the manufacturer's instructions (GENIUS Kit, Boehringer Mannheim, Indianapolis, IN, PN 1093 657). The filter lifts, denaturation, neutralization, hybridization, and washing were done according to the manufacturer's instructions except that hybridization was done at 30°C and the washes were performed twice for 40 minutes each: once at room temperature;
the second at 37°C.
One plaque containing DNA homologous to the probe was purified and subcloned into pBluescript vector (Stratagene (La Jolla, California) 212206) by standard molecular ' biological techniques. This clone, designated SI2I 12, was subjected to sequence analysis and S was found to contain a sequence which had characteristics of a novel, but truncated member of the G-protein-coupled 7TMD receptor family. This clone was later used as probe to detenmine the identity of a novel galanin-binding clone (Y107) found in the expression cloning strategy (see below.) The partial human GalR2 cDNA was obtained by screening approximately two 10 million phage of a human small intestine library (Clontech (Palo Alto, CA) HL 1133a) were screened with a human GalR2 probe obtained by PCR amplification from human genomic DNA. The conditions used were essentially as described for the rat GalR2 isolation.
2. Expression cloning strategy 15 The rat hypothalamus cDNA library was plated on the Luria Broth/Ampicillin (GIBCO) plates in pools of 1,OOO~independent colonies. The plates were incubated at 37°C
for about 20 hours and the bacteria from each plate were scraped in 4-5 ml LB/Ampicillin media. Two ml of the bacteria samples were used for plasmid preparation and one ml of each pool was stored at -80°C in 15% glycerol.
COS-7 cells were grown in Dulbecco's Modified Eagle Medium (DMEM, GIBCO
{Gaithersburg, MD) 11965-092), IO% fetal bovine serum (GIBCO {Gaithersburg, MD) 16000-028), and IX antibiotic/antimycotic solution (GIBCO (Gaithersburg, MD) 039). Cells were maintained by trypsinizing and splitting at 50 to 70%
confluency.
Twenty-four hours before transfection, cells were plated into flaskette chambers (Nunc, Inc. (Naperville, IL) 177453) at 3x105 cells/flaskette (equivalent to 3x104 cells/cmz).
Two ~g of plasmid DNA from each pool was transfected into the cells using 10 ~cl of Lipofectamine (GIBCO (Gaithersburg, MD) 18324-012) according to the manufacturer's protocol.
Forty-eight hours after transfection, the ['Z5I]galanin binding assay was performed in the flaskette chamber. The cells were washed once with 25 mM Tris-HCI, 10 mM
MgCl2, pH
7.4, and blocked for 1 S minutes with 1 ml total binding buffer (25 mM Tris-HCI, 10 mM
MgCl2, 1 % bovine serum albumin, pH 7.4) at room temperature. After aspirating off the blocking solution, 1 ml of binding buffer containing 100 pM 'Z5I-hGalanin (NEN
DuPont (Boston, MA) NEX-333) was added and flasks were incubated at room temperature for 90 minutes. Following the incubation, the labeling buffer was removed and the flaskettes were rinsed (approximately 2 mL per flaskette) four times with ice-cold binding buffer. After a final rinse with ice-cold phosphate buffered saline (PBS)(GIBCO (Gaithersburg, MD) 14190-136), the cells were fixed with ice-cold PBS/1 % glutaraldehyde (Sigma (St.
Louis, MO) G5882). The solution was removed and residual glutaraldehyde rinsed away with one wash of ice-cold PBS/0.5 M Ttis (pH 7.5) followed by one wash of ice-cold PBS.
After separating the slide bases from their tops, the slides were dipped in 0.5% gelatin at 42°C and dried under vacuum. The dried slides were dipped in photographic emulsion (NTB-2) (Kodak (Rochester, NY) 165 4433) diluted 1:1 in 0.02% Aerosol-OT (Sigma (St. Louis, MO) A6627) at 42 °C, dried at room temperature for 1 hour, and exposed in the darkbox for four or five days at 4°C. After sufficient exposure time, the darkbox was brought to room temperature for 1 hour after which the slides were developed in D-19 developer (Kodak (Rochester, NY) 146 4593) for three minutes at 15°C, placed in fixer (Kodak (Rochester, NY) 197 1746) for three minutes at I 5 °C, washed in water, and air dried. Cells were stained with Diff Quik stain set (Baxter (McGaw Park, IL) B4132-I) and air dried. Slides were dipped into xylenes and mounted with DPX mountant (Electron Microscopy Sciences (Fort Washington, PA) 13510). Positive cells were identified using dark field microscopy.
Two positive pools were identified. Since the hypothalamus could express different subtypes of galanin receptor, we analyzed the positive pools for GaIRI
receptors by PCR and homology. Of the 2 positive pools tested as described above, 1 contained GalRl as detenmined by PCR and homology analyses. However, the other pool (Y107) was negative for GalRl by PCR, but homologous to SI2112 probe (see Homology strategy, above).
Because: 1) SI2112 sequence indicated it was likely a novel, albeit truncated and unexpressible, G-protein-coupled receptor; 2) pool YI07 DNA showed homology to the SI2112 probe; and, 3) DNA from pool Y107, when used to transiently transfect COS-7 cells, conferred the ability upon the cells to bind galanin, it was deduced that the clone within pool Y107, which conferred gaIanin-binding ability when expressed, was likely to be an expressible version of the SI2112 clone. Therefore, clones from pool Y107 were probed with radiolabeled DNA prepared from SI2112, and a single clone hybridizing to the SI2112 probe was purified from non-homologous clones. This clone was called Y107.
Sequence analysis of clone Y107 (SEQ ID NO: 3) revealed the presence of one intron of 489-by length, beginning after nucleotide 384 (the second nucleotide of the codon for amino acid 133, an arginine residue). Using Y107 DNA as probe, an intronless version of the Y107 cDNA was obtained from a PCI2 cell cDNA library by homology cloning. The first intronless version of the Y107 was in the pSV-SPORT vector (GIBCO
(Gaithersburg, MD) ' 15386-014); the complete cDNA insert of this clone was subcloned into the pcDNA3 vector (Invitrogen (San Diego, CA) V790-20) in order to maintain, for subsequent pharamacological analyses, common vector and promoter (CMV) backgrounds amongst our clones. The intronless clone in pSV-SPORT was designated BMB77.sv40; the intronless clone contained within pcDNA3 is named BMB77. Clones BMB77 and Y107 differ by one amino acid in sequence. Pharmacological analyses have been performed with both the Y107 (SEQ
ID NO:
3 and 4) and BMB77 {SEQ ID NO: 1 and 2) clones.
DNA and DBDtIdB SPo»y»roc ns~ajy~ls Plasmid DNA was sequenced by Lark Technologies Inc. (Houston, Texas) and Biotechnology Resource Laboratory of Yale University (New Haven, CT) using Sequenase Kit (LJS Biochemical (Cleveland, OH) 70770) or Applied Biosystems' automatic sequencer system (Model 373A). The peptide sequence was deduced from the long open-reading-frame of the nucleotide sequence. DNA and peptide sequences were analyzed using the GCG
program (Genetics Computer Group, Madison, WI). The results are embodied in SEQ ID
NO: 1 (the nucleic acid sequence of'clone BMB77), SEQ ID NO: 2 (the amino acid sequence of clone BMB77), SEQ ID NO: 3 (the nucleic acid sequence of clone Y107), SEQ
ID NO: 4 (the amino acid sequence, omitting the putative intronic region, of clone Y107), SEQ ID NO:
5 (the partial nucleic acid sequence of human GaIR2), and SEQ ID NO: 6 (the partial amino acid sequence of human GalR2).
Example 2: Pharmacological Characterization of the Novel Rat Galanin Receptor Iransient TrancfP~i:~H
Monkey kidney cells (COS-7) were maintained in T-175 cm2 flasks (Nunc, Inc.
(Naperville, IL) 171226) at 37°C with 5% COZ in a humidified atmosphere. Cells were grown in Dulbecco's Modified Eagle Medium (DMEM) (GIBCO (Gaithersburg, MD) 092) supplemented with 2 mM glutamine, 10% fetal bovine serum, 1 mM sodium pyruvate and a antibiotic/antimycotic comprised of pennicillin/streptomycin/amphotericinB (GIBCO, Gaithersburg, MD, PN 15240-013). Cells at 70% confluency were transfected with rat GalR2 DNA using the Lipofectamine reagent (GIBCO (Gaithersburg, MD) 18324-012). I S
pg of DNA and 90 pl of lipofectamine were added to each flask. Media was replaced 24 hours post transfection, and membranes were harvested 24 hours later.
Stable EYbre ctn'ofthe Rat mlR7 Ror ~~lelone BMB77) 293 cells (human embryonic kidney, ATCC) were plated onto a T-25 flask one day prior to transfection, such that they were 50-70% confluent at the time of transfection. 15 ug of rat GalR2 (BMB77) DNA were added to 0.3 ml of Optimem I culture media (GIBCO Life Sciences), and 25 ul of lipofectamine were added to 0.3 ml of Optimem I. The DNA and lipofectamine solutions were combined and incubated at room temperature for 20 minutes.
An additional 2.4 ml of Optimem I was added to the DNA/lipofectamine mixture.
The media was aspirated from T-25 flask containing 293 cells, washed with Optimem I, and the DNA/lipofectamine mixture was added to the 293 cells. After a S-6 hour incubation in a 37°C incubator (5% COZ) for 5-6 hours, the DNA/lipofectamine mixture was replaced with culture media (DMEM, 10% fetal bovine serum, 2 mM glutamine and I S antibiotic/antimycotic.) The day following transfection, the media was replaced with selecting media (culture media with the addition of 350 uglml of Geneticin G-418), and the flask was returned to the 37°C / 5% COZ incubator. When discrete colonies became apparent, cells were pooled.
Growth was monitored, followed by cloning by limited dilution, such that an average of one cell was seeded in each well of a 96-well microtiter culture plate. After about 21 days in culture under selection conditions, those wells containing single colonies were selected and transferred to 24-well culture plates pretreated with poly-1-lysine, following trypsinization.
Each of these clones was propagated until sufficient quantities were available for testing in the ['ZS I]galanin binding assay, from which one particular clone designated 293-rGalR2-1 was selected on the basis of its high level of receptor expression.
Membrane Prey ar ' The media was removed from each flask of transfected cells, and the cells were washed twice with 20 ml ice-cold phosphate buffered saline. The cells were scraped from the flask in S ml of Tris buffer (20 mM Tris-HCI, 5 mM EDTA, pH 7.7), and then transferred to a centrifuge tube. Each flask was rinsed with an additional 5 ml of Tris buffer, and combined in the centrifuge tube. The cells were homogenized in a Polytron PT-3000 (Brinkman Instruments, Mill Valley, New York) for 2 x 10 seconds (12 mM probe, 7000-8000 rpm) and centrifuged at 20,000 x g for 30 minutes at 4°C. The pellet was resuspended in fresh Tris buffer, and centrifuged again at 20,000 x g for 30 minutes at 4°C.
Protein concentration was measured using the Bio-Rad kit according to the standard manufacturer's protocol (Bio-Rad Laboratories (Hercules, CA) S00-0001 ) using bovine IgG as the standard.
LflIGalanin Bindin A av for rat GalRl ar~d.~g~IR2 rln~oc The binding assays were performed on 96-well plates (GF/C Millipore Corp., Bedford, MA PN MAFC NOB 50) pretreated with 0.3% polyethylenimine (PEI) for at least 3 hours prior to use. The PEI was aspirated from the plates on a vacuum manifold, and the wells were rinsed with 200 pl of ice-cold binding buffer (25 mM Tris, 10 mM
MgCl2, 0.1%
BSA, pH 7.4) immediately before samples were added to the wells. For competition assays, increasing concentrations of peptide were incubated with ['ZSI)hGalanin (NEN
DuPont (Boston, MA) NEX333) and membrane. In a final volume of 200 pl, samples consisted of 1.25 pg of protein, 50 pM ['Z3IJhGalanin, and peptide dilution or binding buffer.
Nonspecific binding was defined by 100 nM rat galanin. For saturation experiments, increasing concentrations of ('ZSIjhGalanin were incubated with membrane and 100 nM rat galanin. Samples were incubated for 90 minutes at room temperature with constant shaking.
To terminate the reaction, samples were aspirated on a vacuum manifold and rinsed with 3 x 200 pl ice-cold buffer. Samples were then counted on a gamma counter to quantitate the amount of radioactivity. Rat galanin, fragment peptides (1-15}galanin, (1-12)galanin, (1-10 )galanin, chimeric peptide M40, (2-29)rat galanin, (3-29)rat galanin, (5-29)rat galanin, (9-29)rat galanin, (10-29)rat galanin, (2-30)human galanin, and (3-30)human galanin were synthesized at Bayer Corp. (West Haven, CT}. All other peptides were purchased from either Peninsula (Belmont, CA) or Bachem (Torrance, CA).
In Vitro Pharma oloQv Saturation analysis for rat GalR2 transiently expressed in COS-7 cells yielded a one-component model with an average ICd value of 0.28 nM (n=2) and a receptor density (Bm",~ of 770 fmol/mg protein (Fig. 6). This is very similar to the rat GalR2 receptor stably expressed in 293 cells, which yielded an average IC,~ value of 0.20 nM (n=2) and a receptor density (Bm"~ of 2289 fmoUmg protein (data not shown}.
Table 1 summarizes the ICso values (50% inhibition of specific binding, as determined using nonlinear regression analysis) of various standard peptides, fragments and chimeras for [~ZSI)hGalanin binding to membranes expressing the rGalR2 receptor.
Transiently expressed rat GaIR 1 is included in Table I for comparison of its pharmacological profile to this novel rat GalR2 receptor. The preliminary pharmacological binding profile for rat GalR2 differs from rat GalR1 such that rat galanin itself has about 10-fold lower affinity for GalR2, no 5 matter how it is expressed. When comparing transiently expressed GalRl and GalR2, the chimeric peptide C7 also has about 10-fold lower affinity for GalR2; this difference, however, is not observed with rat GalR2 stably expressed in 293 cells. Rat(I-16)galanin has about S- to 10-fold lower affinity for GalR2 than GaIR 1 (Table 1 ). In addition, the ratio of affinities of ( I - I 2) and ( I - I S)galanin are markedly different for GaIR
I (22-fold difference), 10 while these two peptides have more equivalent binding affinities for GalR2.
The binding profiles for intron-containing (Y107) and intronless (BMB77 clone) GalR2 receptors transiently expressed are very similar, with the possible exceptions of MI5 and (1-12)galanin, which have approximately S- and 3-fold higher amities, respectively, for clone Y107.
WO 97!46681 PCT/US97/09787 Table 1 M40 0.78 (0.75,0.810.77 f 0.03 1.2 t 0.07 ) 0.32 0.10 r(1-16)gaI0.86 (0.97,0.75)1.2 t 0.16 1.1 t 0.15 0.18 0.02 h(2-30)gal0.94 0.65 (0.8,0.5)ND I .9 0.26 (I-IS)gal I.0 (1.1,0.99)1.2 f 0.21 2.4 f 0.98 1.1 0.27 ( 1-12)galI .6 ( I .8, 5.7 f 0.49 4. I t 1.0 24 (22,25) I .4) C7 2.6 3.2 f 0.56 0.4410.06 0.26 0.02 MI5 7.0 38 t 9.8 ND 2.0 (1.5,2.4) (1-10)gal 240 (284,195) 393 t 37 560 t 89 ND
r(3-29)gal> 1000 > I 000 > 1000 > 1000 h(3-30)gal> 1000 ND ND > 1000 r(5-29)gal> 1000 > I 000 ND > 1000 r{9-29)gal> 1000 > I 000 ND > 1000 r( I 0-29)gal> 1000 > I 000 ND > I 000 Table I summarizes the ICso values for various standard peptides for ['2'I)hGalanin binding to rat GalRl and GalR2 clones. The averages _+ standard error of the mean (SEM) represent values from at least three independent experiments. Two independent experiments are represented by the average, followed by the individual values in parentheses.
Remaining values without SEM are from a single experiment. Peptide species are indicated with the following prefixes: r = rat, h = human. ND = not determined Abbreviations of Chimers:
MI5 = (1-13)Galanin + (5-I 1)Substance P = Galantide (see Bartfai, TIPS 13, 312-317 (1992) M35 = (I-13)Galanin + (2-9)Bradykinin (Bartfai, infra) M40 = (I-I3)Galanin + proPro(AIaLeu)ZAIa amide (Bartfai, infra) C7 = (I-13)Galanin + Sp~tide (see Crawley, Brain Research 600, 268-27? (1993) Having now fully described this invention, it will be appreciated by those skilled in the art that the same can be performed with any wide range of equivalent parameters of composition, conditions, and methods of preparing such recombinant molecules, vectors, transformed hosts and proteins without departing from the spirit or scope of the invention or any embodiment thereof.
SEQUENCE LISTING
(1) GENERAL INFORMATION:
(i) APPLICANT: Bloomquist, Brian T. ; McCaleb, Michael L.;
Cornfield, Linda J.; Yoo-Warren, Heeja (ii) TITLE OF INVENTION: GALANIN RECEPTOR GALR2 (iii) NUMBER OF SEQUENCES: 6 (iv) CORRESPONDENCE ADDRESS:
(A) ADDRESSEE: Borden Elliot Scott & Aylen (B) STREET: 1000-60 Queen Street (C) CITY: Ottawa (D) STATE: Ontario (E) COUNTRY: Canada (F) ZIP: K1P 5Y7 (v) COMPUTER READABLE FORM:
(A) MEDIUM TYPE: Diskette, 3.5 inch, 1.44 Mb storage (B) COMPUTER: IBM PC Compatible (C) OPERATING SYSTEM: Windows 95 (D) SOFTWARE: WordPerfect for Windows version 6.1 (vi) CURRENT APPLICATION DATA:
(A) APPLICATION NUMBER: 2,256,523 (B) FILING DATE: 5-JUN-1997 (vii) PRIOR APPLICATION DATA:
(A) APPLICATION NUMBER: 60/019,946 (B) FILING DATE: 5-JUN-1996 (viii) ATTORNEY/AGENT INFORMATION:
(A) NAME: Collard, Christine J.
(B) REGISTRATION NUMBER: 10030 (C) REFERENCE/DOCKET NUMBER: PAT 43573W-1 (ix)TELECOMUNICATION
INFORMATION:
(A) TELEPHONE: (613) 237-5160 (B) TELEFAX: (613) 787-3558 (2) INFORMATION
FOR
SEQUENCE
ID
NO.:
l:
(i) SEQUENCE
CHARACTERISTICS:
(A) LENGTH: 1690 (B) TYPE: Nucleic Acid (C) STRANDEDNESS: Single (D) TOPOLOGY: Linear (vii) IMMEDIATE SOURCE:
(B) CLONE: Clone BMB77 nucleic acid sequence (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 1:
AGTCTAAAGC
ACCCCATCGTTTACGCTCTGGTCTCCAAGCATTTCCGTA,AAGGTTTCCGCAAAATCTGCG 1200 (2) INFORMATION FOR SEQUENCE ID NO. 2:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 372 (B) TYPE: Amino Acid Sequence (C) STR.ANDEDNESS: Single (D) TOPOLOGY: Linear (vii) IMMEDIATE SOURCE:
(B) CLONE: Clone BMB77 amino acid sequence (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 2:
Met Asn Gly Ser Gly Ser Gln Gly Ala Glu Asn Thr Ser Gln Glu Gly Gly Ser Gly Gly Trp Gln Pro Glu Ala Val Leu Val Pro Leu Phe Phe Ala Leu Ile Phe Leu Val Gly Thr Val Gly Asn Ala Leu Val Leu Ala Val Leu Leu Arg Gly Gly Gln Ala Val Ser Thr Thr Asn Leu Phe Ile Leu Asn Leu Gly Val Ala Asp Leu Cys Phe Ile Leu Cys Cys Val Pro Phe Gln Ala Thr Ile Tyr Thr Leu Asp Asp Trp Val Phe Gly Ser Leu Leu Cys Lys Ala Val His Phe Leu Ile Phe Leu Thr Met His Ala Ser Ser Phe Thr Leu Ala Ala Val Ser Leu Asp Arg Tyr Leu Ala Ile Arg Tyr Pro Leu His Ser Arg Glu Leu Arg Thr Pro Arg Asn Ala Leu Ala Ala Ile Gly Leu Ile Trp Gly Leu Ala Leu Leu Phe Ser Gly Pro Tyr Leu Ser Tyr Tyr Arg Gln Ser Gln Leu Ala Asn Leu Thr Val Cys His Pro Ala Trp Ser Ala Pro Arg Arg Arg Ala Met Asp Leu Cys Thr Phe Val Phe Ser Tyr Leu Leu Pro Val Leu Val Leu Ser Leu Thr Tyr Ala Arg Thr Leu Arg Tyr Leu Trp Arg Thr Val Asp Pro Val Thr Ala Gly Ser Gly Ser Gln Ser Ala Lys Arg Lys Val Thr Arg Met Ile Ile Ile Val Ala Val Leu Phe Cys Leu Cys Trp Met Pro His His Ala Leu Ile Leu Cys Val Trp Phe Gly Arg Phe Pro Leu Thr Arg Ala Thr Tyr Ala Leu Arg Ile Leu Ser His Leu Val Ser Tyr Ala Asn Ser Cys Val Asn Pro Ile Val Tyr Ala Leu Val Ser Lys His Phe Arg Lys Gly Phe Arg Lys Ile Cys Ala Gly Leu Leu Arg Pro Ala Pro Arg Arg Ala Ser Gly Arg Val Ser Ile Leu Ala Pro Gly Asn His Ser Gly Ser Met Leu Glu Gln Glu Ser Thr Asp Leu Thr Gln Val Ser Glu Ala Ala Gly Pro Leu Val Pro Pro Pro Ala Leu Pro Asn Cys Thr Ala Ser Ser Arg Thr Leu Asp Pro Ala Cys (2) INFORMATION FOR SEQUENCE ID NO. 3:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 1958 (B) TYPE: Nucleic Acid (C) STRANDEDNESS: Single (D) TOPOLOGY: Linear (vii) IMMEDIATE SOURCE:
(B) CLONE: Clone Y107 nucleic acid sequence (xi) SEQUENCE DESCRIPTION: SEQ ID N0: 3:
AAAAAAAAAPr AAAAAAAAA.A AAAi~AAAA 19 5 8 (2) INFORMATION FOR SEQUENCE ID N0. 4:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 372 (B) TYPE: Amino Acid Sequence (C) STRANDEDNESS: Single (D) TOPOLOGY: Linear (vii) IMMEDIATE SOURCE:
(B) CLONE: Clone Y107 amino acid sequence (omitting putative intron) (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 4:
Met Asn Gly Ser Gly Ser Gln Gly Ala Glu Asn Thr Ser Gln Glu Gly Gly Ser Gly Gly Trp Gln Pro Glu Ala val Leu Val Pro Leu Phe Phe Ala Leu Ile Phe Leu val Gly Thr Val Gly Asn Ala Leu Val Leu Ala Val Leu Leu Arg Gly Gly Gln Ala Val Ser Thr Thr Asn Leu Phe Ile Leu Asn Leu Gly Val Ala Asp Leu Cys Phe Ile Leu Cys Cys Val Pro Phe Gln Ala Thr Ile Tyr Thr Leu Asp Asp Trp Val Phe Gly Ser Leu Leu Cys Lys Ala Val His Phe Leu Ile Phe Leu Thr Met His Ala Ser Ser Phe Thr Leu Ala Ala Val Ser Leu Asp Arg Tyr Leu Ala Ile Arg Tyr Pro Leu His Ser Arg Glu Leu Arg Thr Pro Arg Asn Ala Leu Ala Ala Ile Gly Leu Ile Trp Gly Leu Ala Leu Leu Phe Ser Gly Pro Tyr Leu Ser Tyr Tyr Arg Gln Ser Gln Leu Ala Asn Leu Thr Val Cys His Pro Ala Trp Ser Ala Pro Arg Arg Arg Ala Met Asp Leu Cys Thr Phe Val Phe Ser Tyr Leu Leu Pro Val Leu Val Leu Ser Leu Thr Tyr Ala Arg Thr Leu Arg Tyr Leu Trp Arg Thr Val Asp Pro Val Thr Ala Gly Ser Gly Ser Gln Arg Ala Lys Arg Lys Val Thr Arg Met Ile Ile Ile Val Ala Val Leu Phe Cys Leu Cys Trp Met Pro His His Ala Leu Ile Leu Cys Val Trp Phe Gly Arg Phe Pro Leu Thr Arg Ala Thr Tyr Ala Leu Arg Ile Leu Ser His Leu Val Ser Tyr Ala Asn Ser Cys Val Asn Pro Ile Val Tyr Ala Leu Val Ser Lys His Phe Arg Lys Gly Phe Arg Lys Ile Cys Ala Gly Leu Leu Arg Pro Ala Pro Arg Arg Ala Ser Gly Arg Val Ser Ile Leu Ala Pro Gly Asn His Ser Gly Ser Met Leu Glu Gln Glu Ser Thr Asp Leu Thr Gln Val Ser Glu Ala Ala Gly Pro Leu Val Pro Pro Pro Ala Leu Pro Asn Cys Thr Ala Ser Ser Arg Thr Leu Asp Pro Ala Cys (2) INFORMATION FOR SEQUENCE ID NO. 5:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 1083 (B) TYPE: Nucleic Acid (C) STRANDEDNESS: Single (D) TOPOLOGY: Linear (vii) IMMEDIATE SOURCE:
(B) CLONE: Human GalR2 partial nucleic acid sequence (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 5:
AZ'I' 10 8 3 (2) INFORMATION FOR SEQUENCE ID N0. 6:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 337 (B) TYPE: Amino Acid sequence (C) STRANDEDNESS: Single (D) TOPOLOGY: Linear (vii) IMMEDIATE SOURCE:
(B) CLONE: Human GalR2 partial amino acid sequence (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 6:
Leu Arg Gly Gly Gln Ala Val Ser Thr Thr Asn Leu Leu Ile Leu Asn Leu Gly Val Ala Asp Leu Cys Phe Ile Leu Cys Cys Val Pro Phe Gln Ala Thr Ile Tyr Thr Leu Asp Gly Trp Val Phe Gly Ser Leu Leu Cys Lys Ala Val His Phe Leu Ile Phe Leu Thr Met His Ala Ser Ser Phe Thr Leu Ala Ala Val Ser Leu Asp Arg Tyr Leu Ala Ile Arg Tyr Pro Leu His Ser Arg Glu Leu Arg Thr Pro Arg Asn Ala Leu Ala Ala Ile Gly Leu Ile Trp Gly Leu Ser Leu Leu Phe Ser Gly Pro Tyr Leu Ser Tyr Tyr Arg Gln Ser Gln Leu Ala Asn Leu Thr Val Cys His Pro Ala Trp Ser Ala Pro Arg Arg Arg Ala Met Asp Ile Cys Thr Phe Val Phe Ser Tyr Leu Leu Pro Val Leu Val Leu Gly Leu Thr Tyr Ala Arg Thr Leu Arg Tyr Leu Trp Arg Ala Val Asp Pro Val Ala Ala Gly Ser Gly Ala Arg Arg Ala Lys Arg Lys Val Thr Arg Met Ile Leu Ile Val Ala Ala Leu Phe Cys Leu Cys Trp Met Pro His His Ala Leu Ile Leu Cys Val Trp Phe Gly Gln Phe Pro Leu Thr Arg Ala Thr Tyr Ala Leu Arg Ile Leu Ser His Leu Val Ser Tyr Ala Asn Ser Cys Val Asn Pro Ile Val Tyr Ala Leu Val Ser Lys His Phe Arg Lys Gly Phe Arg Thr Ile Cys Ala Gly Leu Leu Gly Arg Ala Pro Gly Arg Ala Ser Gly Arg Val Cys Ala Ala Ala Arg Gly Thr His Ser Gly Ser Val Leu Glu Arg Glu Ser Ser Asp Leu Leu His Met Ser Glu Ala Ala Gly Ala Leu Arg Pro Cys Pro Gly Ala Ser Gln Pro Cys Ile Leu Glu Pro Cys Pro Gly Pro Ser Trp Gln Gly Pro Lys Ala Gly Asp Ser Ile Leu Thr Val Asp Val Ala
Claims (5)
1. A polynucleotide molecule coding for GalR2 comprising SEQ ID NO: 1, SEQ ID
NO:
3, and SEQ ID NO: 5, or a variant or fragment thereof.
NO:
3, and SEQ ID NO: 5, or a variant or fragment thereof.
2. A purified and isolated GalR2 protein comprising SEQ ID NO: 2, SEQ ID NO: 4 and SEQ ID NO: 6 or a variant or fragment thereof.
3. A vector comprising a neucleic acid sequence according to claim 1.
4. A cell transformed or transfected with the vector according to claim 3.
5. A method of identifying a GalR2 receptor agonist or antagonist comprising contacting a membrane prepared from cells according to claim 4 with test material and evaluating affinity of the test material to the GalR2 receptor.
Applications Claiming Priority (5)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
US08/665,034 | 1996-06-05 | ||
US08/665,034 US6410686B1 (en) | 1996-06-05 | 1996-06-05 | Galanin receptor 2 protein |
US86803497A | 1997-06-03 | 1997-06-03 | |
US08/868,034 | 1997-06-03 | ||
PCT/US1997/009787 WO1997046681A2 (en) | 1996-06-05 | 1997-06-05 | GALANIN RECEPTOR GalR2 |
Publications (1)
Publication Number | Publication Date |
---|---|
CA2256523A1 true CA2256523A1 (en) | 1997-12-11 |
Family
ID=27099113
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
CA002256523A Abandoned CA2256523A1 (en) | 1996-06-05 | 1997-06-05 | Galanin receptor galr2 |
Country Status (2)
Country | Link |
---|---|
EP (1) | EP0907734A2 (en) |
CA (1) | CA2256523A1 (en) |
Cited By (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US7375207B2 (en) | 1996-07-19 | 2008-05-20 | Astrazeneca A.B. | Galanin receptor 2 proteins and nucleic acids |
-
1997
- 1997-06-05 EP EP97929814A patent/EP0907734A2/en not_active Withdrawn
- 1997-06-05 CA CA002256523A patent/CA2256523A1/en not_active Abandoned
Cited By (4)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US7375207B2 (en) | 1996-07-19 | 2008-05-20 | Astrazeneca A.B. | Galanin receptor 2 proteins and nucleic acids |
US7407761B2 (en) | 1996-07-19 | 2008-08-05 | National Research Council Of Canada | Methods for assaying expression of novel galanin receptors |
US7510846B2 (en) | 1996-07-19 | 2009-03-31 | National Research Council Of Canada | Assay employing human or rat GAL-R2 galanin receptor |
US7528229B2 (en) | 1996-07-19 | 2009-05-05 | National Research Council Of Canada | Isolated human and rat GAL-R2 galanin receptors |
Also Published As
Publication number | Publication date |
---|---|
EP0907734A2 (en) | 1999-04-14 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
US20060189530A1 (en) | Neuropeptide Y receptor Y5 and nucleic acid sequences | |
US6379925B1 (en) | Angiogenic modulation by notch signal transduction | |
WO1992017602A1 (en) | Parathyroid hormone receptor and dna encoding same | |
PL182324B1 (en) | Protocadherine proteins and their applications | |
WO1998057621A1 (en) | Angiogenic modulation by notch signal transduction | |
US5919901A (en) | Neuropeptide Y receptor Y5 and nucleic acid sequences | |
AU8897898A (en) | Novel molecules of the tango-77 related protein family and uses thereof | |
AU753185B2 (en) | Ligand receptors and uses therefor | |
US6410686B1 (en) | Galanin receptor 2 protein | |
US20030082672A1 (en) | Dna encoding galanin galr2 receptors and uses thereof | |
EP0730647A1 (en) | Dna sequence coding for a bmp receptor | |
JP2002522011A (en) | G protein-coupled receptor 14273 receptor | |
JP2004500125A (en) | Recombinant cell line expressing GPCRx11 as a functional receptor recognized by angiopeptin and useful for screening agonists and antagonists | |
US20030153041A1 (en) | Parathyroid hormone receptor and DNA encoding same | |
US7150974B1 (en) | Parathyroid hormone receptor binding method | |
JP2005229804A (en) | New melanin concentrating hormone receptor | |
JP2006511194A (en) | Teneurin C-terminal related peptide (TCAP) and methods and uses related thereto | |
CA2256523A1 (en) | Galanin receptor galr2 | |
WO1998033819A9 (en) | Cellular receptors for subgroup c adenoviruses and group b coxsackieviruses | |
Verkoczy et al. | hBRAG, a novel B cell lineage cDNA encoding a type II transmembrane glycoprotein potentially involved in the regulation of recombination activating gene 1 (RAG1) | |
AU2004202022A1 (en) | Human N-type calcium channel isoform and uses thereof | |
US20060292639A1 (en) | Splice variant of the vanilloid receptor VR1A | |
WO2000056756A2 (en) | Prolactin regulatory element binding protein and uses thereof | |
AU699824C (en) | DNA sequence coding for a BMP receptor | |
US7195893B2 (en) | Nucleic acids encoding α2δ calcium channel subunits and methods for making and using them |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
EEER | Examination request | ||
FZDE | Discontinued |