CA2249182A1 - Death domain containing receptors - Google Patents

Abstract

The present invention relates to novel Death Domain Containing Receptor (DR3 and DR3-V1) proteins which are members of the tumor necrosis factor (TNF) receptor family. In particular, isolated nucleic acid molecules are provided encoding the human DR3 and DR3-V1 proteins. DR3 and DR3-V1 polypeptides are also provided as are vectors, host cells and recombinant methods for producing the same. The invention further relates to screening methods for identifying agonists and antagonists of DR3 and DR3-V1 activity.

Description

wo 97/33904 PCTIUS96I16849 Death Domain ContPinin~ Receptors Background of the Invenfion Field of t~te I~ nl~

The present invention relates to a novel member of the tumor necrosis factor family of rec.,~t~l~. More specifically, isolated nucleic acid molecules are provided encoding human Death Domain Cont~inin~ Receptors (DR3 and DR3-V1). Death Domain Cont~ining Receptor polypeptides are also provided, as are vectors, host cells and recombinant methods for producing the same. The invention further relates to screening methods for identifying agonists and antagonists of DR3 activity.

Relnt~l Art Many biological actions, for in~t~nce, response to certain stimuli and natural biological processes, are controlled by factors, such as cytokines. Manycytokines act through receptors by eng~ging the receptor and producing an intra-cellular response.
For example, tumor necrosis factors (TNF) alpha and beta are cytokines which act through TNF receptors to regulate numerous biological processes, including protection against infection and induction of shock and infl~mm~tory disease. The TNF molecules belong to the "TNF-ligand" superfamily, and act together with their receptors or counter-ligands, the "TNF-Iec~l.lul" superfamily.
So far, nine members of the TNF ligand ~u~Jc,r~llily have been identified and ten members of the TNF-receptor supelri~llily have been characterized.
Among the ligands there are included TNF-a, Iymphotoxin-a (LT-a7 also known as TNF-~), LT-,B (found in complex he~ L~ er LT-a2-O, FasL, CD40L, CD27L, CD30L, 4-lBBL, OX40L and nerve growth factor (NGF). The ~UI~Jr~-i1Y of TNF receptors includes the p55TNF rece~Lor, p75TNF receptor, .

WO 97/33904 PCTnU~96/16849 TNF receptor-related protein, FAS antigen or APO-l, CD40, CD27, CD30, 4-lBB, OX40, low affinity p75 and NGF-receptor (Meager, A., Biologicals, 22:291-295 (1994)).
Many members ofthe TNF-ligand sl-p~, r~ ily are e~pI~ssed by activated T-cells, implying that they are necess~ry for T-cell interactions with other cell types which underlie cell ontogeny and functions. (Meager, A., supra).
Con~ider~hle insight into the e~nti~t functions of several members of the TNF receptor fam~ily has been gained from the identification and creation of ml1t~nt~ that abolish the ~ ,ssion of these proteins. For example, naturally oCcl~rring mutations in the FAS antigen and its ligand cause Iymphoproliferativedisease (Watanabe-F-Ik-ln~ R., et al., Nature 356:314 (1992)), perhaps reflecting a failure of program~ned cell death. Mutations of the CD40 ligand cause an X-linked immlln~-deficiency state characterized by high levels of immunoglobulin M and low levels of immunoglobulin G in plasma, indicating faulty T-cell-dependent B-cell activation (Allen, R.C. et al., Science 259:990 (1993)). Targeted mutations of the low affinity nerve growth factor receptor cause a disorder characterized by faulty sensory innovation of peripheral st~uctures (Lee, K.F. et al., Cell 69:737 (1992)).
TNF and LT-a are capable of binding to two TNF receptors (the 55- and 75-kd TNF Iece~k~l~). A large number of biological effects elicited by TNF and LT-a, acting through their receptors, include hemorrhagic necrosis of transplanted tumors, cytotoxicity, a role in endotoxic shock, infl~mm~tion, imml-noregulation, proliferation and anti-viral responses, as well as protectionagainst the deleterious effects of ionizing radiation. TNF and LT-a are involvedin the pathogenesis of a wide range of ~ e~ces, including endotoxic shock, cerebral malaria, tumors, autoimmlln~ disease, AIDS and graft-host rejection (Beutler, B. and Von Huffel, C., Science 264:667-668 (1994)). Mutations in the pSS Receptor cause increased susceptibility to microbial infection.
Moreover, an about 80 amino acid domain near the C-~e . . . i ~ c of TNFR 1 (p55) and Fas was reported as the "death domain," which is responsible for W O 97~3904 PCTrUS96/16849 transducing signals for programmed cell death (Tartaglia et al., Cell 74:845 (1993)).
Apoptosis, or programmed cell death, is a physiologic process e~PntiAl to the normal development and homeostasis of multicellular org~ni~m.s (H.
SteIler, Science 267, 1445-1449 (1995)). Derangements of apoptosis contribute to the pathogenesis of several human ~i.ce~çs including cancer, neurodegel~.dli~/e disorders, and acquired immune deficiency syndrome (C.B.
Thompson, Science 267, 1456-1462 (1995)). Recently, much attention has focused on the signal tr~n~luction and biological function of two cell surface death lece,utol~, Fas/APO-1 and TNFR-1 (J.L. Cleveland, et aL, Cell 81, 479~B2 (1995); A. Fraser, et al., Cell 85, 781-784 (1996); S. Nagata, et al., Science 267, 1449-56 (1995)). Both are m~Tnkers of the TNF receptor family which also include TNFR-2, low affinity NGFR, CD40, and CD30, among others (C.A.
Smith, et al., Science 248, 1019-23 (1990); M. Tewari, et al., in Modular Texts in Molecular and Cell Biology M. Purton, Heldin, Carl, Ed. (Ch~pm~n and Hall, London, 1995). While family members are defined by the presence of cysteine-rich repeats in their extracellular domains, Fas/APO-1 and TNFR-1 also share a region of intracellular homology, ap~ropliately ~le~ign~t~d the "death domain", which is distantly related to the Drosophila suicide gene, reaper (P.
Golstein, et al., Cell 81, 185-6 (1995); K. White et al., Science 264, 677-83 (1994)). This shared death domain suggests that both receptors interact with a related set of signal tr~n~d~-cinE molecules that, until recently, reTn~in~l unidentified. Activation of Fas/APO-1 recruits the death domain-cont~ining adapter molecule FADD/MORT1 (A.M. Chinnaiyan, et al., Cell 81, 505-12 (1995); M. P. Boldin, et al., J. Biol Chem 270, 7795-8 (1995); F.C. ~i~çhkel, etal., EMBO 14, 5579-5588 (1995)), which in turn binds and presumably activates FLICE/MACH 1, a member of the ICE/CED-3 family of pro-apoptotic proteases (M. Muzio et al., Cell 85, 817-827 (1996); M.P. Boldin, et al., Cell 85, 803-815(1996)). While the central role of Fas/APO-1 is to trigger cell death, TNFR-1 can signal an array of diverse biological activities-many of which stem from its ability to activate NF-kB (L.A. Tartaglia, et al., Immunol Today 13, 151-3 .

CA 02249182 1998-09-11 p ~ ~ 9 6 / 1 6 8~
~PE~WS 14 OCT l997 (1992)). Accordintly, TNFR-1 recruits the multivalent adapter molecule TRADD, which like FADD, also co..~;n~ a death domain (H. Hsu, et al., Cell 81, 495-504 (1995); H. Hsu, et al., Cell 84, 299-308 (1996)). Through its ions with a .l~,ll~r of ci~ling molecules including FADD, TRAF2, and RIP, TRADD can signal both apol~to~is and NF-kB activation (H. Hsu, et al., Cell84, 299-308 (1996); H. Hsu, et al., Immunity 4, 387-396 (1996)).
The effects of TNF family ligands and TNF family rece~tol~ are varied and influence numerous functions, both normal and abn.nnn~l in the biological processes of the m~mm~ n system. There is a clear need, therefore, for i~lçntific~tion and char~ e ;~I;on of such receptors and ligands that influence biological activity, both norm~lly and in disease states. In particular, there is a need to isolate and char~ct~ri7e novel members of the TNF lcc~l)tol family.

SummarJv of the lnvention The present invention provides for isolated nucleic acid molecules co.u~ ;ng nucleic acid sequences encoding the arnino acid sequences shown in FIG. 1 (SEQ ID NO:2) and FIG. 2 (SEQ ID NO:4) or the amino acid se lu.,nce encoding the cDNA clones deposited in a b~ 1 host as ATCC Deposit No.
97456 on March 1, 1996 and ATCC Deposit No. 97757 on October 10, 1996.
The present invention also provides vectors and host cells for recombinant ~on of the nucleic acid molecules described herein, as well as to methods of ~ing such vectors and host cells and for using them for production of DR3 or DR3 Variant 1 (DR3-V1) (f~ ly named DDC~) polypeptides or peptides by recombinant techniques.
The invention further provides an isolated DR3 or DR3-V1 polypeptide having an amino acid sequence encoded by a polynucleotide described herein.
The present invention also provides ~li~.,o~l;c assays such as ~ e and ~ stic assays for cletecting levels of DR3 or DR3-V1 protein. Thus, for e, a .lia~nostic assay in accordallce with the invention for ~letecting over-S
-expression of DR3 or DR3-V1, or soluble form thereof, compared to normal control tissue samples may be used to detect the presence of tumors.
Tumor Necrosis Factor (TNF) family ligands are known to be among the most pleiotropic cytokines, inducing a large number of cellular responses, including cytotoxicity, anti-viral activity, immunoregulatory activities, and the transcriptional regulation of several genes. Cellular response to TNF-family ligands include not only normal physiological responses, but also diseases associated with increased apoptosis or the inhibition of apoptosis. Apoptosis-progr~mm~od cell death-is a physiological mçch~ni.cm involved in the deletion ofperipheral T Iymphocytes of the immnne system, and its dysregulation can lead to a number of different pathogenic processes. Diseases associated with increased cell survival, or the inhibition of apoptosis, include cancers, autoimm..ne disorders, viral infections, infl~mm~tion, graft v. host disease, acute graft re3ection, and chronic graft re3ection. Diseases associated with increasedapoptosis include AIDS, neurodegen~ld~ e disorders, myelodysplastic syndromes, ischemic in3ury, toxin-in~ ced liver disease, septic shock, c~rhP~i~
and anorexia.
Thus, the invention further provides a method for enh~ncing apoptosis induced by a TNF-family ligand, which involves ~lmini~tering to a cell which expresses the DR3 polypeptide an effective amount of an agonist capable of increasing DR3 me~ t~d ~ign~linE~. Preferably, DR3 mç~ ted ~ign~ling is increased to treat a disease wherein decreased apoptosis is exhibited.
In a further aspect, the present invention is directed to a method for inhibiting apoptosis intluGed by a TNF-farnily ligand, which involves ~lmini~tPring to a cell which expresses the DR3 polypeptide an effective amount of an antagonist capable of decl~a~ing DR3 medi~ted ci~n~ling. Pl~r~lably~ DR3 me~ te(~ ~ign~ling is decreased to treat a disease wherein increased apoptosis is exhibited.
Whether any candidate "agonist" or "antagonist" of the present invention can enh~nce or inhibit apoptosis can be dcte. .. ,;.l~cl using art-known TNF-family ligand/lec~)tor cellular response assays, inrlu-ling those described in more detail Wo 97/33904 PCT/US96/16849 below. Thus~ in a further aspect, a screening method is provided for determming whether a candidate agonist or antagonist is capable of enhancing or inhibiting a cellular response to a TNF-family ligand. The method involves contacting cellswhich express the DR3 or DR3-VI polypeptide with a candidate compound and a TNF-family ligand, assaying a cellular response, and co~ g the cellular response to a standard cellular response, the standard ~eing assayed when contact is made with the ligand in absence of the candidate compound, whereby an increased cellular response over the standard indicates that the candidate compound is an agonist of the ligand/receptor si~n~ling pdlh~ y and a decreased cellular response compared to the standard indicates that the c~ntli-1~te compound is an antagonist ofthe ligand/receptor ~ign~ling pathway. By the invention, a cell expressing the DR3 or DR3-Vl polypeptide can be contacted with either an endogenous or exogenously ~tlministered TNF-family ligand.

Brief Description of the Figures FIG. lA-C shows the nucleotide and dec~llçe~l amino acid sequence of DR3-V1. It is predicted that amino acids 1 - 35 constitute the signal peptide.
amino acids 36-212 constitute the extracellular domain, amino acids 213-235 constitute the transmembrane domain, amino acids 236-428 constitute the intracellular domain, and amino acids 353-419 the death domain.
FIG. 2A-B shows the nucleotide and deduced amino acid sequence of DR3. It is predicted that amino acids 1 - 24 constitute the signal peptide, amino acids 25-201 constitute the e~ctracellular domain~ amino acids 202-274 constitute the tr~n~memhrane domain, amino acids 225-417 constitute the intracellular domain, and amino acids 342-408 constitute the death domain.
FIG. 3A-D shows the regions of similarity between the amino acid sequences of the DR3-Vl. human tumor necrosis factor receptor 1, and Fas receptor [SEQ ID NOs:S and 6].
FIG. 4 shows an analvsis of the DR3-Vl amino acid sequence. Alpha, beta, turn and coil regions; hydrophilicity and hydrophobicity; allphil,athic SIJ~S 111 UTE SHEET (RULE 26) .. . ... .. .

CA 02249182 1998-09-11 ~; _4 o~,lgg~

regions; flexible regions; antigenic index and surface probability are shown. Inthe "Anti~nic Index - J~m~son-Wolf" graph, amino acid residuesl-22,33-56,59-82, 95-112, 122-133, 161-177, 179-190, 196-20S in Figure 1 col.. ;.~,ond to the shown highly antigenic regions ofthe DR3-Vl protein.

Detnile~Descrip~ion of ~he Preferred Embodimen~s The present invention provides isolated nucleic acid molecules co. ~ g a nucleic acid sequence rnr~ling the DR3-Vl or DR3 polypeptide whose amino acid sequence is shown in FIG. 1 [SEQ ID NO:2] and FIG. 2 [SEQ ID NO:4], rei,l,c~ rely, or a fragment of the polypeptide. The DR3-Vl and DR3 polypeptides ofthe present invention shares ~u~ .lce homology with human TNF
RI and Fas (FIG. 4). The nucleotide Se~lu~..lCe shown in FIG. 1 [SEQ ID NO:l]
was obtained by S~ll ~ the H~TNB61 clone, which was de~ d on March 1, 1996 at the American Type Culture Collection, 12301 Park Lawn Drive, Rockville, Maryland 20852, and given A.~CCjO~ Number 97456. The deposited clone is COIllilh~d ill the pBluescript SK(-) pl~cmi~l (S!.,.~ ., LaJolla, CA).The --~ nucleotide sequence shown in FIG.2 [SEQ ID NO:3] was o~l~;ned by seq~lenring J a clone obtained from a HUVEC library, which was depos;l. d on October 10, 1996 at the AmPric~n Type Culture Collection, 12301 Park Lawn Drive, Rochil~, M~yl~d 20852, and given Accçcc;on Number 97757. The deposited clone i~ t~ ~ed in the pBluescript SK(-) pl~mid (Stratagene, LaJolla, CA).

AME~IDED SHEr CA 02249182 1998-09-ll W O 97~3904 PCT~US96/16849 Nucleic Acid Molecules Unless otherwise indicated, all nucleotide sequences deterrnin~?.l by seql-en~.in~ a DNA molecule herein were determined using an automated DNA
sequencer (such as the Model 373 from Applied Biosystems, Inc.), and all amino acid sequences of polypeptides encoded by DNA molecules determined herein were predicted by translation of a DNA sequence ~etPrrnin~d as above.
Therefore, as is known in the art for any DNA sequence detennin.o(l by this ~ntom~tecl approach, any nucleotide sequence deterrnined herein may contain scme errors. Nucleotide sequences det~rrnined by automation are typically at least about 90% identical, more typically at least about 95% to at least about 99.9% identical to the actual nucleotide sequence of the sequenced DNA
molecule. The actual sequence can be more precisely determined by other approaches including manual DNA seq~l~ncing methods well known in the art.
As is also known in the art, a single insertion or deletion in a ~letennin~d nucleotide sequence co~ ,~cd to the actual sequence will cause a frame shift in translation of the nucleotide sequence such that the predicted amino acid sequence encoded by a deterrninPd nucleotide sequence will be completely dirr~e..~ from the amino acid sequence actually encoded by the sequenced DNA
molecule, beginning at the point of such an insertion or deletion.
By "isolated" polypeptide or protein is inten~1ed a polypeptide or protein removed from its native environment. For example, recombinantly produced polypeptides and proteins c~lessed in host cells are considered isolated for purposed of the invention as are native or recombinant polypeptides which have been substantially purified by any suitable technique such as, for example, the single-step purification method disclosed in Smith and Johnson, Gene 67:31-40 (1988).
Using the infonn~tion provided herein, such as the nucleic acid sequence set out in FIG. 1 or FIG. 2, a nucleic acid molecule of the present invention encoding a DR3-Vl or DR3 polypeptide may be obtained using ~ d;~.l cloning and scl~ee~ g procedures, such as those for cloning cDNAs using mRNA as .. . .

W 097/33904 rCTAUS96/16849 _9_ -starting material. Illustrative of the invention, the nucleic acid molecule described in FIG. 1 was discovered in a cDNA library derived from cells of a human testis tumor. Also illustrative of the invention, the nucleic acid molecule described in FIG. 2 was discovered in a human HWEC cDNA library. In addition, the genes of the present invention have also been identified in cDNA
libraries of the following tissues: fetal liver, fetal brain, tonsil and leukocyte.
Furthermore, multiple forms of DR3 Iral~SC~ are seen in Northern Blots and PCR reactions indicating that multiple variants of the transcript exists, possibly due to alternate splicing of the message.
The DR3-V1 (formerly called DDCR) gene contains an open reading frame encoding a protein of about 428 amino acid residues whose initiation codonis at position 198-200 of the nucleotide sequence shown in FIG. 1 [SEQ ID
NO. 1], with a leader sequence of about 35 amino acid resi(llles. and a ~leducedmolecular weight of about 47 kDa. Of known members of the TNF lec~Lol family, the DR3-V1 polypeptide of the invention shares the greatest degree of homology with human TNF Rl. The DR3-V1 polypeptide shown in FIG. 1 [SEQ
ID NO:2] is about 20% identical and about 50% similar to human TNF Rl.
The DR3 gene contains an open reading frame encoding a protein of about 417 amino acid residues whose initiation codon is at position 1-3 of the nucleotide seqU~nre shown in FIG. 2 [SEQ ID NO:3], with a leader seguence of about 24 amino acid residues, and a ~e~lcecl molecular weight of about 43 kDa.
Of known members of the TNF receptor family, the DR3 polypeptide of the invention shares the greatest degree of homology with human TNF Rl. The DR3 polypeptide shown in FIG. 2 [SEQ ID NO:3] is about 20% identical and about 50% similar to human TNF Rl.
As in-lic~terl, the present invention also provides the mature form(s) ofthe DR3-V1 and DR3 protein of the present invention. According to the signal hypothesis, proteins secreted by m~nnm~ n cells have a signal or se~;leloly leader sequence which is cleaved from the mature protein once export of the growing protein chain across the rough endoplasmic reticulum has been initi~te~lMost m~mm~ n cells and even insect cells cleave secreted ploleins with the . CA 02249182 1998-09-11 ~ 1 4 ~ C ~ 9~

same sFecifi~ity. However, in some cases, cleavage of a se~ cd protein is not entirely lmifulm, which results in two or more mature species on the protein.
Further, it has long been known that the cleavage spe~.ificity of a s~ret~d protein iS Illtim~tf~ly d~ ;n~l by the ~ structure ofthe col~)'~te protein, that is, S it is inherent in the amino acid sequence of the polypeptide. The.~fol~" the present invention provides a nucleotide sequence enro ling the mature DR3-V1 or DR3 polypeptides having the amino acid sequence en~odeA by the cDNA
clones c~ d in the host identified as ATCC Deposit No. 97456 and 97757, re~,tcti~rely, and as shown in Figure 1 (SEQ ID NO:2) and Figure 2 (SEQ ID
~) 10 NO:4). By the mature DR3-V1 or DR3 protein having the amino acid sequence en.~ed by the cDNA clones co.~ d in the host identified as ATCC Deposit No. 97456 and 97757"~,.,~.,ti~ely, is meant the mature form(s) of the DR3-V1 or DR3 protein produced by ~Al,le~ioll in a ~- ~ /n cell (e.g., COS cells, as described below) of the complete open reading i~ame ~ncoded by the human DNA sequence of the clone c~.nl;~;.. ~l in the vector in the deposited host. Asindicated below, the mature DR3-V1 or DR3 having the amino acid sequence encoded by the cDNA clones co.~ -~l in ATCC Deposit No. 97456 and 97757, ~ti~ely, may or may not differ from the predicted C l~lu~" DR3-V1 protein ~_~ shown in Figure 1 (amino acids from about 36 to about 428) or DR3 protein shown in Figure 2 (amino acids from about 24 to about 417) depçn~ling on the accuracy of the predicted cleavage site based on co.ll~ h. analysis.
Methods for predict ng whether a protein has a secl~tul~r leader as well as the cle~ ge point for that leader sequence are available. For i~ nce, the method of McGeoch (Virus Res. 3:271-286 (1985)) and von Heinje (Nucleic Acicls Res. 14:4683-4690 (1986)) can be used. The ac~ of predicting the cleavage points of known m~mm~ n secl~tol~ pluteills for each of these methods is in the range of 75-80%. von Heinje, supra. However, the two m.~thc~ do not always produce the same predicted cleavage point(s) for a given protein.
In the present case, the predicted amino acid sequence of the conll)lete DR3-V1 and DR3 polypeptides of the present invention were analyzed by a wo 97/33904 PCT/US96/16849 com~uLel program ("PSORT"). (see K. Nakai and M. K~nehi~ Genomics 14:897-911 (1992)), which is an expert system for predicting the cellular location of a protein based on the amino acid sequence. As part of this coll~puldlional prediction of localization, the methods of McGeoch and von Heinje are inco.~uoldled. The analysis by the PSORT program predicted the cleavage sites b~lw~el~ amino acids 35 and 36 in Figure 1 (SEQ ID NO:2) and between amino acids 24 and 25 in Figure 2 (SEQ ID NO:4). The.td~ , the complete amino acid sequences were further analyzed by visual inspection, applying a simple form of the (- 1,-3) rule of von Heine. von ~ein~e, supra. Thus, the leader sequence forthe DR3-V I protein is predicted to consist of amino acid residues 1 - 35 in Figure 1 (SEQ ID NO:2), while the predicted mature DR3-Vl protein consists of residues 36-428. The leader sequence for the DR3 protein is predicted to consistof amino acid residues 1- 24 in Figure 2 (SEQ ID NO:4), while the predicted mature DR3 protein consists of residues 25-417.
As one of ordinary skill would appreciate, due to the possibilities of seq-l~n~ing errors Aicc-lc~ed above, as well as the variability of cleavage sites for leaders in different known proteins, the actual DR3-Vl polypeptide encoded by the deposited cDNA comprises about 428 arnino acids, but may be anywhere in the range of 410-440 arnino acids; and the actual leader sequence of this protein is about 35 amino acids, but may be anywhere in the range of about 25 to about 45 arnino acids. The actual DR3 polypeptide encoded by the deposited cDNA
co.~ es about 417 amino acids, but may be anywhere in the range of 400~30 arnino acids; and the actual leader sequence of this protein is about 24 amino acids, but may be anywhere in the range of about 14 to about 34 amino acids.
As indicated, nucleic acid molecules of the present invention may be in the forrn of RNA, such as mRNA, or in the form of DNA, inrlnl1ing, for i~ re, cDNA and genomic DNA obtained by cloning or produced synth~-tic~lly. The DNA may be double-skanded or single-str~nAeA Single-stranded DNA may be the coding strand, also known as the sense strand, or it may be the non-coding strand, also referred to as the anti-sense strand.

- CA 02249182 1998-09-ll ~ , 6 /~9~

By ";~1 ~ d" nucleic acid molecule(s) is int~n~ed a nucleic acid molecule, DNA or RNA, which has been removed from its native environment For CA~Llllple, recombinant DNA molecules co~ ined in a vector are considered i~l~ted for the ~lJoses of the present invention. Further examples of isolated S DNA molecules include rec-)mhin~nt DNA molec~ s .. ~ ~1 in heterologous host cells or purified (partially or s1~hst~nti~11y) DNA molecules in solution.
Isolated RNA molecules include in vivo or in vitro RNA ll~SC;liptS of the DNA
molecules of the present invention. I~!~t~l nucleic acid molecules accordh~g to the present invention further include such molecules produced synthetically.
~; ) 10 Isolated nucleic acid molecules ofthe present invention include DR3-Vl DNA molecules co-l~p- ;h;l~g an open reading frame (ORF) shown in FIG. 1 [SEQ
ID NO:l] and further include DNA molecules which comrri~e a se.lu~,~ce s~hst~nti~lly di~lellt than all or part of the ORF whose initi~tior~ codon is atposilion 198-200 ofthe nucleotide sequence shown in FIG. 1 [SEQ ID NO:l] but which, due to the degellelàc~ of the genetic code, still encode the DR3-Vl polypeptide or a fi~grn~nt thereof. Isolated nucleic acid molecules of the present invention also include DR3 DNA molecules co..~ g an open reading frame (ORF) shown in FIG. 2 [SEQ ID NO:3] and further include DNA molecules which co...~ e a sequence ~b~ 11y dirr~le~l than all or part of the ORF
whose initi~tion codon is at position 1-3 of the n11c1eoti~1e se.~ ce shown in ~~ FIG. 2 tSEQ ID NO:3] but which, due to the deg.,ll~ r of the genetic code, still a~ DR3 polypeptide or a La~n~ thereo~ Of course, the genetic code r:~
is wc~' nown in the art. Thus, it would be routine for one skilled in the art to . . . .
gell~l..t~ such dega~eldle variants.
In another aspect, the invention provides isolated nucleic acid molecules Pnl~ing the DR3-Vl polypeptide having an amino acid S~ U~IlCe en~1e~1 by the cDNA clone co~ ined in the plasrnid deposited as ATCC Deposit No. 97456 on March l, 1996. The invention provides isolated nucleic acid molecules encoding the DR3 polypeptide having an arnino acid sequence encoded by the cDNA clone contained in the p1~mid deposited as ATCC Deposit No. 97757 on October l 0, 1996. Preferably, these nucleic acid molecules will encode the AMi~lD~ SHEr Wo 97/33904 PcT/us96/16849 mature polypeptide encoded by the above-described deposited cDNA clone. The invention further provides an isolated nucleic acid molecule having the nucleotide sequence shown in Figure l (SEQ ID NO:l) or FIG. 2 (SEQ ID NO:3) or the nucleotide sequence of the DR3-V1 or DR3 cDNA cont~ine(~ in the above-described deposited clone, or a nucleic acid molecule having a sequence complement~ry to one of the above sequences. Such isolated DNA molecules and fr~gm~nt.c thereof are useful as DNA probes for gene ma~ing by in situ hybridiz DR3-V 1 or DR3 gene in human tissue (including testis tumor tissue) by Northem blot analysis.
The present invention is fi~rther directed to fr~ment~ of the isolated nucleic acid molecules described herein. By fra~mentc of an isolated DNA
molecule having the nucleotide sequence shown in FIG. 1 [SEQ ID NO:l] or FIG. 2 [SEQ ID NO:3] are int~fle~ DNA fr~gmPntc at least 20 bp, and more ,..~efeldbly at least 30 bp in length which are useful as DNA probes as discussed above. of course larger DNA fr~gmPntc 50-1500 bp in length are also useful as DNA probes according to the present invention as are DNA fr~t~m~nt~
co~ .ol1ding to most, if not all, of the nucleotide sequence shown in FIG. 1 [SEQ ID NO:l] or FIG. 2 [SEQ ID NO:3]. By a fragment at least 20 bp in length, for example, is int~.ntie~ fi~gm~nt~ which include 20 or more bases fromthe nucleotide sequence in FIG. 1 [SEQ ID NO:1] or FIG. 2 [SEQ ID NO:3].
~Ic~l,cd nucleic acid fr~mPnt~ ofthe present invention include nucleic acid molecules en~orling: a polypeptide compn~in~ the DR3 extracellular domain (amino acid residues from about 36 to about 212 in FIG. 1 [SEQ ID NO:2]); a polypeptide comprising the DR3 l~,s",elllbrane domain (amino acid residues from about 213 to about 235 in FIG. 1 [SEQ ID NO:2]; a polypeptide comprising the DR3 intracellular domain (amino acid residues from about 214 to about 428 in FIG. 1 [SEQ ID NO:2]; and a polypeptide compri~ing the DR3 death domain (amino acid residues from about 353 to about 419 in FIG. 1 [SEQ ID NO:2]).
Since the location of these domains have been predicted by colnpu~l graphics, one of ordh~ skill would appreciate that the amino acid residues constitlltin~

CA 02249182 1998-09-ll ~ CTI ~ 9 6 / 1 6 8 ~ ' ~JUS 14 0CT 19 these ~ u may va~y slightly (e.g., by about 1 to 15 residues) d~ n~ g on the criteria used to define the domain.
F~f .l~d nucleic acid fra~mlont~ of the present invention further include nucleic acid molecules en~o-ling ~ilope-bearing portions ofthe DR3-V1 protein.
S In particular, such nucleic acid ~ t~ of the present invention include nucleic acid molecules encoding: a polypeptide comprising amino acid residues from about 1 to about 22 in Figure 1 (SEQ ID NO:2); a polypeptide comrri~ing amino acid residues from about 33 to about 56 in Figure 1 (SEQ ID NO:2); a polypeptide CG...~ g amino acid residues from about 59 to about 82 in Figure S~10 1 (SEQ ID NO:2); a polypeptide co.. ~ g amino acid residues from about 95 ,3 to about 112 in Figure 1 (SEQ ID NO:2); a polypeptide cc~n~ ;ilg amino acid residues from about 122 to about 133 in Figure 1 (SEQ ID NO:2); a polypeptide co...r~ g a-mino acid residues from about 161 to about 177 in Figure 1 (SEQ
IDNO:2); apolypeptide co...~ p amino acid residues from about 179 to about 190 in Figure 1 (SEQ ID NO:2); and a pol,vpeptide comrri~ing a-m-ino acid residues from about 196 to about 205 in Figure 1 (SEQ ID NO:2). The inventors have d.,t~ ~l that the above polypeptide L,~ t~ are ~nti~nic regions ofthe DR3-V1 protein. Methods for ~ ing other such cl,;to~-bearing portions of the DR3-V1 protein are described in detail below.
P~ ,d nucleic acid L ~ n~C of the present invention also include nucldc acid molecules .on~ing cl,;lope-bearing portions of the DR3 protein. In p~rticql~, such nucleic acid fr~gm~ntc of the present invention include nucleic acid molecules en~o~ling the co.le;",ol1ding regions to those cp;lo~-bearing regions ofthe DR3-V1 protein disclosed above. Methods for d~,t~ ...it~ing other such epilope-bearing portions of the DR3 protein are described in detail below.
In another aspect, the invention provides an isolated nucleic acid molecule comprising a polynucleotide which hybridi~s under sllh1g~,~ll hybri-ii7~tiQrl conditions to a portion of the polynucleotide in a nucleic acid molecule of the invention described above, for in~t~nce, the cDNA clones contained in ATCC
Deposit 97456 or ATCC Deposit 97757. By "~1, ;.~g~ hybri~1i7~tion con~litiQns is inten~ed overnight incubation at 42~C in a solution compricing 50%

~ ~t~

WO 97t33904 PCT/US96/16849 formAnni~e, 5x SSC (150 mM NaCl, 15rnM trisodium citrate), 50 mM sodium ph- sphAt~ (pH 7.6), 5x Denhardt's solution, 10% dextran sulfate, and 20 g/ml denatured, sheared salmon sperm DNA, followed by washing the filters in 0.1 x SSC at about 65~C.
By a polynucleotide which hybridizes to a "portion" of a polynucleotide is int~ntl~d a polynucleotide (either DNA or RNA) hybridizing to at least about 15 nucleotides (nt), and more preferably at least about 20 nt, still more preferably at least about 30 nt, and even more preferably about 30-70 nt of the ler~ ce polynucleotide. These are useful as diagnostic probes and primers as ~iicc~sse~
above and in more detail below.
By a portion of a polynucleotide of "at least 20 nt in length," for eYAmpie, is int~n~e~ 20 or more contiguous nucleotides from the nucleotide sequence of the reference polynucleotide (e.g., the deposited cDNA or the nucleotide sequence as shown in Figure l (SEQ ID NO: I ) or Figure 2 (SEQ ID NO:3).
Of course, a polynucleotide which hybridizes only to a poly A sequence (such as the 3 ' terminAI poly(A) tract of the DR3-V l cDNA shown in Figure 1 (SEQ ID NO: l )), or to a complementary stretch of T (or U) resides, would not be inrllldecl in a polynucleotide of the invention used to hybridize to a portion of a nucleic acid of the invention, since such a polynucleotide would hybridize to any nucleic acid molecule contAining a poly (A) stretch or the complement thereof (e.g., practically any double-stranded cDNA clone).
As indicated, nucleic acid molecules of the present invention which encode the DR3-V 1 or DR3 polypeptide may include, but are not limited to the coding sequence for the mature polypeptide, by itself; the coding sequence for the mature polypeptide and additional sequences, such as those encoding a leader or secl~L~ y sequence, such as a pre-, or pro- or prepro- protein sequence; the coding sequence of the mature polypeptide, with or without the aforemtntione~l additional coding sequences, together with additional, non-coding sequences, including for example, but not limited to introns and non-coding 5' and 3' sequences, such as the transcribed, non-tr~nclAtecl sequences that play a role in c~ ion, mRNA proces~ g - including splicing and polyadenylation signals, for exarnple - ribosome binding and stability of mRNA; additional coding sequence which codes for additional amino acids, such as those which provide additional functionalities. Thus, for in~t~nre, the polypeptide may be fused to a marker sequence, such as a peptide, which facilitates purification of the fused S polypeptide. In certain ~ d embodiments of this aspect of the invention, the marker sequence is a hexa-histidine peptide, such as the tag provided in a pQE
vector (Qiagen, Inc.), among others, many of which are commercially available.
As described in Gentz et al., Proc. Natl. Acad. Sci. USA 86: 821-824 (1989), for in.ct~n(~e, hexa-histidine provides for convenient purification of the fusion protein. The HA tag corresponds to an epitope derived of influenza hPnn~g~lutinin protein, which has been described by Wilson et al., Cell 37:767 (1984), for in~t~n~e.
The present invention further relates to variants of the nucleic acid molecules of the present invention, which encode for fr~gmPnt~, analogs or derivatives of the DR3-V I or DR3 polypeptide. Variants may occur naturally, such as an allelic variant. By an "allelic variant" is inten~e~l one of several alternate forms of a gene occupying a given locus on a chromosome of an organism. Genes II, Lewin, B ., ed., John Wi}ey & Sons, New York (1985). Non-naturally occurring variants may be produced using art-known mutagenesis techniques.
Such variants include those produced by nucleotide substitutions, deletion.~ or additions which may involve one or more nucleotides. The variants may be altered in coding or non-coding regions or both. Alterations in the coding regions may produce conservative or non-cons~ live amino acid substitutions, deletions or additions.
Further embo~ of the invention include isolated nucleic acid molecules that are at least 90% identical, and more preferably at least 95%~ 96%, 97%, 98% or 99% identical, to (a) a nucleotide sequence en~o~ling the full-length DR3-VI polypeptide having the complete amino acid sequence in Figure 1 (SEQ
ID NO:2), including the predicted leader sequence; (b) nucleotide sequence encoding the full-length DR3 polypeptide having the complete amino acid CA 02249182 1998-09-ll ~ CTI~ ~ 9 6 / 1 6 8 4 ~
JS 14 ~CT 1997 se.lu~.lce in Figure 2 (SEQ ID NO:4), including the predicted leader sequence;
(c) a nllrleQti~1e sc lu~,~ce enr~ing the mature DR3-V1 polypeptide (full-lengthpolypeptide with the leader removed) having the amino acid ~,. nr~; at poSitiQn.c about 36 to about 428 in Figure 1 (SEQ ID NO:2); (d) a nucleotide sequence çnr,o-ling the full-length DR3-Vl polypeptide having the cGlllplete amino acid sequence including the leader encoded by the cDNA clone co.~t~;l-fd in ATCC
Deposit No. 97456; (e) a nucleotide sequence enr~ing the full-length DR3 polypeptide having the complete amino acid sequence including the leader encoded by the cDNA clone contained in ATCC Deposit No. 97757; (f) a '~10 m~cleoti~le sequence encoding the mature DR3-Vl polypeptide having the amino C~ acid sequence encoded by the cDNA clone c~ nfd in ATCC Deposit No.
97456; (g) a nucleotide se lu~nce enrofling the mature DR3-Vl polypeptide having the amino acid e~ . nr~ enr~ by the cDNA clone c4~ ed in ATCC
Deposit No. 97757; (h) a nucleotide sc lu. nce that ~nr~s the DR3 ~ ular ~lom~in, (i) a mlcleoti~le seqllrnce that enrodes the DR3 l, .n~ nbrane dom~in, a) a nucleotide sequence that enrodes the DR3 intracellular domain, and (k) a nucleotide sequence that encodes the DR3 death dom~in or (1) a nucleotide sequence compl~ r to any of the nucleotide sequences in (a), (b), (c), (d), ~3 (e), (f), (g), (h), (i), a) or (k) above.
By a polynucleotide having a nucleotide sequence at least, for cA~l~le7 95% "i-l~ntir~ln to a lef. l.,nce nucleotide sequence ~ nr~lil~g a DR3-Vl or DR3poly~e is intended that the nucleotide se~lu~,~ce of the polynucleotide is identical to the l~felence sequence except that the polynucleotide se~lu~nce may , include up to five point mutations per each 100 nucleotides of the lef~,lellce nucleotide se~u~llce Pnr~ing the DR3-Vl or DR3 polypeptide In other words, to obtain a polynllcleotide having a nucleotide seq~l~nre at least 95% id~ntir~l to a refel~ ~ce nucleotide sequence, up to 5% of the nucleotides in the ~fe~ ce sequence may be deleted or sub~liluled with another nucleotide, or a number of nucleotides up to 5% of the total nucleotides in the ~felence sequence may be h~s~lled into the l~r~,lence sequence. These mutations of the reference sequencemay occur at the 5 ' or 3 ' termin~l positions of the lefe~llce nucleotide sequence t~

W 0 97J33904 PCT~US96/16849 or anywhere btlweell those tçrmin~l positions, int~ el~ed either individually among nucleotides in the lefe.e.lce sequence or in one or more contiguous groupswithin the l~fe.ence sequence.
As a practical matter, whether any particular nucleic acid molecule is at least 90%, 95%, 96%, 97%, 98% or 99% identical to, for jn~t~nre the nucleotide sequence shown in Figure 1, Figure 2 or to the nucleotide sequences of the deposited cDNA clones can be d~ e(l conv~ntion~lly using known co~ Lel prograrns such as the Bestfit program (Wisconsin Sequence Analysis Package, Version 8 for Unix, Genetics Co..l~lllel Group, University Research Park, 575 Science Drive, Madison, WI 53711. Bestfit uses the local homology algorithm of Smith and W~term~n, Advances in Applfed Mathematics 2: 482-489 (1981), to find the best segmPnt of homology between two sequences. When using Bestfit or any other sequence ~lignment program to ~letermin~P whether a particular sequence is, for in.ct~nre, 95% identical to a reference sequence according to the present invention, the p~r~tnPt~r.e are set, of course, such that the ~,.c~ age of identity is c~lc~ ted over the full length of the reference nucleotide sequence and that gaps in homology of up to 5% of the total number of nucleotides in the reference sequence are allowed.
The present application is directed to nucleic acid molecules at least 90%, 95%, 96%, 97%, 98% or 99% identical to the nucleic acid sequence shown in Figure 1 (SEQ ID NO:l), Figure 2 (SEQ ID NO:3) or to the nucleic acid sequence of the deposited cDNAs, irlei~e~ /e of whether they encode a polypeptide having DR3 activity. This is because even where a particular nucleicacid molecule does not encode a polypeptide having DR3 activity, one of skill inthe art would still know how to use the nucleic acid molecule, for instance, as a hybridization probe or a polymerase chain reaction (PCR) primer. Uses of the nucleic acid molecules of the present invention that do not encode a polypeptidehaving DDCR activity in~ln~le, inter alia, (1) isolating the DR3-VI or DR3 gene or allelic variants thereof in a cDNA library; (2) in situ hybridization (e.g., "FISH") to ~.. e1~pll~ee chromosomal spreads to provide precise chromosomal location of the DR3-VI or DR3 gene, as described in Verma et al., Human W 0 97~3904 PCTruS96/l6849 Chromosomes: A Manual of Basic Techniques, Pergamon Press, New York (1988); and (3) Northern Blot analysis for detecting DR3-VI or DR3 mRNA
s~ion in specific tissues.
Plef~ ,d, however, are nucleic acid molecules having sequences at least 90%, 95%, 96%, 97%, 98% or 99% i(1enti~ to the nucleic acid seqll~n~e shown in Figure 1 (SEQ ID NO:1), Figure 2 (SEQ ID NO:3) or to the nucleic acid sequence of the deposited cDNAs which do, in fact, encode a polypeptide having DR3 protein activity. By "a polypeptide having DR3 activity" is inten~lP~I
polypeptides exhibiting activity similar, but not necessarily i(lentic~l, to an activity of the DR3 protein of the invention (either the full-length protein or,preferably, the mature protein), as measured in a particular biological assay. For example, DR3 protein activity can be measured using the cell death assays p~lr~ led ~s~enti~lly as previously described (A.M. Chinnaiyan, et al., Cell 81,505-12 (1995); M.P. Boldin, et al., J Biol Chem 270, 7795-8 (1995); F.C.
Kischkel, et al., EMBO 14, 5579-5588 (1995); A.M. Chinnaiyan, et al., JBiol Chem 271, 4961-4965 (1996)) and as set forth in Example 7, below. In MCF7 cells, plasmids encoding full-length DR3 or a candidate death domain co"~ g receptors are co-llal~re~;led with the pLantern reporter construct encoding green fluorescent protein. Nuclei of cells transfected with DR3 will exhibit apoptoticmorphology as ~csesse~l by DAPI st~ining. Similar to TNFR-l and Fas/APO-1 (M. Muzio, etal., Cell 85, 817-827 (1996); M. P. Boldin, etaL, Cell 85, 803-815 (1996); M. Tewari, et al., J Biol Chem 270, 3255-60 (1995)), DR3-in~ cecl apoptosis is blocked by the inhibitors of ICE-like ploteases, CrrnA and z-VAD-f nk. In addition, apoptosis induced by DR3 is also blocked by dollfi~
negative versions of FADD (FADD-DN) or FLICE
(FLICE-DN/MACHal C360S).
Of course, due to the degeneracy of the genetic code, one of ordinary skill in the art ~,vill im me(li~tely recognize that a large number of the nucleic acid molecules having a sequence at least 90%, 95%, 96%, 97%, 98%, or 99%
identical to the nucleic acid sequence of the deposited cDNA or the nucleic acidsequence shown in Figure 1 (SEQ ID NO:I) or Figure 2 (SEQ ID NO:3) will WO 97/33904 PCTnUS96/16849 encode a polypeptide "having DR3 protein activity." In fact, since degenerate variants of these nucleotide sequences all encode the same polypeptide, this will be clear to the skilled artisan even without pelrol~ g the above described comp~ricQn assay. It will be further recognized in the art that, for such nucleic acid molecules that are not degenerate variants, a reasonable number will also encode a polypeptide having DR3 protein activity. This is because the skilled artisan is fully aware of anuno acid substitutions that are either less likely or not likely to ~ignific~ntly effect protein function (e.g., replacing one aliphatic amino acid with a second aliphatic amino acid).
For exarnple, guidance concerning how to make phenotypically silent amino acid substitutions is provided in Bowie, J.U. et al., "Deciphering the Message in Protein Sequences: Tolerance to Amino Acid Substitllti()n~ Science 247:1306-13 10 (1990), wherein the authors indicate that proteins are surprisingly tolerant of amino acid substitutions.

Polynu~l~o~i~ assays This invention is also related to the use of the DR3-VI or DR3 polynucleotides to detect complernent~ry polynucleotides such as, for example, as a rli~gnostic reagent. Detection of a mutated form of DR3-Vl or DR3 associated with a dysfunction will provide a diagnostic tool that can add or define a diagnosis of a disease or susceptibility to a disease which results from under-es~ion over-~les~ion or altered expression of DR3-Vl or DR3 or a soluble form thereof, such as, for example, turnors or autoimmune disease.
Individuals carrying mutations in the DR3-Vl or DR3 gene may be deb~cted at the DNA level by a variety of techniques. Nucleic acids for ~i~gno~i~

2~ may be obtained from a patient's cells, such as from blood, urine, saliva, tissue biopsy and autopsy m?.teri~l The genomic DNA may be used directly for detecti~ n or may be amplified enzymatically by using PCR prior to analysis.
(Saiki et al., Nature 324:163-166 (1986)). RNA or cDNA may also be used in the same ways. As an e~ lc, PCR primers compl~ u y to the nucleic acid W O 97/33904 PCTrUS96/16849 encoding DR3-V 1 or DR3 can be used to identify and analyze DR3-V I or DR3 expression and mutations. For example, deletions and insertions can be detected by a change in size of the amplified product in comparison to the normal genotype. Point mutations can be identified by hybridi_ing amplified DNA to radiolabeled DR3-Vl or DR3 RNA or alternatively, radiolabeled DR3-Vl or DR3 antisense DNA sequences. Perfectly matched sequences can be distinguished from mi~m~tçh~cl duplexes by RNase A digestion or by dirr~.ellces in melting tenl~ldlur~s.
Sequence differences between a reference gene and genes having mutations also may be revealed by direct DNA sequencing. In addition, cloned DNA segments may be employed as probes to detect specific DNA segm~nt~
The sensitivity of such methods can be greatly enhanced by ~ .opl;ate use of PCR or another ~mplific~tion method. For example, a sequencing primer is used with double-stranded PCR product or a single-stranded template molecule generated by a modified PCR. The sequence .i~t~ n~tion is performed by conventional procedures with radiolabeled nucleotide or by automatic sequencing procedures with fluoresce.lt-tags.
Genetic testing based on DNA sequence differences may be achieved by detection of alteration in electrophoretic mobility of DNA fr~gmtont~ in gels, with or without denaturing agents. Small sequence deletions and insertions can be visll~li7.ocl by high resolution gel electrophoresis. DNA fr~gm~nt~ of differentsequences may be distinguished on clc..~ g f~).."~,..i-le gradient gels in whichthe mobilities of different DNA fr~gm~nt.~ are retarded in the gel at dirf~
positions according to their specific melting or partial melting te~ dlules (see, e.g., Myers et al., Science 230:1242 (1985)).
Sequence changes at specific locations also may be revealed by nuclease protection assays, such as RNase and Sl protection or the chemical cleavage method (e.g., Cotton ef al., Proc. Natl. Acad. Sci. USA 85: 4397-4401 (1985)).
Thus, the detection of a specific DNA sequence may be achieved by methods such as hybridization, RNase protection, ~llPmi~l cleavage, direct DNA

W O 97~3904 PCTrUS96/16849 sequencing or the use of restriction enzymes, (e.g., restriction fragment lengthpolymorphisms ("RFLP") and Southern blotting of genomic DNA.
In addition to more conventional gel-electrophoresis and DNA
sequencing, mutations also can be detected by in situ analysis.

S Chromosome assays The sequences of the present invention are also valuable for chromosome idPntifi~tion. The sequence is specifically targeted to and can hybridize with aparticular location on an individual human chromosome. The mapping of DNAs to chromosomes according to the present invention is an hllpol L~l first step incorrelating those sequences with genes associated with disease.
In certain l,~cf.,.,~d embo~lim~nt.c in this regard, the cDNA herein disclosed is used to clone genomic DNA of a DR3-V 1 or a DR3 gene. This can be accomplished using a variety of well known techniques and libraries, which ~ener~lly are available coll.~l,c..;ially. The genomic DNA the is used for in situ chromosome mapping using well known techniques for this purpose.
In addition, sequences can be mapped to chromosomes by p~ g PCR
primers (preferably 15-25 bp) from the cDNA. Computer analysis of the 3' untr~nsl~tPd region of the gene is used to rapidly select primers that do not span more than one exon in the genomic DNA, thus complicating the amplification process. These primers are then used for PCR screening of somatic cell hybrids co.,~ g individual human chromosomes.
Fluorescence in situ hybridization ("FISH") of a cDNA clone to a met~ph~e chromosomal spread can be used to provide a precise chromosomal location in one step. This technique can be used with cDNA as short as 50 or 60.For a review of this technique, see Verma et al., Human Chromosomes: a Manual of Basic Techniques, Pergamon Press, New York (1988).
Once a sequence has been mapped to a precise chromosomal location, the physical position of the sequence on the chromosome can be correlated with genetic map data. Such data are found, for example, in V. McKusick, Mendelian WO 97133904 PCTtUS96/16849 Inheritance in Man, available on line through Johns Hopkins University, Welch Medical Library. The relationship between genes and diseases that have been mapped to the sarne chromosomal region are then identified through linkage analysis (coinheritance of physically adjacent genes~).
S Next, it is necess~ to determine the dirrereilces in the cDNA or genomic seq~ ce between affected and unaffected individuals. If a mutation is observed in some or all of the af~cted individuals but not in any normal individuals, then the mutation is likely to be the causative agent of the disease.

Vectors and Host Cells The present invention also relates to vectors which include DNA
molecules of the present invention, host cells which are genetically engin~ered with vectors of the invention and the production of polypeptides of the invention by recombinant techniques.
Host cells can be genetically ~onginPered to incorporate nucleic acid molecules and express polypeptides of the present invention. The polynucleotides may be introduced alone or with other polynucleotides. Such other polynucleotides may be introduced independently, co-introduced or introduced joined to the polynucleotides of the invention.
In accordance with this aspect of the invention the vector may be, for exarnple, a plasmid vector, a single or double-stranded phage vector, a single or double-stranded RNA or DNA viral vector. Such vectors may be introduced into cells as polynucleotides, preferably DNA, by well known techniques for introducing DNA and RNA into cells. Viral vectors may be replication competent or replication defective. In the latter case viral propagation generally will occur only in complçmenting host cells.
Preferred among vectors, in certain respects, are those for ~ ssion of polynucleotides and polypeptides of the present invention. Generally, such vectors comprise cis-acting control regions effective for ~res~ion in a host operatively linked to the polynucleotide to be ~ ssed. Appropriate trans-W O 97/33904 PCT~US96/1684g acting factors either are supplied by the host, supplied by a compl~m~nting vector or supplied by the vector itself upon introduction into the host.
A great variety of ~Al,lc~ion vectors can be used to express a polypeptide of the invention. Such vectors include chromosomal, episomal and virus-derived vectors e.g., vectors derived from bacteri~l plasmids, from bacteriophage, from yeast episomes, from yeast chromosomal elements, from viruses such as baculoviruses, papova viruses, such as SV40, vaccinia viruses, adenoviruses, fowl pox viruses, pseudorabies viruses and retroviruses, and vectors derived from combinations thereof, such as those derived from plasmid and bacteriophage genetic elements, such as cosmids and phagemids. all may be used for ~A~lcs~ion in accordance with this aspect of the present invention. Generally, any vector suitable to m~int~in, propagate or express polynucleotides to express a polypeptide in a host may be used for ~AI,lession in this regard.
The DNA sequence in the ~A~le;,~ion vector is operatively linked to al)pro~liale ~xplcs~ion control sequence(s)), including, for instance, a promoter to direct mRNA transcription. Rel,lcs~ es of such promoters include the phage lambda PL promoter, the E. coli lac, trp and tac promoters, the SV40 earlyand late promoters and promoters of retroviral LTRs, to name just a few of the well-known promoters. In general, ~A~ s~ion constructs will contain sites for ~ lion, initiation and termin~tion, and, in the transcribed region, a ribosome binding site for translation. The coding portion of the mature transcripts ~;x~n~iased by the constructs will include a translation initi~ting AUG at the beginning and a termin~tion codon (UAA, UGA or UAG) apl)ro~liately positioned at the end of the polypeptide to be tr~n~l~te~l In addition, the constructs may contain control regions that regulate as well as engender ~A~ ,s~ion. Generally, such regions will operate by controllingscl;l~tion, such as repressor binding sites and çnh~ncers, among others.
Vectors for propagation and ~AI,lession generally will include selectable m~rk~r~ Such . . ,;.. k.,. ~ also may be suitable for amplification or ~e vectors may contain additional m~rk~rs for this purpose. In this regard, the expression vectors ~l~r~"~bly contain one or more selectable marker genes to provide a phenotypic trait for selection of ~,ansroll~.ed host cells. Preferred markers include dihydrofolate redllrtAce or neomycin resistance for eukaryotic cell culture, andtetracycline or ampicillin reci~t~nr.e genes for culturing E coli and other bacteria.
The vector contAining the ap~ l;ate DNA sequence as described elsewhere herein, as well as an a~ ol,l;ate promoter, and other ay~lopl;ate control sequences, may be introduced into an applopl;ate host using a variety ofwell known techniques suitable to cA~rcs~;on therein of a desired polypeptide.
Representative examples of al,~rop~ e hosts include bacterial cells, such as E.
coli, SL~ olllyces and Salmonella lylJhi llul~ulll cells; fungal cells, such as yeast cells; insect cells such as Drosophila S2 and Spodoptera Sfg cells; animal cellssuch as CHO, COS and Bowes melanoma cells; and plant cells. Hosts for of a great variety of cA~ ion constructs are well known, and those of skill will be enabled by the present disclosure readily to select a host for ~A~lessillg a polypeptides in accordance with this aspect of the present invention.
Among vectors plef~ ,lcd for use in bacteria are pQE70, pQE60 and pQE-9, available from Qiagen; pBS vectors, Phages~ l vectors, Bluescript vectors, pNH8A, pNH16a, pNHl8A, pNH46A, available from Stratagene; and ptrc99a, pKK223-3, pKK233-3, pDR540, pRIT5 available from Pharrnacia.
Among plefclled eukaryotic vectors are pWLNEO, pSV2CAT, pOG44, pXT1 and pSG available from Stratagene; and pSVK3, pBPV, pMSG and pSVL
available from PhArmAriA These vectors are listed solely by way of illustration of the many commercially available and well known vectors available to those of skill in the art.
Selection of ~plo~l;ate vectors and promoters for expression in a host cell is a well known procedure and the requisite techniques for ~A~ies~ion vector construction, introduction of the vector into the host and ~A~s~ion in the host are routine skills in the art.
The present invention also relates to host cells CO~ g the above-described constructs discussed above. The host cell can be a higher eukaryotic cell, such as a ~"~"""AIiAn cell, or a lower eukaryotic cell, such as a yeast cell, or the host cell can be a prokaryotic cell, such as a bacterial cell.

W 097/33904 PCTnUS96/16849 Introduction of the construct into the host cell can be effected by calcium phosphate transfection, DEAE-dextran m~ ted transfection, cationic lipid-me~ t~d transfection, ele~LIopol~lLion, tr~n.~d~lction. infection or other methods.
Such methods are described in many standard laboratory m~nn~l~, such as Davis et al., Basic Methods in Molecular Biology (1986).
The polypeptide may be expressed in a modified form, such as a fusion protein, and may include not only secretion signals but also additional heterologous functional regions. Thus, for in.ct~nr.e, a region of additional amino acids, particularly charged amino acids, may be added to the N-tc~ us of the polypeptide to improve stability and persistence in the host cell, during purification or during subsequent h~n(lling and storage. Also, region also may be added to the polypeptide to facilitate purification. Such regions may be removed prior to final ~ ion of the polypeptide. The addition of peptide moieties to polypeptides to engender secretion or excretion, to improve stability and to facilitate purification, among others, are f~mili51r and routine techniques in the art. A pler~ ;d fusion protein comprises a heterologous region from immlln~ globulin that is useful to solubilize proteins. For example, EP-A-O 464 533 (C'~n~ n co~ultt;ll dl l 2045869) discloses fusion proteins comprising various portions of constant region of immnnoglobin molecu}es together with another hurnan protein or part thereof. In many cases, the Fc part in a fusion protein is thoroughly advantageous for use in therapy and diagnosis and thus results, for G, in irnproved rh~rm~r.okinPtie properties (EP-A 0232 262). On the other hand, for some uses it would be desirable to be able to delete the Fc part after the fusion protein has been expressed, ~letecte(l and purified in the advantageous manner described. This is the case when Fc portion proves to be a hindrance to use in therapy and t1i~gnn.~i~, for example when the fusion protein is to be used as antigen for immllni7~tions. In drug discovery, for example, hurnan proteins, such as, hIL5- has been fused with Fc portions for the purpose of high-throughput sc~ g assays to identify antagonists of hIL-5. See, D. Bennett et al., Journal of Molecular Recognition, Vol. 8:52-58 (1995) and K. Johanson et al., The Journal of Biological Chemistry, Vol. 270, No. 16:9459-9471 (1995).

. . . _ .

The DR3 and DR3-V 1 polypeptides can be recovered and purified from recombinant cell cultures by well-known methods including ammonium sulfate or ethanol pleciyiL~lion, acid extraction, anion or cation exchange chromatography, phosphocellulose chromatography, hydrophobic interaction S chromatography, affinity chromatography, hydroxylapatite chromatography and lectin chromatography. Most preferably, high perforrnance liquid chromatography ("HPLC") is employed for purification. Well known techniques for refolding protein may be employed to regenerate active col1fo~ Lion when the polypeptide is denatured during isolation and/or purification.
Polypeptides of the present invention include naturally purified products, products of chemical synthetic procedures, and products produced by recombinant techniques from a prokaryotic or eukaryotic host, including, for e~mple, bacteri~l, yeast, higher plant, insect and m~mm~ n cells. Depending upon the host employed in a recombinant production procedure, the polypeptides of the present invention may be glycosylated or may be non-glycosylated. In addition, polypeptides of the invention may also include an initial modified methionine residue, in some cases as a result of host-mediated processes.
DR3-Vl or DR3 polynucleotides and polypeptides may be used in accordance with the present invention for a variety of applications, particularly those that make use of the chemical and biological properties of DR3. Among these are applications in tre~tm~nt of tumors, resi~t~nre to parasites, bacteria and viruses, to induce proliferation of T-cells, endothelial cells and certain h~ Loyoietic cells, to treat restenosis, graft vs. host disease, to regulate anti-viral responses and to prevent certain autoimmune diseases after stim~ tion of DR3 by an agonist. Additional applications relate to diagnosis and to tre~tment of disorders of cells, tissues and org~niem.~. These aspects of the invention are ~1iccucsefl further below.

W O 97t33904 PCTAJS96tl6849 DR3 Poly~tides and Fra~".~! .t~

The invention filrther provides an isolated DR3-V I or DR3 polypeptide having the amino acid sequence shown in FIG.1 [SEQ ID NO:2] and FIG.2[SEQ
ID NO:4], respectively, or a fragment thereof. It will be recognized in the art that some amino acid sequence of DR3-V1 or DR3 can be varied without significant effect of the structure or function of the protein. If such differences in sequence are co-~f ~ lated, it should be remembered that there will be critical areas on the protein which ~etennine activity. Such areas will usually comprise residues which make up the ligand binding site or the death domain, or which form tertiary structures which affect these domains.
Thus, the invention further includes variations of the DR3-VI or DR3 protein which show substantial DR3 protein activity or which include regions of DR3-V1 or DR3 such as the protein fr~gm~nt.c ~liccllcsecl below. Such ~ C
include deletions, insertions, inversions, repeats, and type s~lbstit ltions. Asindicated above, guidance conctlllillg which amino acid changes are likely to bephenotypically silent can be found in Bowie, J.U. et al., Science 247:1306-1310 (19go).
Of particular interest are substitutions of charged amino acids with another charged amino acid and with neutral or negatively charged arnino acids.
The latter results in ploteills with reduced positive charge to improve the chala.;t,~ ics of the DR3-V 1 or DR3 protein. The prevention of aggregation is highly desirable. Ag~ lion of pl.~teills not only results in a loss of activity but can also be problematic when l~lel)~hlg ph~ celltical formulations, because they can be immllnogenic. (Pinckard et al., Clin Exp. Immunol. 2:331-340 (1967); Robbins et al., Diabetes 36:838-845 (1987); Cleland et al. Crit. ~ev.
Therapeutic Drug Carrier Systems 10:307-377 (1993)).
The replacement of amino acids can also change the selectivity of binding to cell surface receptors. Ostade et al., Nature 361:266-268 (1993) describes certain mutations resulting in selective binding of TNF-oc to only one of the two known types of TNF receptors. Thus, the DR3-V 1 or DR3 lec~lo~ of the present invention may include one or more amino acid substitutions, deletions or additions, either from natural mutations or human manipulation.
As indicated, changes are preferably of a minor nature, such as conse~ live amino acid s--hstihltions that do not significantly affect the folding or activity of the protein (see Table 1).

TABLE 1. Conservative Arnino Acid Substitutions.
Aromatic Phenylalanine Tryptophan Tyrosine Hydrophobic Leucine Isol~ ..c Valine Polar Glutamine A~,Ja. ..~,i~
Basic Arginine Lysine Histidine Acidic Aspartic Acid Glutarnic Acid Small Alanine Serine Threonine Methionine Glycine Amino acids in the DR3-V 1 or DR3 protein of the present invention that are .oc~nti~l for function can be identified by methods known in the art, such as site-directed mutagenesis or alanine-sc~nning mutagenesis (Cllnningh~m and Wells, Science 244:1081-1085 (1989)). The latter procedure introduces single alanine mutations at every residue in the molecule. The resulting mutant molecules are then tested for biological activity such as receptor 'oinding or in vi~ro, or in vitro proliferative activity. Sites that are critical for ligand-receptor binding can also be deterrnined by structural analysis such as cryst~lli7~tion, WO 97/33904 PCTrUS96/16849 nuclear m~gn~tir resonance or photoaffinity labeling (Smith et al., J. Mol. Biol.
224:899-904 (1992) and de Vos etal. Science 255:306-312 (1992)).
The polypeptides of the present invention are preferably provided in an isolated form, and ~ bly are sllbst~nti~lly purified. A recombinantly produced version of the DR3-V 1 or DR3 polypeptide is sl~bst~nti~l~y purified bythe one-step method described in Smith and Johnson, Gene 67:31 -40 (1988).
The polypeptides of the present invention also include the polypeptide encoded by the deposited cDNA including the leader, the mature polypeptide encoded by the deposited the cDNA minus the leader (i.e., the mature protein), the polypeptide of Figure 1 (SEQ ID NO:2) or Figure 2 (SEQ ID NO:4) including the leader, the polypeptide of Figure 1 (SEQ ID NO:2) or Figure 2 (SEQ ID
NO:4) minus the leader, the extracellular cl~ m~in, the tr~ncm~nnbrarle domain, the intracellular domain, soluble polypeptides comprising all or part of the extracellular and intracelluar domains but lacking the tr~n~memhrane domain as well as polypeptides which are at least 80% identical, more preferably at least 90% or 95% identical, still more preferably at least 96%, 97%, 98% or 99%
identical to the polypeptide encoded by the deposited cDNA clones, to the polypeptide of Figure 1 (SEQ ID NO:2) or Figure 2 (SEQ ID NO:4), and also include portions of such polypeptides with at least 30 amino acids and more preferably at least 50 amino acids.
By a polypeptide having an amino acid sequence at least, for example, 95% "identical" to a reference amino acid sequence of a DR3-Vl or DR3 polypeptide is int~nrlerl that the amino acid sequence of the polypeptide is identical to the reference sequence except that the polypeptide sequence may include up to five amino acid alterations per each 100 amino acids of the reference amino acid of the DR3-V1 or DR3 polypeptide. In other words, to obtain a polypeptide having an amino acid sequence at least 95% identical to a reference amino acid sequence, up to 5% of the amino acid residues in the reference sequence may be deleted or ~ubsliluLed with another aTnino acid, or a number of amino acids up to 5% of the total amino acid residues in the referencesequence may be inserted into the le~ ce sequence. These alterations of the efel~nce sequence may occur at the amino or carboxy terminal positions of the reference amino acid sequence or anywhere between those terminal positions, interspersed either individually among residues in the reference sequence or in one or more contiguous groups within the reference sequence.
As a practical matter, whether any particular polypeptide is at least 90%, 95%, 96%, 97%, 98% or 99% identical to, for in~t~nce7 the amino acid sequence shown in Figure 1 (SEQ ID NO:2), or Figure 2 (SEQ ID NO:4) or to the amino acid sequence encoded by deposited cDNA clones can be .leterminPd conventionally using known computer programs such the Bestfit program (Wisconsin Sequence Analysis Package, Version 8 for Unix, Genetics Computer Group, University Research Park,575 Science Drive, Madison, WI 53711. When using Bestfit or any other sequence ~ nm~nt program to determine whether a particular sequence is, for in~t~n~e 95% identical to a reference sequence according to the present invention, the p~ tP~ ~ are set, of course, such that the percentage of identity is calculated over the full length of the reference aminoacid se~uence and that gaps in homology of up to 5% of the total number of amino acid residues in the reference sequence are allowed.
The present inventors have discovered that the DR3-V 1 polypeptide is a 428 residue protein exhibiting three main structural domains. First, the ligand binding domain was identified within residues from about 36 to about 212 in FIG. 1 [SEQ ID NO:2]. Second, the tr~n~m~mbrane domain was identified within residues from about 213 to about 235 in FIG. 1 [SEQ ID NO:2]. Third, the intracellular domain was identified within residues from about 236 to about 428 in FIG. 1 [SEQ ID NO:2]. Importantly, the intracellular domain includes a death domain at residues from about 353 to about 419. Further l,le~ll~d fr~gm~nt~ of the polypeptide shown in FIG.1 [SEQ ID NO:2] include the mature protein from residues about 36 to about 428 and soluble polypeptides comprising all or part of the extracellular and intracellular domains but lacking the tr~n~memhrane domain.
The present inventors have also discovered that the DR3 polypeptide is a 417 residue protein exhibiting three main structural domains. First, the ligand W 0 97~3904 PCTrUS96/16849 binding domain was identified within residues from about 25 to about 201 in FIG. 2 [SEQ ID NO:4]. Second, the tr~n~m~mhrane domain was identified within residues from about 202 to about 224 in FIG. 2 [SEQ ID NO:4]. Third, the intracellular domain was identified within residues from about 225 to about 417 in FIG. 2 [SEQ ID NO:4]. Importantly, the intracellular domain includes a death domain at residues from about 342 to about 408. Further pler~ ,d fr~m~ontc of the polypeptide shown in FIG. 2 [SEQ ID NO:4] include the mature protein from residues about 25 to about 417 and soluble polypeptides comprising all or part of the extracellular and intracellular domains but lacking the tr~n~m~mhrane clom:~in. As one of slcill in the art will recognize, the full length polypeptides encoded by the DR3-V 1 and DR3 cDNA differ only in the amino acid sequence of the leader peptide. The first 24 amino acids of the polypeptideshown in Figure 1 are replaced by the first 13 amino acids shown in Figure 2 butthe rest of the amino acid sequence is the same. Thus, both the DR3-V 1 cDNA
and DR3 cDNA encode an identical mature protein having the same biological activity.
Thus, the invention further provides DR3-V1 or DR3 polypeptides encoded by the deposited cDNA clones including the leader and DR3-V 1 or DR3 polypeptide fragmf nt~ selected from the mature protein, the extracellular ~lom~in, the tr~n~m~mhrane domain, the intracellular domain, and the death domain.
In another aspect, the invention provides a peptide or polypeptide comprising an e~ilol)e-bearing portion of a polypeptide described herein. The epitope of this polypeptide portion is an immlTn~genic or antigenic epitope of apolypeptide of the invention. An "immunogenic epitope" is defined as a part of a protein that elicits an antibody le~uollse when the whole protein is the immunogen. On the other hand, a region of a protein molecule to which an antibody can bind is defined as an "antigenic epitope." The number of immlmogenic epitopes of a protein generally is less than the number of antigenicepitopes. See, for instance, Geysen et al., Proc. Natl. Acad. Sci. USA 8l :3998-4002 (1983).

.

WO 97~3904 PCT/IUS96/16849 As to the selection of peptides or polypeptides bearing an antigenic epitope (i.e., that contain a region of a protein molecule to which an antibody can bind), it is well known in that art that relatively short synthetic peptides that mimic part of a protein sequence are routinely capable of eliciting an alllise. .ml S that reacts with the partially mimicked protein. See, for i ~ e, Sutcliffe, J. G., Shinnick, T. M., Green, N. and Learner, R.A. (1983) Antibodies that react with predetermined sites on proteins. Science 219:660-666. Peptides capable of eliciting protein-reactive sera are frequently ~ d in the primary sequence of a protein, can be characterized by a set of simple chemical rules, and are confined neither to immunodominant regions of intact proteins (i.e., imml~nl~genic epitopes) nor to the amino or carboxyl t~ min~
~ntigt nic epitope-bearing peptides and polypeptides of the invention are therefore useful to raise antibodies, inciuding monoclonal antibodies, that bindspecifically to a polypeptide of the invention. See, for instance, Wilson et al., Cell 3~:767-778 (1984) at 777.
Antigenic epitope-bearing peptides and polypeptides of the invention preferably contain a sequence of at least seven, more preferably at least nine and most preferably between at least about 15 to about 30 amino acids contained within the amino acid sequence of a polypeptide of the invention.
Non-limiting eY~mplec of antigenic polypeptides or peptides that can be used to generate DR3-specific antibodies include: a polypeptide comprising amino acid residues from about 1 to about 22 in Figure 1 (SEQ ID NO:2); a polypeptide comprising amino acid residues from about 33 to about 56 in Figure 1 (SEQ ID NO:2); a polypeptide comprising amino acid residues from about 59 to about 82 in Figure 1 (SEQ ID NO:2); a polypeptide compri~ing amino acid residues from about 95 to about 112 in Figure 1 (SEQ ID NO:2); a polypeptide comprising amino acid residues from about 122 to about 133 in Figure 1 (SEQ ID NO:2); a polypeptide comprising amino acid residues from about 161 to about 177 in Figure 1 (SEQ ID NO:2); a polypeptide comprising amino acid residues from about 179 to about 190 in Figure 1 (SEQ ID NO:2); and a polypeptide comprising amino acid residues from about 196 to about 205 in wo 97/33904 PCT/US96/16849 Figure 1 (SEQ ID NO:2). In additon, antigenic polypeptides or peptides include polypeptides comprising the amino acid residues that are the co~ ,onding residues to those polypeptides of DR3-Vl disclosed above. As indicated above, the inventors have d~t~ e~ that the above polypeptide fr~grn~ntc are antigenic regions of the DR3-V 1 and DR3 protein.
The epitope-bearing peptides and polypeptides of the invention may be produced by any conventional means. Houghten, R.A., "General method for the rapid solid-phase synthesis of large numbers of peptides: specificity of antigen-antibody interaction at the level of individual amino acids," Proc. Natl.
0 Acad. Sci. USA 82:5131-5135 (1985). This "Simultaneous Multiple Peptide Synthesis (SMPS)" process is further described in U.S. Patent No. 4,631,211 to Houghten et al. (1986).
As one of skill in the art will appreciate,DR3-V 1 or DR3 polypeptides of the present invention and the epitope-bearing fr~gmçnt.s thereof described abovecan be combined ~vith parts of the constant domain of immunnglobulins (IgG), resulting in chimeric polypeptides. These fusion proteins facilitate purification and show an increased half-life in vivo. This has been shown, e.g., for chimericproteins con~i~ting of the first two domains of the human CD4-polypeptide and various domains of the con~ll regions of the heavy or light chains of m~mm~ n immunoglobulins (EPA 394,827; Trann~ock~r et al., Nature 331:84-86 (1988)). Fusion proteins that have a ~ nlficle-linked dimeric ~I~u~;lule due to the IgG part can also be more efficient in binding and neutralizing other molecules than the monomeric DR3-Vl or DR3 protein or protein fragment alone (Fountoulakis et al., J Biochem 270:3958-3964 (1995)).

r~ ~fide assays The present invention also relates to ~ gn~stic assays such as ~ e and diagnostic assays for detecting levels of DR3-V1 or DR3 protein, or the soluble forrn thereof, in cells and tissues, including ~eterrnin~tion of normal and abnorrnal levels. Thus, for in~t~nre, a tli~nostic assay in accordance with the invention for ~etPcting over~ lc~ion of DR3-Vl or DR3, or soluble form thereof, compared to normal control tissue samples may be used to detect the ~s~nce of tumors, for example. Assay techniques that can be used to ~lpt~rminp levels of a protein, such as an DR3 protein of the present invention, or a soluble forrn thereof, in a sample derived from a host are well-known to those of skill in the art. Such assay methods include radioimmunoassays, comp~liLive-binding assays, Western Blot analysis and ELISA assays.
Assaying DR3-V1 or DR3 protein levels in a biological sample can occur using any art-known method. Preferred for assaying DR3-Vl or DR3 protein levels in a biological sarnple are antibody-based techniques. For example,DR3-Vl or DR3 protein ~A~lession in tissues can be studied with classical immlm~)histological meth~-lc (J~lk~nPn, M., et al., J. Cell. Biol. 101:976-985 (1985); J~lk~nPn, M., et al., J. Cell . Biol. 105:3087-3096 (1987)).
Other antibody-based methods useful for detecting DR3-V1 or DR3 protein gene ~A~icssion include immlln~assays~ such as the enzyme linked immlmosorbent assay (ELISA) and the radioimm-m~.c~y (RlA).
Suitable labels are known in the art and include enzyme labels, such as glucose oxidase, radioisotopes, such as iodine (125I, '2'I), carbon (14C), sulphur (35S), tritium (3H), indium ("2In), and technetium (99mTc), and fluorescent labels, such as fluorescein and rhod~mine, and biotin.

Thr~

The Tumor Necrosis Factor (TNF) family ligands are known to be among the most pleiotropic cytokines, in~lcing a large number of cellular responses, including cytotoxicity, anti-viral activity, immlm- regulatory activities, and the L~ scl~lional regulation of several genes (Goeddel, D.V. et aL, "Tumor Necrosis Factors: Gene Structure and Biological Activities," Symp. Quant. Biol. 51:597-609 (1986), Cold Spring Harbor; Beutler, B., and Cerarni, A., Annu. Rev.
Biochem. 57:505-518 (1988); Old, L.J., Sci. Am. 258:59-75 (1988); Fiers, W., FEBSLett. 285:199-224 (1991)). The TNF-family ligands induce such various W O 97~3904 PCTrUS96/16849 cellular responses by binding to TNF-farnily receptors, including the DR3-V 1 orDR3 of the present invention. Cells which express the DR3-V1 or DR3 polypeptide and are believed to have a potent cellular response to DR3-Vl or DR3 ligands include lymphocytes, fibroblasts, macrophages, synovial cells, activated T-cells, lymphoblasts and epithelial cells. By "a cellular response to a TNF-family ligand" is intPnt~ any genotypic, phenotypic, and/or morphologic change to a cell, cell line, tissue, tissue culture or patient that is in~ ce~l by a TNF-family ligand. As indicated, such cellular responses include not only normal physiological responses to TNF-family lig~nric, but also ~ eace~
associated with increased apoptosis or the inhibition of apoptosis. Apoptosis-programmed cell death-is a physiological m~ch~ni~m involved in the deletion of p~,.ipll~,.dl T lymphocytes of the immllne system, and its dysregulation can lead to a number of di~l~nt pathogenic processes (Ameisen, J.C."4XDS 8:1 197-1213 (1994); Kramrner, P.H. etal., Curr. Opin. Immunol. 6:279-289 (1994)).
Diseases associated with increased cell survival, or the inhibition of apoptosis, include cancers (such as follicular lymphomas, carcinomas with p53 mutations, and hormone-dependent turnors, such as breast cancer, prostrate cancer, Kaposi's sarcoma and ovarian cancer); autoimm~mP dis~rders (such as systemic lupus erythPm~tosus and immllne-related glomerulonephritis rh~nm~toid arthritis) and viral infections (such as herpes viruses, pox viruses and adenoviruses), information graft v. host disease, acute graft rejection, and chronic graft re3ection. Diseases associated with increased apoptosis include AIDS;
neurodegenerative disorders (such as Alzheimer's ~ e~ce, Parkinson's (li~e~e7 Amyotrophic lateral sclerosis, Retinitis pigmentosa, Cerebellar degeneration);
myelodysplastic syndromes (such as aplastic anemia), i~çh~mic injury (such as that caused by myocardial infarction, stroke and reperfusion injury), toxin-in~lnce~l liver disease (such as that caused by alcohol), septic shock, c~cht~ and anorexia.
Thus, in one aspect, the present invention is directed to a method for enhancing apoptosis inrlllce~l by a TNF-family ligand, which involves a~1mini~terinE~ to a cell which expresses the DR3-V1 or DR3 polypeptide an W O 97/33904 PCTnUS96/16849 effective amount of DR3-Vl or DR3 ligand, analog or an agonist capable of increasing DR3-Vl or DR3 mç~liAt~d ~ign~ling. Preferably, DR3-V1 or DR3 m~ t~d sign~ling is increased to treat a disease wherein decreased apoptosis or decreased cytokine and adhesion molecule explession is exhibited. An agonist S can include soluble forms of DR3-Vl or DR3 and monoclonal antibodies directed against the DR3-V 1 or DR3 polypeptide.
In a further aspect, the present invention is directed to a method for inhibiting apoptosis induced by a TNF-family ligand, which involves a~lmini~tering to a cell which expresses the, DR3-Vl or DR3 polypeptide an effective amount of an antagonist capable of decreasing DR3-V1 or DR3 m.orli~ted .~ign~ling Preferably, DR3-Vl orDR3 mPrli~ted ~ign~ling is decreased to treat a disease wherein inc.ciased apoptosis or NFkB ~ esaion is exhibited.
An antagonist can include soluble forms of DR3-Vl or DR3 and monoclonal antibodies directed against the DR3-V 1 or DR3 polypeptide.
By "agonist" is int~?n-led naturally occurring and synthetic compounds capable of enh~nsing or potenti~ting apoptosis. By "antagonist" is int~nr~ed naturally occulTing and synthetic compounds capable of inhibiting apoptosis.
Whether any c~nt~ te "agonist" or "antagonist" of the present invention can enhance or inhibit apoptosis can be ~et~rmined using art-known TNF-family ligand/receptor cellular re~l)onse assays, including those described in more detail below.
One such s~;leel~ g procedure involves the use of melanophores which are transfected to express the receptor of the present invention. Such a screening technique is described in PCT WO 92/01810, published February 6, 1992. Such an assay may be employed, for example, for screening for a compound which inhibits (or ~nh~n~es) activation of the receptor polypeptide of the present invention by cont~ting the melanophore cells which encode the receptor with - both a TNF-family ligand and the candidate antagonist (or agonist). Inhibition or Pnh~n~ern~ont ofthe signal gel~al~d by the ligand indicates that the compoundis an antagonist or agonist of the ligand/receptor signaling pathway.

W O 97/33904 PCT~US96/16849 Other screening techniques include the use of cells which express the receptor (for example, ~ sr~ ed CHO cells) in a system which measures extracellular pH changes caused by l~c~)lul activation, for example, as described in Science 246:181-296 (October 1989). For example, compounds may be S contacted with a cell which ~ esses the receptor polypeptide of the present invention and a second messenger response, e.g., signal tr~n~dnl tion or pH
changes, may be measured to clet~rmine whether the potential compound activates or inhibits the receptor.
Another such scl~,~ing technique involves introducing RNA encoding the lcce~lor into Xenopus oocytes to transiently express the receptor. The receptor oocytes may then be contacted with the .ec~,lor ligand and a compound to be screened, followed by detection of inhibition or activation of a calcium signal in the case of sclee.~-llg for compounds which are thought to inhibit activation of the receptor.
Another s, l~ienil1g technique involves ~ies~ing in cells a construct wherein the receptor is linked to a ph~spholipase C or D. Such cells include endothelial cells, smooth muscle cells, embryonic kidney cells, etc. The screening may be accompli~hlod as hereinabove described by ~etecfing activation of the receptor or inhibition of activation of the receptor from the phospholipase signal.
Another method involves screening for compounds which inhibit activation of the receptor polypeptide of the present invention antagonists by dt~ g inhibition of binding of labeled ligand to cells which have the receptor on the surface thereof. Such a method involves transfecting a eukaryotic cell with DNA encoding the l~c~ tor such that the cell expresses the receptor onits surface and cont~ting the cell with a compound in the presence of a labeled ~ form of a known ligand. The ligand can be labeled, e.g., by radioactivity. The amount of labeled ligand bound to the receptors is measured, e.g., by mç~nring radioactivity of the Iecc~ptols. If the compound binds to the lec~ tor as clçt~rmintod by a reduction of labeled ligand which binds to the lecel)~ol~, thebinding of labeled ligand to the receptor is inhibited.

Further screening assays for agonist and antagonist of the present invention are described in Tartaglia, L.A., and Goeddel, D.V., J. Biol. Chem.
267(7):4304-4307(1992).
Thus, in a further aspect, a scle~ g method is provided for Cit;tf.. Illi~;llg whether a candidate agonist or antagonist is capable of enhancing or inhibiting a cellular response to a TNF-family ligand. The method involves cont~ting cells which express the DR3-V 1 or DR3 polypeptide with a candidate compound and a TNF-family ligand, assaying a cellular response, and co~..p,.l ;.-g the cellular ,ollse to a standard cellular response, the standard being assayed when contact is made with the ligand in absence of the c~n~ te compound, whereby an increased cellular response over the standard indicates that the candidate compound is an agonist of the ligand/receptor ~i~n~ling pdlhwdy and a decreased cellular response co,.,~dled to the standard inrlir7/t~ that the c~n-li(l~te compound is an antagonist of the ligand/~ecel)tol ~ig~ling pathway. By "assaying a cellular response" is int~n-le~l qualitatively or ~ fely measuring a cellulamc~ol~rc to a c~n~ te compound and/or a TNF-family ligand (e.g., detennining or estim~ting an increase or decrease in T cell proliferation or tritiated thymidine labeling). By the invention, a cell e~l~lcs~hlg the DR3-V1 or DR3 polypeptide can be contacted with either an endogenous or exogenously ~llmini~tered TNF-family ligand.
Agonist according to the present invention include naturally oCc..rring and synthetic compounds such as, for eY~mple7 TNF family ligand peptide ~gm~ntc, transforming growth factor ,B, neulotl~l~c...i~"s (such as glllt~m~te, dop~min~,N-methyl-D-aspartate), tumor ~u~ essol~ (pS3), cytolytic T cells and ~ntim~t~holites. Preferred agonist include chemotheld~ ic drugs such as, for example, cisplatin, doxorubicin, bleomycin, cytosine arabinoside, nitrogen mustard, methotrexate and vincri~tine. Others include ethanol and ~B-amyloid peptide. (Science 267:1457-1458 (1995)). Further prcfcllcd agonist include polyclonal and monoclonal antibodies raised against the DR3-Vl or DR3 polypeptide, or a fragment thereof. Such agonist antibodies raised against a TNF-family receptor are disclosed in Tartaglia, L.A., et al., Proc. Na~l. Acad. Sci.

USA 88:9292-9296 (1991); and Tartaglia, L.A., and Goeddel, D.V., J. Biol.
Chem. 267 (7):4304-4307 (1992) See, also, PCT Application WO 94/09137.
Antagonist according to the present invention include naturally occurring and synthetic compounds such as, for example, the CD40 ligand, neutral amino S acids, zinc, estrogen, androgens, viral genes (such as Adenovirus EIB, Baculovirus p35 and IAP, Cowpox virus crmA, Epstein-Barr virus BHRFI, LMP-I, African swine fever virus LMVV5-HL, and Herpesvirus yl 34.5), calpain inhibitors, cysteine protease inhibitors, and tumor promoters (such as PMA, Phenobarbital, and a-Hexachlorocyclohexane).
Other potential antagonists include ~ntieenee molecules. ~ntieer-ee technology can be used to control gene e~ ion through ~ntie~nee DNA or RNA or through triple-helix formation. ~ntieerlee techniques are fiieclleced forexample, in Okano, J. Neurochem. 56:560 (1991); Oligodeoxynucleotides as Antisense Inhibitors of Gene Expression, CRC Press, Boca Raton, FL (1988).
Triple helix formation is ~ieclleeecl in, for instance Lee et al., Nucleic AcidsResearch 6:3073 (1979); Cooney et al., Science 241:456 (1988); and Dervan et al., Science 251:1360 (1991). The methods are based on binding of a polynucleotide to a complementary DNA or RNA.
For example, the 5' coding portion of a polynucleotide that encodes the mature polypeptide of the present invention may be used to design an antisen~ -RNA oligonucleotide o.' from about 10 to 40 base pairs in length. A DNA
oligonucleotide is dPeigJ~(l to be comp~ y to a region of the gene involved in transcription thereby preventing L-~scl;l Lion and the production of the receptor. The ~ntieenee RNA oligonucleotide hybridizes to the mRNA in vivo and blocks translation of the mRNA molecule into receptor polypeptide. The oligonucleotides described above can also be delivered to cells such that the ~nti~nee RNA or DNA may be G~IG~ed in vivo to inhibit production of the receptor.
Further antagonist according to the present invention include soluble forrns of DR3-Vl or DR3, i.e.,DR3-Vl or DR3 fi~gm~nte that include the ligand binding domain from the extracellular region of the full length lGce~tor. Such wo 97/33904 PC rluS96/l6849 soluble forms of the receptor, which may be naturally occurring or synthetic, antagonize DR3-V1 or DR3 mediated 5i~tling by competing with the cell surface DR3-V I or DR3 for binding to TNF-family ligands. Thus, soluble forms ofthe receptor that include the ligand binding domain are novel cytokines capable of inhibiting apoptosis in-ln~ecl by TNF-family ligands. These are preferably expressed as dimers or trimers, since these have been shown to be superior to monomeric forms of soluble receptor as antagonists, e.g., IgGFc-TNF lece~u~ol family fusions. Other such cytokines are known in the art and include Fas B (a soluble form of the mouse Fas ~~~tu[) that acts physiologically to limit apoptosis intl~lce~ by Fas ligand (Hughes, D.P. and Crispe, I.N., J. ~xp. Med 182:1395-1401 (1995)).
The ~I,el;.,lents set forth in Examples 6 and 7 d~mort~trate that DR3 is a death domain-cont~ining molecule capable of triggering both apoptosis and NF-kB activation, two pathways dominant in the regulation of the immlme system. The ex~el;lllellts also demon~trate the internal signal trstn.clltlrtion, y of this novel cell death rec~ol . In addition, the ~p~ n~ set forth below ~lemnn~trate that DR3-inA~lced apoptosis was blocked by the inhibitors of ICE-like proteases, CrmA and z-VAD-fmk. Importantly, apoptosis in~ re~i by DR3 was also blocked by domin~ll negative versions of FADD (FADD-DN) or FLICE (FLICE-DN/MACHal C360S), which were previously shown to inhibit death ~ign~ling by Fas/APO-1 and INFR-l. Thus, inhibitors of ICE-like proteases, FADD-DN and FLICE-DN/MACHalC360S could also be used as antagonists for DR3 activity.
The term "antibody" (Ab) or "monoclonal antibody" (mAb) as used herein is meant to include intact molecules as well as fr~gment~ thereof (such as, for example, Fab and F(ab')2 fr~gment~) which are capable of binding an antigen.
Fab and F (ab')2 fragments lack the Fc fragment of intact antibody, clear more rapidly from the circulation, and may have less non-specific tissue binding of an intact antibody (Wahl et al., J. Nucl. Med. 24:316-325 (1983)).
Antibodies according to the present invention may be ~ ,d by any of a variety of m~thr~ using DR3-Vl or DR3 immllnogens of the present W O 97/33904 rCTnUS96/16849 invention. As indicated, such DR3-Vl or DR3 immunogens include the full length DR3-VI or DR3 polypeptide (which may or may not include the leader sequence) and DR3-V 1 or DR3 polypeptide fr~ment~ such as the ligand binding ~lom~in, the tr~n~m~mhrane domain, the intracellular domain and the death domain.
Proteins and other compounds which bind the DR3-V 1 or DR3 domains are also c~n-lirl~t~ agonist and antagonist according to the present invention.
Such binding compounds can be "captured" using the yeast two-hybrid system (Fields and Song, Nature 340:245-246 (1989)). A modified version of the yeast two-hybrid system has been described by Roger Brent and his colleagues (Gyuris, J. et al., Cell 75:791-803 (1993); Zervos, A.S. et al., Cell 72:223-232 (1993)).Preferably, the yeast two-hybrid system is used according to the present invention to capture compounds which bind to either the DR3-V 1 or DR3 ligand binding domain or to the DR3-Vl or DR3 intracellular domain. Such compounds are good c~nrliri~te agonist and antagonist of the present invention.
By a "TNF-family ligand" is int~n-led naturally occ.-rrin~, recombinant, and synthetic ligands that are capable of binding to a member of the TNF receptor family and intl~lein~ the ligand/lec~ ul ei~n~lin~ pathway. Members of the TNF
ligand family include, but are not limited to, the DR3-Vl or DR3 ligand, TNF-oc,lymph-ltoxin-a (LT-a, also lcnown as TNF-~), LT-~ (found in complex heterotrimer LT-a2-~), FasL, CD40, CD27, CD30, 4-lBB, OX40 and nerve growth factor (NGF).
Repl~s~llL~ e therapeutic applications of the present invention are ~licc.lesed in-more detail below. The state of immlmc)deficiency that defines AIDS is secondary to a decrease in the number and function of CD4+
T-lymphocytes. Recent reports esfim~te the daily loss of CD4+ T cells to be between 3.5 X 107 and 2 X 109 cells (Wei X., et al., Nature 373:1 17-122 (1995)).
One cause of CD4+ T cell depletion in the setting of HIV infection is believed to be HIV-in~ ce~l apoptosis. Indeed, HIv-ind~lred apoptotic cell death has been ~l.om-netrated not only in vitro but also, more ill~.,l~llly, in infected individuals (,~mei~en, J.C., AIDS8:1197-1213 (1994~; Finkel, T.H., and Banda, N.K., Curr.

, Opin. Immunol. 6:605-615(1995); Muro-Cacho, C.A. et al., J. Immunol.
154:5555-5566 (1995)). Furthermore, apoptosis and CD4+ T-lymphocyte depletion is tightly correlated in dirrcle~lt animal models of AIDS (Brunner, T., e~ al., Nature 373:441-444 (1995); Gougeon, M.L., et al., AIDS Res. Hum.
Retroviruses 9:553-563 (1993)) and, apoptosis is not observed in those animal models in which viral replication does not result in AIDS (Gougeon, M.L. et al.,AIDS Res. Hum. Retroviruses 9:553-563 (1993)). Further data in~iC~tÇS that uninfected but primed or activated T Iymphocytes from HIV-infected individuals undergo apoptosis after enco--nt~ ing the TNF-family ligand FasL. Using monocytic cell lines that result in death following HIV infection, it has been demonstrated that infection of U937 cells with HIV results in the de novo c~ c~ion of FasL and that FasL m~ t~s HIV-in.1llced apoptosis (Badley, A.D.
et al., J. Virol. 70:199-206 (1996)). Further the TNF-family ligand was detçct~ble in ullil~c~;L~d macrophages and its c~plc3~ion was upregulated following HIV infection resulting in selective killing of uninfected CD4 T-lymphocytes (Badley, A.D et al., J. Virol. 70: 199-206 (1996)). Thus, by the invention, a method for treating HIV+ individuals is provided which involves ~rlmini~t~ring an antagonist of the present invention to reduce selective killing of CD4 T-lymphocytes. Modes of ~mini~tration and dosages are discussed in detail below.
In rejection of an allograft, the imm~lnP system of the recipiçnt animal has not previously been primed to respond because the immlme system for the most part is only primed by environment~l antigens. Tissues from other members of the same species have not been presented in the same way that, for example, viruses and bacteria have been presçnte~l In the case of allograft rejection, immlmo~ .pleS~ive regim~n~ are de~ignPci to prevent the immnne system from reaching the effector stage. However, the immlm.o profile of xenograft rejectionmay resemble disease recu~ ce more that allograft rejection. In the case of disease l~ ce, the immlmP system has already been activated, as evidenced by destruction of the native islet cells. Therefore, in disease leeu~l~llce the i.. ll .. e system is already at the effector stage. Agonist of the present invention W O g7133904 PCTAUS96tl6849 are able to suppress the immlme response to both allografts and xenografts because lymphocytes activated and dirrcr~ ted into effector cells will express the DR3-Vl or DR3 polypeptide, and thereby are susceptible to compounds which enh~nre apoptosis. Thus, the present invention further provides a method for crea.ting immlm~ privileged tissues. Antagonist of the invention can furtherbe used in the tre~tment of Tnfl~mm~t~ry Bowel-Disease.
DR3, like TNFR1, also activates the NF-kB l.,.,~.cc, ;I-tion factor, which is very closely associated with the stim~ ti.nn of cytokine (e.g., IL-8) and adhesion molecule (e.g., ELAM) transcription. Hence, like TNF, the ligand (or agonist) for DR3 and DR3-V1 may in some circ~lm~t~nres be proinfl~mm~tory, and antagonists may be useful reagents for blocking this response. Thus, DR3 and DR3-V1 antagonists may be useful for treating infl~mm~t~ry Aice~s~s~ such as rh~llm~toid arthritis, osteoarthritis, psoriasis, septicemia, and infl~mm~t- ry bowel dlse~e.
In ~dAitio~, due to lymphoblast eA~.c~ion of DR3, soluble DR3, agonist or antagonist mABs may be used to treat this forrn of cancer. Further, soluble DR3 or neutralizing mABs may be used to treat various chronic and acute forms of infl~mm~tion such as rh~- lm~foid arthritis, osteoarthritis, psoriasis, septicemia, and infl~mm~tory bowel disease.

Modes of Administration The agonist or antagonists described herein can be ~Amini.~tered in vitro, ex vivo, or in vivo to cells which express the lccc~tor of the present invention. By . dLion of an "effective amount" of an agonist or antagonist is int~n-le(l an amount of the compound that is sufficient to ~nh~nce or inhibit a cellular response to a TNF-family ligand and include polypeptides. In particular, by ~lmini~tr~tion of an "effective amount" of an agonist or antagonists is int~nAedan amount effective to enh~nce or inhibit DR3-Vl or DR3 meAi~t~d apoptosis.
Of course, where apoptosis is to be enh~n~eA an agonist according to the presentinvention can be co-~Aminict~ored with a TNF-family ligand. One of oldin~y W O 97~3904 PCTrUS96/16849 skill will appreciate that effective amounts of an agonist or antagonist can be ~le,te....il~P(I empiricallyandmaybeemployedinpureformorinph~....~ce~ltically acceptable salt, ester or prodrug form. The agonist or antagonist may be ~rlmini~t~red in co~ osi~ions in combination with one or more ph~rrn~ceutically acceptable excipients.
It will be understood that, when ~rlmini~tered to a human patient, the total daily usage of the compounds and compositions of the present invention will be decided by the ~ttenfling physician within the scope of sound medical jn~gt?m~o-nt The specific th~r~peutically effective dose level for any particular patient will depend upon factors well known in the me~lic~l arts.
As a general proposition, the total ph~nn~e~1ti~11y effective amount of DDCR polypeptide ~lmini~tered p~e~ ally per dose will be in the range of about 1 ~lglkglday to 10 mg/kg/day of patient body weight, although, as noted above, this will be subject to the.a~ulic discretion. More preferably, this doseis at least 0.01 mglkglday, and most preferably for hnm~n~ between about 0.01 and 1 mglkg/day for the h- nnone. If given continuously, the DDCR agonists or antagonists is typically ~ d at a dose rate of about 1 ~lg/kg/hour to about 50 llg/kg/hour, either by 1-4 injections per day or by continuous subcutaneous infusions, for example, using a mini-purnp. An intravenous bag solution may also be employed.
Dosaging may also be arranged in a patient specific manner to provide a pre~letermined conce~k~lion of an agonist or antagonist in the blood, as determined by the RIA technique. Thus patient dosaging may be adjusted to achieve regular on-going trough blood levels, as measured by RIA, on the order of from 50 to 1000 ng/ml, preferably 150 to 500 ng/ml.
ph~rm~Ger1tical compositions are provided comprising an agonist or antagonist and a ph~rm~ceutically acceptable carrier or excipient, which may be ~timini~tered orally, rectally, parenterally, intraci~tem~lly, intravaginally, apeliloneally, topically (as by powders, ointnlent.s, drops or tr~n~derrn~l patch), bucally, or as an oral or nasal spray. Importantly, by co-~lmini~tering an agonist and a TNF-family ligand, clinical side effects can be reduced by using W 0 97/33904 PCTrUS96/16849 lower doses of both the ligand and the agonist. It will be understood that the agonist can be "co-a-lmini~tered" either before, after, or simultaneously with the TNF-farnily ligand, depending on the exigencies of a particular therapeutic applic~tion By "ph~rrn~selltically accept~le carrier" is meant a non-toxic solid, S semisolid or liquid filler, diluent, enrarsu1~ting material or forrn~ tion auxiliary of any type. The term "pale.lL~l~l" as used herein refers to modes of ~rlminictration which include intravenous, h~ cc~ r~ clilollea ACI~ ~ "~31, subcutaneous and i~ icular injection and infusion.
Pharm~reutir~l compositions of the present invention for parenteral injection can comprise ph~rrn~celltically acceptable sterile aqueous or nonaqueous solutions, dispersions, susl)ensions or emulsions as well as sterile powders for l~;co~ l ;on into sterile in~ectable solutions or dispersions just prior to use.
In addition to soluble DR3-V1 or DR3 polypeptides, DR3-V1 or DR3 polypeptide cont~ining the tr~n~m~rnbrane region can also be used when a~plo~l;ately solubilized by including detergents, such as CHAPS or NP:40, with buffer.

Example 1 Expres~:J.. and Purif cation in E. coll The DNA sequence encoding the mature DR3-Vl protein in the deposited cDNA clone (ATCC No. 97456) is ~tnplified using PCR oligonucleotide prirners specific to the arnino tçrrnin~l sequences of the DR3-V1 protein and to vector sequences 3' to the gene. Additional nucleotides cont~ining restriction sites tofacilitate cloning are added to the 5 ' and 3 ' sequences re~e~ ely.
The following primers are used for e~-es~ion of DR3 extracellular domain in ~. coli 5' primer 5'-GCGCCATGGGGGCCCGGCGGCAG-3' (SEQ
ID NO:7) contains an NcoI site and 15 nucleotide starting from 290 nucleotide to 304 FIG. 1. 3' prirner 5'-GCGAAGCTTCTAGGACCCAGAACATCTGCC-3' (SEQ ID NO:8) contains a HindIII site, a stop codon and 18 nucleotides W O 97t33904 PCTrUS96/16849 compliment~ry to nucleotide from 822 to 840 in FIG. 1. Vector is pQE60. The protein is not tagged.
The restriction sites are convenient to restriction enzyme sites in the bacteria} ~ es~ion vector pQE60, which are used for bacterial e~ s~ion in these examples. (Qiagen, Inc. 9259 Eton Avenue, Chatsworth, CA, 91311).
pQE60 ~nrocles ampicillin antibiotic ~ e ("Ampr") and contains a b~ctçri~l origin of replication ("ori"), an IPTG inducible promoter, a ribosome binding site ("RBS").
The amplified DR3-VI DNA and the vector pQE60 both are digested with Nco I and HindIII and the digested DNAs are then ligated together. Insertion of the DDCR protein DNA into the restricted pQE60 vector places the DR3-V1 protein coding region downstream of and operably linked to the vector's IPTG-inducible promoter and in-frame with an initi~tin~ AUG appropllately positioned for translation of DR3-V 1 protein.
The ligation mixture is transformed into co.np~ E. coli cells using standard procedures. Such procedures are described in Sarnbrook et al., Molecular Cloning: a Laboratory Manual, 2nd Ed.; Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. (1989). E. coli strain M15/rep4, co--~;.;..i~-g multiple copies of the plasmid pREP4, which expresses lac repl.,3sor and confers kanamycin rÇcict~nre ("Kanr"), is used in carrying out the illustrative example described herein. This strain, which is only one of many that are suitable for ~A~ S~ g DR3-V l protein, is available commercially from Qiagen.
Tl~l~rul.llants are identified by their ability to grow on LB plates in the presence of ampicillin and kanamycin. Plasmid DNA is isolated from re~is~
colonies and the identity of the cloned DNA confirmed by restriction analysis.
Clones co..~ -g the desired co~ u.;l~ are grown overnight ("O/N") in li~uid culture in LB media supple~nPntec~ with both ampicillin (100 llg/ml) and kanamycin (25 ,ug/ml).
The O/N culture is used to inoculate a large culture, at a dilution of approximately 1: 100 to I :250. The cells are grown to an optical density at 600nm ("OD600") of b~wt;~n 0.4 and 0.6. Isopropyl-B-D-thiogalactopyranoside WO 97/33904 PCTnUS96/16849 ("IPTG") is then added to a final concentration of 1 mM to induce transcription from lac repressor sensitive promoters, by inactivating the lacI repressor. Cells subsequently are incubated further for 3 to 4 hours. Cells then are harvested bycentrifilg~tion and disrupted, by standard methods. Inclusion bodies are purified from the disrupted cells using routine collection techniques, and protein is solubilized from the inclusion bodies into 8M urea. The 8M urea solution co~ t~ g the solubilized protein is passed over a PD-I0 column in 2X
phosphate-buffered saline ~"PBS"), thereby removing the urea, exch~n~ing the buffer and refolding the protein. The protein is purified by a further step of chromatography to remove endotoxin. Then, it is sterile filtered. The sterile filtered protein pr~pdldlion is stored in 2X PBS at a concentration of 95 ~I/ml.

Example 2 Expression in M~ n~t Cells Most of the vectors used for the transient e~ ssion of a given gene sequence in m~mm~ n cells carry the SV40 origin of replication. T-his allows the replication of the vector to high copy numbers in cells (e.g. COS cells) which express the T antigen required for the initiation of viral DNA synthesis. Any other m~mm~ n cell line can also be utilized for this purpose.
A typical m~mm~ n ~ s~ion vector contains the promoter element, which me~ tçs the initiation of transcription of mRNA, the protein coding sequence, and signals required for the termination of transcription and polyadenylation of the llalls~_l;p~. Additional elements include ~?nh~n-~Prs, Kozak sequences and intervening sequences flanked by donor and acceptor sites for RNA splicing. Highly efflcient lldllscl;l~Lion can be achieved with the early and late promoters from SV40, the long tçrrnin~l repeats (LTRs) from Retroviruses, e.g. RSV, HTLVI, HIVI and the early promoter of the cytomegalovirus (CMV).
However, also cellular signals can be used (e.g. human actin, promoter). Suitable ~ rcssion vectors for use in practicing the present invention include, for example, vectors such as pSVL and pMSG (Ph~rrn~ , Uppsala, Sweden), WO 97133904 PCTtUS96/16849 pRSVcat (ATCC 37152), pSV2dhfr (ATCC 37146) and pBC12MI
(ATCC67109). ~ mm~ n host cells that could be used include. human Hela, 283, H9 and Jurkat cells, mouse NIH3T3 and C127 cells, Cos 1, Cos 7 and CV1 African green monkey cells, quail QCl-3 cells, mouse L cells and Chinese hamster ovary cells such as Alternatively, a gene of interest can be ~Aylessed in stable cell lines that contain the gene integrated into a chromosome. The co-transfection with a selectable marker such as dhfr, gpt, neomycin, hy~lol..ycill allows the identification and isolation of the transfected cells.
The transfected gene can also be amplified to express large amounts ofthe encoded protein. The DHFR (dihydrofolate re~-lrt~ce) is a useful marker to develop cell lines that carry several hundred or even several thousand copies ofthe gene of interest. Using this marker, the m~rnm~ n cells are grown in h,.;leasil~g amounts of methotrexate for selection and the cells with the highest rçcict~nre are selecte(l These cell lines contain the amplified gene(s) integrated into a chromosome. Chinese h~m~ter ovary (CHO) cells are often used for the production of proteins.
The ~A~les~ion vectors pCl and pC4 contain the strong promoter (LTR) of the Rous Sarcoma Virus (Cullen et al., Molecular and Cellular Biology 438:44701 (March 1985)), plus a Ldgn,~ ofthe CMV-enhi1"r~ (Boshart et al., Cell 41:521-530 (1985)). Multiple cloning sites, e.g. with the restriction enzyme cleavage sites BamHI, XbaI and Asp718, facilitate the cloning of the gene of interest. The vectors contain in addition the 3' intron, the polyadenylation andtrrrnin~tion signal of the rat pl~loillsulin gene.

Example 2A

E~, c~ /. of ~r~cellular soluble domain of DR3-Vl and DR3 in COS cells The expression plasmid, pDR3-Vl HA, is made by cloning a cDNA
enr.o~ling DR3-V1 (ATCC No. 97456) into the e~ ion vector pcDNAI/Arnp (which can be obtained from Invitrogen, Inc.). Expression pi~miri, pDR3 HA, - CA 02249182 1998-09-11 ~ 9 6 / 1 ~ ~ 4 ~S 14-OCT 1997 is made by cloning a cDNA encoding DR3 (ATCC No. 97757) into the ,iession vector pcDNAI/Amp.
The eA~ression vector pcDNAItamp co~ nC: (1) an E. coli origin of repli~ti~n effective for propagation in E. coli and other prokaryotic cell; (2) an S ~mr:cillin 1e~ A; gene for selection of plasmid-co.. ~S~;oil~g prokaryotic cells;

(3) an SV40 origin of replication for propagation in eukaryotic cells; (4) a CMVplUlllU1:e~, a polylinker, an SV40 intron, and a pol~adc~.~lation signal ~lallg~d so that a cDNA conveniently can be placed under eAplession control of the CMV
promoter and operably linked to the SV40 intron and the polyadenylation signal ~10 by means of restriction sites in the polylinker.A DNA fragJn~nt ~n~ ing the entire DR3-Vl or Dr3 pl~ulsor and a HA
tag fused in frame to its 3' end is cloned into the polylinker region of the vector so that recombinant protein eA~ ssion is directed by the CMV pron~t~.. The HA tag cûll~onds to an epitope derived from the i,.n"...,~ h~...a~ n protein described by Wilson et al., Cell 37:767 (1984). The fusion ofthe HA tag to the target protein allows easy ~letection of the recombinant protein with an antibody that recognizes the HA epitope.
The plasmid construction strategy is as follows:
~ The DR3-Vl or DR3 cDNA of the deposit clone is ~ pl;l;eA using --20 plime~s that collt~hled convenient restriction sites, much as described above regarding the co~hu~;lion of cA~lession vectors for ~ lession of DR3-Vl or DR3 u~E. coli and S. ~giperda.
To facilitate ~tion, pl~rific~tion and ch~ct~ ;on of the eAI,les~d DR3-V1 or DR3, one of the primers CGlllaillS a k- ~ ~a~ gluli~ tag ("HA tag") asdescribed above.
Suitable primers for DR3-Vl include the following, which are used in this example, the 5 ' primer, 5 ' CGCGGATCCGCCATCATGGAGGAGACGCAGCAG 3' (SEQ ID NO:9) contains the und~ ed BamHI site, an ATG start codon and 5 codons the.~
Suitable plilll~,-S for DR3 include the following, which are used in this examp I e, the 5 ' pri mer, 5 ' W O 97~3904 PCTrUS96/16849 CGCGGATCCGCCATCATGGAGCAGCGGCCGCGG 3' (SEQ ID NO:10) cont~in~ the ~lnrl~rlin~d BarnHI site, an ATG start codon and 5 codons thele~rh~.
The 3' primer for both DR3 and DR3-V1, cn~ ;ll;ng the lln~erlinPd Xbal site, stop codon, h~m~gglulillhl tag and last 14 nucleotide of 3' coding sequence (at the 3' end) has the following sequence:
5 'GCGTCTAGATCAAAGCGTAGTCTGGGACGTCGTATGGGTACGGGC
CGCGCTGCA 3' (SEQ ID NO: 11).
The PCR amplified DNA fragment and the vector, pcDNAI/Arnp, are digested with BarnHI and XbaI and then ligated. The ligation ~ ule is transformed into E. coli strain SURE (available from Stratagene Cloning Systems, 11099 North Torrey Pines Road, La Jolla, CA 92037) the transformed culture is plated on arnpicillin media plates which then are incubated to allow growth of ampicillin resistant colonies. Plasmid DNA is isolated from resistant colonies and ç~min--~l by restriction analysis and gel sizing for the presence of the DR3-V1 or DR3-encoding fr?~m.ont ForexpressionofrecombinantDR3-VI orDR3, COS cellsare l~d~lsr~ d with an ~x~iession vector, as described above, using DEAE-DEXTRAN, as described, for in~t~nl~e, in Sambrook et al., Molecular Cloning: a Laboratory Manual, Cold Spring Laboratory Press, Cold Spring Harbor, NY (1989).
Cells are incubated under conditions for expression of DR3-V l or DR3 by the vector.
Expression of the DR3-V1 HA fusion protein or the DR3 HA fusion protein is ~etecte~l by radiolabelling and imml~no~lecipil~lion, using methods described in, for example Harlow et al., Antibodies: a Laboratory Manual, 2nd Ed., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY (1988). To this end, two days after L~ r~;lion~ the cells are labeled by incubation in media C(J~ g 35S-cysteine for 8 hours. The cells and the media are collected, and the cells are washed and then lysed v.~ith detergent-co..~ it-g RIPA buffer: 150 mM
NaCl, 1% NP-40, 0.1% SDS, 1% NP-40, 0.5% DOC, 50 mM TRIS, pH 7.5, as described by Wilson et al. cited above. Proteins are ~l~cipi~led from the cell lysate and from the culture media using an HA-specific monoclonal antibody.

CA 02249182 1998-09-1l ~CT~ 96/ 1684~ ~
AlIJS 14 0CT l99,' The p.oci~ pl'~teillS then are analy~d by SDS-PAGE gels and ~ulul~liography. An e A~,lession product of the eYpected si~ is seen in the cellIysate, which is not seen in negali~,e controls.

Example 2B

S E~cpression and purircation of human DR3-VI and DR3 using the CHO
Expression System ThevectorpCl isusedforthe.,A~,essionofDR3-Vl orDR3 (ATCCNo.
97456 or ATCC No. 97757, rei"~eli~ely) protein. Plasmid pCl is a derivative of the pl~cmid pSV2-dhfr [ATCC A~ccisn No. 37146]. Both pl~cmi~lc contain the mouse DHFR gene under control of the SV40 early plol,lo~l. Chinese h~mcter ovary- or other cells lacking dihydrofolate activity that are l~ r~hd with these pl~cmi~c can be sçlected by ~ing the cells in a selective medium (alpha minus MEM, Life Technologies) suppl~ ~ with the chemotk. .,.~
agent methol.~Aate. The amplification of the DHFR genes in cells resistant to metholl~Aale (MTX) has been well ~oc~ ed (see, e.g., Alt, F.W., Kçlleme, R.M., Bertino, J.R., and Srhimkç, R.T., 1978, J. Biol. Chem. 253:1357-1370, - " Hamlin, J.L. and Ma, C. 1990, Biol~h~m et Biophys. Acta, 1097:107-143, Page, M.J. and Syd~--.h~-.. M.A. 1991, Biotechnology Vol. 9:64 68). Cells grown in iDClell~llg con~ ;one of MTX develop reCiet~n~e to the drug by o~ g the target e~ lc, DHFR, as a result of amplification of the DHFR gene. If a second gene is linked to the DHFR gene it is usually co-~mplifie l and over cA~lesxd. It is state of the art to develop cell lines carrying more than 1,000 copies of the genes. Subsequently, when the mlo,thol~A~le is withdrawn, cell lines contain the amplified gene integrated into the chromosome(s).
Plasmid pC 1 co-l~ins for the eAI,lession of the gene of interest a strong promoter of the long t~min~l repeat (LTR) of the Rous Sarcoma Virus (Cullen, et al., Molecular and Cellular Biology, March 1985:438-4470) plus a fragment isolated from the enh~ncçr of the immç~ t.o early gene of human ~DED~r wO 97/33904 PCT/US96/16849 cy~orn~g~lQvirus (CMV) (Boshart et al., Cell 41:521-530, 1985). Downstream of the promoter are the following single restriction enzyme cleavage sites that allow the integration of the genes: BarnHI followed by the 3' intron and the polyadenylation site ofthe rat ~ )loil1sulin gene. Other high efficient promoters can also be used for the e~lession, e.g., the human ~-actin promoter, the SV40 early or late promoters or the long tennin~l repeats from other retroviruses, e.g., HIV and HTLVI. For the polyadenylation of the mRNA other signals, e.g., from the human growth hormone or globin genes can be used as well.
Stable cell lines carrying a gene of interest integrated into the chromosomes can also be selected upon co-transfection with a selectable marker such as gpt, G418 or hygromycin. It is advantageous to use more than one selectable marker in the be~ g, e.g., G418 plus methotrexate.
The plasmid pC 1 is digested with the restriction enzyme BamHI and then derhl sphnrylated using calf ;-.~ l phos~ by procedures known in the art.
The vector is then isolated from a 1% agarose gel.
The DNA sequence enro-ling DR3-V1 or DR3 in the deposited cDNA
clones are amplified using PCR oligonucleotide primers specific to the amino acid carboxyl t~nnin~l sequence of the DR3-VI or DR3 protein and to vector sequences 3' to the gene. Additional nucleotides cont~ining restriction sites tofacilitate cloning are added to the 5' and 3' sequences respectively.
The 5' oligonucleotide primer for DR3-VI has the sequence 5' CGCGGATCCGCCATCATGGAGGAGACGCAGCAG 3' (SEQ ID NO:12) conL~ -g the underlined BamHI restriction site, which encodes a start AUG, followed by the Kozak sequence ad 18 nucleotides of the DR3-VI coding sequence set out in FIG. I beginnin~ with the 1st base of the ATG codon.
The S' oligonucleotide prirner for DR3 has the sequence 5' CGCGGATCCGCCATCATGGAGCAGCGGCCGCGG 3' (SEQ ID NO:13) con~ the underlined BarnHI restriction site, which encodes a start AUG, followed by the Kozak sequence ad 18 nucleotides of the DR3 coding sequence set out in FIG. 2 beginning with the 1st base of the ATG codon.

wo 97/33904 PCT/USg6/16849 The 3' primer for both DR3 and DR3-Vl has the sequence 5' CGCGGATCCTCACGGGCCGCGCTGCA 3' (SEQ ID NO: 14~ co..~ g the lmt~.orlint?d Bam~ restriction site followed by 17 nucleotides complem~nt~ry to the last 14 nucleotides of the DR3-Vl or DR3 coding sequence set out in FIG. l or FIG. 2, respectively, plus the stop codon.
The restrictions sites are convenient to restriction enzyme sites in the CHO e~lc;s~ion vectors pCl.
The arnplified DR3 or DR3-Vl DNA and the vector pCl both are ~1i~ste~
with BamHI and the digested DNAs then ligated together. Insertion of the DR3-Vl or DR3 DNA into the BamHI restricted vector placed the DR3-Vl or DR3 coding region dowl~ l of and operably linked to the vector's promoter. The sequence of the inserted gene is confinned by DNA sequencing.

Transfection of CNO-DHFR-cells Chinese h~--sl~,. ovary cells lacking an active DH~R enzyme are used for transfection. 5 ~,lg of the ~ ,s~ion plasmid C 1 are coLldllsr~cted with 0.5 llg of the plasmid pSVneo using the lipofecting method (Felgner et al., supra). The pl~emi~l pSV2-neo contains a do....nA..I selectable marker, the gene neo from Tn5 encoding an enzyme that confers reeietAn~e to a group of antibiotics including G418. The cells are seeded in alpha minus MEM suppl~m~nt~d with 1 mg/ml G418. After 2 days, the cells are tryy~ 7~d and seeded in hybridoma cloning plates (Greiner, Gcllll~ly) and cultivated from 10-14 days. After this period, single clones are ~ sil~iGed and then seeded in 6-well petri dishes using dirr~Le.
concentrations of methotrexate (25 nM, 50 nM, 100 nM, 200 nM, 400 nM).
Clones growing at the highest cr~ P~ .I ;nns of methotrexate are then l~ rL .~,dto new 6-well plates co. .~ g even higher concentrations of methullc~ (500 nM, 1 ~lM, 2 ~M, 5 ~lM). The same procedure is repeated until clones grow at a concentration of 100 ~M.
The t;~l~,s~ion of the desired gene product is analyzed by Western blot analysis and SDS-PAGE.

CA 02249182 1998-09-11 ~ 9 6 / 1 6 ~ ~

Example 3 Cloning and expression of the soluble ~.tr 7rellular do~nain of DR3-VI and DR3 in a baculovirus expression system The cDNA s~u~ ce Pnl~ing the soluble eALIacellular domain of DR3-Vl or DR3 protein in the deposited clone (ATCC No. 97456 or ATCC No.
97757, ~e.,~,lively) is ~mplified using PCR oligonl~cleQtide l,lhue.
co,l~,s~wnding to the 5' and 3' sequences of the gene:
The 5' primer for DR3-Vl has the sequence 5' CGCGGATCC
~J GCCATCATGGAGGAGACGCAGCAG 3' (SEQ ID NO:15) co.. ~ g the underlined BamHI restriction e~ e site followed by Kozak sequence and a number of bases of the sequence of DR3-V1 of FIG. 1. Inserted into an t;Al,reision vector, as described below, the 5' end of the ~mplifiçd fragment enco~ing DR3-Vl provides an efficient signal peptide. An effi~i~nt signal for initiation of translation in eukaryotic cells, as described by Kozak, M., ~ Mol.Biol. 196:947-950 (1987) is a~pro~,l;ately located in the vector portion of the construct.
The 5' prirner for DR3 has the se~lu.,~ce 5' CGCGGATCC
GCCATCATGGAGCAGCGGCCGCGG 3' (SEQ ID NO:16) co.~ ;ni.~ the lln-ierlin~d BamHI restriction ~ uc site followed by Kozak sequence and a .. ~ of bases of the sequence of DR3 of FIG. 2. Inserted into an eA~ sion vecu~ii described below, the 5' end of the arnplified L~uc.lt encoding DR3 provide~ an effici~lt signal peptide. An efficient signal for initi~tion of n in euk~ryotic cells, as described by Kozak, M., ~ Mol. Biol. 196:947-950 (1987) is approp,;ately located in the vector portion of the construct.
The 3' primer for both DR3 and DR3-Vl has the s~u~.lce 5' GCGAGATCTAGTCTGGACCC AGAACATCTGCCTCC 3' (SEQ ID NO: 17) cont~inin~ the lln~rlin~d XbaI restriction followed by nucleotides con~ nt~y to the DR3-V 1 or DR3 nucleotide se~u~,nce set out in FIG. 1 or FIG.2, r~ ely~ followed by the stop codon.

~130~

CA 02249182 1998-09-ll W O 97~3904 PCTnUS96/16849 The arnplified fragment is isolated from a 1% agarose gel using a commercially available kit ("Geneclean, " BIO 101 Inc., La Jolla, Ca.) The fragment then is digested with BarnHI and Asp718 and again is purified on a 1%
agarose gel. This fragment is design~ted herein F2.
The vector pA2 is used to express the DR3-VI or DR3 protein in the baculovirus ex~l~ssion system, using standard methods, such as those described in Summers et al., A Manual of Methods for Baculovirus Vectors and Insect Cell Culture Procedures, Texas Agricultural Ex~.ill,ental Station Bulletin No. 1555 (1987). This e~pres~ion vector contains the strong polyhedron promoter ofthe Autograph californica nuclear polyhedrosis virus (ACMNPV) followed by convenient restriction sites. For an easy selection of recombinant virus the beta-galactosidase gene from E. coli is inserted in the same orientation as the polyhedron promoter and is followed by the polyadenylation signal of the polyhedron gene. The polyhedron sequences are flanked at both sides by viral sequences for cell-mediated homologous recombination with wild-type viral DNA to generate viable virus that express the cloned polynucleotide.
Many other baculovirus vectors could be used in place of pA2, such as pAc373, pVL941 and pAcIM1 provided, as those of skill readily ~vill appreciate, that construction provides ~plopliately located signals for transcription, translation, trafficking and the like, such as an in-frame AUG and a signal peptide, as required. Such vectors are described in Luckow et al., Virology 170:31-39, among others.
The plasmid is digested with the restriction enzymes Bam HI and XbaI
and then is dephosphorylated using calf intestin~l phosph~t~se, using routine procedures known in the art. The DNAis then isolated from a 1% agarose gel using a colllll,crcially available kit ("Geneclean" BIO 101 Inc., La Jolla, Ca.).
This vector DNAisdeci~n~ted herein "V2".
Fragment F2 and the dephosphorylated pl~mid V2 are ligated together with T4DNA ligase. E. coli HB101 cells are transformed with ligation mix and spread on culture plates. Bacteria are id~ntifiPd that contain the pl~mid with the human DDCR gene by digesting DNA from individual colonies using BamHI and , CA 02249182 1998-09-ll 4 PCTrUS96/16849 XbaI and then analyzing the digestion product by gel electrophoresis. The sequence of the cloned fragrnent is co~ ,ed by DNA seqU~nring This plasmid is ~lçsign~ted herein pBac DR3-V1 or pBac DR3.
S ~lg of the plasmid pBac DR3-V 1 or pBac DR3 is co-transfected with 1.0 ~g of a commercially available linearized baculovirus DNA ("BaculoGoldTM
baculovirus DNA", Ph~rmingen, San Diego, CA.), using the lipofection method described by Felgner et al., Proc. Na~l. Acad. Sci. USA 84:7413-7417 (1987).
1 ~g of BaculoGoldTM virus DNA and S llg of the plasmid pBac DR3-V1 are mixed in a sterile well of a microliter plate cc ~ g 50 ~11 of serum free Grace's medium (Life Technologies Inc., Gaithersburg, MD). Afterwards 10 Lipofectin plus 90 ,ul Grace's merli~lm are added, mixed and incubated for 15 minllt~s at room telllpc;l~ule. Then the transfection mixture is added drop-wiseto Sf9 insect cells (ATCC CRL 1711) seeded in a 35 mm tissue culture plate with 1 ml Grace's medium without serum. The plate is rocked back and forth to mix the newly added solution. The plate is then inc~bat~d for S hours at 27~C. After5 hours the transfection solution is removed from the plate and 1 ml of Grace's insect medium suppl~-n~Pnted ~,vith 10% fetal calf serum is added. The plate is put back into an incubator and cultivation is continued at 27~C for four days.
After four days the supern~t~nt is collected and a plaque assay is pc;lrol~lled, as described by Summers and Smith, cited above. An agarose gel with "Blue Gal" (Life Technologies Inc., Gaithersburg) is used to allow easy idçntifiç~tion and isolation of gal-~ e;.sing clones, which produce blue-stainedplaques. (A detailed description of a "plaque assay" of this type can also be found in the user's guide for insect cell culture and baculovirology distributed by Life Technologies Inc., Gaithersburg, page 9-10).
Four days after serial dilution, the virus is added to the cells. After app~ ;ate incubation, blue stained plaques are picked with the tip of an Eppendorf pipene. The agar co~ g the recombinant viruses is then resuspended in an Eppendorf tube cn~t~ it-g 200 ~,11 of Grace's medium. The agar is removed by a brief centrifugation and the SU~ tCO~ g the recombinant baculovirus is used to infect Sf9 cells seeded in 35 mm dishes. Four wo 97133904 PCT/US96/16849 days later the s~ of these culture dishes are harvested and then they are stored at 4~C. A clone co-ll;~;..;,~g pro~ ly inserted DR3-Vl or DR3 is identified by DNA analysis including restriction mapping and sequencing. This is deci~:n~te~ herein as V- DR3-Vl or V-DR3.
Sf9 cells are grown in Grace's medium supplemented with 10% heat-inactivated FBS. The cells are infected with the recombinant baculovirus V-DR3-Vl at a multiplicity of infection ("MOI") of about 2 (about l to about 3).
Six hours later the mediurn is removed and is replaced with SF900 II medium minus methionine and cysteine (available from Life Technologies Inc., Gaithersburg). 42 hours later, 5 gCi of 35S-methionine and 5 IlCi 35S cysteine (available from Amersham) are added. The cells are further incubated for 16 hours and then they are harvested by centrifugation, lysed and the labeled proteins are vi~ li7~cl by SDS-PAGE and autoradiography.

Example 4 A. Tissue distri~ution of DR3-Vl gene ~ ion Northern blot analysis is carried out to examine DR3-V l gene (ATCC
No. 97456) ~ e;~ion in human tissues, using methods described by, among others, Sambrook et al., cited above. A cDNA probe cont~inin~ the entire nucleotide se~uence of the DR3-VI protein (SEQ ID NO: 1) is labeled with 32p using the rediprimeTM DNA labeling system (Arnersham Life Science), according to m~nllf~cturer's instructions. After labeling, the probe is purified using a CHROMA SPIN-100TM column (Clontech Laboratories, Inc.), according to m~nl-f~cturer's protocol number PT1200-l. The purified labeled probe is then used to examine various human tissues for DR3-V1 mRNA.
Multiple Tissue Northern (MTN) blots c(~ illg various human tissues (H) or hurnan immune system tissues (IM) are obtained from Clontech and are ç~minecl with labeled probe using ExpressHybTM hybridization solution (Clontech) according to m~nt~turerls protocol number PT1190-1. Following CA 02249182 1998-09-11 ~L1-.

_59_ hybn~ and washing, the blots are mounted and exposed to film at -70~C
overnight and films developed accorditlg to standard procedures Expression of DR3-V1 was detecte~ in tissues ~ ~.. ;ehed in l~ )ho~i~s inçhl~ling ~,;phe.dlblood leukocytes (PBLs), thymus, spleen, colon, and small il~tÇ~ DR3-V1 S ~;AI,lesi,ion appears to be restricted to lymphocyte colllp~llllents, it can be envisaged that DR3-V 1 plays a role in lymphocyte h B. Tissue dis ribution of DR3 gene expression Northern blot analysis is carried out to Ç-A~ DR3 gene (ATCC No.
97757) ~ Ayles~;on in human tissues, using mçth~ described by, among others, Sambrook et al., cited above. A cDNA probe co~ ;ng the entire nucleotide sequence of the DR3 protein (SEQ ID NO:1) is labeled with 32p using the rediprimeTM DNA labeling system (A ~ l~.l Life Science), accordil~g to mPmlfP-~*Irer~s instructions. After iPbeling~ the probe is purified using a CHROMA SPIN-1001M column (Clontech Laboldlol;es, Inc.), accolding to mPm~f~ct ~rer's protocol number PT1200-1. The purified labeled probe is then used to c~ various human tissues for DR3 mRNA.
Multiple Tissue Northern (MT ) blots cn..~ v various human tissues (H) or human ;~ r system tissues (IM) are obtained from Clontech and are r~ with labeled probe using ExpressHyblM hybri(ii7~tiQn solution (Clo~ooh) according to m~nllf~ct lrer's protocol number PT1190-1. Following hybl;di~ation and washing, the blots are mounted and exposed to film at -70~C
overnight~ and films developed according to standard plocedu~es.
Expression of DR3 was cletectecl in tissues enrichçd in lymphocytes in~lu ling ~ ;ph-~ blood leukocytes (PBLs), thymus, spleen, colon, and small intçstine By cO~ d~l, TNFR-1 is ubiquitously ~A~lessed and Fas/APO-1 is t;Aplessed in lymphocytes, liver, heart, lung, kidney, and ovary (W~t~n~b~e-F..h.n~ etal., J. Immunol 148:1274-9 (1992)).
DR3 eA~ s~ion appears to be restricted to lymphocyte colllp~ , it can be envisaged that DR3 plays a role in lymphocyte homços~

W O 97~3904 PCTrUS96/16849 C. Nor~hern Blot analysis of DR3 in various ceU lines Methods Cells Unless stated otherwise, cell lines were obtained from the American Type Culture Collection (Rockville, MD). The myeloid (Koeffler et al. (1980);
Koeffler (1983); Harris and Ralph (1985); and Tucker et al. (1987) and B-cell lines (Jonak et al. (1922)) studied l~plcselll cell types at different stages of the differentiation pathway. KGla and PLB 985 cells (Tucker et al. (1987)) were obtained from H.P. Koeffler (UCLA School of Medicine). BJA-B was from Z.
Jonak (SmithKline Beecham). TF274, a stromal cell line exhibiting osteoblastic features, was generated from the bone marrow of a healthy male donor (Z. Jonak and K.B. Tan, unpublished). Primary carotid artery endothelial cells were purchased from Clonetics Corp. (San Diego, CA) and monocytes were yl~yaled ~ by dirr~ ial centrifugation of y~,~iyhtl~l blood mQnon~ r cells and adhesion to tissue culture dish. CDI9+, CD4+ and CD8+ cells (>90% pure) were isolated with cell type specific immunomagnetic beads (Drynal, Lake Success, NY).

RNA Analysis Total RNA of adult tissues were purchased from Clonetech (Palo Alto, CA). Total RNA was extracted from cell lines (in exponential growth phase) and primary cells with TriReagent (Molecular Research Center, Inc., Cin~inn~ti, OH).S to 7.5 ~lg of total RNA was fractionated in a 1% agarose gel co~ g formaldehyde cast in a Wide Mini-Sub Cell gel tray (Bio-Rad, Hercules, CA) as described (Sambrook, et al.) with slight modifications. The formaldehyde concentration was reduced to 0.5M and the RNA was stained prior to electrophoresis with 100 ~,lg/ml of etidium bromide that was added to the loading buffer. After electrophoresis with continuous buffer recirculation (60 volts/90 min), the gel was photographed and the RNA was transferred quall~iL~lively to Zeta-probe nylon menlblalle (Biorad, Hercules, CA) by vacuum-blotting with 25 CA 02249l82 l998-09-ll W O 97/33904 PCTrUS96/16849 mM NaOH for 90 min. After ne~ li7~tion for 5- 10 min, with 1 M Tris-HCl, pH
7 5 co..~ g 3M NaCI, the blots were prehybridized with 50% formarnide, 8%
dextran sulfate, 6xSSPE, 0.1% SDS and 100 llg/ml of sheared and denatured salmon sperm DNA for at least 30 min at 42~C. cDNA inserts labeled with 32P-dCTP by random priming (Stratagene, La Jolla, CA), were denatured with 0.25M NaOH (10 min at 37~C) and added to the prehybridization solution. After 24-65 hr at 42~C, the blots were washed under high stringency conditions (Sarnbrook, et al.) and exposed to X-ray films.

Results Expression of DR3 was accessed by Northern blot in the following cell lines: TF274 (bone marrow stromal); MG63, TE85 (osteosarcoma); K562 (erythroid); KGla, KGl, PLB985, HT.60, U937, TNHP-l (myeloid); REH, BJAB, Raji, IM-9 (B cell); Sup-T1, Jurkat, H9, Molt-3 (T cell); RL95-2 (endometrial carcinoma); MCF-7 (breast cancer); BE, HT29 (colon cancer);
lS IMR32 (neuroblastoma) and could only be detected in KGla cells. DR3 expression was detected in several Iymphoblast cell lines. In the purified humanhematopoietic cell populations, DR3 was weakly expressed in CD19+ cells, and more highly ~ cssed in monocytes. However the highest levels were observed in T cells (CD4+ or CD8+) upon stim~ tion with PMA and PHA, indicahng that DR3 probably plays a role in the regulation of T cell activation.

Example S

Intrneel/ul(.~r Signaling Molee~-le~ used by DR3 Protein In vitro and in vivo binding studies were undertaken to investigate DR3 sign~ling pathways. Since DR3 contains a death domain, the inventors postulated that DR3, like TNFR-l and Fas/APO-I, may tr~n~d~lce signals by lec~uiLing death domain-co,~ g adapter molecules (DAMs) such as FADD, TRADD, and RIP.

wo g7/33904 P~/US96116849 EJ~L~ / DeSign In vitro binding experimçntc were performed as described previously (A.M. Chinnaiyan, et al., Cell 81, 505-12 (1995); M.P. Boldin, et al., J Biol Chem 270, 7795-8 (1995); F.C. Kischkel. et al., EMBO 14, 5579-5588 (1995)).
S Briefly, the cytoplasmic clom~inc of DR3 (amino acid residues 215-393 (Figure 2)) and the death domain mutant aDR3 (amino acid residues 215-321 (Figure 2)) were amplified by PCR using a~ opliate templ~tes and primers into pGSTag.
pGSTag and pGSTag-TNFR-l were described previously (A.M. Chinnaiyan, et al., Cell 81, 505-12 (1995); M.P. Boldin, et al., JBiol Chem 270, 7795-8 (1995);F.C. Kischkel, et al., EMBO 14, 5579-5588 (1995)). GST and GST fusion proteins were p~,~ed from E.coli strain BL21(DE3)pLysS using standard published procedures and the recombinant proteins immobilized onto glutathione-agarose beads. 35S-Eabeled FADD, RIP and TRADD were ple~)ared by in vitro transcription-translation using the TNT or T7 or SP6-coupled reticulocyte lysatesystem from Promega according to m~nllf~etllrer's instructions, using pcDNA3 AU1-FADD (A.M. Chinnaiyan, et al., Cell 81, 505-12 (1995); M.P. Boldin, et al., JBiol Chem 270, 7795-8 (1995); F.C. ~i~çhk~l, et al., ~MBO 14, 5579-5588 (1995)), pRK myc-TRADD (H. Hsu, et al., Cell 81, 495-504 (1995)), or pRK
myc-RIP (H. Hsu, et al., Immunity 4, 387-396 (1996)) as template. Following tr~n~l~tinn, equal amounts oftotal 35S-labeled reticulocyte Iysate were diluted into 150 ~11 GST binding buffer (50 mM Tris, pH 7.6, 120 mM NaCl, 1% NP-40) and incubated for 2 hrs. at 4~C with the various GST fusion proteins complexed to beads, following the beads were pelleted by plus centrifugation, washed three times in GST buffer, boiled in SDS-sample buffer and resolved on a 12.5% SDS-PAGE. Bound proteins were visualized following autoradioraphy at -80~C. In vitro tr~n~l~tçd 35S-labeled RIP, TRADD and FADD were incubated with glutathione beads co..L~ lg GST alone or GST fusions of the cytoplasmic domain of Fas, TNFR-l,DR3 (215-393), or DDR3 (215-321). After the beads were washed, retained proteins were analyzed by SDS-PAGE and autoradiography. The gel was Coomassie stained to monitor equivalency of loading.

CA 02249182 1998-09-ll To demonstrate the association of DR3 and TRADD in vivo, constructs encoding Flag-TNFR-l and Flag-~\TNFR-l were used. The Flag-TNFR-l and Flag-/~TNFR-l constructs were described elsewhere (A.M. Chinnaiyan, et al.. J
Biol Chem 2 7I, 4961 -4965 (1996)). The constructs encoding Flag-TNFR- l and S Flag-/~TNFR-l were described elsewhere (A.M. Chinnaiyan, et al., JBiol Chem 271, 4961-4965 (1996)). To f~r,ilit~te epitope t~gging, DR3 and 1~DR3 (1-321) were cloned into the IBI Kodak FLAG plasmid (pCMVlFLAG) ntili7.in~ the signal peptide provided by the vector. 293 cells (2 x 10~/1OOmm plate) were grown in DMEM media cont~ining 10% heat-inactivated fetal bovine serurn co.. L;~ g penicillin G, streptomycin, glut:lmin~7 and non-essenti~l amino acids.
Cells were L~ fe~ d using calcium pll- s~,h~te pfeci~ Lion with the constructs encoding the intlie~ted proteins in combination with pcDNA3-CrmA (M. Tewari, et al., JBiol Chem 270, 3255-60 (1995)) to prevent cell death and thus m~int~in protein e~iession. Cells were Iysed in 1 rnl lysis buffer (50mM Hepes, 150mM
NaCl, lmM EDTA, 1% NP-40, and a pfotease inhibitor cocktail). Lysates were imml-n- plecipiL~ed with a control monoclonal antibody or anti-Flag antibody forat least 4 hrs, at 4~C as previously described (A.M. Chinnaiyan, et al., JBiol Chem 271, 4961-4965 (1996)). Tne beads were washed with Iysis buffer 3X, but int he case of TRADD binding, the NaCl conce,lL~alion was adjusted to lM. The p,~;cipil~l~s were fractioned on 12.5% SDS-PAGE and l~ r~led to nitrocellulose. Subsequent Western blotting was pe.roll"ed as described elsewhere (H. Hsu et al., Cell 84, 299-308 (1996); Chinnaiyan, A.M. et aL, JBiolChem 271, 4961-4965 (1996)). After 24-32 hrs, extracts were p~ d and immlmnpreci~i~led with a control monoclonal antibody or anti-Flag monoclonal antibody (IBI Kodak). Western analysis indicated that myc-TRADD and death receptor ~ es~ion levels were similar in all samples. Copreci~ ing myc-TRADD was detected by imm-l~oblotting using an anti-myc HRP
conjugated antibody (Boehringer ~nnh~im).

wO 97/339W PCT/US96/16849 Results As an initial screen, in vitro tr~ncl~tecl radiolabeled DAMs were i~ ed with various glutathione S-transferase (GST) fusion proteins immobilized on glutathione-Sepharose beads. As predicted from previous studies S (A.M. Chinnaiyan, et al., Cell 81, 505-12 (1995); M.P. Boldin, et al., J Biol Chem 270, 7795-8 (1995); F.C. Kischkel, et al., EMBO 14, 5579-5588 (1995);
H. Hsu, et al., Cell 81, 495-504 (1995)), FADD associated with the GST-Fas cytoplasmic domain while TRADD associated with the GST-TNFR-1 cytoplasmic domain. In addition, there was a direct, albeit weak, interaction between RlP and GST-TNFR-l. Interestingly, GST-DDCR associated specific~lly with TRADD, but not FADD or RIP. Furthermore, a truncated death domain mutant of DR3 (GST-DDR3) failed to interact with TRADD. To demonstrate the association of DR3 and TRADD in vivo, 293 cells were transiently transfected with plasmids that direct the synthesis of myc-epitope tagged TRADD (myc-TRADD) and Flag-epitope tagged DR3 (Flag-DR3), Flag-TNFR-1 or lllu~ls. Con~ictent with the in vitro binding study, TRADD
specific~lly co~l~ci~ l with DR3 and TNFR-1, but not with the death domain ",~ , DDR3 and DTNFR-1. Thus, it appears that DR3, like TNFR-1, may activate downstream sign~iing c~cc~3Ps by virtue of its ability to recruit the adapter molecule TRADD.
Ov~ ion of TRADD induces apoptosis and NF-kB activation-two ofthe most ~ t activities si~ by TNFR-1 (H. Hsu, et al., Cell 81,495-504 (1995)). Upon oligomerization of TNFR-1 by trimeric TNF, TRADD is recruited to the lecelJtor ~ign~ling complex (H. Hsu, et al., Cell 84, 299-308 (1996)). TRADD can then recruit the following signal tr~n~ cing molecules:
1) TRAF2, a TNFR-2- and CD40 - ~csoGi~t~(l molecule (M. Rothe, et al., Cell 78, 681-92 (1994); M. Rothe, et al., Science 269, 1424-1427 (1995)), that mP~ tes NF-kB activation, 2) RIP, originally identified as a Fas/APO-1-interacting protein by two-hybrid analysis (B.Z. Stanger, et al., Cell 81, 513-23 (1995)), that mediates NF-kB activation and apoptosis (H. Hsu, et al., Immunity 4, 387-396 (1996)), and 3) FADD, a Fas/APO-1- associated molecule, that mediates Wo 97/33904 Pcr/uS96tl6849 apoptosis (A.M. Chinnaiyan, et al., Cell 81, 505 12 (1995); M.P. Boldin, ef al.,J. Biol C~em 270, 7795-8 (1995); F.C. Kischkel, et al., EMBO 14. 5579-5588 (1995)). Thus, the inventors demonstrate that RIP, TRAF2 and FADD could be co-imml-n~ ciyil~t~d with DR3. In 293 cells expressing DR3 and RIP, only a weak association could be detected between the two molecules. However, in the presence of TRADD, RIP association with DR3 was ~i~nific~ntly enh~nce-l Likewise, very little TRAF2 directly co-~ ecipi~aled with DR3 in 293 cells.
However, when DR3 and TRAF2 were ~I,lessed in the presence of TRADD and RIP (both of which can bind TRAF2), an enh~nred binding of TRAF2 to DR3 could be desecte~l A similar association between FADD and DR3 was also observed. In the presence of TRADD, FADD efficiently coprecipitated with DR3.
Previous studies demonstrated that FADD could recruit the ICE/CED-3-like ~otease FLICE to the Fas/APO-1 death indllcinE ~iEn~linE
complex (M. Muzio, ef al., Cell 85, 817-827 (1996); M.P. Boldin, et al., Cell 85, 803-815 (1996)). To demonstrate that FLICE can associate with TNFR-1 and DR3, co,oleci~ ion experiments in 293 cells were carried out. Interestingly, FLICE was found co"l,~lcAed to TNFR-l and DR3. Co-transfection of TRADD
and/or FADD failed to çnh~nce the FLICE-TNFR-l/DR3 interaction, suggesting that endogenous amounts of these adapter molecules were sufficient to m~int~in this association.

Example 6 DR3 InducedApoptosis and NF-kB Activntion Ove~ ion of Fas/APO-1 and TNFR-1 in m~mm~ n cells mimics receptor activation (M. Muzio, et al., Cell 85, 817-827 (1996); M. P. Boldin, etal., Cell 85, 803-815 (1996)). Thus, this system was utilized to study the functional role of DDCR. ~ctopic expression of DR3 in MCF7 breast carcinoma cells and 293 human embryonic kidney cells in~llcerl rapid apoptosis.

W O 97/33904 PCTrUS96/16849 E~ / Design Cell death assays were perforrned essentially as previously described (A.M. Chinnaiyan, et al., Cell 81, 505-12 (1995); M.P. Boldin, et al., JBiol Chem 270, 7795-8 (1995); F.C. Ki~.~çhkel, etal., EMBO 14, 5579-5588 (1995);
A.M. Chinnaiyan, et al., JBiol Chem 271, 4961-4965 (1996)). Briefly, MCF-7 human breast carcinoma clonal cell lines stably transfected with either vector alone, a CrmA e~ es~ion construct (M. Tewari, et al., JBiol Chem 270, 3255-60 (1995)), or FADD-DN expression construct (A.M. Chinnaiyan, et al., J Biol Chem 271, 4961-4965 (1996)) were transiently transfected with pCMV-~-galatosidase in the presence of a ten-fold excess of pcDNA3 ~x~uression constructs encoding the indicated proteins using lipofectamine (GIBCO-BRL,).
293 cells were likewise transfected using the CaPO4 method. The ICE family inhibitor z-VAD-fmk (Enzyme Systems Products, Dublin, CA) was added to the cells at a concentration of IO~lM, 5 hrs after transfection. 32 hours following transfection, cells were fixed and stained with X-Gal as previously described (A.M. Chinnaiyan, et al., Cell 81, 505-12 (1995); M.P. Boldin, et al., J Biol Chem 270, 7795-8 (1995); F.C. Ki~çhk~l, et al., EMBO 14, 5579-5588 (1995)).
The data (mean +/- SD) shown are the perce~ ge of round blue cells among the total nurnber of blue cells counted. Data were obtained from at least three independent experiments.
NF-kB luciferase assays were l)elro,llled as described elsewhere (H. Hsu, et al., Immunity 4, 387-396 (1996); M.D. Adams, et al., Nature 377, 3-174 (1995); G.S. Feng, et al., JBiol Chem 271, 12129-32 (1996); M. Rothe, et al., Cell 78, 681-92 (1994); M. Rothe, e~al., Science 269, 1424-1427 (1995); (A.M.
Chinnaiyan, et al., JBiol Chem 271, 4961-4965 (1996)). Briefly, 293 cells were co-transfected by calcium phosphate precipitation with pCMV-,B-galactosidase, E-selectin-luciferase lCpOLIcl gene (M. Rothe, et al., Cell 78, 681-92 (1994); M.
Rothe, et al., Science 269, 1424-1427 (1995)), the indicated death receptors. and the indicated dominant negative inhibitors. In addition, DR3 or DDR3 was cotransfected with the pT ~ntern ~xl~es~,ion construct (GIBCO-BRl) which encodes green fluolcsccll~ protein (photographic inset). Cells were visualized by fluorescence microscopy using a FITC range barrier filter cube. Nuclei of transfected cells were vi~ i7Pd by DAPI staining and the image overlaid. (Cell death assays were pc~r~ led P~sPnti~lly as previously described (Chinnaiyan, et al., Cell 81:505-12 (1995); Boldin, et al., J. Biol. Chem. 270:7795-8 (1995);
Ki~rhkel, et al., EMBO 14:5579-5588 (1995)); (Chinnaiyan, et al., J. Biol. Chem.271:4961-4965 (1996)). The dominant negative inhibitors were used at a 4-fold higher quantity than the death receptors. Total DNA was kept constant.
To show that DR3 induces NF-kB activation which is inhibitable by RIP-DN(Stanger,etal., Cell81:513-23(1995))andTRAF2-DN(Hsu,etal. Cell 81:495-504 (1995)); (Rothe, etal., Cell 78:681-92 (1994); Rothe, etal. Science 269:1424-1427 (1995)), 293 cells were co-transfected with the indicated molecules and an NF-kB luciferase reporter plasmid (Rothe, et al., Cell 78:681 -92 (1994); Rothe, et al. Science 269:1424-1427 (1995)) and luciferase activitiessubsequently d~t~ NF-KB luciÇ~l~se assays were performed as described elsewhere ((Hsu, et al., Immuni~y 4:387-396 (1996)); (Adams, et al., Nature 377:3-174 (1995); Feng, et aL, J. Biol. Chem. 271:12129-32 (1996)); (Rothe, et al., Cell 78:681-92 (1994); Rothe, et al. Science 269:1424-1427 (1995));
Chinnaiyan, et al., ~ Biol. Chem. 271:4961 -4965 (1996)). Briefly,293 cells wereco-transfected by calcium phosphate ~ ;ci~ tion with pCMB-~-galactosidase, E-selectin-luciferase lepoll~, gene (Rothe, ef al., Cell 78:681-92 (1994); Rothe, et al. Science 269:1424-1427 (1995)), the indicated death receptors, and the in-iicated dolllillall~ negative inhibitors. The dominant negative inhibitors were used at a 4-fold higher quantity than the death receptors. Total DNA was kept constant. R~ es~ ive ~cfl~llent pclrolllled in duplicate three independent times (mean + SD).

Resuhfs The cells displayed morphological alterations typical of cells undergoing apoptosis, becoming rounded, con-lPneed and dPt~.hing from the dish. In MCF7 cells, plasmids encoding full-length DR3 or DDR3 were co-transfected with the pT ~ntern reporter con~llu-;l encoding green fluolescclll protein. Nuclei of cells W 097133904 PCTnUS96/16849 recled with DR3, but not DDR3, exhibited apoptotic morphology as ~esse~l by DAPI st~ining. Similar to TNFR-1 and Fas/APO-1 (M. Muzio, et al., Cell 85, 817-827 (1996); M. P. Boldin, etal., Cell 85, 803-815 (1996); M. Tewari, etal., JBiol Chem 270, 3255-60 (1995)), DR3-in~ ce~l apoptosis was blocked by the S inhibitors of ICE-like p,~ ase~, CrmA and z-VAD-fmk. Importantly, apoptosis intl~lce(l by DR3 was also blocked by dominant negative versions of FADD
(FADD-DN) or FLICE (FLICE-DN/MACHalC360S), which were previously shown to inhibit death sign~ling by Fas/APO-I and TNFR-1 (M. Muzio, et al., Cell 85, 817-827 91996); M. P. Boldin, et al., Cell 85, 803-815 (1996); H. Hsu, 0 et al., Cell 84, 299-398 (1996); A.M. Chinnaiyan, et aL, JBiol Chem 271, 4961-4965 (1996)). Thus, FADD and the ICE-like protease FLICE are likely necess~ y components of DR3-intlncecl apoptosis.
As DR3 activation recruits three molecules implicated in TNF-in-luce~
NF-kB activation, we ex~min~d whether DR3 could activate NF-kB.
Transfection of a control vector or e~ssion of Fas/APO-1 failed to induce NF-kB activation. By contrast, NF-kB was activated by ectopic expression of DR3 or TNFR-1, but not by the inactive ~ign~ling Illul~ll~ DDR3 or DTNFR-1.
Il"~o,~,lly, DR3-inrlllced NF-kB activation was blocked by dominant negative derivatives of RIP (RIP-DN) and TRAF2 (TRAF2-DN), which were previously shown to abrogate TNF-intince~l NF-kB activation (H. Hsu, et al., Cell 84, 299-398 (1996); H. Hsu, et al., Immunity 4, 387-396 (1996)). As expected, FADD-DN did not il~ r~ with DR3-m~ t~d NF-kB activation (H. Hsu, et al., Cell 84, 299-398 (1996); A.M. Chinnaiyan, et al., JBiol Chem 271, 4961-4965 (1996)) Thus, the e~ nte set forth in Exarnples 6 and 7 demonstrate that DR3 is a death domain-co--r~ molecule capable of triggering both apoptosis and NF-kB activation, two pathways donlinan~ in the regulation of the immlme system. The ~ nt~ also demonstrate the internal signal tr~n.C~Iction m~-~hinery of this novel cell death ~ec~lJton The DR3 .qign~ling complex assembles in a hierarchical manner with the recruitment of the multivalent adapter molecule TRADD, from which two distinct sign~lin~ c~cc~(les em~n~t~

W O 97/33904 PCT~US96/16849 1) NF-kB activation mediated by TRAF2 and RIP and 2) cell death mediated by FADD, FLICE, and RIP.
It will be clear that the invention may be practiced otherwise than as particularly described in the foregoing description and examples.
Numerous modifications and variations of the present invention are possible in light of the above te~lching~ and, therefore, are within the scope of the appended claims.
The entire disclosures of all patents, patent applications, and publications referred to herein are hereby incorporated by reference.

W O 97/33904 rCTrUS96/16849 S~:Qu~N~ LISTING

(1) GENERAL INFORMATION:
(i) APPLICANT: Human Genome Sciences, Inc.
9410 Key West Avenue Rockville, MD 20850 United States of America The Regents of the University of Michigan Ann Arbor, MI
United States of America APPLICANTS/INVENTORS: Yu, Guo-Liang Ni, Jian Dixit, Vishva Gentz, Reiner L.
Dillon, Patrick .
(ii) TITLE OF lN~NllON: Death Domain Cont~ini~g Receptor (iii) NUM~3ER OF S~uu~S: 17 (iv) CORRESPuN~N~ nD~S:
(A) ADDRESSEE: Sterne, Kessler,~Goldstein & Fox, P.L.L.C.
(B~ STREET: 1100 New York Ave., NW, Suite 600 (C) CITY: W~chin~ton (D) STATE: DC
(E) Cûu,. 1~: USA
(F) ZIP: 20005-3934 (v) CO.I~UL~K READABLE FORM:
(A) MEDIUM TYPE: Floppy disk (B) CO.I~U1~K: IBM PC compatible (C) OPERATING SYSTEM: PC-DOStMS-DOS
(D) SOFTWARE: PatentIn Release #1.0, Version #1.30 (vi) CURRENT APPLICATION DATA:
(A) APPLI Q TION NUMBER: To be assigned (B) FILING DATE: Herewith (C) CLASSIFI QTION:
(vii) PRIOR APPLI Q TION DATA:
(A) APPLI QTION NUMBER: US 60/013,285 (B) FILING DATE: 12-MAR-1996 (C) CLASSIFICATION:
(~iii) Al~OkN~Y/AGENT INFORMATION:
(A) NAME: Goldstein, Jorge A.
(B) REGISTRATION NUMBER: 29,021 (C) R~N~/DOCKET NUMBER: 1488.031PC01 (ix) TELECOMM~NI Q TION INFORMATION:
(A) TELEPHONE: 202-371-2600 W O 97l33904 PCTrUS96tl6849 (B) TELEFAX 202-371-2540 (2~ lN~O;~TION FOR SEQ ID NO 1 ( i ) S~UU~N~ CHARACTERISTICS
(A) LENGTH 1783 base pairs (B) TYPE nucleic acid (C) STR~ CS double (D) TOPOLOGY both (ii) MOLECULE TYPE cDNA

(ix) FEAT~RE
(A) NAME/KEY CDS
(B) LOCATION 198. .1481 (Xi ) S~UU~N~ DESCRIPTION SEQ ID NO 1 CAlGG~GGG GGTGGGGGCG ~lGu.GGATT Cul~C1u~GG TGGAGGGGAA Au~,~l~AGG 60 GG~lG~AAG CGCCCC~CC GAAGCCTGGT GTGTGCGCGG GGGGAAGGAA GTTAGTTTCC 120 TCTCCACCCA TGGGCACCCC ~ ~CCCGG GGCLl~GGAA GTGGGCTGCT CTGTGGGCAA 180 A.~u~GGGGC CTCTGAA ATG GAG GAG ACG CAG CAG GGA GAG GCC CCA CGT 230 Met Glu Glu Thr Gln Gln Gly Glu Ala Pro Arg Gly Gln Leu Arg Gly Glu Ser Ala Ala Pro Val Pro Gln Ala Leu Leu Leu Val Leu Leu Gly Ala Arg Ala Gln Gly Gly Thr Arg Ser Pro Arg Cys Asp Cys Ala Gly Asp Phe His Lys Lys Ile Gly Leu Phe Cys Cys Arg Gly Cys Pro Ala Gly His Tyr Leu Lys Ala Pro Cys Thr Glu Pro Cys Gly Asn Ser Thr Cys Leu Val Cys Pro Gln Asp Thr Phe Leu Ala Trp Glu Asn His His Asn Ser Glu Cys Ala Arg Cys Gln Ala Cy8 Asp gs 100 105 W 097/33904 rCTAUS96/16849 Glu Gln Ala Ser Gln Val Ala Leu Glu Asn Cys Ser Ala Val Ala Asp Thr Arg Cys Gly Cys Lys Pro Gly Trp Phe Val Glu Cys Gln Val Ser Gln Cys Val Ser Ser Ser Pro Phe Tyr Cys Gln Pro Cys Leu Asp Cys Gly Ala Leu His Arg His Thr Arg Leu Leu Cys Ser Arg Arg Asp Thr Asp Cys Gly Thr Cys Leu Pro Gly Phe Tyr Glu His Gly Asp Gly Cys Val Ser Cy9 Pro Thr Ser Thr Leu Gly Ser Cys Pro Glu Arg Cys Ala Ala Val Cys Gly Trp Arg Gln Met Phe Trp Val Gln Val Leu Leu Ala Gly Leu Val Val Pro Leu Leu Leu Gly Ala Thr Leu Thr Tyr Thr Tyr Arg His Cys Trp Pro His Lys Pro Leu Val Thr Ala Asp Glu Ala Gly Met Glu Ala Leu Thr Pro Pro Pro Ala Thr His Leu Ser Pro Leu Asp Ser Ala His Thr Leu Leu Ala Pro Pro Asp Ser Ser Glu Lys Ile Cys Thr Val Gln Leu Val Gly Asn Ser Trp Thr Pro Gly Tyr Pro Glu Thr Gln Glu Ala Leu Cys Pro Gln Val Thr Trp Ser Trp Asp Gln Leu Pro Ser Arg Ala Leu Gly Pro Ala Ala Ala Pro Thr Leu Ser Pro Glu Ser W O 97/33904 PCTnUS96/16849 Pro Ala Gly Ser Pro Ala Met Met Leu Gln Pro Gly Pro Gln Leu Tyr Asp Val Met Asp Ala Val Pro Ala Arg Arg Trp Lys Glu Phe Val Arg Thr Leu Gly Leu Arg Glu Ala Glu Ile Glu Ala Val Glu Val Glu Ile Gly Arg Phe Arg Asp Gln Gln Tyr Glu Met Leu Lys Arg Trp Arg Gln Gln Gln Pro Ala Gly Leu Gly Ala Val Tyr Ala Ala Leu Glu Arg Met Gly Leu Asp Gly Cys Val Glu Asp Leu Arg Ser Arg Leu Gln Arg Gly CCG TGACACGGCG CCCACTTGCC ACCTAGGCGC l~ GGCC CTTGCAGAAG 1531 Pro CCCTAAGTAC GGTTACTTAT GCGTGTAGAC ATTTTATGTC ACTTATTAAG CCGL~GGCAC 1591 GGCC~laC~ AGCAGCACCA GCCGGCCCCA CCCLlaLlCG CCCCTATCGC TCCAGCCAAG 1651 GCGAAGAAGC ACGAACGAAT GTCGAGAGGG GGTGAAGACA ll~cl~AACT l~lCLGCC'GG 1711 AGTTTGGCTG AGAlCGCGL-l ATTAAATCTG TGAAAGA~AA CA~AACAAAA CA~AAAAAAA 1771 ~2) lN~O~ ~TION FOR SEQ ID NO:2:
( i ) S ~:~u~NL~ CHARACTERISTICS:
~A) LENGTH: 428 amino acids ~B) TYPE: amino acid ~D) TOPOLOGY: linear (ii) MOLECULE TYPE: protein (xi) S~UU~NL~: DESCRIPTION: SEQ ID NO:2:
Met Glu Glu Thr Gln Gln Gly Glu Ala Pro Arg Gly Gln Leu Arg Gly Glu Ser Ala Ala Pro Val Pro Gln Ala Leu Leu Leu Val Leu Leu Gly W O 97~3904 PCTrUS96/16849 Ala Arg Ala Gln Gly Gly Thr Arg Ser Pro Arg Cys Asp Cys Ala Gly Asp Phe His Lys Lys Ile Gly Leu Phe Cys Cys Arg Gly Cys Pro Ala Gly His Tyr Leu Lys Ala Pro Cys Thr Glu Pro Cys Gly Asn Ser Thr ~ys Leu Val Cys Pro Gln Asp Thr Phe Leu Ala Trp Glu Asn HiS His ~sn Ser Glu Cy8 Ala Arg Cys Gln Ala Cys Asp Glu Gln Ala Ser Gln Val Ala Leu Glu Asn Cys Ser Ala Val Ala Asp Thr Arg Cys Gly Cys Lys Pro Gly Trp Phe Val Glu Cys Gln Val Ser Gln Cys Val Ser Ser Ser Pro Phe Tyr Cys Gln Pro Cy9 Leu Asp Cys Gly Ala Leu His Arg ~i9 Thr Arg Leu Leu Cy8 Ser Arg Arg Asp Thr Asp Cys Gly Thr Cys ~eu Pro Gly Phe Tyr G1U His Gly Asp Gly Cys Val Ser Cys Pro Thr Ser Thr Leu Gly Ser Cys Pro Glu Arg Cys Ala Ala Val Cys Gly Trp Arg Gln Met Phe Trp Val Gln Val Leu Leu Ala Gly Leu Val Val Pro Leu Leu Leu Gly Ala Thr Leu Thr Tyr Thr Tyr Arg His Cys Trp Pro ~is Lys Pro Leu Val Thr Ala Asp Glu Ala Gly Met Glu Ala Leu Thr ~ro Pro Pro Ala Thr His Leu Ser Pro Leu Asp Ser Ala His Thr Leu Leu Ala Pro Pro Asp Ser Ser Glu Lys Ile Cys Thr Val Gln Leu Val Gly Asn Ser Trp Thr Pro Gly Tyr Pro Glu Thr Gln Glu Ala Leu Cys Pro Gln Val Thr Trp Ser Trp Asp Gln Leu Pro Ser Arg Ala Leu Gly Pro Ala Ala Ala Pro Thr Leu Ser Pro Glu Ser Pro Ala Gly Ser Pro CA 02249l82 l998-09-ll WO 97/33904 PCT~US96/16849 Ala Met Met Leu Gln Pro Gly Pro Gln Leu Tyr Asp Val Met Asp Ala Val Pro Ala Arg Arg Trp Lys Glu Phe Val Arg Thr Leu Gly Leu Arg Glu Ala Glu Ile Glu Ala Val Glu Val Glu Ile Gly Arg Phe Arg Asp Gln Gln Tyr Glu Met Leu Lys Arg Trp Arg Gln Gln Gln Pro Ala Gly Leu Gly Ala Val Tyr Ala Ala Leu Glu Arg Met Gly Leu Asp Gly Cys Val Glu Asp Leu Arg Ser Arg Leu Gln Arg Gly Pro (2) lN~O~ ~.TION FOR SEQ ID NO:3:
(i) s~uu~N~ CHARACTERISTICS:
(A) LENGTH: 1254 base pairs (B) TYPE: nucleic acid (C) STR~ S: double (D) TOPOLOGY: both (ii) MOLECULE TYPE: cDNA

(ix) FEATURE:
(A) NAME/KEY: CDS
(B) LOCATION: 1..1251 (xi) ~yu N~ DESCRIPTION: SEQ ID NO:3:

Met Glu Gln Arg Pro Arg Gly Cys Ala Ala Val Ala Ala Ala Leu Leu Leu Val Leu Leu Gly Ala Arg Ala Gln Gly Gly Thr Arg Ser Pro Arg Cy8 Asp Cy~ Ala Gly Asp Phe His Lys Lys Ile Gly Leu Phe Cys Cys Arg Gly Cy8 Pro Ala Gly His Tyr Leu Lys Ala Pro Cys Thr Glu Pro W O 97/33904 PCT~US96/16849 Cys Gly Asn Ser Thr Cys Leu Val Cys Pro Gln Asp Thr Phe Leu Ala Trp Glu Asn His His Asn Ser Glu Cys Ala Arg Cys Gln Ala Cys Asp Glu Gln Ala Ser Gln Val Ala Leu Glu Asn Cys Ser Ala Val Ala Asp Thr Arg Cys Gly Cys Lys Pro Gly Trp Phe Val Glu Cys Gln Val Ser Gln Cys Val Ser Ser Ser Pro Phe Tyr Cys Gln Pro Cys Leu Asp Cys Gly Ala Leu His Arg His Thr Arg Leu Leu Cys Ser Arg Arg Asp Thr Asp Cys Gly Thr Cys Leu Pro Gly Phe Tyr Glu His Gly Asp Gly Cys Val Ser Cys Pro Thr Ser Thr Leu Gly Ser Cys Pro Glu Arg Cys Ala Ala Val Cys Gly Trp Arg Gln Met Phe Trp Val Gln Val Leu Leu Ala Gly Leu Val Val Pro Leu Leu Leu Gly Ala Thr Leu Thr Tyr Thr Tyr Arg His Cys Trp Pro His Lys Pro Leu Val Thr Ala Asp Glu Ala Gly Met Glu Ala Leu Thr Pro Pro Pro Ala Thr His Leu Ser Pro Leu Asp Ser Ala His Thr Leu Leu Ala Pro Pro Asp Ser Ser Glu Lys Ile Cys Thr Val Gln Leu Val Gly Asn Ser Trp Thr Pro Gly Tyr Pro Glu Thr W 097/33904 PCT~US96/16849 Gln Glu Ala Leu Cys Pro Gln Val Thr Trp Ser Trp Asp Gln Leu Pro Ser Arg Ala Leu Gly Pro Ala Ala Ala Pro Thr Leu Ser Pro Glu Ser Pro Ala Gly Ser Pro Ala Met Met Leu Gln Pro Gly Pro Gln Leu Tyr Asp Val Met Asp Ala Val Pro Ala Arg Arg Trp Lys Glu Phe Val Arg Thr Leu Gly Leu Arg Glu Ala Glu Ile Glu Ala Val Glu Val Glu Ile Gly Arg Phe Arg Asp Gln Gln Tyr Glu Met Leu Lys Arg Trp Arg Gln Gln Gln Pro Ala Gly Leu Gly Ala Val Tyr Ala Ala Leu Glu Arg Met Gly Leu Asp Gly Cys Val Glu Asp Leu Arg Ser Arg Leu Gln Arg Gly Pro ~2) lN~O~ ~.TION FOR SEQ ID NO:4:
(i) ~U~N~ C9ARACTERISTICS:
~A) LENGTH: 417 amino acids ~B) TYPE: amino acid (D) TOPOLOGY: linear (ii) MOLECULE TYPE: protein ~xi) S~yu~N~ DESCRIPTION: SEQ ID NO:4:
Met Glu Gln Arg Pro Arg Gly Cys Ala Ala Val Ala Ala Ala Leu Leu ~eu Val Leu Leu Gly Ala Arg Ala Gln Gly Gly Thr Arg Ser Pro Arg ~ys Asp Cy8 Ala Gly Asp Phe His Lys Lys Ile Gly Leu Phe Cy8 Cys CA 02249l82 l998-09-ll W O 97/33904 PCT~US96/16849 Arg Gly Cy9 Pro Ala Gly His Tyr Leu Lys Ala Pro Cys Thr Glu Pro Cys Gly Asn Ser Thr Cys Leu Val Cys Pro Gln Asp Thr Phe Leu Ala ~rp Glu Asn His His Asn Ser Glu Cys Ala Arg Cys Gln Ala Cys Asp ~lu Gln Ala Ser Gln Val Ala Leu Glu Asn Cys Ser Ala Val Ala Asp Thr Arg Cys Gly Cys Lys Pro Gly Trp Phe Val Glu Cys Gln Val Ser Gln Cys Val Ser Ser Ser Pro Phe Tyr Cys Gln Pro Cys Leu Asp Cys Gly Ala Leu His Arg His Thr Arg Leu Leu Cys Ser Arg Arg Asp Thr ~sp Cys Gly Thr Cys Leu Pro Gly Phe Tyr Glu His Gly Asp Gly Cys ~al Ser Cys Pro Thr Ser Thr Leu Gly Ser Cys Pro Glu Arg Cys Ala Ala Val Cys Gly Trp Arg Gln Met Phe Trp Val Gln Val Leu Leu Ala Gly Leu Val Val Pro Leu Leu Leu Gly Ala Thr Leu Thr Tyr Thr Tyr Arg His Cys Trp Pro HiS Lys Pro Leu Val Thr Ala Asp Glu Ala Gly ~et Glu Ala Leu Thr Pro Pro Pro Ala Thr His Leu Ser Pro Leu Asp ~er Ala His Thr Leu Leu Ala Pro Pro Asp Ser Ser Glu Lys Ile Cys Thr Val Gln Leu Val Gly Asn Ser Trp Thr Pro Gly Tyr Pro Glu Thr Gln Glu Ala Leu Cys Pro Gln Val Thr Trp Ser Trp Asp Gln Leu Pro Ser Arg Ala Leu Gly Pro Ala Ala Ala Pro Thr Leu Ser Pro Glu Ser Pro Ala Gly Ser Pro Ala Met Met Leu Gln Pro Gly Pro Gln Leu Tyr WO g7/33904 PCI/US96/16849 Asp Val Met Asp Ala val Pro Ala Arg Arg Trp Lys Glu Phe Val Arg Thr Leu Gly Leu Arg Glu Ala Glu Ile Glu Ala Val Glu Val Glu Ile Gly Arg Phe Arg Asp Gln Gln Tyr Glu Met Leu Lys Arg Trp Arg Gln Gln Gln Pro Ala Gly Leu Gly Ala Val Tyr Ala Ala Leu Glu Arg Met Gly Leu Asp Gly Cys Val Glu Asp Leu Arg Ser Arg Leu Gln Arg Gly Pro (2) INFORMATION FOR SEQ ID NO: 5:
( i ) S~;C?u~:~; CHARACTERISTICS:
~A) LENGTH: 455 amino acids ~B) TYPE: amino acid (C) STRPt~ N~ SS: not relevant (D) TOPOLOGY: not relevant (ii) MOLECULE TYPE: protein (xi) S~;uU~ : DESCRIPTION: SEQ ID NO:5:
Met Gly Leu Ser Thr Val Pro Asp Leu Leu Leu Pro Leu Val Leu Leu Glu Leu Leu Val Gly Ile Tyr Pro Ser Gly Val Ile Gly Leu Val Pro His Leu Gly Asp Arg Glu Lys Arg Asp Ser Val Cys Pro Gln Gly Lys Tyr Ile His Pro Gln Asn Asn Ser Ile Cys Cys Thr Lys Cys His Lys Gly Thr Tyr Leu Tyr Asn Asp Cys Pro Gly Pro Gly Gln Asp Thr Asp Cys Arg Glu Cys Glu Ser Gly Ser Phe Thr Ala Ser Glu Asn His Leu Arg His Cys Leu Ser Cys Ser Lys Cy9 Arg Lys Glu Met Gly Gln Val Glu Ile Ser Ser Cys Thr Val Asp Arg Asp Thr Val Cys Gly Cys Arg W 097/33904 PCTnUS96/16849 Lys Asn Gln Tyr Arg His Tyr Trp Ser Glu Asn Leu Phe Gln Cy8 Phe Asn Cys Ser Leu Cys Leu Asn Gly Thr Val His Leu Ser Cys Gln Glu 14S lS0 lSS 160 Lys Gln Asn Thr Val Cys Thr Cys His Ala Gly Phe Phe Leu Arg Glu Asn Glu Cys Val Ser Cys Ser Asn Cy8 Lys Lys Ser Leu Glu Cys Thr Lys Leu Cys Leu Pro Gln Ile Glu Asn Val Lys Gly Thr Glu Asp Ser Gly Thr Thr Val Leu Leu Pro Leu Val Ile Phe Phe Gly Leu Cys Leu Leu Ser Leu Leu Phe Ile Gly Leu Met Tyr Arg Tyr Gln Arg Trp Lys Ser Lys Leu Tyr Ser Ile Val Cys Gly Lys Ser Thr Pro Glu Lys Glu 245 2s0 255 Gly Glu Leu Glu Gly Thr Thr Thr Lys Pro Leu Ala Pro Asn Pro Ser Phe Ser Pro Thr Pro Gly Phe Thr Pro Thr Leu Gly Phe Ser Pro Val Pro Ser Ser Thr Phe Thr Ser Ser Ser Thr Tyr Thr Pro Gly Asp Cys 290 29s 300 Pro Asn Phe Ala Ala Pro Arg Arg Glu Val Ala Pro Pro Tyr Gln Gly 30s 310 315 320 Ala Asp Pro Ile Leu Ala Thr Ala Leu Ala Ser Asp Pro Ile Pro Asn 325 330 33s Pro Leu Gln Lys Trp Glu Asp Ser Ala His Lys Pro Gln Ser Leu Asp Thr Asp Asp Pro Ala Thr Leu Tyr Ala Val Val Glu Asn Val Pro Pro Leu Arg Trp Ly-q Glu Phe Val Arg Arg Leu Gly Leu Ser Asp His Glu Ile Asp Arg Leu Glu Leu Gln Asn Gly Arg Cys Leu Arg Glu Ala Gln Tyr Ser Met Leu Ala Thr Trp Arg Arg Arg Thr Pro Arg Arg Glu Ala W O 97/33904 PCTrUS96/16849 ~hr Leu Glu Leu Leu Gly Arg Val Leu Arg Asp Met Asp Leu Leu Gly Cys Leu Glu Asp Ile Glu Glu Ala Leu Cys Gly Pro Ala Ala Leu Pro Pro Ala Pro Ser Leu Leu Arg (2) INFORMATION FOR SEQ ID NO: 6:
(i) S~;QU~iN~ ~; CHARACTERISTICS:
(A) LENGTH: 335 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: not relevant (D) TOPOLOGY: not relevant (ii) MOLECULE TYPE: protein (xi) S~;~U~;N~:~; DESCRIPTION: SEQ ID NO:6:
Met Leu Gly Ile Trp Thr Leu Leu Pro Leu Val Leu Thr Ser Val Ala Arg Leu Ser Ser Lys Ser Val Asn Ala Gln Val Thr Asp Ile Asn Ser Lys Gly Leu Glu Leu Arg Lys Thr Val Thr Thr Val Glu Thr Gln Asn Leu Glu Gly Leu His His Asp Gly Gln Phe Cys His Lys Pro Cys Pro Pro Gly Glu Arg Lys Ala Arg Asp Cys Thr Val Asn Gly Asp Glu Pro Asp Cys Val Pro Cys Gln Glu Gly Lys Glu Tyr Thr Asp Lys Ala His Phe Ser Ser Lys Cys Arg Arg Cys Arg Leu Cys Asp G1U Gly His Gly Leu Glu Val Glu Ile Asn Cys Thr Arg Thr Gln Asn Thr Lys Cys Arg Cys Lys Pro Asn Phe Phe Gln Asn Ser Thr Val Cys Glu His Cys Asp Pro Cys Thr Lys Cys Glu His Gly Ile Ile Lys Glu Cys Thr Leu Thr Ser Asn Thr Lys Cys Lys Glu Glu Gly Ser Arg Ser Asn Leu Gly Trp CA 02249l82 l998-09-ll W O 97~3904 PCTrUS96/16849 Leu Cys Leu Leu Leu Leu Pro Ile Pro Leu Ile Val Trp Val Lys Arg Lys Glu Val Gln Lys Thr Cys Arg Lys His Arg Lys Glu Asn Gln Gly Ser His Glu Ser Pro Thr Leu Asn Pro Glu Thr Val Ala Ile Asn Leu Ser Asp Val Asp Leu Ser Lys Tyr Ile Thr Thr Ile Ala Gly Val Met Thr Leu Ser Gln Val Lys Gly Phe Val Arg Lys Asn Gly Val Asn Glu Ala Lys Ile Asp Glu Ile Lys Asn Asp Asn Val Gln Asp Thr Ala Glu Gln Lys Val Gln Leu Leu Arg Asn Trp His Gln Leu His Gly Lys Lys Glu Ala Tyr Asp Thr Leu Ile Lys Asp Leu Lys Lys Ala Asn Leu Cys Thr Leu Ala Glu Lys Ile Gln Thr Ile Ile Leu Lys Asp Ile Thr Ser Asp Ser Glu Asn Ser Asn Phe Arg Asn Glu Ile Gln Ser Leu Val (2) lN~ 0~1ATION FOR SEQ ID NO:7:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 23 base pairs (B) TYPE: nucleic acid (C) STR~NnRn~S: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: cDNA

(Xi) ~:QU~N~: DESCRIPTION: SEQ ID NO:7:

(2) INFORMATION FOR SEQ ID NO:8:
(i) ~QU~NU'~ CHAR~CTERISTICS:
(A) LENGTH: 30 base pairs (B) TYPE: nucleic acid (C) STR~N~ N~:~S: single W O 97/33904 PCTrUS96/16849 (D) TOPOLOGY: linear (ii) MOT .~CTJT ~~ TYPE: cDNA

(xi) S~Qu~N.~ DESCRIPTION: SEQ ID NO:8:

(2) INFORMATION FOR SEQ ID NO:9:
(i) ~yu~N.~ CHARACTERISTICS:
(A) LENGTH: 33 base pairs (B) TYPE: nucleic acid (C) STRPN~ N~:~S: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: cDNA

(Xi ) ~QU~N~ DESCRIPTION: SEQ ID NO:9:

(2) INFORMATION FOR SEQ ID NO:l0:
(i) S~YU~N~: CHARACTERISTICS:
(A) LENGTH: 33 base pairs (B) TYPE: nucleic acid (C) sTRpNn~n~s single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: cDNA

(Xi) ~yU~N~'~ DESCRIPTION: SEQ ID NO:lO:

(2) INFORMATION FOR SEQ ID NO:ll:
( i ) S~YU~N~ CHARACTERISTICS:
(A) LENGTH: 54 base pairs ~B) TYPE: nucleic acid ~C) STR~NI 1~ N~:SS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: cDNA

W O 97/33904 PCT~US96/16849 (xi) Sr;yur;N~ri DESCRIPTION: SEQ ID NO:ll:
GC~cl~GAT CAAAGCGTAG TCTGGGACGT CGTATGGGTA CGGGCCGCGC TGCA 54 (2) INFORMATION FOR SEQ ID NO:12:
(i) S~yur;N~r; CHARACTERISTICS:
(A) LENGTH: 33 base pairs (B) TYPE: nucleic acid ~C) STRAN~ N~:-CS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: cDNA

(xi) ~r;uurN~r; DESCRIPTION: SEQ ID NO:12:

(2) lNrOh ~TION FOR SEQ ID NO:13:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 33 base pairs (B) TYPE: nucleic acid (C) STRPN~ )N~:~S: single (D) TOPOLOGY: linear ( ii ) MOT.RCU~.R TYPE: cDNA

(xi) Sr;uur;N~r; DESCRIPTION: SEQ ID NO:13:

(2) lNrO.~TION FOR SEQ ID NO:14:
(i) ~r;yur;N~r; CHARACTERISTICS:
(A) LENGTH: 26 base pairs (B) TYPE: nucleic acid (C) STR~N~ N~:~S: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: cDNA

(xi) ~r;yur;~r; DESCRIPTION: SEQ ID NO:14:

CA 02249l82 l998-09-ll W O 97/33904 PCTnUS96/16849 ~2) lN~O.~IATION FOR SEQ ID NO:15:
(i) S~QU~NL~: CHARACTERISTICS:
(A) LENGTH: 33 base pairs (B~ TYPE: nucleic acid (C) STR Nn~n~S: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: cDNA

(Xi) S~'~U~:NL'~: DESCRIPTION: SEQ ID NO:15:

(2) INFORMATION FOR SEQ ID NO:16:
( i ) S~'QU~NL~ CHARACTERISTICS:
(A) LENGTH: 33 base pairs (B) TYPE: nucleic acid (C) STR~N~ N~:CS: single ~D) TOPOLOGY: linear (ii) MOLECULE TYPE: cDNA

(Xi) ~'yUkN-L'~ DESCRIPTION: SEQ ID NO:16:

(2) INFORMATION FOR SEQ ID NO:17:
(i) S~:UU~NL~ CHARACTERISTICS:
(A) LENGTH: 35 base pairs ~B) TYPE: nucleic acid ~C) STR~N~ N~:SS: single (D) TOPOLOGY: linear ( ii ) MoT~cuT~ TYPE: cDNA

~xi) SEQUENCE DESCRIPTION: SEQ ID NO:17:

CA 02249l82 l998-09-ll W O 97/33904 PCT~US96/16849 85.1 or ~genl s file ¦ referenQenurnber1~8 031PC~01 ~ ~ Z~ Tr~.. n INDICATIONS RELATING TO A DEPOSITED MICROORGANISM
(PCI' Rule 13b~) A Tbe ' msde below rel-te to the ~, reierred lo in tbe ' , -on psge 4 line 18 n. IDENTIFICATION OF ll~s O ~ l Furtn~ deposits ~re identified on ~n nddition-l ~heet O
N-me of deposit ry mstitution ~ 'r~n Type Culture Cbllection Add~ofdeposit ryinstitution(indl~i~p~l codcon~ca~
12301 p~rkl ~1 Drive Rcckville, Marylan~ 20852 United States o~ America D~te of deposil Accession Numb~r Ma~h 1, 1996 A5'CC' 97456 C AVU~ ~ lONAL lNDICATIONS ~Ic vc bl~ t if na opplic blc~ Tbh ' is continued on ~n ~ddilial~l ~bect ~N~ Plasmid, 231556 D DESICNATED STATES FOR WHIC~ INDlCA'rIONS ARE MADE fif ~llc irJial~ions ot~ na for -ll f v ~ '5' E SEPARATE ~;VRNISHING OF INDICATIONS /lc~rvc bl~At if ~ opplicoblc~
I'oe ' lisledbeiowwillk ' llolhcl - - IBure ubl~ ~spccifJ~ . ACC~;OA
N~cr of Dq~osi~') For recelvinls Of fice use only For I - - ' Bure~u use only O l~is sbeet w s reoei~cd wilh Ibe - ~ r - O This sheet ~v~s recvived b~ the ' ' Bur~ u on A ' ' officer Authorizcd officer Fonn PcI~/Roll34 (July 1492~

85.2 INDICATIONS RELATING TO A DEPOSITED MICROORGANISM
(PCT Rule 13bis)

Claims (26)

What Is Claimed Is:

1. An isolated nucleic acid molecule comprising a polynucleotide having a nucleotide sequence at least 95% identical to a sequenceselected from the group consisting of:
(a) a nucleotide sequence encoding the full-length death domain containing receptor polypeptide (DR3-V1) having the complete amino acid sequence in Figure 1 (SEQ ID NO:2);
(b) nucleotide sequence encoding the full-length death domain containing receptor (DR3) polypeptide having the complete amino acid sequence in Figure 2 (SEQ ID NO:4), including the predicted leader sequence;
(c) a nucleotide sequence encoding the DR3-V1 polypeptide having the amino acid sequence at positions from about 36 to about 428 in Figure1 (SEQ ID NO:2);
(d) a nucleotide sequence encoding the full-length DR3-V1 polypeptide having the complete amino acid sequence including the leader encoded by the cDNA clone contained in ATCC Deposit No. 97456;
(e) a nucleotide sequence encoding the full-length DR3 polypeptide having the complete amino acid sequence including the leader encoded by the cDNA clone contained in ATCC Deposit No. 97757;
(f) a nucleotide sequence encoding the mature DR3-V1 polypeptide having the amino acid sequence encoded by the cDNA clone contained in ATCC Deposit No. 97456;
(g) a nucleotide sequence encoding the mature DR3 polypeptide having the amino acid sequence encoded by the cDNA clone contained in ATCC Deposit No. 97757;
(h) a nucleotide sequence that encodes the DR3 extracellular domain;
(i) a nucleotide sequence that encodes the DR3 transmembrane domain;

(j) a nucleotide sequence that encodes the DR3 intracellular domain;
(k) a nucleotide sequence that encodes the DR3 death domain;
and (l) a nucleotide sequence complementary to any of the nucleotide sequences in (a), (b), (c), (d), (e), (f), (g), (h), (i), (j) or (k)

2. The nucleic acid molecule of claim 1 wherein said polynucleotide has the complete nucleotide sequence in Figure 1 (SEQ ID NO: 1).

3. The nucleic acid molecule of claim 1 wherein said polynucleotide has the nucleotide sequence in Figure 1 (SEQ ID NO:1) encoding the death domain containing polypeptide having the complete amino acid sequence in Figure 1 (SEQ ID NO:2).

4. The nucleic acid molecule of claim 1 wherein said polynucleotide has the nucleotide sequence in Figure 1 (SEQ ID NO:1) encoding the mature death domain containing receptor polypeptide having the amino acid sequence in Figure 1 (SEQ ID NO:2).

5. The nucleic acid molecule of claim 1 wherein said polynucleotide has the complete nucleotide sequence of the cDNA clone contained in ATCC
Deposit No. 97456.

6. The nucleic acid molecule of claim 1 wherein said polynucleotide has the complete nucleotide sequence in Figure 2 (SEQ ID NO:3).

7. The nucleic acid molecule of claim 1 wherein said polynucleotide has the nucleotide sequence in Figure 1 (SEQ ID NO:1) encoding the death domain containing receptor polypeptide having the complete amino acid sequence in Figure 1 (SEQ ID NO:2).

8. The nucleic acid molecule of claim 1 wherein said polynucleotide has the nucleotide sequence in Figure 2 (SEQ ID NO:3) encoding the mature death domain containing receptor polypeptide having the amino acid sequence in Figure 2 (SEQ ID NO:4).

9. The nucleic acid molecule of claim l wherein said polynucleotide has the complete nucleotide sequence of the cDNA clone contained in ATCC
Deposit No.97757.

10. The nucleic acid molecule of claim 1 wherein said polynucleotide has the nucleotide sequence encoding the death domain containing receptor polypeptide having the complete amino acid sequence encoded by the cDNA
clone contained in ATCC Deposit No. 97456.

11. The nucleic acid molecule of claim 1 wherein said polynucleotide has the nucleotide sequence encoding the mature death domain containing receptor polypeptide having the amino acid sequence encoded by the cDNA
clone contained in ATCC Deposit No. 97456.

12. The nucleic acid molecule of claim 1 wherein said polynucleotide has the nucleotide sequence encoding the death domain containing receptor polypeptide having the complete amino acid sequence encoded by the cDNA
clone contained in ATCC Deposit No. 97757.

13. The nucleic acid molecule of claim 1 wherein said polynucleotide has the nucleotide sequence encoding the mature death domain containing receptor polypeptide having the amino acid sequence encoded by the cDNA
clone contained in ATCC Deposit No. 97757.

14. An isolated nucleic acid molecule comprising a polynucleotide which hybridizes under stringent hybridization conditions to a polynucleotide having a nucleotide sequence identical to a nucleotide sequence in (a), (b), (c), (d), (e), (f), (g), (h), (i), (j), (k) or (l) of claim 1 wherein said polynucleotide which hybridizes does not hybridize under stringent hybridization conditions to a polynucleotide having a nucleotide sequence consisting of only A residues or of only T residues.

15. An isolated nucleic acid molecule comprising a polynucleotide which encodes the amino acid sequence of an epitope-bearing portion of a death domain containing receptor polypeptide having an amino acid sequence in (a), (b), (c), (d), (e), (f), (g), (h), (i), (j) or (k) of claim 1.

16. The isolated nucleic acid molecule of claim 15, which encodes an epitope-bearing portion of a death domain containing receptor polypeptide selected from the group consisting of: a polypeptide comprising amino acid residues from about 1 to about 22 in Figure 1 (SEQ ID NO:2); a polypeptide comprising amino acid residues from about 33 to about 56 in Figure 1 (SEQ ID
NO:2); a polypeptide comprising amino acid residues from about 59 to about 82 in Figure 1 (SEQ ID NO:2); a polypeptide comprising amino acid residues from about 95 to about 112 in Figure 1 (SEQ ID NO:2); a polypeptide comprising amino acid residues from about 122 to about 133 in Figure 1 (SEQ ID NO:2); a polypeptide comprising amino acid residues from about 161 to about 177 in Figure 1 (SEQ ID NO:2); a polypeptide comprising amino acid residues from about 179 to about 190 in Figure 1 (SEQ ID NO:2); and a polypeptide comprising amino acid residues from about 196 to about 205 in Figure 1 (SEQ
ID NO:2).

17. A method for making a recombinant vector comprising inserting an isolated nucleic acid molecule of claim 1 into a vector.

18. A recombinant vector produced by the method of claim 17.

19. A method of making a recombinant host cell comprising introducing the recombinant vector of claim 18 into a host cell.

20. A recombinant host cell produced by the method of claim 19.

21. A recombinant method for producing a death domain containing receptor polypeptide, comprising culturing the recombinant host cell of claim 20under conditions such that said polypeptide is expressed and recovering said polypeptide.

22. An isolated death domain containing receptor polypeptide having an amino acid sequence at least 95% identical to a sequence selected from the group consisting of:
(a) the amino acid sequence of the DR3-V1 polypeptide having the complete 428 amino acid sequence, including the leader sequence shown in Figure 1 (SEQ ID NO:2);
(b) the amino acid sequence of the DR3 polypeptide having the complete 417 amino acid sequence, including the leader sequence, shown in Figure 2 (SEQ ID NO:4);
(c) the amino acid sequence of the DR3-V1 polypeptide having the amino acid sequence at positions from about 36 to about 428 in Figure 1 (SEQ ID NO:2);
(d) the amino acid sequence of the DR3-V1 polypeptide having the complete amino acid sequence, including the leader, encoded by the cDNA clone contained in ATCC Deposit No. 97456;
(e) the amino acid sequence of the DR3 polypeptide having the complete amino acid sequence, including the leader, encoded by the cDNA clone contained in ATCC Deposit No. 97757;

(f) the amino acid sequence of the mature DR3 polypeptide having the amino acid sequence encoded by the cDNA clone contained in ATCC
Deposit No. 97456;
(g) the amino acid sequence encoding the mature DR3 polypeptide having the amino acid sequence encoded by the cDNA clone contained in ATCC Deposit No. 97757;
(h) the amino acid sequence of the DR3 extracellular domain;
(i) the amino acid sequence of the DR3 transmembrane domain;
(j) the amino acid sequence of the DR3 intracellular domain;
(k) the amino acid sequence of the DR3 death domain; and (l) the amino acid sequence of an epitope-bearing portion of any one of the polypeptides of (a), (b), (c), (d), (e), (f), (g), (h), (i), (j) or (k).

23. An isolated antibody that binds specifically to a death domain containing receptor polypeptide of claim 22.

24. A method of treating diseases and disorders associated with the inhibition of apoptosis comprising administering an effective amount of the polypeptide as claimed in claim 22, or an agonist thereof to a patient in need thereof.

25. A method of treating diseases and disorders associated with increased apoptosis comprising administering to a patient in need thereof an effective amount of an antagonist of the polypeptide as claimed in claim 22 to apatient in need thereof.

26. A method of treating inflammatory diseases and disorders comprising administering to a patient in need thereof an effective amount of an antagonist of the polypeptide as claimed in claim 22.