CA2251262C - Nucleic acid encoding a nervous tissue sodium channel - Google Patents

Abstract

A novel nucleic acid sequence encoding for a mammalian voltage-gated, preferablyTTX-resistant, sodium channel is isolated. Also disclosed are polypeptide products of recombinant expression of these sequences, expression vectors comprising the DNA sequence, and host cells transformed with these expression vectors. Other aspects of this invention are peptides whose sequences are based on the amino acid sequences deduced from these DNA sequences, antibodies specific for such proteins and peptides, procedures for detection and quantitation of such proteins and nucleic acids related thereto. Another aspect of this invention is the use of this voltage-gated, preferably tetrodotoxin-resistant, sodium channel as a therapeutic target for compounds.

Description

l~ ' I

Ref. 20016 This invention relates generally to sodium channel proteins and more particularly to a novel nucleic acid sequence encoding for a mammalian a,-subunit of a voltage-gated, preferably tetrodotoxin-resistant, nervous tissue sodium channel protein. This invention further relates to its production by recombinant technology.
The basic unit of information transmitted from one part of the nervous system to another is a single action potential or nerve impulse. The "transmission line"
for these impulses is the axon, or nerve fiber. The electrical excitability of the nerve membrane has been shown to depend on the membrane's voltage-sensitive ionic permeability system that allows it to use energy stored in ionic concentration gradients. Electrical activity of the nerve is triggered by a depolarization of the membrane, which opens channels through the membrane that are highly selective for sodium ions, which are then driven inward by the electrochemical gradient. Of the many ionic channels, the voltage-gated or voltage-sensitive sodium channel is one of the most studied. It is a transmembrane protein that is essential for the generation of action potentials in excitable cells. An excellent review of sodium channels is presented in Catterall, TINS 16(12), 500-506 (1993).
The cDNAs for several Na+ channels have been cloned and sequenced. Numa et al., Annals of the New York Academy of Sciences 479, 338-355 (1986), describe cDNA
from the electric organ of eel and two different ones from rat brain. Rogart, U.S.
Patent No. 5,380,836, describes cDNA from rat cardiac tissue. See also Rogart et al., Proc. Natl.
Acad. Sci. 86, 8170-8174 (1989). The sequence of PN1 and its orthologs in humans (hNE) and rabbits (Na+s) have been published (see, for example, Klugbauer et al., EMBOJ 14, 1084-1090 (1995) and Belcher et al., Proc. Natl. Acad. Sci. U.S.A. 923, 11034-11038 (1995)).
The sequence of rat PN1 cloned from DRG and its function expression have been described (see, for example, Sangameswaran et al., J.Biol.Chem. 272, 14805-14809 (1997)). Other cloned sodium channels include rat brain types I and II, Noda et al., Nature 320, 188-192 (1986), IIa, Auld et al., Neuron l, 449-461 (1988), and III, Kayano et al., FEBS Lett. 228, 187-194 (1988), rat 11.9.98/Ar/vh skeletal muscle (SkMl), Trimmer et al., Neuron 3, 33-49 (1989), rat NaCh6, Schaller et al., J.
Neurosci. 15, 3231-3242 (1995), rat peripheral nerve sodium channel type 3 (rPN3), Sangameswaran et al., J. Biol Chem. 271, 5953-5956 (1996), also called SNS, Akopian et al., Nature 379, 257-262 (1996), rat atypical channel, Felipe et al., J. Biol.
Chem. 269, 30125-30131 (1994), and the rat glial sodium channel, Akopian et al., FEBS Lett.
400, 183-187 ( 1997).
These studies have shown that the amino acid sequence of the Na+ channel has been conserved over a long evolutionary period. These studies have also revealed that the channel is a single polypeptide containing four internal repeats, or homologous domains (domains I-IV), having similar amino acid sequences. Each domain folds into six predicted and helical transmembrane segments: five are hydrophobic segments and one is highly charged with many positively charged lysine and arginine residues. This highly charged segment is the fourth transmembrane segment in each domain (the S4 segment) and is likely to be involved in voltage-gating. The positively charged side chains on the S4 segment are likely to be paired with the negatively charged side chains on the other five segments such that membrane depolarization could shift the position of one helix relative to the other, thereby opening the channel. Accessory subunits may modify the function of the channel.
Therapeutic utility in recombinant materials derived from the DNA of the numerous sodium channels have been discovered. For example, U.S. Patent No. 5,132,296 by Cherksey discloses purified Na+ channels that have proven useful as therapeutic and diagnostic tools.
Isoforms of sodium channels are divided into "subfamilies". The term "isoform"
is used to mean distinct but closely related sodium channel proteins, i.e., those having an amino acid homology of approximately 60-80%. These also show strong homology in functions.
The term "subfamilies" is used to mean distinct sodium channels that have an amino acid homology of approximately 80-95%. Combinations of several factors are used to determine the distinctions within a subfamily, for example, the speed of a channel, chromosomal location, expression data, homology to other channels within a species, and homology to a channel of the same subfamily across species. Another consideration is an affinity to tetrodotoxin ("TTX"). TTX is a highly potent toxin from the puffer or fugu fish which blocks the conduction of nerve impulses along axons and in excitable membranes of nerve fibers.
TTX binds to the Na+ channel and blocks the flow of sodium ions.
Studies employing TTX as a probe have shed much light on the mechanism and structure of Na+ channels. There are three Na+ channel subtypes that are defined by the affinity for TTX, which can be measured by the ICso values: TTX-sensitive Na+
channels (ICSo = 1-30 nM), TTX-insensitive Na+ channels (ICSO = 1-5 ~M), and TTX-resistant Na+ channels (ICso >_ 50 pM).
TTX-insensitive action potentials were first studied in rat skeletal muscle (Redfern et al., Acta Physiol. Scand. 82, 70-78 (1971)). Subsequently, these action potentials were described in other mammalian tissues, including newborn mammalian skeletal muscle, mammalian cardiac muscle, mouse dorsal root ganglion cells in vitro and in culture, cultured mammalian skeletal muscle and L6 cells. See Rogart, Ann. Rev. Physiol. 43, 711-725 (1980).
Rat dorsal root ganglia neurons possess both TTX-sensitive (ICso ~ 0.3 nM) and TTX-resistant (ICSO ~ 100 ~M) sodium channel currents, as described in Roy et al., J. Neurosci. 12, 2104-2111 (1992). TTX-resistant sodium currents have also been measured in rat nodose and petrosal ganglia. See Ikeda et al., J. Neurophysiol. S5, 527-539 (1986) and Stea et al., Neurosci. 47, 727-736 (1992). Electrophysiologists believe that another TTX-resistant sodium channel is yet to be detected.
Though cDNAs from rat skeletal muscle, heart and brain are known, identification and isolation of cDNA from peripheral sensory nerve tissue, such as dorsal root ganglia, has been hampered by the difficulty of working with such tissue.
SUMMARY OF THE INVENTION
The present invention provides novel purified and isolated nucleic acid sequences encoding mammalian, preferably TTX-resistant, nervous tissue sodium channel proteins that are strongly expressed in adult DRG and nodose ganglia, less strongly expressed in brain, spinal cord and superior cervical ganglia, and not expressed in sciatic nerve, heart or skeletal muscle. In presently preferred forms, novel DNA sequences comprise cDNA
sequences encoding rat nervous tissue sodium channel protein. One aspect of the present invention is the a-subunit of this sodium channel protein.
Disclosed is the DNA, cDNA, and mRNA derived from the nucleic acid sequences of the invention and the cRNA derived from the mRNA. Specifically, two cDNA
sequences together encode for the full length rat nervous tissue sodium channel.
Also included in this invention are alternate DNA forms, such as genomic DNA, DNA
prepared by partial or total chemical synthesis from nucleotides, and DNA
having deletions or mutations.
Still another aspect of the invention is the novel rat TTX-resistant sodium channel protein and fragments thereof, encoded by the DNA of this invention.
Another aspect of the present invention are recombinant polynucleotides and oligonucleotides comprising a nucleic acid sequence derived from the DNA
sequence of this invention.
Another aspect of the invention is a method of stabilizing the full length cDNA which encodes the protein sequence of the invention.
Further aspects of the invention include expression vectors comprising the DNA
of the invention, host cells transformed or transfected by these vectors, and a cDNA
library of these host cells.
Also forming part of this invention is an assay for inhibitors of the sodium channel protein comprising contacting a compound suspected of being an inhibitor with expressed sodium channel and measuring the activity of the sodium channel.
Further provided is a method of inhibiting the activity of the TTX-resistant sodium channel comprising administering an effective amount of a compound having an ICso of 10 E.~M or less.

Additionally provided are methods of employing the DNA for forming monoclonal and polyclonal antibodies, for use as molecular targets for drug discovery, highly specific markers for specific antigens, detector molecules, diagnostic assays, and therapeutic uses, such as pain relief, a probe for the PN5 channel in other mammalian tissue, designing therapeutics and screening for therapies.
BRIEF DESCRIPTION OF THE SEO ID'S AND FIGURES
Figures lA-E depict the 5908 nucleotide cDNA native sequence encoding the rat sodium channel type 5 ("PN5") (SEQ ID NO: 1), derived from two overlapping cDNA clones, designated 26.2 and 1.18.
Figures 2A-F depict the deduced amino acid sequence of PN5 (SEQ 1D NO: 2, represented in the three-letter amino acid code). Figures 2G-H, depicting the deduced amino acid sequence of PN5 in single letter amino acid code, also show the homologous domains (I-IV); the putative transmembrane segments (Sl-S6); the amino acid confernng resistance to TTX (~); N-glycosylation sites (~); cAMP-dependent protein kinase A (PKA) phosphorylation site (0); and the termination codon (*).
Figure 3A depicts an 856 base pair sequence for the human PN5 (SEQ ID NO: 3).
Figure 3B depicts the amino acid sequence comparison of the hPNS fragment with rat PNS.
Figure 4 depicts the sequence for the novel sodium channel domain IV probe (SEQ ID
NO: 4).
Figures 5A-E depict the 5334 nucleotide sequence modified for stability and expression (SEQ ID NO: 5). Nucleotides 24 to 5518 constitute the 5295 by region coding for a 1765 amino acid protein.
Figure 6 depicts the cloning map of PNS.
DETAILED DESCRIPTION OF THE INVENTION
The present invention relates to a purified and isolated nucleic acid sequence encoding for a novel mammalian, preferably TTX-resistant, sodium channel protein. The term "purified and isolated DNA" refers to DNA that is essentially free, i.e. contains less than about 30%, preferably less than about 10%, and even more preferably less than about 1%, of the DNA
with which the DNA of interest is naturally associated. Techniques for assessing purity are well known to the art and include, for example, restriction mapping, agarose gel electrophoresis, and CsCI gradient centrifugation.
The term "DNA" is meant to include "cDNA", or complementary DNA, which is single-stranded or double-stranded DNA sequences made by reverse transcription of mRNA
isolated from a donor cell or by chemical synthesis. For example, treatment of mRNA with a reverse transcriptase such as AMV reverse transcriptase or M-MuLV reverse transcriptase in the presence of an oligonucleotide primer will furnish an RNA-DNA duplex which can be treated with RNase H, DNA polymerise, and DNA ligase to generate double-stranded cDNA.
If desired, the double-stranded cDNA can be denatured by conventional techniques such as heating to generate single-stranded cDNA. The term "cDNA" includes cDNA that is a complementary copy of the naturally occurring mRNA ,as well as complementary copies of variants of the naturally occurring mRNA that have the same biological activity. Variants would include, for example, insertions, deletions, sequences with degenerate codons and alleles.
"cRNA" corresponding to mRNA transcribed from a DNA sequence encoding the a-subunit of a novel, preferably TTX-resistant, sodium channel protein is contemplated by this invention. The term "cRNA" refers to RNA that is a copy of the mRNA
transcribed by a cell.
Specifically, the invention encompasses DNA having the native versions of the nucleotide sequences set forth in Figures lA-E (SEQ 117 NO: 1) designated herein as sodium channel type 5 (PNS). Figures lA-E depict the 5908 nucleotide cDNA construct comprising a 5298-base (counting the stop codon) open reading frame (SEQ ID NO:1).
Nucleotide residue 79 represents the start site of translation and residue 5376 represents the end of the stop codon.
The invention also encompasses engineered versions of PNS, and specifically the version as set forth in Figures SA-E (SEQ ID NO: 5). This 5334 nucleotide SaII-XbaI clone lacks most of the untranslated sequences, the 5298 nucleotide open reading frame beginning at nucleotide 24 and ending at nucleotide 5321. The start and stop codons are underlined, as are the translationally silent mutations at nucleotides 3932, 3935, 3941, 3944, and 3947, which were introduced to block rearrangement in this region during growth in E.
Coli.
The nucleotide sequence of SEQ )D NO: 1 (Figures lA-E) corresponds to the cDNAs from rat. A homology search provided that the closest related sodium channel is found in the rat cardiac channel, with 72.5% homology. The next closely related channels are rPNl, with 72% and rat brain types I and III, with 71.8% and 71.3% respectively. Homology to rPN3a, hPN3, rPN4, rPN4a, rat brain type II and rat skeletal muscle are each approximately 70 to 71 %.
Additionally, an 856 base pair clone (SEQ m NO: 3) as shown in Figure 3A has been isolated from a human dorsal root ganglia (DRG) "cDNA library" and is closely related to the rat PNS amino acid sequence with 79% identity and 86% homology. The human PNS
sequence spans the region between IIIS 1 and interdomain III/IV which includes the fast inactivation gate (i.e., IFM) that is located within interdomain III/IV.
The term "cDNA library" refers to a collection of clones, usually in a bacteriophage, or less commonly in bacterial plasmids, containing cDNA copies of mRNA sequences derived from a donor cell or tissue.
It is believed that additional homologs of the novel rat TTX-resistant sodium channel described herein are also expressed in other mammalian tissue.
Northern blot analysis (Example 5) indicates that PNS is encoded by a -6.5 kb transcript.
The deduced amino acid sequence of PNS, shown in Figures 2A-F (SEQ ID NO: 2), exhibits the primary structural features of an a-subunit of a voltage-gated, TTX-resistant sodium channel. Shown in Figures 2G-H are the homologous domains (I-IV); the putative transmembrane segments (Sl-S6); the amino acid conferring resistance to TTX (~
); N-glycosylation sites (~); and cAMP-dependent PKA phosphorylation sites (0). DNA
sequences encoding the same or allelic variant or analog sodium channel protein polypeptides of the nervous system, through use of, at least in part, degenerate codons are also contemplated by this invention.
An interesting feature of this deduced amino acid sequence is that the amino acid that is most responsible for TTX-sensitivity is located at position 355 and is not aromatic. In rat and human brain type sodium channels, skeletal muscle channel, and in PNl and PN4, this amino acid is tyrosine or phenylalanine and these channels are all TTX-sensitive. In PN3 and PNS, the amino acid is a serine. Since PN3 is highly resistant to TTX, the implication is that PNS is also a TTX-resistant channel. The cardiac channel has a cysteine at this position and is "insensitive" to TTX.
Although PNS contains all of the hallmark features of a voltage-gated sodium channel, it has unique structural features that distinguish it from other sodium channels. For example, DIIS4 has 5 basic amino acids conserved in all sodium channels that could play a significant role in the voltage sensing aspects of the channel function. In PNS, the first basic amino acid is replaced by an alanine. Similarly, in DIIIS4, PNS has 5 basic amino acids rather than six that are present in other sodium channel sequences, the last arginine replaced by a glutamine.
In DIIIS3, the transmembrane segment contains only 18 amino acids, in contrast to 22 amino acids in other channels. Also, the short linker (4 amino acids) loop between S3 and S4 in DIII
is even shorter by a ,deletion' of 3 amino acids. This shortening of the S3 and the linker loop has been confirmed by designing primers in the appropriate region of the sequence for an RT-PCR experiment from rat DRG and sequencing the amplified DNA fragment. Such an experiment has been performed to confirm the sequence of another region of PNS, in the DIVSS-S6 loop, where there was a deletion of an 8 amino acid peptide.
Reverse transcription-polymerise chain reaction (oligonucleotide-primed RT-PCR) tissue distribution analysis of RNA from the rat central and peripheral nervous systems, in particular from rat DRG, was performed. Eight main tissue types were screened for expression of the unique PNS genes corresponding to positions 5651-5903 of SEQ
>D NO: 1 (Figures lA-E). PNS mRNA was present in five of the tissues studied: brain, spinal cord, DRG, nodose ganglia, and superior cervical ganglia. PNS was not present in the remaining tissues studied: sciatic nerve tissue, heart or skeletal muscle tissue. PNS
was found to be the strongest in DRG and nodose ganglia, leading the applicants to believe that the DRG is enriched with PNS. PNS shows dramatic abundance differences across a range of tissues.
PNS has a gradient of expression with high expression in DRG. PNS has a gradient of expression like other channels, but more limited distribution.
The invention not only includes the entire protein expressed by the cDNA
sequences of SEQ ID NOS: 1, 2 and 3, but also includes protein fragments. These fragments can be obtained by cleaving the full length proteins or by using smaller DNA
sequences or "polynucleotides" to express the desired fragment.
The term "polynucleotide" as used herein refers to a polymeric form of nucleotides of any length, either ribonucleotides or deoxyribonucleotides. This term refers only to the primary structure of the molecule. Thus, this term includes double- and single-stranded DNA, as well as double- and single-stranded RNA. It also includes modified, for example, by methylation and/or by capping, and unmodified forms of the polynucleotide.
Further, the term "polynucleotide" is intended to include a recombinant polynucleotide, which is of genomic, cDNA, semisynthetic or synthetic origin which, by virtue of its origin or manipulation is not associated with all or a portion of the polynucleotide with which it is associated in nature and/or is linked to a polynucleotide other than that to which it is linked in nature.
Accordingly, the invention also includes polynucleotides that can be used to make polypeptides of about 10 to 1500, preferably 10 to 100, amino acids in length.
The isolation and purification of such recombinant polypeptides can be accomplished by techniques that are well known in the art, for example, preparative chromatographic separations or affinity chromatography. In addition, polypeptides can also be made by synthetic means which are well known in the art.

The invention allows for the manipulation of genetic materials by recombinant technology to produce polypeptides that possess the structural and functional characteristics of the novel voltage-gated, TTX-resistant sodium channel a-subunit found in sensory nerves.
Site directed mutagenesis can be used to provide such recombinant polypeptides. For example, synthetic oligonucleotides can be specifically inserted or substituted into the portion of the gene of interest to produce genes encoding for and expressing a specific mutant.
Random degenerate oligonucleotides can also be inserted and phage display techniques can be used to identify and isolate polypeptides possessing a functional property of interest.
In addition, the present invention contemplates recombinant polynucleotides of about 15 to 20kb, preferably 10 to l5kb, nucleotides in length, comprising a nucleic acid sequence "derived from" the DNA of the invention.
The term "derived from" a designated sequence, refers to a nucleic acid sequence that is comprised of a sequence of approximately at least 6 to 8 nucleotides, more preferably at least 10 to 12 nucleotides, and, even more preferably, at least 15 to 20 nucleotides that correspond to, i.e., are homologous or complementary to, a region of the designated sequence.
The derived sequence is not necessarily physically derived from the nucleotide sequence shown, but may be derived in any manner, including for example, chemical synthesis or DNA
replication or reverse transcription, which are based on the information provided by the sequences of bases in the regions) from which the polynucleotide is derived.
A neonatal expression test was performed with Fl 1, a fusion cell line designed from neonatal rat DRG fused with a mouse cell line, N18TG, from Massachusetts General Hospital.
F11 responds to trophic agents, such as NGF, by extending dendrites. It was found that PNS
was present in both native F11 and F11 treated with NGF, leading the applicants to believe that the sodium channel is natively expressed in F11.
In situ hybridization of PNS mRNA to rat DRG tissue provides localization predominantly in the small and medium neurons with no detection in large neurons.

PNS was also mapped to its cytogenetic location on mouse chromosome preparations.
PNS maps to the same chromosome as the cardiac channel and PN3.
In general, sodium channels comprise an a- and two Li-subunits. The 13-subunits may modulate the function of the channel. However, since the a-subunit is all that is required for the channel to be fully functional, expression of the cDNA in SEQ m NO: 1 (Figures lA-E) will provide a fully functional protein. The gene encoding the 131-subunit in peripheral nerve tissue was found to be identical to that found in rat heart, brain and skeletal muscle. The cDNA of the B1-subunit is not described herein as it is well known in the art, see Isom et al., Neuron 12, 1183-1194 (1994). However, it is to be understood that by combining the known sequence for the Lil-subunit with the a-subunit sequence described herein, one may obtain complete PNS voltage-gated, preferably TTX-resistant, sodium channel.
The present invention also includes "expression vectors" comprising the DNA or the cDNA described above, host cells transformed with these expression vectors capable of producing the sodium channel of the invention, and cDNA libraries comprising such host cells.
The term "expression vector" refers to any genetic element, e.g., a plasmid, a chromosome, a virus, behaving either as an autonomous unit of polynucleotide expression within a cell or being rendered capable of replication by insertion into a host cell chromosome, having attached to it another polynucleotide segment, so as to bring about the replication and/or expression of the attached segment. Suitable vectors include, but are not limited to, plasmids, bacteriophages, and cosmids. Vectors will contain polynucleotide sequences which are necessary to effect ligation or insertion of the vector into a desired host cell and to effect the expression of the attached segment. Such sequences differ depending on the host organism, and will include promoter sequences to effect transcription, enhancer sequences to increase transcription, ribosomal binding site sequences and transcription and translation termination sequences.

The term "host cell" generally refers to prokaryotic or eukaryotic organisms and includes any transformable or transfectable organism which is capable of expressing a protein and can be, or has been, used as a recipient for expression vectors or other transferred DNA.
Host cells can also be made to express protein by direct injection with exogenous cRNA
translatable into the protein of interest. A preferred host cell is the Xenopus oocyte.
The term "transformed" refers to any known method for the insertion of foreign DNA
or RNA sequences into a host prokaryotic cell. The term "transfected" refers to any known method for the insertion of foreign DNA or RNA sequences into a host eukaryotic cell. Such transformed or transfected cells include stably transformed or transfected cells in which the inserted DNA is rendered capable of replication in the host cell. They also include transiently expressing cells which express the inserted DNA or RNA for limited periods of time. The transformation or transfection procedure depends on the host cell being transformed. It can include packaging the polynucleotide in a virus as well as direct uptake of the polynucleotide, such as, for example, lipofection or microinjection. Transformation and transfection can result in incorporation of the inserted DNA into the genome of the host cell or the maintenance of the inserted DNA within the host cell in plasmid form. Methods of transformation are well known in the art and include, but are not limited to, viral infection, electroporation, lipofection, and calcium phosphate mediated direct uptake.
It is to be understood that this invention is intended to include other forms of expression vectors, host cells, and transformation techniques which serve equivalent functions and which become known to the art hereto.
The invention also pertains to an assay for inhibitors of the novel TTX-resistant sodium channel protein comprising contacting a compound suspected of being an inhibitor with expressed sodium channel and measuring the activity of the sodium channel. The compound can be a substantially pure compound of synthetic origin combined in an aqueous medium, or the compound can be a naturally occurnng material such that the assay medium is an extract of biological origin, such as, for example, a plant, animal, or microbial cell extract.

PN5 activity can be measured by methods such as electrophysiology (two electrode voltage clamp or single electrode whole cell patch clamp), guanidinium ion flux assays, and toxin-binding assays. An "inhibitor" is defined as generally that amount that results in greater than 50% decrease in PN5 activity, preferably greater than 70% decrease in PN5 activity, more preferably greater than 90% decrease in PN5 activity.
Many uses of the invention exist, a few of which are described below:
1. Probe for mamalian charnels.
As mentioned above, it is believed that additional homologs of the novel rat TTX-resistant sodium channel described herein are also expressed in mammalian tissue, in particular, human tissue. The entire cDNAs of PNS rat sodium channels of the present invention can be used as a probe to discover whether additional novel PN5 voltage-gated, preferably TTX-resistant, sodium channels exist in human tissue and, if they do, to aid in isolating the cDNAs for the human protein.
The human homologues of the rat TTX--resistant PN5 channels can be cloned using a 1-'i human DRG cDNA library. Human DRG are obtained at autopsy. The frozen tissue is homogenized and the RNA extracted with guanidine isothiocyanate (Chirgwin et al.
Biochemistry 18, 5294-5299, (1979)). 'The RNA is size-fractionated on a sucrose gradient to enrich for large mRNAs because the sodium channel cx.-subunits are encoded by large (7-11 kb) transcripts. Double-stranded cDNA is prepared using the Superscript Choice cDNA
kit (GIBCO BRL) with either oligo{dT) or random hexamer primers. EcoRI
adapters are ligated onto the double-stranded cDNA which is then phosphorylated. The cDNA
library is constructed by ligating the double--stranded cDNA into the bacteriophage-lambda ZAP II*
vector (Stratagene) followed by packaging into phage particles.
Phage are plated out on 150 mm plates on a lawn of XLI-Blue MRF' bacteria (Stratagene) and plaque replicas ar-e made on Hybondi'N nylon membranes (Amersham).
Filters are hybridized to rat PN5 cDNA probes by standard procedures and detected by autoradiography or chemiluminesc;ence. The signal produced by the rat PN5 probes * Trade mark hybridizing to positive human clones at high stringency should be stronger than obtained with rat brain sodium channel probes hybridizing to these clones. Positive plaques are further purified by limiting dilution and re-screened by hybridization or PCR.
Restriction mapping and polymerase chain reaction will identify overlapping clones that can be assembled by S standard techniques into the full-length human homologue of rat PNS. The human clone can be expressed by injecting cRNA transcribed in vitro from the full-length cDNA
clone into Xenopus oocytes, or by transfecting a mammalian cell line with a vector containing the cDNA
linked to a suitable promoter.
2. Antibodies Against PNS.
The polypeptides of the invention are highly useful for the development of antibodies against PNS. Such antibodies can be used in affinity chromatography to purify recombinant sodium channel proteins or polypeptides, or they can be used as a research tool. For example, antibodies bound to a reporter molecule can be used in histochemical staining techniques to identify other tissues and cell types where PNS are present, or they can be used to identify epitopic or functional regions of the sodium channel protein of the invention.
The antibodies can be monoclonal or polyclonal and can be prepared by techniques that are well known in the art. Polyclonal antibodies are prepared as follows: an immunogenic conjugate comprising PNS or a fragment thereof, optionally linked to a Garner protein, is used to immunize a selected mammal such as a mouse, rabbit, goat, etc. Serum from the immunized mammal is collected and treated according to known procedures to separate the immunoglobulin fraction.
Monoclonal antibodies are prepared by standard hybridoma cell technology based on that reported by Kohler and Milstein in Nature 256, 495-497 (1975). Spleen cells are obtained from a host animal immunized with the PNS protein or a fragment thereof, optionally linked to a carrier. Hybrid cells are formed by fusing these spleen cells with an appropriate myeloma cell line and cultured. The antibodies produced by the hybrid cells are screened for their ability to bind to expressed PNS proteins.

A number of screening techniques well known in the art, such as, for example, forward or reverse enzyme-linked immunosorbent assay screening methods, may be employed. The hybrid cells producing such antibodies are then subjected to recloning and high dilution conditions in order to select a hybrid cell that secretes a homogeneous population of antibodies specific to either the PNS protein.
In addition, antibodies can be raised by cloning and expressing nucleotide sequences or mutagenized versions thereof coding at least for the amino acid sequences required for specific binding of natural antibodies, and these expressed proteins used as the immunogen.
Antibodies may include the complete immunoglobulin or a fragment thereof.
Antibodies may be linked to a reporter group such as is described above with reference to polynucleotides.
Example 10 illustrates practice of producing an antibody.
3. Therapeutic Targets for Compounds to Treat Disorders and Assays Thereof.
The present invention also includes the use of the novel voltage-gated, preferably TTX-resistant, sodium channel a-subunit as a therapeutic target for compounds to treat disorders of the nervous system based on the RT-PCR localization data. The disorders include, but are not limited to, epilepsy, stroke injury, brain injury, diabetic neuropathy, traumatic injury, chronic neuropathic pain, and AIDS-associated neuropathy.
4. Designing Therapeutics based on Inhibiting PNS and assays thereof.
This invention is also directed to inhibiting the activity of PNS in brain, spinal cord, DRG, nodose ganglia, and superior cervical ganglia tissues. However, it is to be understood that further studies may reveal that PNS is present in other tissues, and as such, those tissues can also be targeted areas. For example, the detection of PNS mRNA in nodose ganglia suggests that PNS may conduct TTX-resistant sodium currents in this and other sensory ganglia of the nervous system.
In addition, it has been found that proteins not normally expressed in certain tissues are expressed in a disease state. Therefore, this invention is intended to encompass the inhibition of PNS in tissues and cell types where the protein is normally expressed, and in those tissues and cell types where the protein is only expressed during a disease state.
For example, it is believed that TTX-resistant sodium channels play a key role in transmitting nerve impulses relating to sensory inputs such as pain and pressure. This information will facilitate the design of therapeutics that can be targeted to a specific area such as peripheral nerve tissue.
The recombinant protein of the present invention can be used to screen for potential therapeutics that have the ability to inhibit the sodium channel of interest.
In particular, it would be useful to inhibit selectively the function of sodium channels in peripheral nerve tissues responsible for transmitting pain and pressure signals without simultaneously affecting the function of sodium channels in other tissues such as heart and muscle.
Such selectivity would allow for the treatment of pain without causing side effects due to cardiac or neuromuscular complications. Therefore, it would be useful to have DNA
sequences coding for sodium channels that are selectively expressed in peripheral nerve tissue.
5. Pain Reliever.
Sodium channels in peripheral nerve tissue play a large role in the transmission of nerve impulses, and therefore are instrumental in understanding neuropathic pain transmission.
Neuropathic pain falls into two components: allodynia, where a normally non-painful stimulus becomes painful, and hyperalgesia, where a usually normal painful stimulus becomes extremely painful.
In tissue localization studies, PNS mRNA maps small and medium neurons of DRG.
PNS mRNA is also present in brain and spinal cord. Inhibiting its activities may help prevent ailments such as headaches and migraines. The ability to inhibit the activity of these sodium channels, i.e., reduce the conduction of nerve impulses, will affect the nerve's ability to transmit pain impulses. Selective inhibition of sodium channels in sensory neurons such as DRG will allow the blockage of pain impulses without complicating side effects caused by inhibition of sodium channels in other tissues such as brain and heart. In addition, certain diseases are caused by sodium channels that produce impulses at an extremely high frequency.
The ability to reduce the activity of the channel can then eliminate or alleviate the disease.
Accordingly, potential therapeutic compounds can be screened by methods well known in the art to discover whether they can inhibit the activity of the recombinant sodium channel of the invention. Barram, M. et al., Naun-Schmiedeberg's Archives of Pharmacology 347, 125-132 (1993) and McNeal, E.T. ez al., J. Med. Chem. 28, 381-388 (1985). For similar studies with the acetyl choline receptor, see, Claudio et al., Science 238, 1688-1694 (1987).
For example, pain can be alleviated by inhibiting the activity of the novel preferably TTX-resistant sodium channel comprising administering a therapeutically effective amount of a compound having an ICso approximately 10 E..~M or less, preferably <_1 E.~M.
Potential therapeutic compounds are identified based on their ability to inhibit the activity of PNS.
Therefore, the aforementioned assay can be used to identify compounds having a therapeutically effective ICso.
The term "ICSO" refers to the concentration of a compound that is required to inhibit by 50% the activity of expressed PNS when activity is measured by electrophysiology, flux assays, and toxin-binding assays, as mentioned above.
6. Diagnostic Assays.
The basic molecular biology techniques employed in accomplishing features of this invention, such as RNA, DNA and plasmid isolation, restriction enzyme digestion, preparation and probing of a cDNA library, sequencing clones, constructing expression vectors, transforming cells, maintaining and growing cell cultures, and other general techniques are well known in the art, and descriptions of such techniques can be found in general laboratory manuals such as Molecular Cloning: A Laboratory Manual by Sambrook et al.
(Cold Spring Harbor Laboratory Press, 2nd edition, 1989).
For example, the polynucleotides of the invention can be bound to a "reporter molecule" to form a polynucleotide probe useful for Northern and Southern blot analysis and in situ hybridizations.

The term "reporter molecule" refers to a chemical entity capable of being detected by a suitable detection means, including, but not limited to, spectrophotometric, chemiluminescent, immunochemical, or radiochemical means. The polynucleotides of this invention can be conjugated to a reporter molecule by techniques well known in the art.
Typically the reporter molecule contains a functional group suitable for attachment to or incorporation into the polynucleotide. The functional groups suitable for attaching the reporter group are usually activated esters or alkylating agents. Details of techniques for attaching reporter groups are well known in the art. See, for example, Matthews, J.A., Batki, A., Hynds, C., and Kricka, L.J., Anal. Biochem. 151, 205-209 (1985) and Engelhardt et al., European Patent Application No.0302175.
Accordingly, the following Examples are merely illustrative of the techniques by which the invention can be practiced.
Abbreviations The following abbreviations are used throughout the Examples and have each of the respective meanings defined below.
BSA: bovine serum albumin Denhardt's solution: 0.02% BSA, 0.02% polyvinyl-pyrrolidone, 0.02% Ficoll (0.1 g BSA, 0.1 g Ficoll and 0.1 g polyvinylpylrolidone per S00 ml) DRG: dorsal root ganglia EDTA: Ethylenediaminetetraacetic acid, tetrasodium salt MEN: 20 mM MOPS, 1 mM EDTA, 5 mM sodium acetate, pH 7.0 MOPS: 3-(N-morpholino)propanesulfonic acid (Sigma Chemical Company) PNS: peripheral nerve sodium channel 5 PNS: peripheral nervous system SDS: sodium dodecyl sulfate SSC: 150 mM NaCI, 15 mM sodium citrate, pH 7.0 SSPE: 80 mM NaCI, 10 mM sodium phosphate, 1 mM ethylenediaminetetraacetate, pH
8.0 TEV: two electrode voltage clamp TTX: tetrodotoxin (Sigma Chemical Company) CA 02251262 2001-12-07 .. ... . .,....,.., EXAMPLES
The following Examples illustrate practice of the invention.
Materials The plasmid pBK-CMV was obtained from Stratagene (La Jolla, CA); the plasmid ~ pBSTA is described by Goldin et cil., it Methods in Enzymology (Rudy &
Iverson, eds.) 207, 279-297; the plasmid pCIneo was obtained from Promega (Madison, WI); and the plasmid pCRII was obtained from Invitrog~°n (Carlsbad, CA).
The oocyte expression vector plasmid pBSTAcIIr was constructed from pBSTA by insertion of a synthetic oligonucleotide linker; plasmid pKK232-8 was obtained from Pharmacia Biotech (Piscataway, NJ); plasmid pCRII was obtained from Invitrogen, San Diego, CA. Competent E. coli cell lines STBL2TM and SURE~ were obtained from GibcolBRL and Stratagene, respectively.

OBTAINING RNf~ FROM RAT DRG. BRAIN AND SPINAL CORD
Lumbar DRG No. 4 and Nn. 5 (L4 and L5 ) brain and spinal cord were removed from anesthetized adult male Sprague-Dawley rats under a dissecting microscope. The tissues were frozen in dry ice and homogenized with a Polytron~omogenizer; the RNA was extracted by the guanidine isothiocyanate procedure (see Chomczynksi et al., Anal.
Biochemistry 162, 156-2l) 159 (1987)). Total RNA (5 ~.g of each sample) was dissolved in MEN buffer containing 50%
formamide, 6.6% formaldehyde arid denatured at 6~°C for 5-10 min. The RNA was electrophoresed through a 0.8% ag;arose gel containing 8.3% formaldehyde in MEN buffer.
The electrode buffer was MEN buffer containing 3.7% formaldehyde; the gel was run at 50 V
for 12-18 hours.
2:> Size markers, including ribosomal 18S and 28S RNAs and RNA markers (GIBCO
BRL), were run in parallel lanes of the gel. Their positions were determined by staining the excised lane with ethidium bromide (0.5 ~g/ml) followed by photography under IJV light.
* Trade mark After electrophoresis, the gel was rinsed in 2xSSC and the RNA was transferred to a Duralose*membrane (Stratagene) ~~ith ?OxSSC by capillary action; the membrane was baked under vacuum at 8U°C for 1 hour.

PRC>BE FROM RA'T BRAL'~1 IIA
A 'ZP-labeled cRNA probe complementary to nucleotides 4637-5868 of the rat brain IIA sodium channel a-subunit sequence was synthesized in vitro with T7 RNA
polymerise (Pharmacia) using pEAF8 template; DNA, (Noda et al., Nature 320, 188-192 (1986)) that had been linearized with BstEII.
Protocols for each procedure mentioned above can be found in Molecular Cloning: A
Laboratory Manual by Sambrook Eat al. (Cold Spring Harbor Laboratory Press, 2nd edition, 1989).
1 ~~

HYBRIDIZATION OF RNA WITH THE PROBE FROM RAT BRAIN IIA
The membrane of Example 1 was prehybridized in 50% formamide, SxSSC, 50 mM
sodium phosphate, pH 7.1, lx Denhardr's solution, 0.5% SDS, and sheared, heat-denatured salmon sperm DNA (1 mg/ml) for 16 hours at 42°C. The membrane was hybridized in 50%
formamide, SxSSC, SO mM sodium phosphate, pH 7.1, lx Denhardt's solution, 0.5%
SDS, and sheared, heat-denatured salmon sperm DNA (200 ~.g/ml) with the 32P-labeled cRNA probe (ca.
1-3x 106 cpm/ml) described in Example 2 for 18 hours at 42°C.
2.'i The membrane was rinsed with 2xSSC, 0.1% SDS at room temperature for 20 min. and then washed sequentially with: 2xSSC, 0.1%- SDS at 55°C for 30 min., 0.2xSSC, 0.1% SDS
at 65°C for 30 min., 0.2xSSC, 0.1~~'o SDS at 70°C for 30 min., and 0.2xSSC, 0.1% SDS, 0.1%
sodium pyrophosphate at 70°C for 20 min. The filter was exposed against Kodak X-omit*AR
film at -80°C with intensifying screens for up to 2 weeks.

* Trade mark The pEAF8 probe hybridized to mRNAs in the DRG sample with sizes of 11 kb, 9.5 kb, 7.3 kb, and 6.5 kb, estimated on the basis of their positions relative to the standards.

NOVEL SODIUM CHANNEL DOMAIN IV PROBE
The probe was obtained as follows: RT-PCR was performed on RNA isolated from rat DRG using degenerate oligonucleotide primers that were designed based on the homologies between known sodium channels in domain IV. The domain IV products were cloned into a plasmid vector, transformed into E. coli and single colonies isolated. The domain IV specific PCR products obtained from several of these colonies were individually sequenced. Cloned novel domain IV sequence was as follows (SEQ ID NO: 4):

This sequence was labeled with 32P by random priming.

HYBRIDIZATION OF RNA WITH THE NOVEL SODIUM CHANNEL 3'-UTR PROBE
_'i A Northern blot was prepared with 10~,g total RNA from rat brain, spinal cord, and DRG. The blot was hybridized with a cRNA probe from the 3 '-UTR. The 3 '-UTR
was cloned into pSP 73 vector, the cRl'dA transcribed using a Trans Probe T kit (Pharmacia Biotech) and''P UTP. The blot was prehybridized for 2 hours at 65°C in a solution containing SXSSC, 1X Denhardt's solution, 0.5% SDS, 50mM sodium phosphate, pH
7.1, 1C> salmon sperm DNA (lmg/ml) and 50% formamide. Hybridization was conducted at 45°C for l~ hours in the above solution except that the salmon sperm DNA was included at a concentration of 200~,g/ml and the '2P-labeled probe was added at 7.5x105 cpm.ml solution.
The blot was subsequently washed three times at 2XSSC and 0.1 % SDS at room temperature, once with 0.2XSSC and 0.1 % SDS at 65°C for 20 min., and once with 0.2XSSC, 0.1 % SDS
15 and 0.1 % sodium pyrophosphate at 65°C for 20 min. The blot was analyzed on a PhosphoImager~BioRad) after an exposure of 2 days. The results indicated that there was a -6.5kb band signal present in brain only in the Lane containing RNA from DRG.
Because of the lower abundance of PN5 mRN,A, as evidenced by the RT-PCR experiment, the 6.5kb band was not detectable in brain and spinal cord.

CONSTRUCTION & SCREENING OF cDNA LIBRARY FROM RAT DRG
An EcoRI-adapted cDNA library was prepared from normal adult male Sprague-Dawley rat DRG poly(A)+ RNA using the Superscript Choice System (GIBCO BRL).
cDNA
(>4 kb) was selected by sucrose gradient fractionation as described by Kieffer, Gene 109, 115-119 (1991). The cDNA was then ligated into the Zap Express vector (Stratagene), and packaged with the Gigapack*II XL lambda packaging extract (Stratagene).
Similarly, a >2kb DRG cDNA library was synthesized.

* Trade mark Phage (3.5x105) were screened by filter hybridization with a 32P-labeled probe (rBIIa, bases 4637-5868 as follows of Auld et al., Neuron 1, 449-461 (1988)). Filters were hybridized in 50% formamide, 5X SSPE, SX Denhardt's solution, 0.5% SDS, 250~tg/ml sheared, denatured salmon sperm DNA, and 50 nuvl sodium phosphate at 42°C and washed in 0.5X
S SSC/O.I% SDS at 50°C.
Southern blots of EcoRI-digested plasmids were hybridized with the'ZP-labeled DNA
probe, (SEQ ID NO: 4). The filte;~s were then hybridized in 50% formamide, 6X
SSC, SX
Denhardt's solution, 0.5%, SDS, and 100p,g/ml sheared, denatured salmon sperm DNA at 42°C and were washed in O.1X SSC/0.1% SDS at 65°C.
I0 Positive clones were excised in vivo into pBK-CMV using the ExAssistlXLOLR
system (Stratagene).

1.5 CLONES AND NUCLEOTTDE ANALYSIS
cDNA clones, 26.2 and 25. I were isolated from the >4kb DRG cDNA library and clone 1.18 was isolated from the >2kb DRG cDNA library. By sequence analysis, 26.2 appeared to be a full-length cDNA encoding a novel sodium channel and 25.1 extended from 2~) domain II to the 3'-UTR. However, each had a deletion which truncated the coding region.
Clone 1.18 had the 3 '- untranslated region, in addition to the C-terminus of the deduced amino acid sequence of PNS. The construct in the expression vector, pBSTACIIr, consisted of sequences from 26.2 and 1.18.
PN5 homology to other known sodium channels was obtained using the GAPBest Fit 25 (GCG) program:
Channel % Similarity % Identity PN3a 71 54 30 hPN3 71 5 5 PN4a 71 53 * Trade mark PNl 72 55 rat brain type I 72 55 rat brain type II 71 54 rat brain type III 71 54 rat cardiac channel 73 56 rat skeletal muscle channel 71 53 Stabilizing the PNS full length cDNA
A. Media, E. coli cell lines, and growth conditions:
Growth of fragments of PNS could be accomplished under standard conditions;
however growth of plasmids containing full length constructs of PNS (in pCIneo, pBSTAcIIr, and other vectors) could not be accomplished without use of special growth media, conditions, and E. coli strains. The following proved to be optimal: (1) use of E. coli STBL2TM for primary transformation following ligation reactions and for large scale culturing; (2) solid media was 1/2x FM (see below) plus lx LB (Tryptone, 1%, Yeast Extract, 0.5%, NaCI, 0.5%), plus 15g/L agar, or lxFM plus 1/2x LB; (3) liquid media optimally was lx FM
plus 1/2x LB;
(4) carbenicillin, 100~g/ml, was used for all media, as it is metabolized less rapidly than ampicillin; (5) temperature for growth should be no greater than 30°C, usually 24-26°C; this necessitated longer growth periods than normally employed, from 24 to 72 hours.
2x Freezing Medium (2xFM):
K2HP04 12.6g Na3Citrate 0.9g MgS04.7H20 0.18g (NH4)2S04 1.8g KH2P04 3.6g Glycerol 88g H20 qs to IL
2x FM and the remaining media components are prepared separately, sterilized by autoclaving, cooled to at least 60°C, and added together to form the final medium.
Carbenicillin is prepared at 25mg/mI H20 and sterilized by filtration. 2x FM was first described for preparation of frozen stocks of bacterial cells (Practical Methods in Molecular Biology, Schleif, R.F. and Wensink, P.C., Springer-Verlag, New York (1981) pp. 201-202).
B. Expression Vectors In order to provide for increased stability of the full length cDNA, the oocyte expression vector pBSTAcIIr was modified to reduce plasmid copy number when grown in E.
coli and to reduce possible read-through transcription from vector sequences that might result in toxic cryptic expression of PNS protein, Brosius J., Gene 27, 151-160(1984). pBSTAcIIr was digested with PvuII. The 755 by fragment containing the T7 promoter, 13-globin 5 'UTR, the multiple cloning site, Li-globin 3 'UTR, and T3 promoter was ligated to the 3.6 kb fragment containing the replication origin, ampicillin resistance gene, rrnBT~ and rrnBTlT2 transcription terminators from pKK232-8, which had been fully digested with SmaI and partially digested with PvuII and treated with shrimp intestinal phosphatase to prevent self ligation. The resulting plasmid in which the orientation of the pBSTA fragment is such that the T7 promoter is proximal to the rrnBTl terminator was identified by restriction mapping and named pHQB. As is the case with pBSTA, the direction of transcription of the ampicillin resistance gene and replication origin of pHQ8 is opposite to that of the gene expression cassette, and the presence of the rrnB Tl terminator should reduce any remaining read-through from the vector into the T7 promoter driven expression cassette.
C. Assembly of full length cDNA for expression Since pBK-CMV.26.2 had a 58 by deletion (corresponding to by 4346 to 4403 of SEQ
>D NO: 1) and the sequnce of pBK-CMV.1.18 begins at by 4180 of SEQ )D NO: l, pBK-CMV.1.18 could be used to "repair" pBK-CMV.26.2. A strategy was developed to assemble a full length cDNA from clones pBK-CMV.26.2 and pBK-CMV.1.18 in three sections, truncating the 5 ' and 3 ' UTRs and introducing unique restriction sites at the 5 ' and 3 ' ends in the process. The 5 ' end was generated by PCR from 26.2, truncating the 5 ' IJTR by incorporating a SaII site just upstream of the start codon. The central section was a restriction fragment from 26.2. The 3 ' end was prepared by overlap PCR from both 26.2 and 1.18 and incorporating an XbaI site just down stream of the stop codon. These sections were digested at unique restriction sites and assembled in pBSTAcIIr. Although this construct appeared to have a correct sequence, upon recloning as a SaII to XbaI fragment into pCIneo, two type of isolates were found, one with a deletion and one with an 8 by insertion. Reexamination of the pBSTAcIIr clone showed the sequence was "mixed" in this region, so that the clone must have rearranged.
The 8 by insertion was found as a repeat of one of the members of an 8 by duplication in the native sequence, forming a triple 8 by repeat in the rearranged isolate. Numerous cloning attempts inevitably gave rise to this rearrangement. Overlap PCR was used to introduce silent mutations into one of the 8 by repeats, and a fragment containing this region was included when the PNS coding region was assembled into HQB, the low-copy number version of pBSTAcIIr, to give plasmid HR-1. This sequence proved to be stable (see Figures SA-E, SEQ
ID NO: 5).
The 5 ' end fragment was prepared by PCR using pBK-CMV.26.2 DNA as template and primers 4999 (CTTGGTCGACTCTAGATCAGGGTGAAGATGGAGGAG; SaII site underlined, PNS homology in italics, corresponding to by 58-77 of SEQ ID NO:
1, initiation codon in bold) and 4927 (GGGTTCAATGTGGTTTTATCT, corresponding to by 1067 to 1047 of SEQ ID NO: 1), followed by gel purification, digestion with SaII and KpnI (KpnI site at pb 1003-1008, SEQ ID NO: 1), and gel purification.
The central 3.1 kb fragment was prepared by digestion of pBK-CMV.26.2 DNA with KpnI and AatII (AatII site at 4133-4138), followed by gel purification.
The 3 ' end fragment was prepared as follows: PCR using primers 4837 (TCTGGGAAGTTTGGAAG, corresponding to by 3613 to 3629 of SEQ ID NO: 1) and 4931 (GACCACGAAGGCTATGTTGAGG, corresponding to by 4239 to 4218 of SEQ >D NO: 1) on pBK-CMV.26.2 DNA as template gave a fragment of 0.6 kb. PCR using primers (CCTCAACATAGCCTTCGTGGTC, corresponding to by 4218 to 4239 of SEQ ID NO: 1) and 4929 (GTCTTCTAGATGAGGGTTCAGTCATTGTG, XbaI site underlined, PNS
homology in italics, corresponding to pb 5386 to 5365 of SEQ ll~ NO: 1, stop codon in bold) on pBK-CMV.1.18 DNA as template gave a fragment of 1.2 kb, introducing a XbaI
site 7 by from the stop codon. Thus the 3 ' end of the 4837-4931 fragment exactly complements the 5 ' end of the 4930-4929 fragment. These two fragments were gel purified and a fraction of each combined as template in a PCR reaction using primers 4928 (CAAGCCTTTGTGTTCGAC, corresponding to by 4084 to 4101 of SEQ 1D NO: 1) and 4929, to give a fragment of 1.3 kb.
This fragment was gel purifed, digested with AatII and XbaI, and the 1.2 kb fragment gel purified.
The 3 ' end fragment was cloned into AatII and XbaI digested pBSTAcIIr. One isloate was digested with SaII and KpnI and ligated to the 5 ' end fragment. The resulting plasmid, after sequence verification, was digested with KpnI and AatII and ligated to the central 3.1 kb fragment, to form pBSTAcIIr.PNS(clone 21). pBSTAcIIr.PNS (clone 21) was digested with SaII and XbaI to release the 5.3 kb PNS fragment which was cloned into SaII
and XbaI
digested pCIneoII. Multiple isolates were found, of which GPII-1, which was completely sequenced, was typical and contained an 8 by insert. This CAGAAGAA, after pb 3994 of SEQ 1D NO: 1, converted the direct repeat of this sequence at this location into a triple direct repeat, causing a shift in the reading frame. In an attempt to repair this defect, pBSTAcIIr.
PNS (clone 21) was digested with NheI (bp 2538-2543 SEQ >D NO: 1) and XhoI (bp 4833, SEQ )D NO: 1) to give a 6.2 kb fragment and with AatII and XhoI to give a 0.7 kb fragment which were ligated to the 1.6 kp fragment resulting from digestion of pBK-CMV.26.2 with AatII and NheI. Although no isolates were found which were completely correct, one isolate, HA-4, had only a single base change, deletion of the C at by 4827 (SEQ ID NO: 1) adjacent to the XhoI site.
In order to prevent the 8 by insertion rearrangement from occurring, three silent mutations were introduced in the 5 ' repeat, and two additional mutations in a string of Ts would also be introduced, as shown below (bp 3982 to 4014, SEQ ID NO: 1;
mutation sites underlined, 8 by repeats in native sequence in italics):
native GAC ATT Tl'T ATG ACA GAA GAA CAG AAG AAA TAT
Asp Ile Phe Met Thr Glu Glu Gln Lys Lys Tyr mutant GAC ATC TTC ATG ACT GAG GAG CAG AAG AAA TAT
As isolate HA-4 had the native direct repeat sequence (as opposed to e.g.
pBSTAcIIr.PNS (clone 21)) and the region near the XhoI site defect would not be involved, it was used as template DNA for the following PCR reactions. Primer P5-3716S
(CCGAAGCCAATGTAACATTAGTAATTACTCGTG, corresponding to pb 3684 to 3716, SEQ ID NO: 1) was paired with primer P5-3969AS
(GCTCCTCAGTCATGAAGATGTCTTGGCCACCTAAC, correspoind to by 4003 to 3969, SEQ ID NO: 1, mutated bases are underlined ) to give a 320 by product. Primer (GGCCAAGACATCTTCATGACTGAGGAGCAGAAGAAATATTAC, corresponding to by 3976 to 4017, SEQ m NO: 1; mutated bases are underlined) was paired with primer P5-4247AS (CTCAAAGCAAAGACTTTGATGAGACACTCTATGG, corresoinding to by 4280 to 4247, SEQ ID NO: 1) to give a 305 by product. The 3' end of the 320 by fragment thus has a 28 by exact match to the 5 ' end of the 305 by fragment. The two bands were gel purified and a fraction of each combined in a new PCR reaction with primers P5-37165 and P5-4247AS to give a 597 by product, which was T/A cloned into vector pCRII.
Isolate HO-7 was found to have the desired sequence. A four-way ligation was performed to assemble the full-length, modified PNS:

the oocyte expression vector HQ-8 ws digested with SaII and XbaI to give a 4.4 kb vector fragment; GPII-1 was digested wtih SaII and MIuI to give a 3.8 kb fragment containing the 5' half of PNS; HO-7 was digested with MIuI (bp 3866 to 3871, SEQ ID NO: 1) and AatII to give a 0.3 kb fragment containing the mutant 8 by repeat region of PNS; GPII-1 was digested with AatII and XbaI to give the remaining 1.3 kb 3 ' portion of PNS. A portion of the ligation reaction was transformed into E. coli Stable 2 cells. Of the 9.6 kb isolates containing all four fragments, HR-1 was sequenced and found to have the desired 5.4 kb sequence.
These isolates grew well and showed no tendency to rearrange. The sequence of this engineered version of PN5 is shown in Figures 5A-E (SEQ ID NO: 5).

An 856 by clone (Figure 3A, SEQ )D No.: 3) has been isolated from a human dorsal root ganglia (DRG) cDNA library that is most closely related to rat PN5 with 79% identity for the amino acid sequence. The human PN5 sequence spans the region between IIIS
1 and interdomain III/IV which includes the fast inactivation gate (i.e., IFM) that is located within interdomain III/IV.
The human DRG cDNA library was constructed from lumbar 4 and 5 DRG total RNA
that was randomly primed. First strand cDNA was synthesized with Superscript II reverse transcriptase (GIBCO BRL) and the second strand synthesis with T4 DNA
polymerise. EcoRI
adaptors were ligated to the ends of the double stranded cDNAs and the fragments cloned into the ZAP II vector (Stratagene). The library was screened with digoxigenin-labeled rat PN3, rat PNl and human heart hHl probes. Positive clones were sequenced and compared to known human and rat sodium channel sequences. Only the aforementioned clone was identified as human PN5 sequence.
Channel % Similarity % Identity Human Brain (HBA) 76 69 Human Heart (hHl) 81 74 Human Atypical He~~rt 60 52 Human Skeletal Muscle 80 71 Human Neuroendocrine 78 71 Human PN3 77 70 Rat PNl 79 72 Rat PN3 78 71 Rat PN4 78 70 Rat PN5 86 79 Figure 3B compares the an>ino acid sequence of the hPNS fragment with the rat amino acid sequence in the appropriate region.
EXA.~VIPLE 9 1_i TISSUE DISTRIBUTION BY RT-PCR
Brain, spinal cord, DRG, nodose ganglia, superior cervical ganglia, sciatic nerve. heart and skeletal muscle tissue were isalated from anesthetized, normal adult male Sprague-Dawley rats and were stored at -80°C. RIA was isolated from each tissue using RNAzoI*(Tel-Test, Inc.). Random-primed cDNA was reverse transcribed from 500ng of RNA from each tissue.
The forward primer (CAGATTGTGTTCTCAGTACATTCC) and the reverse primer (CCAGGTGTCTAACGAATAAATACJG) were designed from the 3 '-untranslated region to yield a 252 base pair fragment. The cycle parameters were: 94°C/2 min.
(denaturation), 94°C/30 sec., 65°C/30 sec. and 72"C/lmin. (35 cycles) and 72°C/4 min. The reaction 2-'i products were analyzed on a 4% agarose gel.
A positive control and a na-template contral were also included. cDNA from each tissue was also PCR amplified using primers specific for glyceraldehyde-3-phosphate dehydrogenase to demonstrate template viability, as described by Tso et al., Nucleic Acid Res.
13, 2485-2502 {1985).
3(f Tissue distribution profile of rPNS by analysis of R_NA from selected rat tissues by RT-PCR was as follows:
Tissue RT-PCR 35 c cles Brain +

Trade mark Spinal cord +

DRG +++

Nodose ganglia +++

Superior cervical ganglia +

S Sciatic nerve -Heart -Skeletal muscle -F11-untreated +

F11-treated +

PNS was also detected after only 25 cycles (24 + 1) in the same five tissues as above in the same relative abundance.

ANTIBODIES
A synthetic peptide (26 amino acids in interdomain II and III - residues 977 to 1002) was conjugated to KLH and antibody raised in rabbits. The antiserum was subsequently affinity purified.
PNS constitutes a subfamily of novel sodium channel genes; these genes are different from those detectable with other probes (e.g., PEAF8 and PN3 probes).
Although the foregoing invention has been described in some detail by way of illustration and example for purposes of clarity and understanding, it will be obvious that certain changes and modifications may be practiced within the scope of the appended claims.

SEQUENCE LISTING
(1) GENERAL INFORMATION:
(i)APPLICANT:

(A) NAME: F. HOFFMANN-LA ROCHE AG

(B) STREET: Grenzacherstrasse 124 (C) CITY: Basle (D) STATE: BS

(E) COUNTRY: Switzerland (F) POSTAL CODE (ZIP): CH-4010 (G) TELEPHONE: 061-6884256 (H) TELEFAX: 061-6881395 (I) TELEX: 962292/965542 hlr ch (ii) TITLE OF INVENTION: Nucleic Acid Encodinga Nervous Tissue Sodium Channel (iii) NUMBER OF SEQUENCES: 5 (iv) COMPUTER READABLE FORM:

(A) MEDIUM TYPE: Floppy disk (B) COMPUTER: IBM PC compatible (C) OPERATING SYSTEM: PC-DOS/MS-DOS

(D) SOFTWARE: PatentIn Release ( 1.0,sion ( 1.30 Ver (v) CURRENT APPLICATION DATA

(A) APPLICATION NUMBER:

(B) FILING DATE:

(2) INFORMATION
FOR
SEQ
ID NO:1:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 5908 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: cDNA

(iii) HYPOTHETICAL: NO

(iv) ANTI-SENSE: NO

(vi) ORIGINAL SOURCE:

(A) ORGANISM: rat (F) TISSUE TYPE: Dorsal root ganglia (G) CELL TYPE: Peripheral nerve (xi) SEQUENCE DESCRIPTION: SEQ ID N0: 1:

AATGCCTATC

(3) INFORMATION FOR SEQ ID N0:2:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 1765 amino acids (B) TYPE: amino acid (C) STRANDEDNESS:
(D) TOPOLOGY: not relevant (ii) MOLECULE TYPE: protein (iii)HYPOTHETICAL: YES
(vi) ORIGINAL SOURCE:
(A) ORGANISM: rat (F) TISSUE TYPE: dorsal root ganglia (G) CELL TYPE: peripheral nerve (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 2:
Met Glu Glu Arg Tyr Tyr Pro Val Ile Phe Pro Asp Glu Arg Asn Phe Arg Pro Phe Thr Ser Asp Ser Leu Ala Ala Ile Glu Lys Arg Ile Ala Ile Gln Lys Glu Arg Lys Lys Ser Lys Asp Lys Ala Ala Ala Glu Pro Gln Pro Arg Pro Gln Leu Asp Leu Lys Ala Ser Arg Lys Leu Pro Lys Leu Tyr Gly Asp Ile Pro Pro Glu Leu Val Ala Lys Pro Leu Glu Asp Leu Asp Pro Phe Tyr Lys Asp His Lys Thr Phe Met Val Leu Asn Lys Lys Arg Thr Ile Tyr Arg Phe Ser Ala Lys Arg Ala Leu Phe Ile Leu Gly Pro Phe Asn Pro Leu Arg Ser Leu Met Ile Arg Ile Ser Val His Ser Val Phe Ser Met Phe Ile Ile Cys Thr Val Ile Ile Asn Cys Met Phe Met Ala Asn Ser Met Glu Arg Ser Phe Asp Asn Asp Ile Pro Glu Tyr Val Phe Ile Gly Ile Tyr Ile Leu Glu Ala Val Ile Lys Ile Leu Ala Arg Gly Phe Ile Val Asp Glu Phe Ser Phe Leu Arg Asp Pro Trp Asn Trp Leu Asp Phe Ile Val Ile Gly Thr Ala Ile Ala Thr Cys Phe Pro Gly Ser Gln Val Asn Leu Ser Ala Leu Arg Thr Phe Arg Val Phe Arg Ala Leu Lys Ala Ile Ser Val Ile Ser Gly Leu Lys Val Ile Val Gly Ala Leu Leu Arg Ser Val Lys Lys Leu Val Asp Val Met Val Leu Thr Leu Phe Cys Leu Ser Ile Phe Ala Leu Val Gly Gln Gln Leu Phe Met Gly Ile Leu Asn Gln Lys Cys Ile Lys His Asn Cys Gly Pro Asn Pro Ala Ser Asn Lys Asp Cys Phe Glu Lys Glu Lys Asp Ser Glu Asp Phe Ile Met Cys Gly Thr Trp Leu Gly Ser Arg Pro Cys Pro Asn Gly Ser Thr Cys Asp Lys Thr Thr Leu Asn Pro Asp Asn Asn Tyr Thr Lys Phe Asp Asn Phe Gly Trp Ser Phe Leu Ala Met Phe Arg Val Met Thr Gln Asp Ser Trp Glu Arg Leu Tyr Arg Gln Ile Leu Arg Thr Ser Gly Ile Tyr Phe Val Phe Phe Phe Val Val Val Ile Phe Leu Gly Ser Phe Tyr Leu Leu Asn Leu Thr Leu Ala Val Val Thr Met Ala Tyr Glu Glu Gln Asn Arg Asn Val Ala Ala Glu Thr Glu Ala Lys Glu Lys Met Phe Gln Glu Ala Gln Gln Leu Leu Arg Glu Glu Lys Glu Ala Leu Val Ala Met Gly Ile Asp Arg Ser Ser Leu Asn Ser Leu Gln Ala Ser Ser Phe Ser Pro Lys Lys Arg Lys Phe Phe Gly Ser Lys Thr Arg Lys Ser Phe Phe Met Arg Gly Ser Lys Thr Ala Gln Ala Ser Ala Ser Asp Ser Glu Asp Asp Ala Ser Lys Asn Pro Gln Leu Leu Glu Gln Thr Lys Arg Leu Ser Gln Asn Leu Pro Val Asp Leu Phe Asp Glu His Val Asp Pro Leu His Arg Gln Arg Ala Leu Ser Ala Val Ser Ile Leu Thr Ile Thr Met Gln Glu Gln Glu Lys Phe Gln Glu Pro Cys Phe Pro Cys Gly Lys Asn Leu Ala Ser Lys Tyr Leu Val Trp Asp Cys Ser Pro Gln Trp Leu Cys Ile Lys Lys Val Leu Arg Thr Ile Met Thr Asp Pro Phe Thr Glu Leu Ala Ile Thr Ile Cys Ile Ile Ile Asn Thr Val Phe Leu Ala Val Glu His His Asn Met Asp Asp Asn Leu Lys Thr Ile Leu Lys Ile Gly Asn Trp Val Phe Thr Gly Ile Phe Ile Ala Glu Met Cys Leu Lys Ile Ile Ala Leu Asp Pro Tyr His Tyr Phe Arg His Gly Trp Asn Val Phe Asp Ser Ile Val Ala Leu Leu Ser Leu Ala Asp Val Leu Tyr Asn Thr Leu Ser Asp Asn Asn Arg Ser Phe Leu Ala Ser Leu Arg Val Leu Arg Val Phe Lys Leu Ala Lys Ser Trp Pro Thr Leu Asn Thr Leu Ile Lys Ile Ile Gly His Ser Val Gly Ala Leu Gly Asn Leu Thr Val Val Leu Thr Ile Val Val Phe Ile Phe Ser Val Val Gly Met Arg Leu Phe Gly Thr Lys Phe Asn Lys Thr Ala Tyr Ala Thr Gln Glu Arg Pro Arg Arg Arg Trp His Met Asp Asn Phe Tyr His Ser Phe Leu Val Val Phe Arg Ile Leu Cys Gly Glu Trp Ile Glu Asn Met Trp Gly Cys Met Gln Asp Met Asp Gly Ser Pro Leu Cys Ile Ile Val Phe Val Leu Ile Met Val Ile Gly Lys Leu Val Val Leu Asn Leu Phe Ile Ala Leu Leu Leu Asn Ser Phe Ser Asn Glu Glu Lys Asp Gly Ser Leu Glu Gly Glu Thr Arg Lys Thr Lys Val Gln Leu Ala Leu Asp Arg Phe Arg Arg Ala Phe Ser Phe Met Leu His Ala Leu Gln Ser Phe Cys Cys Lys Lys Cys Arg Arg Lys Asn Ser Pro Lys Pro Lys Glu Thr Thr Glu Ser Phe Ala Gly Glu Asn Lys Asp Ser Ile Leu Pro Asp Ala Arg Pro Trp Lys Glu Tyr Asp Thr Asp Met Ala Leu Tyr Thr Gly Gln Ala Gly Ala Pro Leu Ala Pro Leu Ala Glu Val Glu Asp Asp Val Glu Tyr Cys Gly Glu Gly Gly Ala Leu Pro Thr Ser Gln His Ser Ala Gly Val Gln Ala Gly Asp Leu Pro Pro Glu Thr Lys Gln Leu Thr Ser Pro Asp Asp Gln Gly Val Glu Met Glu Val Phe Ser Glu Glu Asp Leu His Leu Ser Ile Gln Ser Pro Arg Lys Lys Ser Asp Ala Val Ser Met Leu Ser Glu Cys Ser Thr Ile Asp Leu Asn Asp Ile Phe Arg Asn Leu Gln Lys Thr Val Ser Pro Lys Lys Gln Pro Asp Arg Cys Phe Pro Lys Gly Leu Ser Cys His Phe Leu Cys His Lys Thr Asp Lys Arg Lys Ser Pro Trp Val Leu Trp Trp Asn Ile Arg Lys Thr Cys Tyr Gln Ile Val Lys His Ser Trp Phe Glu Ser Phe Ile Ile Phe Val Ile Leu Leu Ser Ser Gly Ala Leu Ile Phe Glu Asp Val Asn Leu Pro Ser Arg Pro Gln Val Glu Lys Leu Leu Arg Cys Thr Asp Asn Ile Phe Thr Phe Ile Phe Leu Leu Glu Met Ile Leu Lys Trp Val Ala Phe Gly Phe Arg Arg Tyr Phe Thr Ser Ala Trp Cys Trp Leu Asp Phe Leu Ile Val Val Val Ser Val Leu Ser Leu Met Asn Leu Pro Ser Leu Lys Ser Phe Arg Thr Leu Arg Ala Leu Arg Pro Leu Arg Ala Leu Ser Gln Phe Glu Gly Met Lys Val Val Val Tyr Ala Leu Ile Ser Ala Ile Pro Ala Ile Leu Asn Val Leu Leu Val Cys Leu Ile Phe Trp Leu Val Phe Cys Ile Leu Gly Val Asn Leu Phe Ser Gly Lys Phe Gly Arg Cys Ile Asn Gly Thr Asp Ile Asn Met Tyr Leu Asp Phe Thr Glu Val Pro Asn Arg Ser Gln Cys Asn Ile Ser Asn Tyr Ser Trp Lys Val Pro Gln Val Asn Phe Asp Asn Val Gly Asn Ala Tyr Leu Ala Leu Leu Gln Val Ala Thr Tyr Lys Gly Trp Leu Glu Ile Met Asn Ala Ala Val Asp Ser Arg Glu Lys Asp Glu Gln Pro Asp Phe Glu Ala Asn Leu Tyr Ala Tyr Leu Tyr Phe Val Val Phe Ile Ile Phe Gly Ser Phe Phe Thr Leu Asn Leu Phe Ile Gly Val Ile Ile Asp Asn Phe Asn Gln Gln Gln Lys Lys Leu Gly Gly Gln Asp Ile Phe Met Thr Glu Glu Gln Lys Lys Tyr Tyr Asn Ala Met Lys Lys Leu Gly Thr Lys Lys Pro Gln Lys Pro Ile Pro Arg Pro Leu Asn Lys Cys Gln Ala Phe Val Phe Asp Leu Val Thr Ser Gln Val Phe Asp Val Ile Ile Leu Gly Leu Ile Val Leu Asn Met Ile Ile Met Met Ala Glu Ser Ala Asp Gln Pro Lys Asp Val Lys Lys Thr Phe Asp Ile Leu Asn Ile Ala Phe Val Val Ile Phe Thr Ile Glu Cys Leu Ile Lys Val Phe Ala Leu Arg Gln His Tyr Phe Thr Asn Gly Trp Asn Leu Phe Asp Cys Val Val Val Val Leu Ser Ile Ile Ser Thr Leu Val Ser Arg Leu Glu Asp Ser Asp Ile Ser Phe Pro Pro Thr Leu Phe Arg Val Val Arg Leu Ala Arg Ile Gly Arg Ile Leu Arg Leu Val Arg Ala Ala Arg Gly Ile Arg Thr Leu Leu Phe Ala Leu Met Met Ser Leu Pro Ser Leu Phe Asn Ile Gly Leu Leu Leu Phe Leu Val Met Phe Ile Tyr Ala Ile Phe Gly Met Ser Trp Phe Ser Lys Val Lys Lys Gly Ser Gly Ile Asp Asp Ile Phe Asn Phe Glu Thr Phe Thr Gly Ser Met Leu Cys Leu Phe Gln Ile Thr Thr Ser Ala Gly Trp Asp Thr Leu Leu Asn Pro Met Leu Glu Ala Lys Glu His Cys Asn Ser Ser Ser Gln Asp Ser Cys Gln Gln Pro Gln Ile Ala Val Val Tyr Phe Val Ser Tyr Ile Ile Ile Ser Phe Leu Ile Val Val Asn Met Tyr Ile Ala Val Ile Leu Glu Asn Phe Asn Thr Ala Thr Glu Glu Ser Glu Asp Pro Leu Gly Glu Asp Asp Phe Glu Ile Phe Tyr Glu Val Trp Glu Lys Phe Asp Pro Glu Ala Ser Gln Phe Ile Gln Tyr Ser Ala Leu Ser Asp Phe Ala Asp Ala Leu Pro Glu Pro Leu Arg Val Ala Lys Pro Asn Lys Phe Gln Phe Leu Val Met Asp Leu Pro Met Val Met Gly Asp Arg Leu His Cys Met Asp Val Leu Phe Ala Phe Thr Thr Arg Val Leu Gly Asp Ser Ser Gly Leu Asp Thr Met Lys Thr Met Met Glu Glu Lys Phe Met Glu Ala Asn Pro Phe Lys Lys Leu Tyr Glu Pro Ile Val Thr Thr Thr Lys Arg Lys Glu Glu Glu Gln Gly Ala Ala Val Ile Gln Arg Ala Tyr Arg Lys His Met Glu Lys Met Val Lys Leu Arg Leu Lys Asp Arg Ser Ser Ser Ser His Gln Val Phe Cys Asn Gly Asp Leu Ser Ser Leu Asp Val Ala Lys Val Lys Val His Asn Asp (4) INFORMATION FOR SEQ ID N0:3:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 856 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: cDNA
(iii) HYPOTHETICAL: NO
(iv) ANTI-SENSE: NO
(vi) ORIGINAL SOURCE:
(A) ORGANISM: human (F) TISSUE TYPE: Dorsal root ganglia (G) CELL TYPE: Peripheral nerve (xi) SEQUENCE DESCRIPTION: SEQ ID N0:3:

(5) INFORMATION FOR SEQ ID N0:4:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 701 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: RT-PCR
(A) DESCRIPTION: /desc = DNA probe/domain IV"
(iii)HYPOTHETICAL: NO
(iv) ANTI-SENSE: NO
(vi) ORIGINAL SOURCE:
(A) ORGANISM: rat (F) TISSUE TYPE: dorsal root ganglia (G) CELL TYPE: peripheral nerve (xi) SEQUENCE DESCRIPTION: SEQ ID N0:4:

(5) INFORMATION FOR SEQ ID N0:5:
(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 5334 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE
TYPE:
RT-PCR

(A) DESCRIPTION: cDNA

(iii)HYPOTHETICAL:
NO

(iv) ANTI-SENSE:
NO

(vi) ORIGINAL
SOURCE:

(A) ORGANISM:

(F) TISSUE TYPE:

(G) CELL TYPE:

(xi) SEQUENCE DESCRIPTION: SEQ
ID N0:5:

Claims (16)

1. A DNA encoding a sodium channel protein or the .alpha.-subunit thereof, which DNA
comprises essentially the nucleotide sequence set forth in SEQ ID NO:1, SEQ ID
NO:3, SEQ ID NO:5, or nucleotides 79 through 5376 of SEQ ID NO:1.

2. The DNA of claim 1 wherein said sodium channel protein is tetrodotoxin-resistant.

3. The DNA of claim 1 or 2 wherein said sodium channel protein is found in mammals.

4. The DNA of claim 1 or 2 wherein said sodium channel protein is found in rat.

5. The DNA of claim 1 or 2 wherein said sodium channel protein is found in human.

6. The DNA of any one of claims 1 to 5 wherein said DNA is cDNA.

7. The DNA of any one of claims 1 to 5 wherein said DNA is synthetic DNA.

8. An expression vector comprising a DNA as claimed in any one of claims 1 to 7.

9. A host cell transformed with an expression vector as claimed in claim 8.

10. A polynucleotide comprising a DNA as claimed in any one of claims 1 to 7 or a nucleic acid sequence derived from said DNA.

11. A sodium channel protein encoded by a DNA as claimed in any one of claims 1 to 7 or an allelic variant protein thereof.

12. The protein of claim 11 having the amino acid sequence set forth in SEQ ID
NO:2 or an allelic variant protein thereof.

13. A method for identifying inhibitors of tetrodotoxin-resistant sodium channel protein comprising contacting a compound suspected of having such inhibitor activity with a sodium channel protein of claim 11 or claim 12 and measuring the activity of said expressed sodium channel protein.

14. Polyclonal antibodies raised against a tetrodotoxin-resistant sodium channel protein encoded by a DNA as claimed in any one of claims 1 to 7 or against an allelic variant protein thereof.

15. A diagnostic kit comprising a polynucleotide of claim 10 capable of specifically hybridizing to a DNA encoding a tetrodotoxin-resistant sodium channel protein.

16. A reagent comprising an isolated DNA as claimed in any one of claims 1 to 7 for identifying a compound suspected of being an inhibitor of tetrodotoxin-resistant sodium channel protein.