CA2248638A1 - Methods and compositions for inhibiting hexokinase - Google Patents

Abstract

Disclosed are compositions and methods for inhibiting hexokinase enzymes in mammalian cells. Specifically provided are proteins that stimulate the production of trehalose-6-phosphate and their respective genes; hexokinasespecific ribozymes and genes encoding such constructs; and agents that competitively reduce hexokinase activity, e.g., by displacing hexokinase from mitochondria, and their respective genes. The latter group of agents includes inactive hexokinases and fragments thereof that retain mitochondrial binding functions and hexokinase-glucokinase chimeras that further substitute glucokinase activity for hexokinase activity. Mammalian cells including such hexokinase inhibitors, methods of making such cells and various in vitro and in vivo methods of using cells with reduced hexokinase activity are also described herein.

Description

W O 97/26357 PCT~US97/00787 DEISCRIPTION

METHODS AND COMPOSITIONS FOR INHIBITING ~IEXOKTNASE

BACKGROUI~D OF THE INVENTION

5 1. Field oftheInvention The present invention relates generally to the field of cellular biochemistry and also to the field of diabetes. More particularly, it provides compositions and methods for inhibiting hexokinases in m:~mm~ n cells. Specifically provided are agents that stimulate the production of trehalose-6-phosphate; hexokinase-specific ribozymes and o agents that competitively reduce hexokinase activity, e.g, by displacing hexokinase from mitochondria. Cells incorporating such agents and their respective genes-, and advantageous methods of making and using cells with reduced hexokinase activity are also provided.

2. Description of the Related Art The participation of the pancreatic islets of Langerhans in fuel homeostasis is mediated in large part by their ability to respond to changes in circulating levels of key metabolic fuels by secreting peptide ho1mones. Insulin secretion from islet ,B cells is stimulated by amino acids, three-carbon sugars such as glyceraldehyde and, most prorninently, by glucose. The capacity of normal islet ~ cells to sense a rise in 20 blood glucose concentration and to respond to elevated levels of glucose (as occurs following ingestion of a carbohydrate containing meal) b~i secreting insulin is critical to control of blood glucose levels. Increased insulin secretion in response to aglucose load prevents chronic hyperglycemia in normal individuals by stimulatingglucose uptake into peripheral tissues,- particularly muscle and adipose tissue.

WO 97/26357 PCTrUS97/00787 Individuals in which islet ~ cell function is i1npaired suffer from diabetes.
Insulin-dependent diabetes mellitus (IDDM, also known as Juvenile-onset, or Type I
diabetes) represents approximately 15% of all human diabetes. IDDM is distinct from non-insulin dependent diabetes (NIDDM) in that only IDDM involves specific 5 destruction of the insulin producing ,~ cells of the islets of Langerhans in the pancreas.
The destruction of ,B cells in IDDM appears to be a result of specific autoirnmune attack, in which the patient's own immune system recognizes and destroys the ,B cells, but not the surrounding a (glucagon producing) or ~ (somatostatin producing) cells that comprise the islet.

0 The precise events involved in ,B cell recognition and destruction in IDDM are currently unknown, but involve both the cellular and humoral components of the immune system. In IDDM, islet ~ cell destruction is ultimately the result of cellular mech~ni~m.~, in which cytotoxic T cells destroy ,~ cells which are erroneously perceived as foreign or harrnful. The humoral component of the immune system, comprised of the antibody-producing B cells, is also inappropriately active in IDDM
patients, who have serum antibodies against various ~ cell proteins.

Glucose stimulates de novo insulin biosynthesis in ,~ cells by increasing transcription, mRNA stability, transl~tion, and protein processing. Glucose alsorapidly stimulates the release of pre-stored insulin. Glucose transport into the ~ cell and metabolism of this sugar are absolute requirements for insulin secretion, leading to the hypothesis that its specific stimulatory effect is mediated by, and proportional to, its flux rate through glycolysis and related pathways.

The facilitated-diffusion type glucose transporter, GLUT-2, and the glucose phosphorylating enzyme, glucokinase, are known to be involved in the control of glucose metabolism in islet ~ cells (U.S. Patent 5,427,940). Both proteins are members of gene families; GLUT-2 is unique among the five-member family of glucose transporter proteins in that it has a distinctly higher Km and Vm" ~ for glucose.
Glucokinase is the high Km and high Vm~ counterpart of GLUT-2 among the famil~

W O 97/26357 PCT~US97/00787 of hexokinases. Importantly, both proteins have affinities for glucose that allow dramatic changes in their activities over the physiological range of glucose. These proteins thus work in concert as the "glucose-sensing apparatus" that modulates insulin secretion in response to changes in circulating glucose concentrations by s regulating glycolytic flux.

Treatment for IDDM is still centered around self-injection of insulin once or twice daily. The development of new therapeutic strategies is therefore nece~s~ry.
The possibility of islet or pancreas fragment transplantation has been investigated as a means for p~rrn~nent insulin replacement (Lacy et al., 1986). However, this approach o has been severely hampered by the difficulties associated with obtaining tissue, as well as the finding that transplanted islets are recognized and destroyed by the same autoimmune mech~ni.cm responsible for destruction of the patients original islet~3 cells.

U.S. Patent 5,427,940 provided, for the first time, recombinant cells that 5 secrete insulin in response to glucose. The generation of such artificial ~ cells is achieved through the introduction of one or more genes selected from the insulingene, the glucokinase gene and the GLUT-2 glucose transporter gene, so as to provide an engineered cell having all three of these genes in a biologically functional and responsive configuration.

The availability of the engineered cells of U.S. Patent 5,427,940 makes cell-based insulin replacement therapy for IDDM a realistic goal. However, while evidently of significant use, it appears that these cells are not optimal for IDDM
treatment owing to the fact that the glucokinase:hexokinase activity ratio in such cells is not likely to result in insulin secretion at physiological glucose concentrations.
Accordingly, it is evident that improvements are needed in the engineering of cells for use in the tre~tment of diabetes and in other applications.

W O 97/26357 PCTrUS97/00787 SUMMARY OF THE INVh NTION

The present invention seeks to overcome these and other drawbacks inherent in the prior art by providing compositions and methods for inhibiting hexokinase in m~mm~ n cells. Metabolic inhibitors of hexokinase activity are provided in the s form of agents that stimulate the production of trehalose-6-phosphate and molecular biological inhibitors of hexokinase are provided in the form of hexokinase-specific ribozymes. Further provided are agents that displace hexokinase from mitochondria and thus co~lly~ ely reduce hexokinase activity. This group of agents includes inactive hexokinases and fragments thereof that retain mitochondrial binding 0 functions and, also, hexokinase-glucokinase chimeras that further substitute glucokinase activity for hexokinase activity. All of the inhibitory agents may be provided in the form of a gene or vector that expresses the particular agent.

~ amm~ n cells including such hexokinase inhibitors are also provided, as are methods of making and using cells with reduced hexokinase activity. Important 5 examples of m~mm~ n cells that include hexokinase inhibitors are cells that ha~e been engineered to secrete polypeptide hormones and other biologically active agents, as exemplified by cells that secrete insulin in response to glucose. The cells may be used in various in vitro and in vivo embodiments, such as in the production of large quantities of proteins and in cellular-based delivery methods and treatment protocols.

Further aspects of the invention concern the role of low Km hexokinases as regulators of cell growth. These aspects are generally based on the inventors' findings that inhibition of low Km hexokinase achieved using knockout technology significantly slows cell growth. Accordingly, methods of reducing the growth of a cell by inhibiting the ultimate activity of a low Km hexokinase form yet another aspect 2s of the invention.

Accordingly, the present invention provides m~mm~ n cells that comprise at least one inhibitor of a low Km hexokinase, the inhibitor selected from:

W 097/26357 PCTrUS97/00787 (a~ an agent that stimulates the production of trehalose-6-phosphate;
(b) a low Km hexokinase-specific ribozyme;-or (c) an agent that competitively reduces low Km hexokinase activity;

s wherein said inhibitor is present in an amount effective to reduce the lowKm hexokinase activity of the cell.

The cells of the invention will generally have a reduced a low Km hexokinase activity relative to a parent cell from which the instant cell was prepared. It is o contemplated that cells in which the low Km hexokinase activity is reduced by any degree relative to control levels, i.e., levels within the cell prior to contact with an inhibitor, will be useful in the context of the present invention.

Depending on the int~n~le~ use of the cells, cells in which a moderate hexokinase inhibition is achieved will still have utility. Such inhibition levels are 5 contemplated to be those in which the low Km hexokinase activity is reduced by at least about 5%, about 10%, about 15%, about 20%, or about 25% relative to control levels. Of course, cells exhibiting more significant inhibition are also contemplated within the invention. Accordingly, cells in which the low Km hexokinase activity is reduced by about 30%, about 40%, about 50%, about 60% or even about 70% or 20 higher, with respect to control levels, are contemplated as part of this invention and will be preferred in certain embodiments.

In certain embodiment~, p~ticularly where the cell in question is an engineered cell designed to secrete insulin in response to glucose, other pararneters may be applied in assessing useful levels of low Km hexokinase inhibition. For 2~ example, it may be desired to determine the ratio of glucokinase to hexokinase (GK:HK ratio) and to monitor changes in this ratio as hexokinase is inhibited. It will be understood that a cell in which this ratio is changed to reflect the ratio commonly W O 97/26357 PCTrUS97/00787 observed in functional or natural pancreatic ,B cells, or in which the ratio is changed towards this, will be an advantageous engineered cell in the context of this invention.

In certain plefelled embo-limen~c, it is contemplated that cells of this invention will have a low Km hexokinase activity that has been reduced to a level ayyloyliate to 5 confer more physiological insulin secretion capacity to the cell. This includes genetically engineered cells that have a near-homeostatic insulin secretion capacity.

"Engineered cells that exhibit more physiological insulin secretion" are cells that exhibit glucose-stimulated insulin secretion (GSIS) closer to the normal range than the parent cell from which they were prepared and, generally, also than thelO previously described en~in~e.red cells. In this regard, the maximal glucose response of previously described cell lines generally occurs at subphysiological glucose concentrations of between about 10 !lM and about 100 ~

The GSIS of normal islet ~ cells generally occurs at glucose concentrations of between about 3 mM to 20 mM, with ranges of 5 to 20 mM and 4 to 9 mM being 5 frequently reported. Insulin responses in these ranges would therefore be described as "near-homeostatic insulin secretion". Cells that comprise an inhibitor in an amount effective to reduce the low Km hexokinase activity of the cell to a level sufficient to confer insulin secretion in response to an extracellular glucose concentration of between about 1 mM and about 20 mM will thus be most ylefelled. Extracellular 20 glucose concentrations of "between about 1 mM and about 20 mM" ~,vill be understood to include each and every numerical value within this range, such as being about 1, 2, 3, 4, 5, 7.5, 10, 12, 14, 16, 18, and about 20 mM or so.

Any of the low Km hexokinases present within m~mm~ n cells may be inhibited according to the present invention, that is hexokinase I, hexokinase II and/or 2s hexokinase III. In embodiments concerning engineered cells for use in treating diabetes, the yLerelled target are hexokinase I and/or hexokinase II, as these are the predominant isoforms present in cell lines contemplated for such uses.

W O 97/26357 PCT~US97/00787 Irrespective of the type of inhibitor provided to a cell in order to inhibit hexokinase, it is generally pLefe.led that the inhibitor be introduced into the cell by means of a recombinant gene that expresses the inhibitor. Generally, this will be achieved by introducing into the cell a recombinant vector that comprises a promoter s operatively linked to a gene that encodes the inhibitor, where the promoter directs the expression of the inhibitor in the host cell. The construction and use of recombinant vectors and promoters is well known to those of skill in the art and is further described in detail herein.

In certain embodiments, the inhibitory agents for use in this invention is an lo agent, such as an enzyme, that stimul~te the production of trehalose-6-phosphate. A
currently preferred enzyme is trehalose-6-phosphate synthase, as may be exemplified by the yeast enzyme termed TPS1. Synthase genes from insects, blue-green algae and bacteria such as E. coli may also be used in these aspects of the invention.

Cells provided with a TPS1 enzyme that includes a contiguous amino acid sequence from S3~Q ID NO:2 are currently preferred. The TPSI protein may be advantageously provided to a cell by introducing into the cell a recombinant gene that includes a contiguous nucleic acid sequence from SEQ ID NO:1. Of course, it will be well understood that all biological functional equivalents of enzymes such as TPS1 are included within the scope of the present invention. In fact, the invention 20 contemplates the use of any agent, whether biological or chemical, that result in an increase in trehalose-6-phosphate concentration within a m~mm~ n cell.

Further aspects of the present invention concern m~mm~ n cells that comprise a low Km hexokinase-specific ribozyme or a gene encoding such a ribozyme. As used herein, the term "a low Km hexokinase-specif1c ribozyme" means2s a nucleic acid sequence that comprises a ribozyme catalytic domain sequence in ~ combination with a nucleic acid sequence that is complementary to and binds to an RNA transcript of a low Km hexokinase gene.

A number of ribozymes are known, virtually any one of which may be used in conjunction with the present invention. By way of example only, one may mention ribozyme catalytic domains from hamrnerhead ribozymes and from hairpin ribozyme structures. Specific examples include ribozyme sequences from RNaseP, hepatitis s delta virus, avocado sunblotch viroid virus, lucerne transient streak, and tobacco ringspot virus.

In certain of these embodiments, the hexokinase-specific ribozyme will comprise a ribozyme catalytic domain linked to a nucleic acid sequence that is complementary to and binds to an RNA transcript of a hexokinase I gene; in other0 embodiments, the ribozyme will comprise a nucleic acid sequence that directs binding to a hexokinase II gene. The hexokinase nucleic acid sequence may be linked either to the S' end or to the 3' end of the ribozyme sequence, although it is most preferred that the ribozyme sequence be linked at each end to a hexokinase nucleic acid sequence. In this manner, this hexokinase-specific sequences will flank the ribozyme 5 catalytic sequence.

Hexokinase sequences of between about 6 and about 30 bases in length may be used in the aforementioned constructs, with sequences of between about 10 andabout 15 bases in length being currently preferred. Hexokinase I-specific nucleic acid sequences are represented by contiguous sequences from SEQ ID NO:13; with 20 hexokinase II-specific sequences being represented by contiguous sequences from SEQ ID NO:15. Exemplary low Km hexokinase-specific ribozymes for use in the present invention include SEQ ID NO:3, SEQ ID NO:4, and SEQ ID NO:5.

In still further embo~liment~, the inhibitory agents for use in the present invention will be agents that competitively reduce low Km hexokinase activity. One 2s exarnple of such an agent is the glucokinase enzyme. Other possible examples include glycerol kinase. Preferred examples of these agents are agents that lack low Km hexokinase activity and that displace low Km hexokinase from mitochondria. A

W O 97/26357 PCTrUS97/00787 number of such constructs are contemplated to be useful in the context of the present invention.

One broad group of such inhibitors are those that simply compete for hexokinase binding sites and consequentially displace endogenous low Km 5 hexokinases from their mitochrondial binding sites within an intact cell. Such"displacing agents" will generally comprise a mitochondrial binding region from the N-termin~l domain of a low Km hexokinase, such as hexokinase I or hexokinase II.
The term "mitochrondial binding region from the N- termin~l domain," as used herein, includes constructs of between about 15 amino acids in length and about 455 0 arnino acids in length, with all intermediates between these two extremes being contemplated. Such mitochondrial binding regions are exemplified by peptides, polypeptides and proteins that include a contiguous amino acid sequence from SEQ -ID NO:7 and those that include a contiguous sequence from between about position 1 to about position 455 of SE~Q ID NO:16. Currently preferred recombinant genes that 5 encode such mitochondrial binding agents are those that include a contiguous nucleic acid sequence from SEQ ID NO:6 and those that include a contiguous sequence frombetween about position l to about position 1563 of SEQ ID NO:15.

Constructs that consist essentially of the N-termin~l domain of a low Km hexokinase will be plcrcl,cd for use in certain aspects of the invention. This is based 20 upon the belief that this domain will readily form a collcclly folded structure that effectively competes with endogenous hexokinase enzymes.

Constructs capable of displacing low Km hexokinases from mitochondria, whilst simultaneously providing to the cell a high Km hexokinase (glucokinase) activity form another preferred aspect of the present invention. Of course, it will be 25 understood that such "displacement-replacement" conskucts will not themselvesexhibit low Km hexokinase activity. These constructs will generally comprise a mitochondrial binding peptide, polypeptide or protein from the N-terminal domain of a low Km hexokinase operatively linked to at least the catalytic domain of a glucokinase enzyme (hexokinase IV).

Appropriate hexokinase IV domains that may be used in this manner are those that include a contiguous amino acid sequence from SEQ ID NO:20 or SEQ ID
5 NO:22, so long as the domains exhibit a~pro~l;ate hexokinase IV activity. In certain embodiments, it will be preferred to use the full-length hexokinase IV sequence in creating a HK:GK chimera, as this will be one of the most straightforward approaches.
In constructing a recombinant gene that encodes such a chimera or fusion protein, one may use a contiguous nucleic acid sequence from SEQ ID NO:19 or SEQ ID NO:21.
o A currently prefelled example of such a gene construct is that which comprises the contiguous nucleic acid sequence of SEQ ID NO:9.

In addition to truncated hexokinases and hexokinase-glucok-inase chimeras low Km hexokinases that have been subjected to mutagenesis to render them catalytically inactive may also be used in displacing endogenous hexokinase from the 5 mitochondria. In this way, a substantially full-length low Km hexokinase enzyme may be used, so long as it does not exhibit any significant enzymatic activity. Hexokinase enzymes may be mutated both chemically and by using molecular biological techniques to introduce amino acid changes at specific points in the protein sequence.

The range of m~mm~ n cells that may be used in connection with the present 20 invention is virtually limitless. By way of example only, one may mention neuroendocrine cells and secretory cells, as exemplified in certain circumstances by insulinoma cells. Both glucose-responsive and non-glucose-responsive cells are also contemplated for use herewith.

In certain embodiments, the present invention provides engineered cells that 25 secrete insulin in response to glucose, which cells comprise an inhibitor of a low Km hexokinase, the inhibitor selected from:

(a) an agent that stimulates the production of trehalose-6-phosphate;

W O 97/26357 PCTrUS97/00787 (b) a low Km hexokinase-specific ribozyme; or ~- (c) an agent that competitively reduces low Km hexokinase activity;

wherein said inhibitor is present in an amount effective to reduce the lowKm 5 hexokinase activity of said cell.

Such engineered cells will generally comprise at least one of a recombinant hexokinase IV gene, a recombinant insulin gene and/or a recombinant GLUT-2 gene.In ~ler~lled embotliment.~, where the cell comprises a hexokinase IV gene and/or a o GLUT-2 gene, these genes will be an islet isoform of such genes. In general, it is preferred to introduce the recombinant gene into the cell by means of a recombinant vector.

In general, the cells for use in the present invention may be derived from any m~mm~ n cell, including human cells. The cells may produce a desired product, 5 such as being a hybridoma that produces an antibody. Further, any cell in accordance with the present invention may be a cell that further comprise a recombinant gene that expresses a selected protein. The foregoing insulin-secreting cells are just oneexample of this concept.

Any one of an extremely large number of therapeutic proteins could be 20 produced in a recombinant host cell of the present invention. All such cells fall within the scope of the invention so long as they comprise an inhibitor of a low Km hexokinase. In certain embodiments, the cells will be secretory cells that comprise a recombinant gene that expresses a selected protein that is secreted. The secreted protein may be one that is ordinarily secreted by the particular cell type or one that 25 has been introduced into such a cell for the purposes of over-production and/or cell-based delivery.

Further cells of the invention are cells that comprise a recombinant gene that expresses a selected protein, wherein the gene is under the control of a promoter wo 97l26357 PCT/US97tOo787 that is responsive to a particular agent, hormone or secretagogue, and wherein the cells produce the selected protein in response to the secretagogue. Cells chat comprise a recombinant gene under the control of the insulin gene promoter are one example, wherein the cells produce the selected protein in response to glucose.

s However, cells that col~Lilulively produce one or more desired proteins are also included within the invention. As are cells that secrete products in response to one or more agents that are not the primary secretagogue, or agents that are not even physiologically relevant. These cells are exemplified in part by cells that secrete insulin in response to a non-glucose secretagogue, such as cells that secrete insulin in 0 response to forskolin, dibutyryl cAMP or isobutylmethylx~nthin~ (I13MX). These cells may also cell secretes insulin in response to glucose.

Cells that are capable of forming secretory granules are therefore preferred in certain aspects of the invention. Such cells are exemplified by neuroendocrine and endocrine cells; such as thyroid and pihlitary cells, as filrther exemplified by AtT-20 cells, GH-1 and GH-3 cells; and cells derived from pancreatic ,B cells, including inclllinoma cells and cells such as TC, HIT and RIN cells. CTG-5 and CTG-6 cells are further examples. Such cells may secrete recombinant in~l-lin, or may be cells wherein at least a portion of the insulin produced is encoded by a recombinant insulin gene. The cells may also comprise a glutamic acid decarboxylase gene, which may be present in a recombinant form.

The TPS, ribozyme and hexokinase displacement agents described above may be combined in any given cell in order to effect even greater hexokinase inhibition. Any one or more of the foregoing methods may also be combined ~,vithother methods of inhibiting hexokinase. For example, combination of these methods along with the expression or over-expression of glucokinase is particularly contemplated.

It is also contemplated that any or all of the foregoing agents could be used ina cell in which a low Km hexokinase gene has been interrupted using well-established knockout technology, such as homologous recombination, random integration and/orRNA-DNA oligonucleotide targeted modification. Combination of any of the s foregoing agents along with an antisense RNA molecule that is complementary to, and that binds to, a low Km hexokinase gene or RNA transcript is also contemplated within the invention.

Any of the cells of the invention may be comprised within a population of like cells. The cells or cell populations may be formulated in ph~rm~eutically acceptable o media or vehicles or may be encapsulated within biocompatible coatings and/or semi-permeable devices. The cells or cell populations of the invention may also be contained within an implantable medical or Vetelil~ly device, optionally housed wlthin an animal or human subject. Further, the cells or cell populations may begrown in contact with a solid support, such as gelatin beads, and may be contained I S within a column or within a bioreactor.

The present invention further provides an engineered m~mm~ n cell derived from a cell that forrns secretory granules, the cell secreting insulin in response to glucose and comprising a first recombinant gene selected from the group consisting of hexokinase IV, insulin and GLUT-2 and a second recombinant gene selected from the 20 group consisting of:

(a) a recombinant gene that expresses a protein that stim~ tes the production of trehalose-6-phosphate;
(b) a recombinant gene that expresses a lowKm hexokinase-specific ribozyme; and 2s (c) a recombinant gene that expresses an agent that competitively reduces - low Km hexokinase activity.

.

W O 97126357 PCTrUS97/00787 The first recombinant genes of the glucose-responsive cells are preferably isletisoforms of hexokinase IV and GLUT-2 genes. The glucose-responsive cells may also comprise surprisingly high levels of insulin, such as being cells that contain a recombinant GLUT-2 gene. Cells that contain and produce interm~ te levels of 5 insulin, e.g., that contain at least about 1 mUnit of human insulin per million cells, and that produce media that contains at least about S Units of human insulin perliter of media, are also provided.

The invention further includes glucose-responsive cells or populations thereof o that are comprised within an artificial ~ cell device, such as being positioned within or ellca~?sulated by a selectively permeable, biocomr~tible membrane or coating. The - cells may be microenca~s-llated, such as by hydrogel or ~lgin~t~ co~tin~, and may be - positioned within or encapsulated by a se l~e~ eable capsule; seeded within a semipermeable fiber; positioned in a tubular semipermeable ~ n~lalle, optionallywithin a protective housing, further optionally wherein each end of the tubular Illc:~nblalle is ~ rh~d to an arterial graft that extends beyond the housing and joins the device to the vascular system of an animal as an arteriovenous shunt. Any such device may comprise a population of between about 1,000 and about 10,000 en~in~ered cells.
Also included within the invention are methods for m~king engineered cells that have reduced low Km hexokinase activity. Such methods generally comprise contacting a cell with a composition comprising an inhibitory agent characterized as:

(a) an agent that stimulates the production of trehalose-6-phosphate;
(b) a low Km hexokinase-specific ribozyme; or (c) an agent that competitively reduces low Km hexokinase activity.

In general, the inhibitory agents will be introduced into the cell by means of arecombinant gene or vector that expresses the inhibitory agent. Preferred cells that W O 97t26357 PCT~US97/00787 can be generated in this manner include cells that comprise a recombinant gene that - expresses a selected protein, such as insulin, and cells that further secrete the encoded protein.

Many methods of using the cells of the present invention are provided herein.
5 A first method is that for providing glucose-responsive insulin secreting capacity to a m~mm~l or human subject. This method generally comprises ~rlmini~tering to the m~mm~l or patient, a biologically or therapeutically effective amount of a population of engineered cells that secrete insulin in response to glucose, preferably that secrete human insulin in response to glucose, the population comprising cells that have a o reduced low Km hexokin~e activity and which cells comprise:

~a) an agent that stimulates the production of trehalose-6-phosphate, (b) a low Km hexokinase-specific ribozyme; or (c) an agent that competitively reduces low Km hexokinase activity.

The engineered cells will preferably be provided to the animal or patient in theforrn of a semipermeable device or following encapsulation in a biocompatible coating. The cells may be implanted, e.g., illLl~eliLoneally or subcutaneously, or may be implanted within a selectively permeable device that is connt-.cte~l to the vasculature of the ~ h Glucose-responsive, insulin secreting cells of the present invention are therefore int~ntl.o,(l for use in in vivo methods of producing insulin. Uses of such cells in the l,lep~aLion of a mP~ m~t for use in treating diabetes are also provided, as is the use of such cells in all such in vivo treatment methods.

The cells of the present invention, whether or not they are glucose-responsive, may also be characterized as cells for use in in vitro methods o~ producing insulin.
Uses of such cell in the pl~paldLion of a cell suspension for use in an insulin-producing bioreactor are thus provided.

W 097/26357 PCTrUS97/00787 A further method of the invention is therefore a method for producing insulin, preferably human insulin, which method generally comprises the steps of:

(a) culturing an engineered cell that secretes insulin, the cell having a reduced low Km hexokinase activity and comprising:
(i) an agent that ~tim~ tes the production of trehalose-6-phosphate;
(ii) a low Km hexokinase-specific ribozyme; or (iii) an agent that competitively reduces low Km hexokinase activity;
and o (b) obtaining insulin from the cultured cell.

The "culturing" generally involves obtaining cells capable of secreting insulin, e.g., in response to glucose; growing the cells in culture; m~int~inin~ or stim~ tin~ the cells for a period sufficient to allow the cells to secrete insulin: and 5 collecting the media that has been in contact with the cells in order to collect or purify the secreted insulin.

The en~in~ered cells may secrete insulin in response to a non-glucose secretagogue, wherein the cells are cultured in the presence of a non-glucose 20 secretagogue. The cells may also secrete insulin in response to glucose, wherein the cells are cultured in the ~,~sellce of glucose, e.g., wherein the buffer contains S rnM
glucose. The cells may be contacted with a non-glucose secretagogue and with glucose, either simultaneously or in any desired order. The cells may be gro~ incontact with a solid support, such as beads, and may be cont~in~l within a column or 25 a bioreactor.

In addition to cells that contain an inhibitor of a low Km hexokinase the present invention also provides compositions comprising the inhibitors themselves.

Therefore, another aspect of the present invention is a composition comprising an inhibitor of a low Km hexokinase, characterized as:

(a) a recombinant vector comprising a promoter operably linked to a gene that encodes a protein that stimulates the production of trehalose-6-phosphate, the promoter expressing the protein in a m~mm~liAn cell;
(b) a low Km hexokinase-specific ribozyme or a recombinant gene or vector that expresses said ribozyme; or (c) an agent that competitively reduces lowKm hexokinase activity or a recombinant gene or vector that ~yr~sses said agent.

Any of the foregoing compositions may be defined as a composition for use in the preparation of a ~ n cell that has a reduced low Km hexokinase activity.
Uses of any such composition in the p~aldtion of a m~mm~ n cell that has a reduced low Km hexokinase activity relative to the parent cell from which it is 1S prepared are also provided.

In yet still further embodiments, the present invention provides advantageous methods for inhibiting the growth rate of a cell, whether in vitro or in vivo. To inhibit the growth rate of a cell in accordance with the aspects of the invention, one would 20 simply reduce the low Km hexokinase activity in the cell, as exemplified by inhibiting hexokinase I and/or hexokinase II.

Any of the foregoing trehalose-6-phosphate generation, hexokinase-specific ribozymes and agents that competitively reduce low Km hexokinase activity, e.g., by displacing hexokinase from the mitochondria, may be used to inhibit low Km 25 hexokinase with a view to inhibiting the growth rate of a cell.

In addition to the foregoing methods, any other methods known to those of skill in the art may also be employed in these aspects of the invention. By way of - example only, one may mention methods to reduce hexokinase activity by . . .

W 097/26357 PCTr~S97/00787 interruption of a low Km hexokinase gene, as may be achieved by homologous recombination or random integration, and also, the use of antisense technology.

Regardless of the particular method or methods employed, it will generally be plere led to contact the target cell with a recombinant gene or vector that expresses s the active inhibitory agent or construct. Providing to the cell a recombinant glucokinase enzyme in this manner is another method that is contemplated to be use~ul in the generation of a cell with a reduced gro~vth rate.

As described earlier, the range of cells, including hu~nan origin cells, that may be manipulated in this manner to produce slower-growing cells is virtually 0 inexhaustible. The cells may or may not comprise a recombinant gene that expresses a selected protein, and may or may not secrete a natural or recombinant protein product, either constitutively or in response to a specific signal or stimulatory agent.
The cells may be derived from a hybridoma that produces antibodies.

Accordingly, further cells of the invention are those tnat are characterized as cells that have been manipulated, by any means, to lower the activity of a low Km hexokinase. These cells are int~.ntlecl for use in the pl~palaLion of a population of cells that exhibit a reduced growth rate or are defined as "a slow-growing population of cells". Such cells may further be used in the pl~aldtion of a population of cells for in vitro or in vivo protein production or in the preparation of a "protein-producing population of cells".

The cells may be used in methods of producing one or more selected proteins, which methods comprise culturing a population of growth rate-inhibited cells that express the selected protein, the growth rate-inhibited cells having a reduced low Km hexokinase activity. The growth rate-inhibited cells may express, e.g., insulin, or may produce an antibody.

W O 97/26357 PCTrUS97/00787 These growth rate-inhibited cells may also be ~-lmini.~tered to an animal or - human subject in order to provide to the animal or patient a selected protein or polypeptide. In such embodiments, one would a~lmini.~ter to an animal or human abiologically or therapeutically effective amount of a growth rate-inhibited cell or 5 population of such cells, wherein the cell or cells express the selected protein that one wishes to deliver to the animal or human subject. Using cells with low Km hexokinase activity in this manner is contemplated to be advantageous in that the cells are likely to survive for longer periods within the host animal. Preferably, the growth rate-inhibited cells will be enc~psul~ted in a biocompatible coating prior to ~lmini~tration 0 to the animal or human subject.

BRIEF DESCR~PTION OF THE DRAWINGS

The following drawings fonn part of the present specification and are included to further demonstrate certain aspects of the present invention. The invention may be better understood by reference to one or more of these drawings in combination with s the detailed description of specific embo~iment~ presented herein.

FIG. 1. Western analysis of hexokinase N-terminal half expression in RIN
1046-38 cells. Whole cell lysates were resolved by SDS-PAGE and irnmunoreactive proteins were detected using a rat hexokinase I specific antibody. Lysates prepared from parental RIN 1046-38 and GK-8 cells (a RIN clone overexpressing rat 20 glucokinase) are in lanes 1 and 2 as controls. Endogenous hexokinase I runs with an a~ ~ent molecular weight of greater than 100 kD on this gel system. Lysates fromfive monoclonal RIN lines expressing the hexokinase N-tPrrnin:~l half are in lanes 3 through 7.

FIG. 2. Measurement of glucose phosphorylating activity in 293 cell extracts 2s which were transiently transfected with chimeric constructs. Assays were done either at 3 or 20 mM glucose in the absence or presence of glucose-6-phosphate (G6P) asindicated. 293 cells were transiently transfected with plasmids expressing the wild W O 97/263~7 PCT~US97/00787 type HK-I (HK), HK-isletGK fusion (HK/GK), or wild type islet GK (GK) and compared with nontransfected 293 cells (Parental). Activity is reported as micromoles glucose phosphorylated per gram protein per minute.

FIG. 3. Glucose usage at low and high glucose concentrations in parental RIN
1046-38 cells compared to RIN cells o~ielCxl!-essing glucokinase (RIN 40-2c).

FIG. 4. Hexokinase ribozyme transgene expression in RIN cells. Northern analysis of RNA isolated from two independent G418 resistant pools of RIN 1046-38 cells stably transfected with pCMV8/HKRIBO1+2/IRES/NEO (EP113/lA and B). A
probe specific for the neomycin resistance gene detects the HKribozyme/IRES/Neo o message at the expected molecular weight of 1100 base pairs in both polyclones with no detectable signal in the parental RIN 1046-38.

FIG. 5: Map of wild-type HKI allele, vector for replacement, and disrupted HKI allele. Arrows indicate the direction of transcription of hexokinase 1 (E1 for exon 1 shown), neomycin resistance (positive selection gene) and the hsv-tk (negative selection gene). Oligos 1 (SEQ ID NO:39), 2 (SEQ ID NO:41), 3 (SEQ ID NO:40) and 4 (S~Q ID NO:42) used in PCRTM analysis are indicated. Capital bold letters indicate restriction enzyme sites introduced by the knock-out vector and lower case letters indicate sites in the endogenous gene. b, B=BamHI; e= EcoRI; k= KpnI;
N =NotI; x, X-X~oI. The 16 kb KpnI fragment cloned from RIN 1046-38 genomic 20 DNA is indicated as well as the probe used in genomic Southerns (FIG. 6).

FIG. 6: Genomic Southern confirming hexokinase I gene disruption. The probe (hatched rectangle, Fig. 5) is a 1 kb PstI fragment upstream of the recombination site. Genomic DNA was digested with NotI and ~;coRI. The DNA in each lane is as follows: first lane, R~N 1046-38, second lane, RIN-52/17 cont~ining a 2s randomly integrated HKI replacement vector; and lane 3, RIN-52117 cont~ining a disrupted allele of the ~KI gene (clone 86/X4).

W O 97126357 PCTrUS97/00787 FIG 7: Measurement of 3[H] glucose usage at low glucose concentration in - cells expressing HK/GK fusion protein, clone BG 139/2.1 and 139/2.18. and cells expressing N-terminal half of hexokinase, clone BG119/2.6 and 119/2.15. Assays were perforrned at glucose concentration of 0.01, 0.05 and 0.5 mM respectively. The s usage is compared with that of parental RIN 38 cells and human insulin expressing R5C.I-17 cell line. Activity is expressed as llmole glucose per gram protein perminute.

FIG 8. Western analysis of Chimeric HK/GK fusion protein expression. A
novel fusion protein with an expected molecular weight of 105 kD is recognized using o glucokinase specific antibody.

FIG 9: Measurement of glucose phosphorylation activity in cells expressing HK/GK fusion proteinj clone BG 139/2.1 and 139/2.18. The assay is performed at 3and 20 mM in the presence and absence of 10 mM glucose-6-phosphate. The activityis compared with that of human insulin expressing RIN 17 cell line and glucokinase s overexpressing cell line BG40/110. Activity is expressed as ~lmole glucose per gram protein per minute.

FIG 10: Measurement of endogenous rat insulin secretion in cells expressing HK/GK fusion protein, clone BG 139/2.1 and 139/2.18. Assays were performed with 0.1 mM IBMX at glucose concentration of 0, 0.05, 0.25, 0.5, 1, 3, and 5 mM
20 respectively in the presence and absence of 2 mM 5-thioglucose. Results are expressed as nanograms insulin per gram protein per minute.

FIG 11: Thin Layer chromatographic assay for threhalose. TPS (trehalose phosphate synthase) expressing cell line BG120 was used. Two BG 120 cell sampleswere cultured at 37~ C and 42~ C respectively with 14C glucose for an hour prior to 2s TLC analysis.

W 097/26357 PCTrUS97/00787 DI~TAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

The present invention relates to several compositions and methods for reducing the activity of a particular class of enzymes, known as hexokin~es, in m~mmz~ n cells. Three general groups of compositions and methods for achieving s this end are described. These methods may, of course, be combined with other methods of hexokinase inhibition, such as expression of glucokinase, and with other cellular engineering methods.

The invention relates first to compositions and methods for displacing cellular hexokinases from their mitochondrial binding site or sites. As mitoçhon-lri~l binding 0 enhances the activity of hexokin~es, displacement is an effective method of inhibition. In certain aspects, an inactive hexokinase variant or fragment that still binds to mitochondria is supplied to a cell. In other aspects, the inactive hexokinase or hexokinase fragment is fused to an active glucokinase or portion thereof, resulting in a displacement-replacement method. In this embodiment, the chimeric enzyme not 5 only displaces cellular hexokinases from their mitochondrial site, thus inhibiting hexokinase, but also provides to the cell additional copies of the glucokinase enzyme that operates in glucose sensing. It is preferred that the engineered hexokinase or hexokinase-glucokinase chimera be provided to the cell by means of a eukaryotic expression vector that is introduced into the cell and that directs expression of the 20 desired protein.

Next, the present invention concerns compositions and methods for stimulating the production of the compound trehalose-6-phosphate in a m~mm~ n cell. The yeast enzyme trehalose-6-phosphate synthase (TPS 1 ) is currently the preferred agent for use in generating trehalose-6-phosphate, which is a metabolic 25 inhibitor of hexokinase activity. Engineering of the yeast gene encoding TPS 1 into a eukaryotic expression vector and introduction of the vector into a m~mm~ n cell is generally the preferred method of producing the trehalose-6-phosphate inhibitor.

W O 97/26357 PCTrUS97/00787 The third general aspect of the invention relates to compositions and methods for inhibiting hexokinase at the messenger RNA (mRNA) level. In these aspects, the invention provides hexokinase-specific ribozymes that destroy hexokinase mRNA
species. These are fragments of ribonucleic acid that comprise a sequence s complementary to a specific portion of one or more hexokinase mRNAs and that also contain a second segment of ribonucleic acid with RNA degradative catalytic activity ("catalytic ribozyme"). Again, it is preferred to engineer the hexokinase-specific ribozyme into a eukaryotic expression vector and to introduce the vector into a m~mm~ n cell, where it directs the destruction of hexokinase mRNA and reduces 0 expression of the hexokinase enzyme.

Any of the three aspects of the invention may be combined together and/or with other methods for inhibiting hexokinase. One such method is that for stimulating the production of the compound glucose-6-phosphate in a m~mm~ n cell. The enzyme glucokinase, the high Km member of the hexokinase gene family, is currently 5 the preferred agent for use in generating glucose-6-phosphate, which is a metabolic inhibitor of low Km hexokinases that are inhibited as disclosed herein. Engineering of a m~mm~lian glucokinase cDNA or gene into a eukaryotic expression vector and introduction of the vector into a m~mm~ n cell is generally the ~lerell~d method of producing the glucose-6-phosphate inhibitor.

20 A. Hexokin~

Glucose enters m~mm~ n cells through glucose transport proteins.
Following entry into the cell, the first step of glucose metabolism is its phosphorylation to glucose-6-phosphate, which is catalyzed by one of a family ofhexokinase enzymes. There are four known members of the family, termed 25 hexokinases I, II, III, and IV (HKI, HKII, HKIII and HKIV; Wilson, 1985), which are encoded by separate genes (Schwab and Wilson, 1989; 1991; Thelan and Wilson, 1991). Hexokinases I, II, and III have similar kinetic and structural properties, while W O 97/26357 PCTrUS97/00787 hexokinase IV, also known as glucokinase (GK), is less related. Hexokinases I, II, and III are generally termed "low Km" hexokinases because they have a Km for glucose in the range of 10-50,uM, compared to approximately 6-8 mM for glucokinase (Wilson, 1985).

The low Km hexokinases have a molecular mass of approximately 100,000 Daltons. Gene cloning and arnino acid sequence analysis has revealed that the low Km hexokinases are comprised of two halves of homologous sequence. Glucokinase lacks this internal repeat, and is thus only half as large as the low Km enzymes. The two halves of the low Km hexokinases are commonly described as the C-terminal o "catalytic" domain and the N-terminal "regulatory" domain. The C-terminal domain retains full catalytic activity when expressed independently of the N-terminal domain and also exhibits allosteric inhibition by glucose-6-phosphate. It is believed that the glucose-6-phosphate allosteric site of the C-terminal domain is latent in the intact enzyme, and that allosteric regulation of the intact enzyme is conferred by the glucose-6-phosphate binding site of the N-termin~l "regulatory" domain (Wilson, 1 994).

Different members of the hexokinase gene family tend to be expressed in different m~mm~ n tissues. Thus, hexokinase I is expressed in brain, red blood cells, and many other tissues, hexokinase II is expressed mainly in muscle and fat, hexokinase III is expressed in lung, and glucokinase is expressed primarily in liver and pancreatic islet ~ cells. Transformed cell lines, such as those contemplated by the inventors for use in insulin replacement in diabetes generally express high levels of hexokinase I and II, irrespective of the hexokinase isoforms expressed in their primary tissue of origin (M~thl-p~ et al., 1995). For example, insulinoma cell lines derived 2s from islet ~ cells often contain 4-6 times more low Km hexokinase enzymatic activity than normal islet ~ cells (Ferber et al., 1994; Efrat et al., 1993) and studies performed by the inventors on one such cell line, RIN1046-38, reveals that the low Km hexokinase activity is contributed by expression of both hexokinases I and II, with no W O 97/26357 PCTrUS97/00787 detectable expression of hexokinase III. Thus, the methods described in this application are generally focused upon inhibition of the activities of hexokinases I and II, as these are the major low Km isoforms found in cell lines.

All four isoforms of rat hexokinase (I through III, and IV being glucokinase) have been cloned. The nucleic acid and amino acid sequences of each are includedherein as SEQ ID NO:13 through SEQ ID NO:22. Referring to the nucleic acid sequence first, these are HKI, SEQ ID NO:13 and SEQ ID NO:14; HKII, SEQ ID
NO:15 and SEQ ID NO:16; HKIII, SEQ ID NO:17 and SEQ ID NO:18; rat islet GK, SEQ ID NO:19 and SEQ ID NO:20; and rat liver GK, SEQ ID NO:21 and SEQ ID
lo NO:22.

Hexokinase isoforms have also been cloned from many other species that are known to have similar properties to the rat hexokinases referenced above. These include human isoforms of HKI(GenBank Accession # M75126 and X69160), HK II
(#Z46376), HK III (#U42303) and GK (#M88011, M69051, and M90299), yeast 5. cerevisiae HKs(#M14410,M11184andM11181)andGK(#M24077),mouseHK
(# J05277) and GK (# L38990), bovine HK (# M65140), Plasmodium HK
(# M92054) and E coli GK (# U22490). It is contemplated that the foregoing HK and GK sequence inforrnation could be employed in designing and creating inhibitory constructs for use as disclosed herein, although the use of the rat HK and GK
sequence information is currently preferred.

B. Mitochondrial Binding Low Km hexokinases are distinguished from glucokinase in that they are allosterically regulated by glucose-6-phosphate and by binding to mitochondria (Wilson, 1968; 1973; 1985; 1994). Micromolar concentrations of glucose-6-phosphate inhibit the activities of hexokinases l, II, and III, but appreciable inhibition of glucokinase requires glucose-6-phosphate concentrations in excess of 10 mM.
Binding of hexokinases I and Il to mitochondria alters their kinetic properties (Wilson, 1968; 1985; 1994), while glucokinase does not appear to be capable of binding to mitochondria at all (Becker et al. 1996).

When bound to mitochondria, hexokinase I undergoes an increase in affinity (a decrease in Km) for its substrate ATP (Wilson, 1985). In addition, the enzyme s becomes far less inhibitable by glucose-6-phosphate, as indicated by a several-fold increase in Kj for this ligand (Wilson, 1985). Studies with hexokinase I have revealed the existence of two types of mitochondrial binding sites (Kabir and Wilson, 1994).
Glucose-6-phosphate causes displacement of a l)lopol~ion of mitochondrially-bound hexokinase from one type of site. The enzyme that remains bound to mitochondria o after glucose-6-phosphate treatment is considered to occupy the second site, from which it can be removed by treatment with 0.5 M KSCN.

It has been known for some time that limited digestion of hexokinase I with chymotrypsin yields an enzyme fragment that retains catalytic activity but that loses its capacity for mitochondrial binding, and that enzyme treated in this manner is 5 lacking in a portion of its N-terminal domain (Polakis and Wilson, 1985). The N-t~nnin~l sequences of both hexokinases I and II are relatively hydrophobic, and it has been shown that the hydrophobic N-terrninus of hexokinase I is capable of insertion into the lipid bilayer of the mitochondrial membrane (Xie and Wilson, 1988).

Subsequently, Gelb et al., (1992) demonstrated that a chimeric protein con~ ting of the N-tçnninzll 15 amino acids of hexokinase I fused to chloramphenicol acetyltransferase was capable of binding to rat liver mitochondria, and that this binding was competitive with authentic hexokinase I (Gelb etal. 1992). Although Gelb etal. (1992) have suggested that the first 15 amino acids of hexokinase aresufficient to target such a chimeric protein to mitochondria, these studies were not designed to attempt to alter metabolic regulation in target cell lines. Thus, the elements required to effect displacement of endogenous hexokinase from its W 097~6357 PCTAUS97/00787 mitochondrial binding site were not unequivocally identified in the study of Gelb et al. as discussed below.

While the results of Gelb et al. (1992) argue for the importance of this small N-terminal segment in targeting of hexokinase to mitochondria, others have suggested that other regions of the molecule may also be important in stabilizing the interaction (Polakis and Wilson, 1985; Felgner and Wilson, 1977; Smith and Wilson, 1991).
This is based on studies showing that hexokinase I binding to rnitochondria is stabilized by Mg2, an effect likely reflecting electrostatic interactions between the enzyme and the outer mitochondrial membrane (i.e., not involving the N-terminal 15 o amino acids that are intercalated into the membrane). Therefore, the mitochondrial binding regions of HK have not been clearly identified to date, and there is even less information available on the issue of HK displacement.

At least part of hexokinase binding to mitochondria is via interactions with members of a family of proteins known as voltage-dependent anion channels (VDAC)s or porins (Fiek et al., 1982; Linden et al., 1982). These porins form a channel through which metabolites such as ATP and various anions traverse the outer mitochondrial membrane. ~inding of hexokinases to porin thus may ensure a supply of intramitochondrially-generated ATP as substrate.

Constructs of the present invention may comprise the N-terrninal 15 arnino acids of a hexokinase enzyme, preferably hexokinase I or II, since this segment should be easily expressed in cells and retained as a stable peptide. Constructs compri~ing the entire N-terminal domain of either hexokinase I or hexokinase II, or the intact, full-length hexokinase I or II proteins that have been rendered inactive by site-directed mutagenesis of amino acids that are important for the enzyme's catalytic function are also contemplated. Constructs based upon hexokinase I will be particularly, or even exclusively, ~er~lled in certain embodiments.

W O 97/263~7 PCT~US97/00787 The reason for preferring the N-tt~rmin~l domain construct is that this element seems to comprise a complete structural domain, based upon studies in which thisdomain can be expressed in bacteria and shown to bind glucose-6-phosphate (Wilson, 1994, Arora etal., 1993; White and Wilson, 1987; White and Wilson, 1990). This s suggests that the intact N-termin~l domain should fold and form a structure analogous to its structure in the full-length hexokinase I or II protein. As the inventorscontemplate that this structure mediates attachment of the intact hexokinase protein to mitochondria, the intact, correctly folded N-termin~l domain is a preferred embodiment of this invention.

o For embodiments involving the N-terminal domain, a segment comprising amino acids 1-455 is pl~rell~d because of a naturally occurring NcoI restrictionenzyme site in the DNA sequence corresponding to amino acid 482. This NcoI site allows the fragment encoding the N-terminal domain to be easily isolated and subcloned, and also allows direct fusion of the N-terminal domain of hexokinase to the intact functional sequence of glucokinase via an NcoI site located at the AUG start codon of this gene.

Of course, it will be understood that peptides, polypeptides and protein domains of any intermediate length between about 15 amino acids and about 455 arnino acids, and longer proteins, may be used in displacing endogenous hexokinase from the mitochondria. Accordingly, constructs comprising about 20, about 50, about 100, about 150, about 200, about 300 or about 400 amino acids in length may be used for these purposes. It is also cont~lnl)lated that an intact hexokinase protein that is rendered catalytically inactive will interact with mitochondria in a manner identical to the active proteins. Expression of such a HK variant is therefore another method for 2~ inhibiting endogenous HK (Baijal et al., 1992). Inactivated hexokinase proteins include those that have been subjected to chemical mutagenesis and also those produced using molecular biological techniques and recombinant protein production.

W O 97126357 PCTrUS97/00787 The identification of appropriate polypeptide regions and/or particular amino acid sites that may be targeted in order to inactivate hexokinase will be known to those of skill in the art. The crystal structure of certain hexokinase enzymes is available. Coupling the crystal structure information with a comparison of the 5 primary sequence information for various distinct hexokinases will allow one to identify those regions and sites that are important for hexokinase activity, such as the binding sites for ATP, glucose and glucose-6-phosphate. This has been discussed in detail in various publications, such as Printz etal. (1993), incorporated herein by reference, which information can be used in connection with preparing mutants and o variants for use herewith. Deletion of certain amino acids or peptide segments, as may be achieved by molecular biological manipulation, is another contemplated method for preparing inactive hexokin~e~

The enzyme glycerol kinase is another protein thought to bind to mitochondria via porins or VDACs (Adams et al., 1991). Glycerol kinase catalyzes formation ofglycerol phosphate from glycerol, using ATP as phosphate donor. Thus, expressionof glycerol kinase in cell lines represents an alternative to expression of inactive hexokinase proteins or fragments thereof which is also contemplated for use in the displacement of endogenous lowKm hexokinases from their norrnal mitochondrial binding site.

A particularly powerful method of inhibiting hexokinase within a m~mm~ n cell involves the displacement of hexokinase from the mitochondria and the concomitant provision of active glucokinase. This is advantageously achieved by providing to the cell a hexokinase-glucokinase chimera or fusion protein, in which the hexokinase portion is capable of binding to the mitochondria and ye~ does not exhibit 2s hexokinase catalytic activity, and in which the glucokinase portion is catalytically active. Chemically-fused polypeptides are a possibility, but recombinant proteins are naturally most p~ ed for use in this manner. The identification of app~ liate hexokinase fragments for use in such a chimera has been described herein above.

W O 97/26357 PCTrUS97100787 In terms of the glucokinase portions of these fi~sion proteins, any glucokinase-derived sequence that contains enough primary sequence information to confer glucokinase catalytic activity to the chimera will be useful in this context. However, it will often be preferred to use the entire glucokinase enzyme as this is more s str~ ro~ d in terms of methodology. Again, one may look to the extensive information available in various published references in order to assist with the identification of al~plo,uliate glucokinase enzymes or fragments thereof.

At this point, a discussion of the kinetic l~lopel lies of hexokinase and glucokinase is relevant. It will be understood that in providing a functional equivalent o of a hexokinase or glucokinase enzyme, one would desire to provide a protein that has substantially the same kinetic parameters as the native enzyrne. Equally, in providing a hexokinase mutant that is devoid of catalytic activity, one would provide an enzyme that is either completely inactivated or whose kinetic parameters have been shifted so that it is, in fact, distinct from the native enzyme.

Table 1, below, sets forth a comparison of glucokinase with hexokinases I-III.
This inforrnation may be used in order to determine whether any particular variant is "equivalent", and also, to confirrn that any inactive mutants have indeed been properly disabled.

A Comparison of Glucokinase With Hexokinases GK HK I-III
Km glucose 5-12 mM 0.02-0.13 mM
Km ATP 0.5 mM 0.2-0.5 mM
Kj G-6-P 60 mM 0.2-0.9 mM
Molecular weight 52 kD 100 kD
Substrate plefe~ellce' Glucose Mannose 0.8 1-1.2 W 0971263~7 PCTrUS97/00787 TABLE 1 (continued) GK HK I-III
2-Deoxyglucose 0.4 1-1.4 Fructose 0.2 1.1-1.3 lThe activity of glucose as a substrate is taken as 1. The other numbers are expressed in relation to the activity of glucose as a substrate.

C. Trehalose-6-Phosphate Metabolism In Bakers yeast, glucose phosphorylation is also catalyzed by a family of 5 hexokinases that are related in sequence and function to the m~mm~ n hexokinase gene family. Yeast cells, however, contain other genes involved in carbohydrate metabolism for which there are no m~mm~ n counterparts. The trehalose-6-phosphate synthase/trehalose-6-phosphate phosphatase complex is an example of such an activity.

o The trehalose-6-phosphate synthase/phosphatase complex catalyzes the formation of trehalose, a disaccharide of two glucose molecules (a-D-glucopyranosyl (1-1) a-D-glucopyranoside) by first forming trehalose-6-phosphate by cond~n.c~tion of t~,vo molecules of glucose-6-phosphate and then using its phosphatase activity to remove the phosphate groups to generate free trehalose (Bell et al., 1992). Trehalose is thought to represent a form of storage polysaccharide in yeast, bacteria and other lower org~nicm.c, but neither the trehalose-6-phosphate synthase enzyme complex nor its products trehalose-6-phosphate or free trehalose are known to be present in m~mm~ n cells.

Blasquez et al. have demonstrated that trehalose-6-phosphate can inhibit the activity of hexokinases from a variety of different or~ani.cm.c, including rat brain, which expresses predomin~ntly hexokinase I (Blasquez et al., 1993). This has led to the suggestion that trehalose-6-phosphate may be an important regulator of glycolytic flux in yeast cells. Consistent with this notion, the yeast gene known as cif-l was W O 97n63s7 PCTrUS97/00787 originally cloned from yeast that are unable to grow in glucose (Blasquez et al., 1993) and subsequently shown to be identical to the smallest subunit (56 kD) of the trehalose phosphate synthase/trehalose-6-phosphate phosphatase complex (Bell et al., 1992). Cells lacking in the CIF-l gene product exhibit rapid depletion of ATP, presumably because they are unable to produce trehalose-6-phosphate that normally serves to moderate yeast hexokinase activity. It is believed that the 56 kDa CIF-I
gene product encodes the trehalose phosphate synthase activity (Bell ef al., 1992).

One of the three general methods described in this application for inhibiting low Km hexokinase activity in m~mm~ n cells is to express an enz,vme, such as yeast 0 trehalose-6-phosphate synthase, that will allow trehalose-6-phosphate to accurnulate.
This will have two effects. First, the accurnulated trehalose-6-phosphate will serve to allosterically inhibit endogenous low Km hexokinase activity. Second, where trehalose-phosphate synthase is used, this enzyme will divert glucose-6-phosphate into trehalose-6-phosphate at low, non-stimulatory glucose concentrations where low K" hexokinases but not glucokinases are active, thereby "short-circuiting" metabolic n~lin~; for insulin secretion, which is thought to require ATP produced l~ia further glucose metabolism (Newgard and McGarry, 1995).

A currently preferred gene for use in these aspects is the S. cerevisiae gene encoding trehalose-6-phosphate synthase (TPSl) (nucleic acid, SEQ ID NO:l, and 2~ encoded arnino acid, SEQ ID NO:2). Genes from several other org~ni~m~ encoding trehalose-6-phosphate synthase have been isolated and the amino acid sequences deduced. These include E. coli (GenBank Accession # X69160), S. pombe (# Z29971), Mycobacterium laprae (~ U15187) and Aspergillus niger (# U07184). Itis contemplated that any of the foregoing or other biological functional equivalents 2~ thereof may be used in the context of the present invention.

W 097126357 PCT~US97/00787 D. Hexokinase Inhibition at Nucleic Acid Level Several different ribozyme motifs have been described with RNA cleavage activity (reviewed in Symons, 1992). Examples that would be expected to functionequivalently for the down regulation of low Km hexokinases include sequences from 5 the Group I self splicing introns including tobacco ringspot virus (Prody et al., 1986), avocado sunblotch viroid (Palukaitis etal., 1979 and Symons, 1981), and Lucerne transient streak virus (l~orster and Symons, 1987). Sequences from these and related viruses are referred to as hammerhead ribozymes based on a predicted folded secondary structure.

0 Other suitable ribozymes include sequences from RNase P with RNA cleavage activity (Yuan etal., 1992, Yuan and Altman, 1994), hairpin ribozyme structures (Berzal-Herranz etal., 1992; Chowrira etal;, 1993) and hepatitis ~ virus based ribozymes (Perrotta and Been, 1992). The general design and optimization of ribozyme directed RNA cleavage activity has been discussed in detail (Haseloff and Gerlach, 1988, Symons, 1992, Chowrira, et al., 1994, and Thompson, et al., 1995).

The other variable on ribozyme design is the selection of a cleavage site on a given target RNA. Ribozymes are targeted to a given sequence by virtue of annealing to a site by complimentary base pair interactions. Two stretches of homology arerequired for this targeting. These stretches of homologous sequences flank the 20 catalytic ribozyme structure defined above. Each stretch of homologous sequence can vary in length from 7 to 15 nucleotides. The only requirement for dçfining the homologous sequences is that, on the target RNA, they are separated by a specific sequence which is the cleavage site. For hammerhead ribozymes, the cleavage site is a dinucleotide sequence on the target RNA, uracil (U) followed by either an adenine, 2~ cytosine or uracil (A,C or U; Perriman, et al., 1992; Thompson, et al., 1995). The frequency of this dinucleotide occurring in any given RNA is statistically 3 out of 16.
Therefore, for a given target messenger RNA of 1000 bases, 187 dinucleotide cleavage sites are statistically possible. The message for low Km hexokinases targeted here are greater than 3500 bases long, with greater than 500 possible cleavage sites.

~ he large number of possible cleavage sites in the low Km hexokinases coupled with the growing number of sequences with demonstrated catalytic RNA
s cleavage activity indicates that a large number of ribozymes that have the potential to downregulate the low Km hexokinases are available. Designin~ and testing ribozymes for efficient cleavage of a target RNA is a process well known to those skilled in the art. Examples of scientific methods for designing and testing ribozymes are described by Chowrira etal., (1994) and Lieber and Strauss (1995), each incorporated by lo reference. Therefore, it will be understood that the sequences of SEQIDNO:3, SEQIDNO:4 and SEQIDNO:5 are exemplary and by no means limiting. The identification of operative and preferred sequences for use in hexokinase-targeted ribozymes is simply a matter of preparing and testing a given sequence, and is aroutinely practiced "screening" method known to those of skill in the art.

5 E. Combination of Inhibitory Methods Any of the three general methods of HK inhibition described above (mitochondrial HK displacement, trehalose-6-phosphate generation and anti-HK
ribozymes) may be combined with one another and/or with other engineering methods. It is particularly contemplated that these methods could be used in 20 combination with glucokinase overproduction. Glucokinase overproduction alone is even thought to be a useful method of inhibiting hexokinase, as set forth below.
Low Km hexokin~es, including hexokinases I and II that are present at high levels in m~mm~ n cell lines, are inhibited by glucose-6-phosphate. Thus, this invention also relates to methods for m~int~ining glucose-6-phosphate at high levels 2s in cell lines. The ~l~rell~d method for achieving con~i~tently high levels of glucose-~-phosphate in cells is to overexpress glucokinase in such lines.

Expression of glucokinase is considered advantageous for two distinct reasons.
First, as described in U.S. patent 5,427,940, expression of glucokinase is part of an advantageous method for engineering of glucose-stimulated insulin secretion in cell lines. Glucokinase expression is herein shown to have the added benefit of 5 m~int~inin~ high levels of glucose-6-phosphate to keep low Km hexokinases in an inhibited state. This advantage would become particularly relevant at glucose concentrations in the physiological range (4-9 mM), because glucokinase is active at these levels. Also, while glucokinase is a member of the hexokinase gene family, it is not itself inhibited by glucose-6-phosphate.

0 F. Advantages of Hexokinase Inhibition in M~m~ n Cells The various aspects of this invention focus specifically on reclllcing the levels of low Km hexokinase activity in m~mm~ n cells. A particular type of target cell is a neuroendocrine cell. There are at least two significant achievements accomplished by the hexokinase inhibition of the present invention, as set forth below.

1. Reduced Growth Rate In addition to the regulation of insulin secretion by glucose, the hexokinase gene farnily may also be important in the regulation of cell growth and proliferation.
As described above, increases in low Km hexokinase activity usually correlate with the kansformation of cells from a norrnal to cancerous phenotype. However, the 20 correlation has not been proven to exist as a cause and effect relationship. In addition, increases in mitotic activity are not universally linked to induction of low Km hexokinases. The activity of these enzymes did not increase in preneoplastic mouse ~B cell lines over-e~ es~ g simian virus 40 large T antigen (Tag; Radvanyi et al., 1993); nor are they universally elevated in fully transformed mouse ~ cells (Efrat et cll., 1993).

W O97/26357 PCT~US97/00787 The reduction of hexokinase activity in a cell line by any suitable method, including any of the novel methods disclosed herein, is contemplated to be of use in inhibiting cell growth. Hexokinase I was discovered to be a regulator of cell growth during the inventors' studies in which a RIN cell line (86/~4) that contains a disrupted 5 allele of the HKI gene was surprisingly found to grow about one-half as fast as clones cont~inin~ the normal compliment of two HKI wild-type genes.

A relationship between low Km hexokinase activity and cellu}ar growth rates has three important implications relative to the application of cell-based therapies.
First, from the perspective of iterative genetic engineering, an untimely or unregulated o decrease of hexokinase activity will potentially hinder the growth and selection of clones posses~in~ desired genotypes and traits. A cell line that over-expresses hexokinase I from a regulatable promoter may provide the optimal genetic background for engineering of gene targets. For example, a RIN cell line could be developed that transgenically expresses hexokinase under the control of the 5 tetracycline (Tet)-resistance operon regulatory system (Gossen and Bujard, 1992).
This e~yles~ion system allows powerful transcription of gene products and permits the ablation of gene expression in the presence of Tet and Tet derivatives. Efrat e~al.(l995) have demonstrated the feasibility of using this expression system toregulate large Tag gene expression. The expression of Tag caused transformation and 20 expansion of mouse ~ cells. A decrease of Tag expres~ion, by the in vitro or in vivo mini~tration of Tet, led to an inhibition of cellular proliferation.

A RIN or neuroendocrine cell line that expresses HKI from a repressible promoter could be further engineered to express high levels of human insulin, glucokinase, and GLUT-2. In addition, such a cell line would be an ideal host for the ~5 ablation or down regulation of low Km hexokin~e~ Such engineering could be pursued without the hindering complication of slowed growth. Following a series o~
desired genetic manipulations, the growth of the cells and the glucose sensing ability could be modulated by down regulating hexokinase expression.

A second implication of low Km hexokinase as a regulator of cellular growth concerns the use of engineered cells for in vivo therapies. It is envisioned that cell-based delivery will be conducted by maintenance of the cells in vivo in a perm-selective device. It is contemplated that cells with reduced levels of low Km s hexokinase activity will survive for longer periods of time in devices or capsules as a consequence of their reduced growth rates.

A third implication of low Km hexokinases as regulators of cellular growth involves the creation of novel ~ cell lines. The over~ ession of HKI by introduction of exogenous DNA into a primary ~ cell could be an essential ingredient 0 of the transformation process. NIH-3T3 cells, an immortalized cell line, showed increases in glycolysis and growth rates following transfection with low Km hexokinase (Fanciulli et al., 1994). In a plcf. l~cd embodiment, hexokinase I would need to be under the control of a promoter that can be down regulated. Such transcriptional regulation would allow the subsequent modulation of growth and glucose sensing.

2. Glucose-Regulatable Protein Secretion A second important reason for reducing hexokinase activity is that it will contribute to the development of engineered cells that exhibit glucose-regulatable protein secretion, the most important aspect of which is presenlly the physiologically 2n regulated release of insulin. Insulin release from the ~ cells of the islets of Langerhans in the pancreas is prominently regulated by the circulating glucose concentration. Glucose stimulates insulin release over the physiological range of glucose concentrations (approximately 4-9 mM), with the amount of insulin secreted being proportional to the rate of glucose metabolism (Newgard and McGarry, 1995).

25Glucose phosphorylation appears to play an important role in regulating glucose metabolism and insulin responsiveness (Meglasson and Matschinsky, 1986).Thus, while islet extracts contain approximately equal amounts of high Km W O 97/26357 PCTrUS97/00787 glucokinase and low Km hexokinase activities (Meglasson and Matchinsky, 1986;
Hughes et al., 1992), the hexokinases appear to be inhibited in intact islets, presurnably by glucose-6-phosphate, allowing the glucokinase activity to be predominant. Since glucokinase has a Km for glucose (approximately 6-8 rnM) that is s within the physiological range, it is ideally suited for regulating glycolytic flux and insulin release in proportion to the extracellular glucose concentration.

The concept of a regulatory role for glucokinase, which has been developèd over several years (Meglasson and Matschinsky, 1986; IVI~tshchinsky, 1990), is supported by recent genetic and molecular studies, in which reduced c~ression of0 glucokinase was shown to result in less robust glucose-stimulated insulin secretion (Froguel etal~, 1993; Efrat etal., 1994). Islet ~cells are also equipped with a specialized glucose transporter, GLUT-2, which like glucokinase is the high Km member of its gene family.

One of the present inventors has shown that GLUT-2 and glucokinase work in tandem as the "glucose sensing apparatus" of the ~ cell (U.S. Patent S,427,940;
Newgard etal., 1990). U.s. Patent 5,427,940, incorporated herein by reference, describes methods for conferring glucose sensing in neuroendocrine cells and cell lines by transfection of such cells with one or more genes selected from the insulin gene, the glucokinase gene and the GLUT-2 glucose transporter gene, so as to provide 20 an engin~.ered cell having all three of these genes.

The ovelex~lcssion of low Km hexokinases is known to exert a dominant effect on the glucose concentration threshold for insulin secretion. Overexpression of a low Km hexokinase from yeast in islet ~ cells of transgenic ~nim~l.s results in increased rates of low Km glucose metabolism and enhanced insulin release at 2s subphysiological glucose concentrations (Epstein et al., 1992; Voss-McGowan et al., Ig94). Similar changes were noted upon o~/elexL~Ics~ion of hexokinase I in isolated W 097/26357 PCTrUS97/00787 ~9 rat islets (Becker et al., 1994a) or in a well-differentiated insulinoma cell line called MIN-6 (Ishihara et al., 1994).

It has been shown that the neuroendocrine cell lines that are contemplated for use in engineering artificial ,~cells generally have significantly higher low Kmhexokinase activity than normal islet ~ cells (Hughes et al., 1992; Efrat et al., 1993;
Hughes etal., 1993; Ferber etal., 1994; Knaack etal., 1994), and that glucose metabolism in such cells is highly active at low glucose concentrations. As the glucokinase:hexokinase activity ratio is a critical determin~nt of the glucose response threshold in insulin secreting neuroendocrine cells, and as an imbalance in favor of o hexokinase can cause insulin secretion to occur at glucose concentrations that are below the physiological threshold, it is evident that the most preferred artifieial ,B cells should be further engineered to reduce hexokinase activity. The application of the methods of the present invention to the development of improved insulin secreting cells thus represents a significant advance.

(~. Inhibition Levels As defined herein, the degree of inhibition of hexokinase that is preferred is that necessary to achieve a glucose responsive insulin secretion in the physiologic range of 1.0 to 20 mM glucose. It will be understood by those working in this field that the absolute level of inhibition is difficult to predict. Measurements of 20 . hexokinase and glucokinase in freshly isolated islets as well as cell lines varies drarnatically. Ratios of HK to GK can vary from 2.8 (Burch etal., 1981) to 0.8 (~iang etal., 1990) to 0.5 (Hosokawa etal., 1995) in fresh islets all with "normal"
glucose stimulated insulin secretion. Reports of cell lines with "normal" secretion show an HK to GK ratio of 0.6 (Efrat et al., 1993), in the range of the fresh islets.
25 These discrepancies illustrate the difficulties in specifying absolute numbers of glucokinase and hexokinase activities, hence the ~refere.lce for using glucose .

responsive insulin secretion ranges as a meaningful parameter in characterizing the cells of the invention.

The present discoveries may be utilized in conjunction with certain further techniques, as described in the following sections, or as known to those of skill in the s art.

1. Host Cells Using the present invention may be combined with engineering of secretory cells to synth~si7e proteins for either in vitro large scale production, or for in vivo cell-based delivery. Regulated secretory cells present a natural bioreactor containing o specialized enzymes involved in the proces.cing and maturation of secreted proteins.
These processing enzymes include endoproteases (Steiner et al., 1992) and carboxypeptidases (Fricker, 1988) for the cleavage of prohormones to hormones and PAM, an enzyme catalyzing the amidation of a number of peptide hormones (Eipper et al., 1992). Similarly, maturation and folding of peptide hormones is performed in a 5 controlled, stepwise manner with defined parameters including pH, calcium and redox states.

Complete processing requires sufficient levels of the processing enzymes as well as sufficient retention of the maturing peptides. In this way, physiological signals leading to the release of the contents of the secretory granules ensures release 20 of fully processed, active proteins. This is important for both maximum production for in vi~ro purposes and for the possible use of cells for in vivo purposes.

All cells secrete proteins through a con~lilulive, non-regulated secretor,v y~lwdy. A subset of cells are able to secrete proteins through a specialized regulated secretory pathway. Proteins destined for secretion by either mechanism are targeted 25 to the endoplasmic reticulum and pass through the golgi ~~ dlus. Constitutively secreted proteins pass directly from the golgi to the plasma membrane in vesicles, fusing and releasing the contents constitutively without the need for external stimuli.
In cells with a regulated pathway, proteins leave the golgi and concentrate in storage vesicles or secretory granules. Release of the proteins from secretory granules is regulated, requiring an external stimuli. This P~tern~l stimuli, defined as a 5 secretagogue, can vary depending on cell type, optimal concentration of secretagogue, and dynamics of secretion. Proteins can be stored in secretory granules in their final processed form for long periods of time. In this way a large intracellular pool of mature secretory product exists which can be released quickly upon secretagogue stimulation.

o A cell specialized for secreting proteins via a regulated pathway can also secrete proteins via the constitutive secretory pathway. Many cell types secreteproteins by the constitutive pathway with little or no secretion through a regulated pathway. As used herein, "secretory cell" defines cells specialized for regulated secretion, and excludes cells that are not specialized for regulated secretion. The regulated secretory pathway is found in secretory cell types such as endocrine, exocrine, neuronal, some gastrointestinal tract cells and other cells of the diffuse endocrine system.

(a~ Glucose Responsive Cells For delivery of some peptide hormones or factors, it may be desirable to cause the polypeptide to be released from cells in response to changes in the circulating glucose concentration. A well-known example of a secretory cell type that is regulated in this fashion is the ~ cell of the pancreatic islets of Langerhans, which releases insulin in response to changes in the blood glucose concentration.

Engineering of primary ,~ cells for production of products other than insulin isnot particularly practical. Instead, a preferred vehicle may be one of the several cell lines derived from islet ~ cells that have emerged over the past two decades. While early lines were derived from radiation or virus-induced tumors (Gazdar et al., 1980, w o97n6357 PCTrUS97/00787 Santerre et al., 1981), more recent work has centered on the application of transgenic technology (Efrat et al., 1988, Miyazaki et al., 1990). A general approach taken with the latter technique is to express an oncogene, most often SV40 T-antigen, undercontrol of the insulin promoter in transgenic ~nim~ , thereby generating ,B cell tumors that can be used for prop~gating insulinoma cell lines (Efrat etal., 1988, Miyazaki etal., 1990).

While insulinoma lines provide an advantage in that they can be grown in essentially unlimited quantity at relatively low cost, most exhibit dir~,ellces in their glucose-stimulated insulin secretory response relative to normal islets. These 0 dirr~lences can be quite profound, such as in the case of RINm5F cells, which were derived from a radiation-induced insulinoma and which in their current form are completely lacking in any acute glucose-stimulated insulin secretion response (Halban etal., 1983, Shirnuzu etal., 1988). RIN1046-38 cells are also derived from a radiation-intl~lceA insulinoma but can be shown to be glucose responsive when studied at low passage numbers (Clark et al., l 990b). This response is maximal at subphysiological glucose concentrations and is lost entirely when these cells are cultured for more than 40 passages (Clark et al., l 990a).

GLUT-2 and glucokinase are expressed in low passage RIN 1046-38 cells but are gradually ~limini.~h~d with time in culture in synchrony with the loss of glucose-20 stimulated insulin release (Ferber et al., 1994). Restoration of GLUT-2 and glucokinase expression in RrN1046-38 cells by stable transfection restores glucose-stim~ e(l insulin secretion (Ferber etal., 1994), and the use of these genes as a general tool for engineering of glucose sensing has been described in a previously issued patent (Newgard, US Patent 5,427,940). RIN 1046-38 cells transfected with2~ the GLUT-2 gene alone are m~xim~lly glucose responsive at low concentrations of the sugar (approximately 50 ~M), but the threshold for response can be shifted by preincubating the cells with 2-deoxyglucose, which when converted to 2-W O g7126357 PCTAUS97/00787 deoxyglucose inside the cell serves as an inhibitor of low Km hexokinase, but not glucose activity (Ferber et al., 1994).

~ ecently, Asafari et a/. have reported on the isolation of a new insulinoma cell line called rNS-1 that retains many of the characteristics of the dirr~,~."i~tecl ,B cell, s most notably a relatively high insulin content and a glucose-stimulated insulin secretion response that occurs over the physiological range (Asafari et a/., 1992).
This line was isolated by prop~g~ting cells freshly dispersed from an X-ray in~ ce~l insulinoma tumor in media cont~ining 2-mercaptoethanol. Con~i~tçnt with the finding of physiological glucose responsiveness, a recent report indicates that INS-1 o cells express GLUT-2 and glucokinase as their predominant glucose transporter and glucose phosphorylating enzyme, respectively (Marie et al., 1993). INS-l cells grow very slowly in the presence of 2-mercaptoethanol, and it remains to be deterrninP(l whether glucose responsiveness and expression of GLUT-2 and glucokinase are retained with prolonged culturing of these cells.

C~ell lines derived by transgenic expression of T-antigen in ,~ cells (generallytermed ,BTC cells) also exhibit variable phenotypes (Efrat et al., 1988, Miyazaki e~ al., 1990, Whitesell et al., 1991 and Efrat et al., 1993). Some lines have little glucose-stimulated insulin release or exhibit maximal responses at subphysiological glucose concenkations (Efrat et a/., 1988, Miyazaki et a/., 1990, Whitesell et a/., 1991), while others respond to glucose concentrations over the physiological range (Miyazaki et al., 1990 and Efrat et a/., 1993). It appears that the near-normal responsiveness of the latter cell lines is not penn~ent, since further time in culture results in a shift in glucose dose response such that the cells secrete insulin at subphysiological glucose concentrations (Efrat et al., 1993). In some cases, these changes have been correlated with ~xplession of glucose transporters and glucose phosphorylating enzymes.

Miyazaki et aZ. isolated two classes of clones from transgenic ~nim~
essing an insulin promoter/T-antigen construct. Glucose unresponsive lines such - as MIN-7 were found to express GLUT-1 rather than GLUT-2 as their major glucose W 0971263~7 PCTrUS97/00787 transporter isoform, while M~N-6 cells were found to express GLUT-2 and to exhibit normal glucose-stimulated insulin secretion (Miyazaki et al., 1990).

More recently, Efrat and coworkers demonstrated that their cell line ~TC-6, which exhibits a glucose-stimulated insulin secretion response that resembles that of 5 the islet in magnitude and concentration dependence, expressed GLUT-2 and contained a glucokinase:hexokinase activity ratio similar to that of the norrnal islet (Efrat etal., 1993). With time in culture, glucose-stimulated insulin release became m~xim~l at low, subphysiological glucose concentrations. GLUT-2 e~ression did not change with time in culture, and glucokinase activity actually increased slightly, o but the major change was a large (approximately 6-fold) increase in hexokinaseexpression (Efrat et al., 1993). Furtherrnore, ove.c~ies~ion of hexokinase I, but not GLUT-1, in well-differenti~ted MIN-6 cells results in both increased glucose metabolism and insulin release at subphysiological glucose concentrations. Similar results have been obtained upon ov~r~ ession of hexokinase I in normal rat islets 5 (Becker et al., 1 994b). These results are all consistent with the observations of Ferber et a~. described above in showing that a high hexokinase:glucokinase ratio will cause insulin-secreting cells to respond to glucose concentrations less than those required to stimul~te the normal ,~ cell.

(b) Non-~lucose Responsive Cells An alternative to in~lllinoma cell lines are non-islet cell lines of neuroendocrine origin that are engineered for insulin e~les~ion. The foremost example of this is the AtT-20 cell, which is derived from ACTH secreting cells of the anterior pituitary. Over a decade ago, Moore et al. demonstrated that stable transfection of AtT-20 cells with a construct in which a viral promoter is used to direct expression of the human proinsulin cDNA resulted in cell lines that secreted the correctly processed and mature insulin polypeptide (Moore etal., 1983). Insulin secretion from such lines (generally termed AtT-20ins) can be stimulated by agents W O 971263~7 PCTrUS97/00787 such as forskolin or dibutyryl cAMP, with the major secreted product in the form of mature insulin, suggesting that these cells contain a regulated secretory pathway that is similar to that operative in the islet ,B cell (Moore et al., 1983, Gross et al., 1989).

More recently, it has become clear that the peptidases that process proinsulin to insulin in the islet ~ cell, termed PC2 and PC3, are also expressed in AtT-20ins cells (Smeekens and Steiner, 1990, Hakes etal., 1991). AtT-20ins cells do not respond to glucose as a secretagogue (Hughes etal., 1991). Interestingly, AtT-20cells express the glucokinase gene (Hughes etal., 1991, Liang e~al., 1991) and at least in some lines, low levels of glucokinase activity (Hughes etal., 1991; 1992, 0 Quaade etal., 1991), but are completely lacking in GLUT-2 expression (Hughes et al., 1991; 1992). Stable transfection of these cells with GLUT-2, but not the related transporter GLUT-1 confers glucose-stimul~te-l insulin secretion, albeit with m~im~l responsiveness at subphysiological glucose levels, probably because of a non-optimal hexokinase:glucokinase ratio (Hughes et al., 1992, 1993).

Is The studies with AtT-20ins cells are important because they demonstrate that neuroendocrine cell lines that normally lack glucose-stimulated peptide release may be engineered for this function. Other cell lines that are characterized as neuroendocrine, but lacking in endogenous glucose response include PC12, a neuronal cell line (ATCC CRL 1721) and GH3, an anterior piluil~y cell line that secretes growth horrnone (ATCC CCL82.1). It is not possible to ~let~rmine whether such cell lines will gain glucose responsiveness by engineering similar to that described for the AtT-20ins cell system without performing the studies. However, these lirles do exhibit other important properties, such as a regulated secretory pathway, expression of endopeptidases required for processing of prohormones to their mature horrnone products, and post-translational modification enzymes.

- In sum, all neuroendocrine cell lines are useful for recombinant protein production, and supplemented by the hexokinase inhibition methods disclosed herein, which is the production of heterologous products in a cell line in which the natural W 0971263~7 PCTAUS97/00787 product (insulin, growth hormone, ACTH, etc.) has been elimin~te~l Some or all of these lines will also be useful for glucose-regulated product delivery, using the methods described in U.S. Patent 5,427,940 to generate such responsiveness.

(c) Methods for Blo~kir~ Endogenous Protein Production Blocking ~x~lession of an endogenous gene product is an important modification of host cells that may be used in combination with the present invention.
The targeted endogenous gene encodes a protein normally secreted by the host cell.
Blocking expression of this endogenous gene product, while engineering high level t;x~ession of genes of interest, represents a unique way of flPsignin~ cells for protein o production.

Cells generated by this two-step process express heterologous proteins, including a variety of natural or engineered proteins (fusions, chimeras, protein ~g,ment~, etc.). Cell lines developed in this are uniquely suited for in vivo cell-based delivery or in vitro large scale production of defined peptide hormones with little or no cont~n~in~ting or ullw~lL~d endogenous protein production.

Four basic approaches are contemplated for blocking of expression of an endogenous gene in host cells. First, constructs are designed to homologously recombine into particular endogenous gene loci, rendering the endogenous gene nonfunctional. Second, constructs are (lç~ign~l to integrate randomly throughout the genome. Th*d, constructs are rlesign~d to introduce nucleic acids complementary to a target endogenous gene. Expression of RNAs corresponding to these complementary nucleic acids will interfere with the transcription and/or translation of the target se~uences. And fourth, constructs are de~igned to introduce nucleic acids encoding ribozymes - RNA-cleaving enzymes - that will specifically cleave a target mRNA
corresponding to the endogenous gene.

W O 97/26357 PCT~US97/00787 (i) Antisense. Antisense methodology tal~es advantage of the fact that nucleic acids tend to pair with "complementary" sequences. By complementary, it is meant that polynucleotides are those which are capable of base-pairing according to the standard Watson-Crick complementarity rules. That is, the larger purines will base pair with the smaller pyrimidines to form combinations of guanine paired with cytosine (G:C) and adenine paired with either thymine (A:T) in the case of DNA, or adenine paired with uracil (A:U) in the case of RNA. Inclusion of less cornmon bases such as inosine, 5-methylcytosine, 6-methyl~clenine, hypo~nthine and others in hybridizing sequences does not interfere with pairing.

0 Targeting double-stranded (ds) DNA with polynucleotides leads to triple-helix formation; targeting RNA will lead to double-helix formation. Antisense polynucleotides, when introduced into a target cell, specifically bind to their target polynucleotide and interfere with transcription, RNA proces~ing, transport, translation and/or stability. Antisense RNA constructs, or DNA encoding such ~nti~en.ce RNAs, may be employed to inhibit gene transcription or translation or both within a host cell, either in vitro or in vivo, such as within a host animal, including a human subject.

~nti~çn.~e constructs may be designed to bind to the promoter and other control regions, exons, introns or even exon-intron boundaries of a gene. It is contemrl~te~l that the most effective antisense constructs may include regions complement~ry to intron/exon splice junctions. Thus, ~nti~ence constructs with complementarity to regions within 50-200 bases of an intron-exon splice junction may be used. It has been observed that some exon sequences can be included in the construct without seriously affecting the target selectivity thereof. The amount of exonic m~t~ri~l included will vary depending on the particular exon and intron sequences used. One can readily test whether too much exon DNA is included simply by testing the constructs in vitro to determine whether normal cellular function is affected or whether the expression of related genes having complementary sequences is affected.

W O 97n6357 PCT~US97/00787 As stated above, "complementary" or "antisense" means polynucleotide sequences that are substantially complementary over their entire length and have very few base mi.cm~tçl es. For example, sequences of fifteen bases in length may be termed complementary when they have complementary nucleotides at thirteen or s fourteen positions. Naturally, sequences which are completely complementary will be sequences which are entirely complementary throughout their entire length and have no base mi~m~t~hes. Other sequences with lower degrees of homology also are contemplated. For example, an ~nti~nie construct which has limited regions of high homology, but also contains a non-homologous region (e.g, ribozyme) could be o designed. These molecules, though having less than 50% homology, would bind to target sequences under al,plopliate conditions.

It may be advantageous to combine portions of genomic DNA with cDNA or synthetic sequences to generate specific constructs. For example, where an intron is desired in the ultimate construct, a genomic clone will need to be used. The cDNA or 5 a synthesized polynucleotide may provide more convenient restriction sites for the rem~ining portion of the construct and, therefore, would be used for the rest of the sequence.

(ii) Homologous Recombination. Another approach for blocking of endogenous protein production involves the use of homologous recombination.
20 Homologous recombination relies, like antisense, on the tendency of nucleic acids to base pair with complementary sequences. In this instance, the base pairing serves to facilitate the interaction of two separate nucleic acid molecules so that strand breakage and repair can take place. In other words, the "homologous" aspect of the methodrelies on sequence homology to bring two complementary sequences into close 2s proximity, while the "recombination" aspect provides for one complementary sequence to replace the other by virtue of the breaking of certain bonds and theformation of others.

W 097/26357 PCT~US97/00787 Put into practice, homologous recombination is used as follows. First, a target gene is selected within the host cell. Sequences homologous to the target gene are then ineluded in a genetic construct, along with some mutation that will render the target gene inaetive (stop codon, interruption, etc.). The homologous sequences s fl~nking the inactivating mutation are said to "flank" the mutation. F]~nkin~, in this context, simply means that target homologous sequenees are loeated both upstream(5') and downstrearn (3') of the mutation. These sequences should correspond to some sequences upstream and downstrearn of the target gene. The eonstruct is then introduced into the cell, thus permitting recombination between the eellular sequences o and the construct.

As a practical matter, the genetic eonstruct will normally act as far more than a vehicle to interrupt the gene. For example, it is important to be able to seleet for recombinants and, therefore, it is common to include within the construct a seleetable marker gene. This gene permits seleetion of eells that have integrated the eonstruct 15 into their genomic DNA by conferring resistanee to various biostatic and biocidal drugs. In addition, a heterologous gene that is to be expressed in the cell also may advantageously be included within the construct. The arrangement might be as follows:

...vector-S'-fl~nking sequence-heterologous gene-seleetable marker gene-fl~nking sequence-3'-vector Thus, using this kind of construct, it is possible, in a single reeombinatorial event, to (i) "knock out" an endogenous gene, (ii) provide a selectable marker for identifying sueh an event and (iii) introduce a heterologous gene for expression.
2~
Another refinement of the homologous recombination approach involves the use of a "negative" selectable marker. This marker, unlike the selectable marker, eauses death of cells which express the marker. Thus, it is used to identify W O 97n6357 PCTrUS97100787 undesirable recombination events. When seeking to select homologous recombinantsusing a selectable marker, it is difficult in the initial screening step to identify proper homologous recombinants from recombinants generated from random, non-sequence specific events. These recombinants also may contain the selectable marker gene and s may express the heterologous protein of interest, but will, in all likelihood, not have the desired "knock out" phenotype. By ~ rhing a negative selectable marker to the construct, but outside of the fl~nking regions, one can select against many random recombination events that will incorporate the negative selectable marker.
Homologous recombination should not introduce the negative selectable marker, as it o is outside ofthe fl~nking sequences.

In a particular aspect of this embodiment, the negative selectable maker may be GLUT-2. It is also contemplated that GLUT-5 would function in a similar manner to GLUT-2. Therefore, the selection protocols described below are intended to refer to the use of both GLUT-2 and GLUT-5.

In a first embodiment, a target gene within a GLUT-2- host cell is selected as the location into which a selected gene is to be transferred. Sequences homologous to the target gene are included in the expression vector, and the selected gene is inserted into the vector such that target gene homologous sequences are interrupted by the selected gene or, put another way, such the target gene homologous se~uences "flank"
20 the selected gene. In p~ef~ d embodiments, a drug selectable marker gene also is inserted into the target gene homologous sequences. Given this possibility, it should be a~alell~ that the term "flank" is used broadly herein, namely, as describing target homologous sequences that are both upstream (5') and do~ll~llealll (3') of the selected gene andlor the drug selectable marker gene. In effect, the fl~nking sequences need 25 not directly abut the genes they "flank".

The construct for use in this embodiment is further characterized as having a functional GLUT-2 gene attached thereto. Thus, one possible arrangement of se~uences would be:

W O 97n63~7 PCTrUS97/00787 ... 5'-GLUT-2-fl~nkin~ target sequences.selected gene.drug-selectable marker gene-fl~nking target sequences-3' ...

Of course, the GLUT-2 could come at the 3'-end of the construct and the selected5 gene and drug-selectable marker genes could exchange positions.

Application of a drug to such cells will permit isolation of recombinants, but further application of Streptozotocin (glucopyranose, 2-deoxy-2-[3-methyl-e-nitrosourido-D]; STZ) to such cells will result in killing of non-homologous 0 recombinants because the incorporated GLUT-2 gene will produce GLUT-2 transporter, rendering the cells susceptible to STZ tre~tment (the origmal cell was GLUT-2-).

On the other hand, site-specific recombination, relying on the homology between the vector and the target gene, will result in incorporation of the selected 5 gene and the drug selectable marker gene only; GLUT-2 sequences will not be introduced in the homologous recombination event because they lie outside the f~anking sequences. These cells will be drug resistant and but not acquire the GLUT-2 sequences and, thus, remain insensitive to STZ. This double-selection procedure ~drugres/STZres) should yield recombinants that lack the target gene and 20 express the selected gene. Further screens for these phenotypes, either functional or immunologic, may be applied.

A modification of this procedure is one where no selected gene is included, i.e., only the selectable marker is inserted into the target gene homologous sequences.
Use of this kind of construct will result in the "knock-out" of the target gene only.
25 Again, proper recombinants are screened by drug resistance and STZ resistance (the original cell was GLUT-2-).

(iii) Random Integration. Though less specific than homologous recombination, there may be situations where random integration will be used as a W O 97/263~7 PCTrUS97/00787 method of knocking out a particular endogenous gene. Unlike homologous recombination, the recombinatorial event here is completely random, i.e., not reliant upon base-pairing of complementary nucleic acid sequences. Random integration islike homologous recombination, however, in that a gene construct, often COI~t~ g a s heterologous gene and a selectable marker, integrates into the target cell genomic DNA via strand breakage and reformation.

Because of the lack of sequence specificity, the chances of any given recombinant integrating into the target gene are greatly reduced. As a result, it may be necessary to "brute force" the selection process. In other words, it may be necessary 0 to screen hundreds of thousands of drug-resistant recombinants before a desired mutant is found. Screening can be facilitated, for exarnple, by e7c~mining recombinants for expression of the target gene using irnmunologic or even functional tests; e~ c;ssion of the target gene indicate recombination elsewhere and, thus, lack of suitability.

1~ (iv) Genomic Site-Directed Mutagenesis with Oligonucleotides.
Through analysis of radiation-sensitive m~lt~nt.~ of Ustilago maydis, genes have been characterized that participate in DNA repair (Tsukuda et al., 1989; Bauchwitz and Holloman, 1990). One such gene, ~EC2, encodes a protein that catalyzes homologous pairing between complement~ry nucleic acids and is required for a functional recombinational repair pathway (Kmiec et al., 1994; Rubin et al., 1994). In vitro characterization of the REC2 protein showed that homologous pairing was more efficient between RNA-DNA hybrids than the corresponding DNA duplexes (Kmiec et al, 1994; PCT, WO 96/22364). However, efficiency in pairing between DNA:DNA
duplexes could be enhanced by increasing the length of the DNA oligonucleotides ~Kmiec et al., 1994). These observations led investigators to test the use of chimeric R~A-DNA oligonucleotides (RDOs) in the targeted modification of genes in m~mm~ n cell lines (Yoon et al., 1996; Cole-Strauss et al., 1996; PCT
WO95115972). The RNA-DNA oligonucleotides that were used to test this W 097/26357 PCT~US97/00787 application contained self-~nne~ling sequences such that double-hairpin capped ends are formed. This feature is thought to increase the in vivo half-life of the RDO by decreasing degradation by helicases and exonucleases. Further, the RDOs contained a single base pair that differs from the target sequence and other~vise aligns in perfect s register. It is believed that the single mi.cm~t~.~ will be recognized the DNA repair enzymes. And the RDOs contained RNA residues modified by 2'-O-methylation of the ribose sugar. Such modification makes the RDO resistant to degradation by ribonuclease activity (Monia et al., 1993).

Two separate experimental systems have been used to test the use of RDOs for 0 targeted gene disruption in m~3mm~ n cell lines. In one system RDOs were used to target and correct an alkaline phosphatase cDNA in that was m~int~ined in the episomal DNA of Chinese h~m.~ter ovary cells. An inactive form of alkaline phosphatase was converted to a wild-type form with an efficiency of about 30%
(Yoon et al., 1996). In a second system, a genetic mutation within chromosomal 5 DNA was targeted and corrected. A lymphoid blast cell line was derived from a patient with sickle cell disease who was homozygous for a point mutation in the ,B-globin gene. Here again the overall frequency of gene conversion from the mutant to the wild-type form was very high and was found to be dose-dependent on the concentration of the RDOs (Cole-Strauss et al., 1996).

If the use of RDOs or DNA oligonucleotides for the purposes of targeted gene col~ve.~ion is broadly applicable to various m~mm~ n cell lines, then it offers several advantages to current technologies that have been used to accomplish gene disruption such as homologous recombination. First, if gene conversion by RDO orDNA oligonucleotides occurs in various cell lines at an efficiency of 30% then this will represent a much higher rate than has been reported for targeted gene disruption via homologous recombination. Secondly, only short sequences are required for gene disruption by RDOs or DNA oligonucleotides(typically 60mers to 70mers); whereas homologous recombination requires very long stretches of complementary sequences.

~omologous sequences from 9 to 15 kilobases are typically recommended in the construction of targeting vectors. As a result, construction of DNA vectors for homologous recombination usually involves extensive gene mapping studies and time con~uming efforts in the isolation of genomic DNA sequences. Such efforts are 5 unnecç~ry if RDOs are used for targeted gene conversions. Thirdly, assays for gene conversion by RDOs can be ~ ro~ ed 4 to 6 hours following introduction of the RDOs or DNA oligonucleotides into the cell. In contrast, gene conversion by homologous recombination requires a relatively long period of time (days to weeks) between the time of introducing the targeting vector DNA and assaying for o recombinants.

(v) Ribozymes. The use of hexokinase-specific ribozymes has been described herein above. However, while the inhibition of hexokinase is intended for use in a recombinant cell which is also used for high level protein production, additional ribozymes may also be used to block endogenous protein production. The 5 following information is provided in order to compliment the earlier section and to assist those of skill in the art in this endeavor.

Ribozymes are RNA-protein complexes that cleave nucleic acids in a site-specific fashion. Ribozymes have specific catalytic domains that possess endonuclease activity (Kim and Cech, 1987; Gerlack et al., 1987; Forster and 20 Symons, 1987). For example, a large number of ribozymes accelerate phosphoester transfer reactions with a high degree of specificity, often cleaving only one of several phosphoesters in an oligonucleotide substrate (Cech et al., 1981; Michel and Westhof, 1990; Reinhold-Hurek and Shub, 1992). This specificity has been attributed to the requirement that the substrate bind via specific base-pairing interactions to the internal 25 guide sequence ("IGS") of the ribozyme prior to chemical reaction.

Ribozyme catalysis has primarily been observed as part of sequence specific cleavagetligation reactions involving nucleic acids (Joyce, 1989; Cech etal., 1981).
For example, U.S. Patent No. 5,354,855 reports that certain ribozymes can act as .. ... .. .

W O 97126357 PCT~US97/00787 endonucleases with a sequence specificity greater than that of known ribonucleases and approaching that of the DNA restriction enzymes. Thus, sequence-specific ribozyme-mediated inhibition of gene ~x~uression may be particularly suited to therapeutic applications (Scanlon etal., 1991; Sarver etal., 1990; Sioud etal., 1992).
5 Recently, it was reported that ribozymes elicited genetic changes in some cell lines to which they were applied; the altered genes included the oncogenes H-ras, c-fos and genes of HIV. Most of this work involved the modification of a target mRNA, based on a specific mutant codon that is cleaved by a specific ribozyme. In light of the information included herein and the knowledge of one of ordinary skill in the art, the 0 ~ )aldlion and use of additional ribozymes that are specifically targeted to a given gene will now be straightfor~vard.

(d) Methods for Increasing Production of Recombinant Peptides from Secretory Cells The present invention may also be used in methods for augmenting or s increasing the capabilities of cells to produce biologically active polypeptides. This can be accomplished, in some instances, by ov~lc~l,lessillg the proteins involved in protein proces~ing, such as the endoproteases PC2 and PC3 (Steiner et al., 1992), or the peptide amidating enzyme PAM (Eipper etal., 1992) in the case of peptide hormones.

Expression of proteins involved in m~ g the specialized phenotype of host cells, especially their secretory capacity, is important. Engineering the overe~ ession of a cell type-specific transcription factor such as the insulin promoter factor 1 (IPF1) found in pancreatic ~ cells (Ohlsson etal., 1993) could increase or stabilize the capabilities of engineered neuroendocrine cells. Insulin promoter factor 1 ~IPF-1; also referred to as STF-1, IDX-1, PDX-l and ,BTF-1) is a homeodomain-co~.t~inil-g transcription factor proposed to play an important role in both pancreatic development and insulin gene expression in mature ,Bcells (Ohlsson etal., 1993, Leonard etal., 1993, Mil}er etal., 1994; Kruse etal., 1993). In embryos, IPF-1 is W O 97/263S7 PCTrUS97/00787 expressed prior to islet cell hormone gene expression and is restricted to positions within the primitive foregut where pancreas will later form. Indeed, mice in which the IPF-1 gene is disrupted by targeted knockout do not form a pancreas (Jonssonetal., 1994). Later in pancreatic development, as the different cell types of the 5 pancreas start to emerge, IPF-l expression becomes restricted predominantly to~ cells. IPF-1 binds to TAAT consensus motifs contained within the FLAT E and P1elements of the insulin enhancer/plollloter, whereupon, it interacts with other transcription factors to activate insulin gene transcription (Peers et al. 1994).

Stable ovelex~-cs~ion of IPF-l in neuroendocrine ~ cell lines will serve two 0 pu~poses. First, it will increase transgene ~xple~s~ion under the control of the insulin enhancer/promoter. Second, because IPF-l appears to be critically involved in ,B cell maturation, stable o~ ,ression of IPF-l in ,B cell lines should cause these mostly dedifferenti~ted ,B cells to regain the more differentiated function of a normal animal ,B cell. If so, then these redirrerentiated ,B cell lines could potentially function as a 5 more effective neuroendocrine cell type for cell-based delivery of fully processed, bioactive peptide hormones.

Also, further engineering of cells to generate a more physiologically relevant regulated secretory response is contemplated. Exarnples would include engineering overexpression of other .sign~ling proteins known to play a role in the regulated 20 secretory response of neuroendocrine cells. These include cell surface proteins such as the ,~ cell specific inwardly rectifying potassiurn channel (sulfonylurea receptor, SUR, and ATP sensitive channel, BIR; Inagaki et al., 1995), involved in release of the secretory granule contents upon glucose stimulation. Other cell surface signaling receptors which help potentiate the glucose stimulated degranulation of ~3 cells25 including the glucagon-like peptide I receptor (Thorens, 1992) and the glucose-dependent insulinotropic polypeptide receptor (also known as gastric inhibitory peptide receptor; Usdin et al., 1993) can be engineered into neuroendocrine cells.
These ,~ cell specific signaling receptors, as well as GLUT-2 and glucokinase, are W 097/26357 PCT~US97/00787 involved in secretory granule re}ease in response to glucose. In this way glucose stimulated release of any heterologous peptide targeted to the secretory granule can be engineered.

Alternatively, other cell surface ~ign~lin~ proteins involved in non-glucose s stimulated release of secretory granule contents can be engineered into neuroendocrine cells. Examples would include releasing factor receptors such as growth hormone releasing factor receptor (Lin etal., 1992) and somatostatin or growth hormone releasing hormone receptor (Mayo, 1992). Fnginç~ring these receptors, and receptors specific for other releasing factors, into neuroendocrine cell o lines should result in physiological release of heterologous peptides targeted to the secretory granules for either in vivo ~ cell based delivery or for in vitro production.

(e) Methods for Re-en~ineerin~ Engineered Cells In many situations, multiple rounds of iterative engineering will be undertaken in generating the final cell lines. The events that may be conducted as separate5 construction events include blocking expression of endogenous gene products bymolecular methods (including targeting of both copies of the endogenous gene), introducing a heterologous gene, and further modification of the host cell to achieve high level expression. The particular difficulty in perforrning multiple steps like this is the need for distinct selectable markers. This is a limitation in that only a few 20 selectable markers are available for use in m~rnm~ n cells and not all of these work sufficiently well for many purposes.

The Cre/Lox site specific recombination system (Sauer, 1993, available through Gibco/BRL, Inc., Gaithersburg, Md.) may be used to rescue specific genesout of a genome, especially drug selection markers, as a way of increasing the 25 possible number of rounds of engineering. Briefly, the system involves the use of a bacterial nucleotide sequence knows as a loxP site, which is recognized by the bacterial Cre protein. The Cre protein catalyzes a site specific recombination event.

W 097126357 PCTrUS97/00787 This event is bidirectional, i e., Cre will catalyze the insertion of sequences at a loxP
site or excise sequences that lie between two loxP sites. Thus, if a construct cl-nt~ining a selectable marker also has loxP sites fl~nking the selectable marker, introduction of the Cre protein, or a polynucleotide encoding the Cre protein, into the s cell will catalyze the removal of the selectable marker. If successfully accomplished, this will make the selectable marker again available for use in further genetic engineering of the cell. This technology is explained in detail in U.S. Patent No.
4,959,317, which is hereby incorporated by reference in its entirety.

It also is contemplated that a series of different markers may be employed in lo some situations. These markers are discussed in greater detail below.

(~) Proteins A variety of different proteins can be expressed in which hexokinase has been inhibited according to the present invention. Proteins can be grouped generally into two categories; secreted and non-secreted. Discussions of each are set out below.
5 There are some general properties of proteins that are worthy of discussion at this juncture.

First, it is contemplated that many proteins will not have a single sequence but, rather, will exists in many forms. These forms may represent allelic variation or, rather, mutant forms of a given protein. Second, it is contemplated that various20 proteins may be expressed advantageously as "fusion" proteins. Fusiorls are generated by linking together the coding regions for two proteins, or parts of two proteins. l'his generates a new, single coding region that gives rise to the fusion protein. Fusions may be useful in producing secreted forms of proteins that are not normally secreted or producing molecules that are immunologically tagged. Tagged proteins may be 25 more easily purified or monitored using antibodies to the tag. A third variation contemr l~tecl involves the e~lession of protein fr~gmellt~ ~t may not be necessary to express an entire protein and, in some cases, it may be desirable to express a particular .

W O 97/26357 PCTrUS97/00787 functional domain, for example, where the protein fragment remains fùnctional but is more stable or less antigenic.

(i) Secreted Proteins. Expression of several proteins that are normally secretedcan be engineered into neuroendocrine cells. The cDNAs encoding a number of s useful human proteins are availahle. Examples would include soluble CD-4, Factor VIII, Factor IX, von Willebrand Factor, TPA, urokinase, hirudin, interferons, TNF, interleukins, hematopoietic growth factors, antibodies, glucocerebrosidase, adenosine de~min~ce, phenylalanine hydroxylase, albumin, transferin and nerve growth factors.

The exogenous polypeptide may be a hormone, such as growth hormone, prolactin, placental lactogen, ll~teini7ing hormone, follicle-~tim~ ting horrnone, chorionic gonadotropin, thyroid-stim~ ting hormone, adrenocorticotropin (ACTH), angiotensin I, angiotensin II, ,B-endorphin, ,B-melanocyte stim~ ting hormone (~-MSH), cholecystokinin, endothelin I, g~l~nin, gastric inhibitory peptide (GIP), glucagon, insulin, lipotropins, neurophysins and somatostatin.

1S The exogenous polypeptide to be secreted may be amidated or a fusion protein. Amidated polypeptides include calcitonin, calcitonin gene related peptide (CGRP), ~-calcitonin gene related peptide, hypercalcemia of malignancy factor (1-40), parathyroid hormone-related protein (107-139) (PTH-rP), parathyroid hormone-related protein (107-111) (PTH-rP), cholecystokinin (27-33) (CCK), galanin message associated peptide, preprogalanin (65-105), gastrin I, gastrin releasingpeptide, glucagon-like peptide (GLP-l), pancre~t~tin, pancreatic peptide, peptide YY, PHM, secretin, vasoactive intestin~l peptide (VIP), oxytocin, vasol~les~ir (AVP), vasotocin, enke~h~lin~, enkeph~lin~mide, metorphin~mide (adrenorphin), a-melanocyte stimulating hormone (a-MSH), atrial natriuretic factor (5-28) (ANF), 2s amylin, amyloid P component (SAP-1), corticotropin releasing hormone (CRH),growth hormone releasing factor (GHRH), luteinizing hormone-releasing hormone (LHRH), neuropeptide Y, substance K (neurokinin A), substance P and thyrotropin releasing hormone (TRH).

(ii) Non-Secreted Proteins. Expression of non-secreted proteins can be engineered into neuroendocrine cells. The cDNAs encoding a number of useful 5 hurnan proteins are available. These include cell surface receptors and ch~nnel~ such as GLUT-2, CFTR and the leptin receptor f~,) Growth-Rate Reduced Cells In that inhibiting one or more hexokinases is intPn~ecl as a method for slo~vingthe growth of a m~mm~ n cell, cells from virtually any established cell line that o grows continuously in culture may be used in these aspects of the invention.
Examples of such m~mm~ n host cell lines include VERO cells, HeLa cells, Chinesehamster ovary (CHO) cell lines, COS cells, such as COS-7, W138, BHK, HepG2, 3T3, RIN, MDCK, A549, PC12, K562 and 293 cells.

Cells intended for use in generating monoclonal antibodies (MAbs) may also 5 be provided with a low Km hexokinase inhibitor, or be rendered hexokinase deficient, in order to slow their growth rate. MAbs are readily prepared through use of well-known techniques, such as those exemplified in U.S. Patent 4,196,265, incorporated herein by reference.

MAb-producing cells are generally hybrid cells derived from the fusion of a 20 somatic cell that has the potential to produce antibodies, specifically a B lymphocyte or B cell, with an immortal myeloma cell, generally one of the sarne species as the animal that was immunized in order to provide the B cells. Such cells that have reduced low Km hexokinase activity form another aspect of this invention.

Primary cell lines are also contemplated for use with these aspects of the 25 invention. Primary cell lines are those cells that have been removed from an animal or human subject and are capable of surviving in culture for a limited period of time.

W O 97/26357 PCTrUS97/00787 Such cells are often manipulated, e.g., to introduce a beneficial gene that expresses a selected protein, and then re-introduced into the animal from which they were originally obtained. This technique is often termed ex vivo gene therapy, and can be used to deliver cytotoxic proteins, e.g., to cancer cells, and therapeutic proteins 5 intended to correct a deficiency in a given cell type or types.

Primary cells of all vertebrate species are thus considered for use ~vith the hexokinase inhibition aspects of this invention, whether or not they are returned to the body of an animal. These include, by way of example only, bone marrow cells, nerve cells, lung epithelial cells and hepatocytes.

0 Cells that contain a low Km hexokinase inhibitor and which are located within an animal or human subject are also encomp~se~l within the cells of the invention, whether or not they were originally derived from the animal. Cells that were not so-obtained from the ultimate host animal may be cells from an immunologically compatible animal, cells that have been immunologically modified or disabled, cells that are protected within a semi-permeable device in the host animal and even cells that are largely unmodified in immunological terms and that are intended to have a temporary life span within the host animal.

2. (~enetic C:lonstructs DNA e~yieSSiOn plasmids may be used to optimize production of hexokinase inhibitors and/or heterologous proteins. A number of promoter/enhancers from both viral and m~mm~ n sources may be used to drive expression of the genes of interest in neuroendocrine cells. Elements designed to optimize messenger RNA stability and tr~n~l~t~hility in neuroendocrine cells are defined. The conditions for the use of a number of dominant drug selection markers for establishing perm~nent, stable ~ 25 neuroendocrine cell clones expressing the peptide hormones are also provided, as is an element that links ~yiession of the drug selection markers to expression of the heterologous polypeptide.

W 097/26357 PCTrUS97/00787 (a) Vector Backbone Throughout this application, the term "e~les~ion vector or construct" is meant to include any type of genetic construct containing a nucleic acid coding for a gene product in which part or all of the nucleic acid encoding sequence is capable of being 5 transcribed. The transcript may be tr~n~l~te~l into a protein, but it need not be. Thus, in certain embodiments, expression includes both transcription of a gene and translation of mRNA into a gene product. In other embodiments, expression only includes transcription of the nucleic acid encoding a gene of interest.

In pl~r~",_d embotliment.c, the nucleic acid encoding a gene product is under o transcriptional control of a promoter. A "promoter" refers to a DNA sequence recognized by the synthetic m~hinery of the cell, or introduced synthetic m~chin~:ry, required to initiate the specific transcription of a gene. The phrase "under transcriptional control" means that the promoter is in the correct location and orientation in relation to the nucleic acid to control RNA po~ymerase initiation and s expression of the gene.

The term promoter will be used here to refer to a group of transcriptional control modules that are clustered around the initiation site for RNA polymerase II.
Much of the thinkin~ about how promoters are organized derives from analyses of several viral promoters, including those for the HSV thymidine kinase (tk) and SV40 20 early transcription units. These studies, ~ m~.nte-l by more recent work, have shown that promoters are composed of discrete fimctional modules, each con~ tin~ of approximately 7-20 bp of DNA, and cont~inin~ one or more recognition sites for transcriptional activator or repressor proteins.

At least one module in each promoter functions to position the start site for 2s RNA synthesis. The best known example of this is the TATA box, but in some promoters lacking a TATA box, such as the promoter for the m~mm~ n tennin~l .....

W O 97/26357 PCT~US97/00787 deoxynucleotidyl transferase gene and the promoter for the SV40 late genes, a discrete element overlying the start site itself helps to fix the place of initiation.

Additional promoter elements regulate the frequency of transcriptional initiation. Typically, these are located in the region 30-110 bp upstrearn of the start s site, although a number of promoters have recently been shown to contain functional elements downstream of the start site as well. The spacing between promoter elements frequently is flexible, so that promoter function is preserved when elements are inverted or moved relative to one another. In the tk promoter, the spacing between promoter elements can be increased to 50 bp apart before activity begins to decline.
o Depending on the promoter, it appears that individual elements can function either co-operatively or independently to activate transcription.

The particular promoter that is employed to control the expression of a nucleic acid encoding a particular gene is not believed to be important, so long as it is capable of expressing the nucleic acid in the targeted cell. Thus, where a human cell is5 targeted, it is preferable to position the nucleic acid coding region adjacent to and under the control of a promoter that is capable of directing expression in a hurnan cell.
Generally speaking, such a promoter might include either a human or viral promoter.

In various embodiments, the human cytomegalovirus (CMV) immediate early gene promoter, the SV40 early promoter and/or the Rous sarcoma virus long terminal 20 repeat can be used to obtain high-level expression of the gene of interest. The use of other viral or m~mm~ n cellular or bacterial phage promoters which are well-known in the art to achieve expression of a gene of interest is contemplated as well, provided that the levels of expression are sufficient for a given purpose.

By employing a promoter with well-known properties, the level and pattern of 2s expression of the gene product following transfection can be optimized. Further, selection of a promoter that is regulated in response to specific physiologic signals can permit inducible expression of the gene product. Tables 4 and 5 list several elements/promoters which may be employed, in the context of the present invention, to regulate the expression of the gene of interest. This list is not intended to be exhaustive of all the possible elements involved in the promotion of gene expression but, merely, to be exemplary thereof.

Enhancers were originally detecte~l as genetic elements that increased transcription from a promoter located at a distant position on the same molecule of DNA. This ability to act over a large distance had little precedent in classic studies of prokaryotic transcriptional regulation. Subsequent work showed that regions of DNA
with enhancer activity are o~ rd much like promoters. That is, they are composedo of many individual elements, each of which binds to one or more transcriptional proteins.

The basic distinction between enhancers and promoters is operational. An enhancer region as a whole must be able to stimulate transcription at a distance; this need not be true of a promoter region or its component elements. On the other hand, a promoter must have one or more elements that direct initiation of RNA synthesis at a particular site and in a particular orientation, whereas enhancers lack these specificities. Promoters and enhancers are often overlapping and contiguous, often seeming to have a very similar modular org~ni7~tion.

Viral promoters, cellular promoters/enhancers and inducible promoters/enhancers that could be used in combination with the nucleic acid encoding a gene of interest in an ~ es~ion construct. Some examples of enhancers include immunoglobulin heavy chain; immunoglobulin light chain; T-cell receptor; HLA
DQ a and DQ ,B ,~-interferon; interleukin-2; interleukin-2 receptor; Gibbon ape leukemia virus; MHC Class II S or HLA-DR; ,B-actin; muscle creatine kinase;
prealbumin (transthyretin); elastase I; metallothionein; collagenase; albumin gene;
a-felo~rotein; a-globin; ,~-globin; c-fos; c-HA-ras; insulin neural cell adhesion molecule (NCAM); al-~~ y~ ; H2B (TH2B) histone; mouse or ~ype I collagen;
glucose-regulated proteins (GRP94 and GRP78); rat growth hormone; human serum WO 97/26357 PCTrUS97/00787 amyloid A (SAA); troponin I (TN I); platelet-derived growth factor; Duchenne muscular dystrophy, SV40 or CMV; polyoma; retroviruses; papilloma virus; hepatitis B virus and human immunodeficiency virus. Inducers such as phorbol ester (TFA) heavy metals; glucocorticoids; poly (rl)X; poly(rc); Ela; H2O2; IL-1; interferon, s Newcastle disease virus; A23187; IL-6; serum; SV40 large T antigen; FMA; thyroid hormone or glucose could be used. Additionally, any promoter/enhancer combination (as per the Eukaryotic Promoter Data Base, EPDB) could also be used to drive expression of the gene. Eukaryotic cells can support cytoplasmic transcription from certain bacterial promoters if the a~ropliate bacterial polymerase is provided, either o as part of the delivery complex or as an additional genetic expression construct.

In pr~el~ed embodiments, the expression construct will comprise a virus or engineered construct derived from a viral genome. The ability of certain viruses to enter cells via receptor-mediated endocytosis and to integrate into host cell genome and express viral genes stably and efficiently have made them attractive candidates for the transfer of foreign genes into m~mmalian cells (Ridgeway, 1988; Nicolas and Rubenstein, 1988; Baichwal and Sugden, 1986; Temin, 1986). The first viruses used as gene vectors were DNA viruses including the papovaviruses (simian virus 40, bovine papilloma virus, and polyoma) (Ridgeway, 1988; Baichwal and Sugden, 1986)and adenoviruses (Ridgeway, 1988; Baichwal and Sugden, 1986). These have a 20 relati~ely low capacity for foreign DNA sequences. Furthermore, their oncogenic potential and cytopathic effects in permissive cells raise safety concerns. They can accommodate only up to 8 kb of foreign genetic m~t~rial but can be readily introduced in a variety of cell lines and laboratory ~nim~l~ (Nicolas and Rubenstein, 1988;Temin, 1986).

2s (b) Re~ulatory l~lements Where a cDNA insert is employed, one will typically desire to include a polyadenylation signal to effect proper polyadenylation of the gene transcript. The W 097/26357 PCT~US97/00787 nature of the polyadenylation signal is not believed to be crucial to the successful practice of the invention, and any such sequence may be employed. The inventors have employed the human growth hormone and SV40 polyadenylation signals in that they were convenient and known to function well in the target cells employed. Also s contemplated as an element of the expression cassette is a termin~tQr. These elements can serve to enhance message levels and to minimi7e read through from the cassette into other sequences.

(c) Selectable Markers In certain embodiments, the delivery of a nucleic acid in a cell may be o identifled in vitro or in vivo by including a marker in the expression construct. The marker would result in an i~lentifi~hle change to the transfected cell permitting easy identification of expression. Usually the inclusion of a drug selection marker aids in cloning and in the selection of transforrnants, for example, neomycin, puromycin, hygromycin, DHFR, GPT, zeocin and histidinol. Alternatively, enzymes such as herpes simplex virus thymidine kinase (tk) (eukaryotic) or chloramphenicol acetyltransferase (CAT) (prokaryotic) may be employed. Immunologic markers also can be employed. The selectable marker employed is not believed to be important, so long as it is capable of being expressed simultaneously with the nucleic acid encoding a gene product. Further examples of selectable markers are well known to one of skill 20 in the art.

(d) Multi~ene Constructs and IRES

In certain embodiments, the use of internal ribosome binding sites (IRES) elements are used to create multigene, or polycistronic, messages. IRES elements are able to bypass the ribosome sc~nning model of 5' methylated Cap dependent 25 translation and begin translation at internal sites (Pelletier and Sonenberg, 1988).
IRES elements from two members of the picornavirus farnily (polio and .

W O 97/26357 PCT~US97/00787 encephalomyocarditis) have been described (Pelletier and Sonenberg, 1988), as well an IRES from a m~mm~ n message (Macejak and Sarnow, 1991). IRES elements can be linked to heterologous open reading frames. Multiple open reading frames can be transcribed together, each separated by an IRES, creating polycistronic messages.
5 By virtue of the IRES element, each open reading frame is accessible to ribosomes for efficient translation. Multiple genes can be efficiently expressed using a single promoter/enhancer to transcribe a single message.

Any hetero}ogous open reading frame can be linked to IRES elçrnPnt~ This includes genes for secreted proteins, multi-subunit proteins encoded by independent o genes, intracellular or membrane-bound proteins and selectable markers. In this way expression of several proteins can be simultaneously ~ in~red into a cell with asingle construct and a single selectable marker.

3. Biological Functional Equivalents Various nucleic acid and protein sequences are described herein that may be 5 used in the diverse hexokinase inhibition methods of the present invention.
Particularly preferred genes and proteins are trehalose-6-phosphate synthase (TPS1);
hexokinase I; hexokinase II; hexokinase III; glucokinase (hexokinase IV); and fragments thereof. The following description is provided in order to further explain the equivalents of the foregoing genes and proteins that will be understood by those of 20 skill in the art to fall within the scope of the present invention.

(a) Proteins and DNA Se~ments As used herein, in the context of the foregoing nucleic acid sequences, the terrns "gene", "DNA segment" and "polynucleotide" refer to DNA molecules that have been isolated free of total genomic DNA of a particular species. Therefore, the DNA segments encode their respective proteins or polypeptides, but are isolated away from, or purified free from, total genomic DNA. Included within the terrn "DNA

W 097126357 PCT~US97/00787 segment" are DNA segments and smaller fr~ment~ of such segments, and also recombinant vectors, including, for example, plasmids, cosmids, phage, viruses, and the like.

DNA segments such as those encoding TPS 1, low Km hexokinase, s glucokinase, and other polypeptides and proteins described herein may compriseisolated or purified genes including their respective coding sequences and, in certain aspects, regulatory sequences, isolated substantially away from other naturally occurring genes or protein encoding sequences. In this respect, the term "gene" is used for simplicity to refer to a functional protein encoding unit. As will be 0 understood by those in the art, this functional term includes both genomic sequences and cDNA sequences.

"Isolated substantially away from other coding sequences" means that the particular protein-encoding unit forms the significant part of the coding region of the DNA segment, and that the DNA segment does not contain large portions of naturally-occurring coding DNA, such as large chromosomal fragments or other functional genes or cDNA coding regions. Of course, this refers to the DNA segment as originally isolated, and does not exclude genes or coding regions later added to the segment by the hand of man.

In particular embodiments, this invention concerns the use of isolated DNA
20 segments and recombinant vectors incorporating DNA sequences that encode various proteins defined herein in terms of their amino acid sequences. Other sequences that are "essentially as set forth in" the $equence identifiers are, of course, encompassed within the invention. The term "a sequence essentially as set forth in" means that the sequence substantially corresponds to a portion of the recited sequence and has 25 relatively few amino acids that are not identical to, or a biologically functional equivalent of, the amino acids of the recited sequence.

.

W O 97/26357 PCT~US97/00787 The term "biologically functional equivalent" is well understood in the art and is further defined in detail herein. Accordingly, sequences that have between about 70% and about 80%; or more preferably, between about g 1% and about 90%, or evenmore preferably, between about 91% and about 99%; of amino acids that are identical 5 or functionally equivalent to the amino acids of a recited sequence will be sequences that are "essentially as set forth in" the recited sequence. Naturally, there is the very important provision that to be "equivalent" the encoded protein must function essentially in the same way as the recited protein. This is particularly important in the present invention, where the different kinetic properties of isoenzymes catalyzing the 0 same biochemical steps lie at the heart of several fealll,cs of the invention. However, with this in mind, there are still a number of equivalents and sequence variants of the aforementioned proteins that can be generated and used.

In certain other embodiments, the invention concerns the use of isolated DNA
segments and recombinant vectors that include within their sequence a nucleic acid 5 sequence essentially as set forth in a recited sequence identifier. The term "essentially as set forth in", when referring to nucleic acids, is used in the same sense as described above and means that the nucleic acid sequence substantially corresponds to a portion of the recited sequence and has relatively few codons that are not identical, orfunctionally equivalent, to the codons of the recited sequence. The term "functionally 20 equivalent codon" is used herein to refer to codons that encode the same amino acid, such as the six codons for arginine or serine, and also refers to codons that encode biologically equivalent amino acids, as set forth in the table below.

WO 97n6357 PCT/US97/00787 Table 2 Amino Acids Codons Alanine Ala A GCA GCC GCG GCU
Cysteine Cys C UGC UGU
Aspartic acid Asp D GAC GAU
Glutamic acid Glu E GAA GAG
Phenylalanine Phe F UUC WU
Glycine Gly G GGA GGC GGG GGU
Histidine His H CAC CAU
Isoleucine Ile I AUA AUC AUU
Lysine Lys K AAA AAG
Leucine Leu L UUA UUG CUA CUC CUG CW
Methionine Met M AUG
Asparagine Asn N AAC AAU
Proline Pro P CCA CCC CCG CCU
Glutamine Gln Q CAA CAG
Arginine Arg R AGA AGG CGA CGC CGG CGU
Serine Ser S AGC AGU UCA UCC UCG UCU
Threonine Thr T ACA ACC ACG ACU
Valine Val V GUA GUC GUG GW
Tryptophan Trp W UGG
Tyrosine Tyr Y UAC UAU

Accordingly, DNA segments prepared in accordance with the present invention may also encode biologically functional equivalent proteins or peptides that have variant arnino acids sequences. Such sequences may arise as a consequence of 5 codon redundancy and functional equivalency that are known to occur naturally within nucleic acid sequences and the proteins thus encoded. Alternatively, functionally equivalent proteins or peptides may be created via the application of W 097/26357 ~ PCTrUS97/00787 recombinant DNA technology, in which changes in the protein structure may be engineered, based on considerations of the properties of the amino acids being exchanged, as described herein.

It will also be understood that amino acid and nucleic acid sequences may 5 include additional residues, such as additional N- or C-tçrmin~l amino acids or 5' or 3' nucleotides, and yet still be "es.s~nti~IIy as set forth in" one of the sequences disclosed herein, so long as the sequence meets the criteria set forth above, including the m~ eIlA..ce of biological protein activity following expression, where proteins are concerned. ~he addition of terminal sequences particularly applies to nucleic acid o sequences for use in vectors that may, for example, include various non-codingsequences fl~nking either of the 5' or 3' portions of the coding region or may include various internal sequences, i e., inkons, which are known to occur within genes.
Excepting intronic or fl~nking regions, and allowing for the de~eneracy of the genetic code, sequences that have between about 70% and about 80%; or more lS preferably, between about 81% and about 90%; or even more preferably, between about 91% and about 99%; of nucleotides that are identical to the nucleotides of a recited sequence will be sequences that are "essentially as set forth in" the recited sequence. Sequences that are es.centi~Ily the same as those set forth in a recited sequence may also be functionally defined as sequences that are capable of 20 hybridizing to a nucleic acid segment cont~ining the complement of the recited sequence under relatively stringent conditions. Suitable relatively stringent hybridization conditions are well known to those of skill in the art.

(b) Biolo~ical Functional Equivalents Modification and changes may be made in the structure of protein molecules 25 and still obtain other molecules having like characteristics. For example, certain amino acids may be substituted for other amino acids in a protein structure without appreciable loss of interactive binding capacity with structures such as, for example, substrates and effectors.

Since it is the interactive capacity and nature of a protein that defines that protein's biological functional activity, certain amino acid sequence substitutions can s be made in a protein sequence (or, of course, its underlying DNA coding sequence) and nevertheless obtain a protein with like (agonistic) properties. Equally, it is these same type considerations that are employed to create a protein or polypeptide with counterveiling (or antagonistic) properties, as discussed herein in terms of modifying hexokinase andlor glucokinase sequences to provide mutants with selected features.

o In terms of maintaining protein function es.centi~lly as in the wild type, or natural, molecule, it is thus contemplated by the inventors that various changes may be made in the sequence of a given protein or peptide (or underlying DNA) without appreciable loss of their biological utility or activity.

It is also well understood by the skilled artisan that, inherent in the definition of a biologically functional equivalent protein, is the concept that there is a limit to the number of changes that may be made within a defined portion of the molecule and still result in a molecule with an acceptable level of equivalent biological activity.
Biologically functional equivalents are thus defined herein as those proteins in which only certain, not most or all, of the amino acids have been substituted. To be equivalent, the overall function or kinetic parameters of the resultant protein cannot be significantly changed. However, a plurality of distinct proteins with different substitutions may easily be made and used in accordance with the invention.

It is also well understood that where certain residues are shown to be particularly important to the biological or structural properties of a protein or peptide, e.g., residues in active sites, such residues may not generally be exchanged. This is the case in the present invention where certain residues may be critical.

W 097/26357 PCTrUS97/00787 Amino acid substitutions are generally based on the relative similarity of the amino acid side-chain substituents, for example, their hydrophobicity, hydrophilicity, charge, size, and the like. An analysis of the size, shape and type of the amino acid side-chain substituents reveals that arginine, lysine and histidine are all positively 5 charged residues; that alanine, glycine and serine are all of a similar size; and that phenylalanine, tryptophan and tyrosine all have a generally similar shape. Therefore, based upon these considerations, arginine, lysine and histidine; alanine, glycine and serine; and phenylalanine, tryptophan and tyrosine; are defined herein as biologically functional equivalents.

0 To effect more q~l~ntit~live changes/In making such changes, the hydropathic index of amino acids may be considered. Each amino acid has been assigned a hydropathic index on the basis of their hydrophobicity and charge characteristics, these are: isoleucine (+4.5); valine (+4.2); leucine (+3.8); phenylalanine (+2.8);
cysteinelcystine (+2.5); methionine (+1.9); alanine (+l.g); glycine (-0.4); threonine (-0.7); serine (-0.8); tryptophan (-0.9); tyrosine (-1.3); proline (-1.6); histidine (-3.2);
gh1t:~m:~te (-3.5); glutamine (-3.5); aspartate (-3.5); asparagine (-3.5); lysine (-3.9);
and arginine (-4.5).

The importance of the hydropathic arnino acid index in conferring interactive biological function on a protein is generally understood in the art (Kyte & Doolittle, 1982, incorporated herein by reference). It is known that certain amino acids may be substituted for other amino acids having a similar hydropathic index or score and still retain a similar biological activity. In making changes based upon the hydropathic index, the substitution of amino acids whose hydropathic indices are within 2 ispreferred, those which are within I are particularly preferred, and those within 0.5 are even more particularly preferred.

It is also understood in the art that the substitution of like amino acids can be made effectively on the basis of hydrophilicity. It is known that an amino acid can be W O 97/26357 PCT~US97/00787 substituted for another having a similar hydrophilicity value and still obtain abiologically equivalent, and in particular, an immunologically equivalent protein.

As detailed in U.S. Patent 4,554,101, the following hydrophilicity values have been assigned to amino acid residues: arginine (+3.0), lysine (+3.0); aspartate s (+3.0 + 1); glllt~m~t~ (+3.0 + 1); serine (+0.3); asparagine (+0.2); glut~mine (+0.2);
glycine (0); threonine (-0.4); proline (-0.5 + 1); alanine (-0.5); histidine (-0.5);
cysteine (-1.0); methionine (-1.3); valine (-1.5); leucine (-1.8); isoleucine (-1.8);
tyrosine (-2.3); phenylalanine (-2.5); tryptophan (-3.4).

In making changes based upon similar hydrophilicity values, the substitution o of amino acids whose hydrophilicity values are within 2 is preferred, those which are within 1 are particularly pl~r~lled, and those within 0.5 are even more particularly preferred.

While discussion has focused on functionally equivalent proteins arising from arnino acid changes, it will be appreciated that these changes may be effected by 15 alteration of the encoding DNA; taking into consideration also that the genetic code is degenerate and that two or more codons may code for the same amino acid. The table of amino acids and their codons, presented herein above, is useful in the design of mutant proteins and in DNA probes and primers and the like.

(c) Site-Specific Muta~enesis Site-specific mutagenesis is a technique useful in the plep~lion of modified proteins through specific mutagenesis of the underlying DNA. The technique further provides a ready ability to prepare and test sequence variants by introducing one or more nucleotide sequence changes into the DNA. The techniques are generally wellknown, as exemplified by U.S. Patent 4,888,286, incorporated herein by reference.

2s Site-specific mutagenesis allows the production of mutants through the use of specific oligonucleotide sequences which encode the DNA sequence of the desired W 097126357 PCT~US97/00787 mutation, as well as a sufficient number of ~dj~r~nt nucleotides, to provide a primer sequence of sufficient size and sequence complexity to form a stable duplex on both sides of the deletion junction being traversed. Typically, a primer of about 17 to 25 nucleotides in length is preferred, with about 5 to 10 residues on both sides of the 5 junction of the sequence being altered.

As will be appreciated, the technique typically employs a phage vector which exists in both a single stranded and double stranded form. Typical vectors useful in site-directed mutagenesis include vectors such as the M13 phage (Messing etal., 1981). These phage are readily commercially available and their use is generally well 0 known to those skilled in the art. Double stranded plasmids are also routinelyemployed in site directed mutagenesis which elimin~tes the step of transferring the gene of interest from a plasmid to a phage.

In general, site-directed mutagenesis in accordance herewith is performed by first obtaining a single-stranded vector or melting apart the two strands of a double 5 stranded vector which includes within its sequence a DNA sequence which encodes GLUT-2. An oligonucleotide primer bearing the desired mutated sequence is prepared, generally synthetically, for example by the method of Crea et al. (1978).
This primer is then annealed with the single-stranded vector, and subjected to DNA
polymerizing enzymes such as E. coli polymerase I Klenow fragment, in order to 20 complete the synthesis of the mutation-bearing strand. Thus, a heteroduplex is forrned wherein one strand encodes the original non-mllt~ted sequence and the second strand bears the desired mutation. This heteroduplex vector is then used to transform appropriate cells, such as E. coli cells, and clones are selected which include recombinant vectors bearing the mutated sequence arrangement. Further relevant 2~ publications include Adelman et al. (1983).

The preparation of sequence variants of GLUT-2 using site-directed mutagenesis is provided as one means of producing useful species and is not meant to - be limiting as there are other ways in which sequence variants of GLUT-2 may be obtained. For example, recombinant vectors encoding GLUT-2 may be treated with mutagenic agents to obtain sequence variants (see, e.g, a method described by Eichenlaub, 1979) for the mutagenesis of plasmid DNA using hydroxylamine.

Although the foregoing methods are suitable for use in mutagenesis, the use of s the polymerase chain reaction (PCRTM) is generally now preferred. This technology offers a quick and efficient method for introducing desired mutations into a given DNA sequence. The following text particularly describes the use of PCRTM to introduce point mutations into a sequence, as may be used to change the amino acid encoded by the given sequence. Adaptations of this method are also suitable for lo introducing restriction enzyme sites into a DNA molecule.

- In this method, synthetic oligonucleotides are designed to incorporate a point mutation at one end of an amplified segment. Following PCRTM, the amplified fragments are blunt-ended by treating with Klenow fragment, and the blunt-ended ~ragments are then ligated and subcloned into a vector to facilitate sequence analysis.

To prepare the template DNA that one desires to mutagenize, the DNA is subcloned into a high copy number vector, such as pUC19, using restriction sitesflankin~; the area to be mutated. Template DNA is then prepared using a plasmid miniprep. Appropriate oligonucleotide primers that are based upon the parent sequence, but which contain the desired point mutation and which are flanked at the S' 20 end by a restriction enzyme site, are synthesi7~.d using an automated synth~.ei7~r. It is generally required that the primer be homologous to the template DNA for about 15 bases or so. Primers may be purified by rl~n~tl~rin~ polyacrylamide gel electrophoresis, although this is not absolutely necessary for use in PCRTM. The 5' end of the oligonucleotides should then be phosphorylated.

The template DNA should be amplified by PCRTM, using the oligonucleotide primers that contain the desired point mutations. The concentration of MgCl2 in the amplification buffer will generally be about 15 mM. Generally about 20-25 cycles of W O 97/26357 PCTrUS97/00787 PCRTM should be carried out as follows: denaturation, 35 sec. at 95C; hybridization, 2 min. at 50~C; and extension, 2 min. at 72~C. The PCRTM will generally include a last cycle extension of about 10 min. at 72~C. After the final extension step, about 5 units of Klenow fragments should be added to the reaction mixture and incubated for a 5 further 15 min. at about 30~C. The exonuclease activity of the Klenow fragments is required to make the ends flush and suitable for blunt-end cloning.

The resultant reaction mixture should generally be analyzed by non~lç~ ring agarose or acrylamide gel electrophoresis to verify that the amplification has yielded the predicted product. One would then process the reaction mixture by removing 0 most of the mineral oils, extracting with chloroform to remove the rem~ining oil, extracting with buffered phenol and then concentrating by precipitation with 100%
ethanol. Next, one should digest about half of the amplified fragments with a restriction enzyme that cuts at the fl~nking sequences used in the oligonucleotides.
The digested fragments are purified on a low gelling/melting agarose gel.

To subclone the fragments and to check the point mutation, one would subclone the two amplified fragments into an a~plopl;ately digested vector by blunt-end ligation. This would be used to transform E. coli, from which plasmid DNA
could subsequently be prepared using a miniprep. The amplified portion of the plasmid DNA would then be analyzed by DNA sequencing to confirm that the correctpoint mutation was generated. This is important as Taq DNA polymerase can introduce additional mutations into DNA fragments.

The introduction of a point mutation can also be effected using sequential PCRTM steps. In this procedure, the two fragments encompassing the mutation are annealed with each other and extended by mutually primed synthesis. This fragment is then amplified by a second PCRTM step, thereby avoiding the blunt-end ligation required in the above protocol. In this method, the p.e~ lion of the template DNA, the generation of the oligonucleotide primers and the first PCRTM amplification are performed as described above. In this process, however, the chosen oligonucleotides W 097~6357 PCT~US97/00787 should be homologous to the template DNA for a stretch of between about 1~ and about 20 bases and must also overlap with each other by about 10 bases or more.

In the second PCRTM amplification, one would use each arnplified fragment and each fl~nking sequence primer and carry PCRTM for between about 20 and about25 cycles, using the conditions as described above. One would again subclone thefr~gments and check that the point mutation was correct by using the steps outlined above.

In using either of the foregoing methods, it is generally plefe.,ed to introducethe mutation by amplifying as small a fragment as possible. Of course, pararneters }o such as the melting tell~eld~ of the oligonucleotide, as will generally be influenced by the GC content and the length of the oligo, should also be carefully considered.
The execution of these methods, and their optimization if necessary, will be known to those of skill in the art, and are further described in various publications, such as Current Protocols in Molecular Biology, 1995, incorporated herein by reference.

5 4. In vivo Delivery and Treatment Protocols (a) Adenovirus One of the y~f~l~ed methods for in vivo delivery involves the use of an adenovirus ~xyres~ion vector. "Adenovirus exy,es~ion vector" is meant to includethose constructs co~ ; adenovirus sequences sufficient to support p~ck~ging of 20 the construct and to express a polynucleotide that has been cloned therein. In certain contexts, for example antisense constructs, expression does not require that the gene product be synth~si7~od.

The expression vector comprises a genetically engineered forrn of adenovirus.
Knowledge of the genetic org~ni7~tion or adenovirus, a 36 kb, linear, double-stranded 2~ DNA virus, allows substitution of large pieces of adenoviral DNA with foreign W O 97/26357 PCTrUS97/00787 sequences up to 7 kb (Grunhaus and Horwitz, 1992). In contrast to retrovirus, the adenoviral infection of host cells does not result in chromosomal integration because adenoviral DNA can replicate in an episomal manner without potential genotoxicity.
Also, adenoviruses are structurally stable, and no genome rearrangement has beens detected after extensive amplification. Adenovirus can infect virtually all epithelial cells regardless of their cell cycle stage. So far, adenoviral infection appears to be linked only to mild disease such as acute respiratory disease in hllm~n~

Adenovirus is particularly suitable for use as a gene transfer vector because ofits mid-sized genome, ease of manipulation, high titer, wide target-cell range and high o infectivity. Both ends of the viral genome contain 100-200 base pair inverted repeats (ITRs), which are cis elements necessary for viral DNA replication and p~ ging.
The early (E) and late (L) regions of the genome contain different transcription units that are divided by the onset of viral DNA replication. The E1 region (ElA and ElB) encodes proteins responsible for the regulation of transcription of the viral genome I S and a few cellular genes. The expression of the E2 region (E2A and E2B) results in the synthesis of the proteins for viral DNA replication. These proteins are involved in DNA replication, late gene expression and host cell shut-off (Renan, 1990). The products of the late genes, including the majority of the viral capsid proteins, are expressed only after significant processing of a single primary transcript expressed ~o from the major late promoter (MLP). The MLP (located at 16.8 m.u.) is particularly efficient during the late phase of infection, and all the mRNAs expressed from this promoter possess a S'-tripartite leader (TL) sequence which makes them preferredmRNAs for translation.

In a current system, recombinant adenovirus is generated from homologous 2s recombination between shuttle vector and provirus vector. Due to the possiblerecombination between two proviral vectors, wild-type adenovirus may be generated from this process. Therefore, it is critical to isolate a single clone of virus from an W097126357 PCT~US97/00787 individual plaque and examine its genomic structure. Use of the YAC system is analtemative approach for the production of recombinant adenovirus.

Generation and propagation of adenovirus vectors, which are replication deficient, depend on a unique helper cell line, clesign~te~l 293, which was transformed 5 from hurnan embryonic kidney cells by Ad5 DNA fragments and constitutively expresses El proteins (Graham et al., 1977). Since the E3 region is dispensable from the adenovirus genome (Jones and Shenk, 1978), the current adenovirus vectors, with the help of 293 cells, carry foreign DNA in either the El, the E3 or both regions (Graham and Prevec, 1991).

o In nature, adenovirus can package approximately 105% of the wild-type genome (Ghosh-Choudhury et al., 1987), providing capacity for about 2 extra kb of DNA. Combined with the approximately 5.5 kb of DNA that is replaceable in the E1and E3 regions, the maximum capacity of the current adenovirus vector is about 7.5 kb, or about 15% of the total length of the vector. More than 80% of the adenovirus viral genome remains in the vector backbone and is the source of vector-borne cytotoxicity.

Helper cell lines may be derived from human cells such as human embryonic kidney cells, muscle cells, hematopoietic cells or other human embryonic mesen~llymal or epithelial cells. ~ltern~tively, the helper cells may be derived from the cells of other m~mm~ n species that are pe~lllissi~le for hurnan adenovirus. Such cells include, e.g., Vero cells or other monkey embryonic mesenchymal or epithelial cells. As stated above, the preferred helper cell line is 293.

Recently, Racher et al. (1995) disclosed improved methods for culturing 293 cells and prop~g~ting adenovirus. In one format, natural cell aggregates are grown by inoculating individual cells into I liter siliconized spinner flasks (Techne, Cambridge, UK) cont~ -g 100-200 ml of medium. Following stirring at 40 rpm, the cell viability is estim~teA with trypan blue. In another format, Fibra-Cel microcarriers W O 97126357 PCT~US97/00787 (Bibby Sterlin, Stone, UK; 5 g/l) is employed as follows. A cell inoculum, resuspended in 5 ml of medium, is added to the carrier (50 ml) in a 250 ml Erlenmeyer flask and left stationary, with occasional agitation, for 1 to 4 h. The mediurn is then replaced with 50 ml of fresh medium and ~h~king initiated. For virus 5 production, cells are allowed to grow to about 80% confluence, after which time the medium is replaced (to 25% of the final volume) and adenovirus added at an MOI of 0.05. Cultures are left stationary overnight, following which the volume is increased to 100% and ~h~king commenced for another 72 h.

Other than the requirement that the adenovirus vector be replication defective, 0 or at least conditionally defective, the nature of the adenovirus vector is not believed to be crucial to the ~1cces~ful practice of the invention. The adenovirus may be of any of the 42 different known serotypes or subgroups A-F. Adenovirus type 5 of subgroup C is the preferred starting material in order to obtain the conditionalreplication-defective adenovirus vector for use in the present invention. This is 5 because Adenovirus type 5 is a human adenovirus about which a great deal of biochemical and genetic information is known, it has historically been used for most constructions employing adenovirus as a vector and it is non-oncogenic.

As stated above, a typical vector is replication defective and will not have an adenovirus El region. Thus, it will be most convenient to introduce the 20 polynucleotide encoding the gene of interest at the position from which the E1-coding sequences have been removed. However, the position of insertion of the constructwithin the adenovirus sequences is not critical to the invention. The polynucleotide encoding the gene of interest may also be inserted in lieu of the deleted E3 region in E3 replacement vectors as described by Karlsson et al. (1986) or in the E4 region 25 where a helper cell line or helper virus complements the E4 defect.

Adenovirus is easy to grow and manipulate and exhibits broad host range in vitro and in vivo. This group of viruses can be obtained in high titers, e.g, 109-101 1 plaque-forming units per ml, and they are highly infective. The life cycle of W O 97126357 PCT~US97/00787 adenovirus does not require integration into the host cell genome. The foreign genes delivered by adenovirus vectors are episomal and, therefore, have low genotoxicity to host cells. No side effects have been reported in studies of vaccination with wild-type adenovirus (Couch etal., 1963; Top etal., 1971), demonstrating their safety and therapeutic potential as in vivo gene transfer vectors.

Adenovirus vectors have been used in eukaryotic gene expression (Levrero etal., 1991; Gomez-Foix etal., 1992) and vaccine developrpent (Grunhaus and Hor~,vitz, 1992; Graham and Prevec, 1992). Recently, animal studies suggested that recombinant adenovirus can be used for gene therapy (sll~lro~d-perricaudet and o Perricaudet, 1991, SlldLro~ Perricaudet e~al., 1990; Rich etal., 1993). Studies in ~tlmini.~tering recombinant adenovirus to different tissues include trachea instillation (Rosenfeld et al., 1991; 1992), muscle injection (Ragot et al., 1993), peripheral intravenous inJections (Herz and Gerard, 1993) and stereotactic inoculation into the brain (Le Gal La Salle et al., 1993).

s (b) Retroviruses The retroviruses are a group of single-stranded RNA viruses characterized by an ability to convert their RNA to double-stranded DNA in infected cells by a process of reverse-L~ s~ lion (Coffin, 1990). The resulting DNA then stably integrates into cellular chromosomes as a provirus and directs synthesis of viral proteins. The 20 integration results in the retention of the viral gene sequences in the recipient cell and its clescPn~nt~ The retroviral genome contains three genes, gag, pol, and env that code for capsid proteins, polymerasé enzyme, and envelope components, respectively.
A sequence found upstream from the gag gene contains a signal for p~ck~ging of the genome into virions. Two long terrnin~l repeat (LTR) sequences are present at the 5' 2s and 3' ends of the viral genome. These contain strong promoter and enhancer sequences and are also required for integration in the host cell genome (Coffin, 1990).

W 097/26357 PCTrUS97/00787 In order to construct a retroviral vector, a nucleic acid encoding a gene of interest is inserted into the viral genome in the place of certain viral sequences to produce a virus that is replication-defective. In order to produce virions, a p~ck~ging cell line co~ g the gag, pol, and env genes but without the LTR and p~r~ gjng s components is constructed (Mann et al., 1983). When a recombinant plasmid cont~inin~ a human cDNA, together with the retroviral LTR and p~ ing sequences is introduced into this cell line (by calcium phosphate ~)r,_ci~ lion for exarnple), the p7~el~ging sequence allows the RNA transcript of the recombinant plasmid to be packaged into viral particles, which are then secreted into the culture media (Nicolas o and Rubenstein, 1988; Temin, 1986; Mann etal., 1983). The media cont~ining the recombinant retroviruses is then collected, optionally concentrated, and used for gene transfer. Retroviral vectors are able to infect a broad variety of cell types. However, integration and stable expression require the division of host cells (Paskind et al., 1 975).

s A novel approach designed to allow specific targeting of retrovirus vectors was recently developed based on the chemical modification of a retrovirus by thechemical addition of lactose residues to the viral envelope. This modification could permit the specific infection of hepatocytes via sialoglycoprotein receptors.

A different approach to targeting of recombinant retroviruses was designed in which biotinylated antibodies against a retroviral envelope proteirl and against a specific cell receptor were used. The antibodies were coupled via the biotin components by using streptavidin (Roux et al., 1989). Using antibodies against major histocompatibility complex class I and class II antigens, they demonstrated the infection of a variety of human cells that bore those surface antigens with an ecotropic virus in vitro (~oux et al., 1989).

There are certain limitations to the use of retrovirus vectors in all aspects ofthe present invention. For example, retrovirus vectors usually integrate into random - sites in the cell genome. This can lead to insertional mutagenesis through the W O 97/26357 PCT~US97/00787 interruption of host genes or through the insertion of viral regulatory sequences that can interfere with the function of fl~nking genes (Varmus etal, 1981). Another concern with the use of defective retrovirus vectors is the potential appearance of wild-type replication-competent virus in the p~ck~E~ing cells. This can result from s recombination events in which the intact sequence from the recombinant virus inserts upsL.ea~l, from the gag, pol, env sequence integrated in the host cell genome.
However, new p~ ging cell lines are now available that should greatly decrease the likelihood of recombination (Markowitz et al., 1988; Hersdorffer et al., 1990).

(c) Other Viral Vectors as F~ression Constructs 0 Other viral vectors may be employed as expression constructs in the present invention. Vectors derived from viruses such as vaccinia virus (Ridgeway, 1988;
Baichwal and Sugden, 1986; Coupar etal., 1988) adeno-associated virus (AAV) (Ridgeway, 1988; Baichwal and Sugden, 1986; Hermonat and Muzycska, 1984) and herpesviruses may be employed. They offer several attractive features for various m~mm~ n cells (Frie~lm~nn, 1989; Ridgeway, 1988; Baichwal and Sugden, 1986;
Couparetal., 1988;Horwichetal., 1990).

With the recent recognition of defective hepatitis B viruses, new insight was gained into the structure-function relationship of different viral sequences. In vitro studies showed that the virus could retain the ability for helper-dependent p~c.k~inE~
and reverse transcription despite the deletion of up to 80% of its genome (Horwich ef al., 1990). This suggested that large portions of the genome could be replaced with foreign genetic material. The hepatotropism and persistence (integration) were particularly attractive properties for liver-directed gene transfer. Chang et al. recently introduced the chlorarnphenicol acetyltransferase (CAT) gene into duck hepatitis B
2~ virus genome in the place of the polymerase, surface, and pre-surface coding sequences. It was cotransfected with wild-type virus into an avian hepatoma cell line.
Culture media cont~ining high titers of the recombinant virus were used to infect WO 97/26357 PCTrUS97/00787 primary duckling hepatocytes. Stable CAT gene expression was detected for at least 24 days after transfection (Chang et al., 1991).

(d) Non-viral vectors In order to effect expression of sense or ~nti~en~e gene constructs, the expression construct must be delivered into a cell. This delivery may be accomplished in vitro, as in laboratory procedures for transforming cells lines, or in vivo or ex vivo, as in the treatment of certain disease states. As described above, the pl~rell~,d mechanism for delivery is via viral infection where the expression construct is encapsidated in an infectious viral particle.

0 Several non-viral methods for the transfer of expression constructs into cultured m~mm~ n cells also are contemplated by the present invention. These include calcium phosphate precipitation (Graham and Van Der Eb, 1973; Chen and Okayama, 1987; Rippe etal., 1990) DEAE-dextran (Gopal, 1985), electroporation (Tur-Kaspa etal., 1986; Potter etal., 1984), direct microinjection (Harland and Weintraub, 1985), DNA-loaded liposomes (Nicolau and Sene, 1982; Fraley etal., 1979) and lipofectamine-DNA complexes, cell sonication (Fechheimer etal., 1987),gene bombardment using high velocity microprojectiles (Yang etal., 1990), and receptor-mediated transfection (Wu and Wu, 1987; 1988). Some of these techniquesmay be successfully adapted for in vivo or ex vivo use.

Once the expression construct has been delivered into the cell the nucleic acid encoding the gene of interest may be positioned and expressed at different sites. In certain embodiments, the nucleic acid encoding the gene may be stably integrated into the genome of the cell. This integration may be in the cognate location and orientation via homologous recombination (gene replacement) or it may be integrated in a random, non-specific location (gene augmentation). In yet further embodiments, the nucleic acid may be stably m~int~in~d in the cell as a separate, episomal segment of DNA. Such nucleic acid segments or "episomes" encode sequences sufficient to W 097/26357 PCT~US97/00787 permit m~inten~nce and replication independent of or in synchronization with the host cell cycle. How the expression construct is delivered to a cell and where in the cell the nucleic acid remains is dependent on the type of expression construct employed.

In one embodiment, the ~ e~ion constr~ct may simply consist of naked s recombinant DNA or plasmids. Transfer of the construct may be performed by any of the methods mentioned above which physically or chemically permeabilize the cellmembrane. This is particularly applicable for transfer in vitro but it may be applied to in vivo use as well. Dubensky et al. (1984) successfully injected polyomavirus DNA
in the form of CaPO4 precipitates into liver and spleen of adult and newborn mice 0 demonstrating active viral replication and acute infection. Benvenisty and Neshif (19g6) also demonstrated that direct intraperitoneal injection of CaPO4 precipitated plasmids results in expression of the transfected genes. It is envisioned that DNA
encoding a gene of interest may also be transferred in a similar manner in vivo and express the gene product.

1S Another embodiment for transferring a naked DNA expression construct into cells may involve particle bombardment. This method depends on the ability to accelerate DNA coated microprojectiles to a high velocity allowing them to pierce cell membranes and enter cells without killing them (Klein et al., 1987). ~everal devices for accelerating small particles have been developed. One such device relies on a high 20 voltage discharge to generate an electrical current, which in turn provides the motive force (Yang e~ al., 1990). The microprojectiles used have consisted of biologically inert substances such as tungsten or gold beads.

~ elected organs including the liver, skin, and muscle tissue of rats and mice have been bombarded invivo (Yang etal., 1990; Zelenin etal., 1991). This may 2s require surgical exposure of the tissue or cells, to elimin~te any intervening tissue between the gun and the target organ, i.e., ex vivo tre~tment Again, DNA encoding a particular gene may be delivered via this method and still be incorporated by the present invention.

W O 97/26357 PCTrUS97/00787 In a further embodiment of the invention, the expression construct may be entrapped in a liposome. Liposomes are vesicular structures characterized by a phospholipid bilayer membrane and an inner aqueous medium. Multilamellar liposomes have multiple lipid layers separated by aqueous medium. They form 5 spontaneously when phospholipids are suspended in an excess of aqueous solution.
The lipid components undergo self-rearrangement before the formation of closed structures and entrap water and dissolved solutes between the lipid bilayers (Ghosh and Bachhawat, 1991). Also contemplated are lipofectamine-DNA complexes.

Liposome-me~ ted nucleic acid delivery and expression of foreign DNA
in vitro has been very s~lcces~ful. Wong et al. (1980) demonstrated the feasibility of liposome-mediated delivery and e~ cssion of foreign DNA in cultured chick embryo, HeLa and hepatoma cells. Nicolau et al. (1987) accomplished successful liposome-mediated gene transfer in rats after intravenous injection.

In certain embodiments of the invention, the liposome may be complexed with a hemaggllltin~ting virus (HVJ). This has been shown to facilitate fusion with the cell membrane and promote cell entry of liposome-encapsulated DNA (Kaneda etal., 1989). In other embodiments, the liposome may be complexed or employed in conjunction with nuclear non-histone chromosomal proteins (HMG-I; Kato etal., 1991). ln yet further embodiments, the liposome may be complexed or employed in 20 conjunction with both HVJ and HMG- 1. In that such ~ ression constructs have been successfully employed in transfer and expression of nucleic acids in vitro and in vivo, they are applicable for the present invention. Where a bacterial promoter is employed in the DNA construct, it also will be desirable to include ~vithin the liposome an ~plo~.iate bacterial polymerase.

Other expression constructs which can be employed to deliver a nucleic acid encoding a particular gene into cells are receptor-me~ ted delivery vehicles. These take advantage of the selective uptake of macromolecules by receptor-mediated endocytosis in almost all eukaryotic cells. Because of the cell type-specific distribution of various receptors, the delivery can be highly specific (Wu and Wu, 1993).

Receptor-mediated gene targeting vehicles generally consist of t~,vo components: a cell receptor-specific ligand and a DNA-binding agent. Several s ligands have been used for receptor-mediated gene transfer. The most extensively characterized ligands are asialoorosomucoid (ASOR; Wu and Wu, 1987) and transferrin (Wagner et al., 1990). Recently, a synthetic neoglycoprotein, which recognizes the same receptor as ASOR, has been used as a gene delivery vehicle (Ferkol etal., 1993; Perales etal., 1994) and epidermal growth factor (EGF) has also 0 been used to deliver genes to squamous carcinoma cells (Myers, EPO 0273085).
In other embo.1iment.~, the delivery vehicle may comprise a ligand and a liposome. For example, Nicolau et al. (1987) employed lactosyl-ceramide, a galactose-terminal asialoganglioside, incorporated into liposomes and observed an increase in the uptake of the insulin gene by hepatocytes. Thus, it is feasible that a nucleic acid encoding a particular gene also may be specifically delivered into a cell type such as lung, epithelial or tumor cells, by any number of receptor-ligand systems with or without liposomes. For example, epidermal gro~,vth factor (EGF) may be used as the receptor for mediated delivery of a nucleic acid encoding a gene in many tumor cells that exhibit upregulation of EGF receptor. Mannose can be used to target the 20 mannose receptor on liver cells. Also, antibodies to CD5 (CLL), CD22 (lymphoma), CD25 (T-cell leukemia) and MAA (melanoma) can similarly be used as targeting moieties.

In certain embodiments, gene transfer may more easily be performed under ex vivo conditions. Ex vivo gene therapy refers to the isolation of cells from an animal.
2s the delivery of a nucleic acid into the cells in vitro, and then the return of the modified cells back into an animal. This may involve the surgical removal of tissue/organs from an animal or the primary culture of cells and tissues. Anderson et al., U.s.

W O 97n6357 PCT~US97/00787 Patent 5,399,346, and incorporated herein in its entirety, disclose ex vivo therapeutic methods.

(e) Pharmaceutical Compositions Where clinical applications are contemplated, it will be necessary to yleyare a s ph~ ceutical composition - either gene delivery vectors or engineered cells - in a form a~proyliate for the intended application. Generally, this will entail yrepdlillg compositions that are essentially free of pyrogens, as well as other i~"y~;lies that could be harmful to hum~ns or ~nim~

One will generally desire to employ ayplopliate salts and buffers to render o delivery vectors stable and allow for uptake by target cells. Buffers also will be employed when recombinant cells are introduced into a patient. Aqueous compositions of the present invention comprise an effective amount of the vector to cells, dissolved or dispersed in a pharmaceutically acceptable carrier or aqueous medium. The phrase "pharmaceutically or ph~ cologically acceptable'l refer to 5 molecular entities and compositions that do not produce adverse, allergic, or other untoward reactions when atlministered to an animal or a human. As used herein, "ph~rm~ceutically acceptable carrier" includes any and all solvents, dispersion media, coatings, antibacterial and antifungal agents, isotonic and absorption delaying agents and the like. The use of such media and agents for ph~ ceutically active substances 20 is well know in the art. Except insofar as any conventional media or agent isincompatible with the vectors or cells of the present invention, its use in therapeutic compositions is contemplated. Supplementary active ingredients also can be incorporated into the compositions.

Solutions of the active ingredients as free base or pharmacologically 2~ acceptable salts can be prepared in water suitably mixed with s~ ct~nt, such as hydroxyy,opylcellulose. Dispersions also can be prepared in glycerol, liquid polyethylene glycols, mixtures thereof and in oils. Under ordinary conditions of W O 97126357 PCT~US97/00787 storage and use, these plepal~ions contain a preservative to prevent growth of microorg~ni~m~.

The expression vectors and delivery vehicles of the present invention may include classic ph~rm~reutical plep~dlions. Administration of these compositions5 according to the present invention will be via any common route so long as the target tissue is available via that route. This includes oral, nasal, buccal, rectal, vaginal or topical. Alternatively, ~(imini~tration may be by orthotopic, intr~tlertn~l, subcutaneous, intramuscular, hlL~a~cl;lolleal or intravenous injection. Such compositions would normally be ~t~mini~tered as ph~rm~elltically acceptable o compositions, described supra.

The vectors and cells of the present invention are advantageously ~tlmini~tered - in the form of injectable compositions either as liquid solutions or suspensions; solid forms suitable for solution in, or suspension in, liquid prior to injection also may be prepared. These plepaldlions also may be emulsified. A typical composition for such purposes comprises about 50 mg or up to about 100 mg of human serum albumin per milliliter of phosphate buffered saline. Other ph~rrn~ceutically acceptable carriers include aqueous solutions, non-toxic excipients, including salts, preservatives, buffers and the like. Examples of non-aqueous solvents are propylene glycol, polyethylene glycol, vegetable oil and injectable organic esters, such as ethyloleate. Aqueous 20 carriers include water, alcoholic/aqueous solutions, saline solutions, palcllte.~l vehicles such as sodium chloride, Ringer's dextrose, etc. Intravenous vehicles include fluid and nutrient replenishers. Preservatives include antimicrobial agents, anti-oxidants, chelating agents and inert gases. The pH and exact concentration of the various components in the ph~rm~ceutical are adjusted according to well know 25 pararneters.

Additional formulations are suitable for oral ~imini~tration. Oral formulations include such typical excipients as, for exarnple, pharrnaceutical grades of m~nnitol, lactose, starch, m~gneciurn stearate, sodium saccharine, cellulose, magnesium W O 97t26357 PCTrUS97/00787 carbonate and the like. The compositions take the form of solutions, suspensions, tablets, pills, capsules, sustained release forrnulations or powders. When the route is topical, the form may be a cream, ointm~nt, salve or spray.

An effective amount of the therapeutic agent is determined based on the intended goal. The term "unit dose" refers to a physically discrete unit suitable for use in a subject, each unit cont~ining a predetermined quantity of the therapeutic composition calculated to produce the desired response in association with its ~lmini.~tration, i.e., the apl~royl;ate route and tre~tm~nt regimen. The quantity to be ~lmini~t~red, both according to number of tre~tm~nt~ and unit dose, depends on the o subject to be treated, the state of the subject and the protection desired. Precise amounts of the th~ld~eulic composition also depend on the ju~1gment of the practitioner and are peculiar to each individual.

(fl Cell Implantation It is proposed that engineered cells of the present invention, including those 5 that respond to glucose by secreting insulin, those that deliver other polypeptides and/or those having reduced growth rates, may be introduced into ~nim~l~ with certain needs, such as :-nim~l~ with insulin-dependent diabetes.

In the diabetic treatment aspects, ideally cells are engineered to achieve glucose dose responsiveness closely resembling that of islets. However, other cells 20 will also achieve advantages in accordance with the invention. It should be pointed out that the experiments of Madsen and coworkers have shown that implantation ofpoorly differentiated rat insulinoma cells into ~nim~ results in a return to a more differentiated state, marked by enhanced insulin secretion in response to metabolic ~uels (Madsen, et al., 1988). These studies suggest that exposure of engineered cell 25 lines to the in vivo milieu may have some effects on their response(s) to secretagogues.

W 097/263~7 PCTrUS97/00787 The prer~ d methods of ~(lmini~tration involve the encapsulation of the hexokinase-inhibited cells in a biocompatible coating. In this approach, the cells are ellLl~ped in a capsular coating that protects the contents from immunological responses. One preferred encapsulation technique involves encapsulation with 5 ~l~in~te-polylysine-~l~in~te. Capsules made employing this technique generally have a diameter of approximately 1 rnrn and should contain several hundred cells.

Cells with reduced low Km hexokinase activity in accordance herewith may thus be impl~nt~l using the ~l~in~te-polylysine encapsulation technique of O'Shea and Sun (1986), with modifications, as later described by Fritschy et al. (1991). The 0 en~in~ered cells are suspended in 1.3% sodiurn ~lgin~te and encapsulated by extrusion of drops of the cell/~l~inQte suspension through a syringe into CaC12. After several washing steps, the droplets are suspended in polylysine and rewashed. The alginate within the capsules is then reliquified by suspension in 1 mM EGTA and then rewashed ~,vith Krebs balanced salt buffer.

1S An alternative approach is to seed Amicon fibers with cells of the present invention. The cells become enrneshed in the fibers, which are semiperrneable, and are thus protected in a manner similar to the micro encapsulates (Altman et al., 1986).
After successful encapsulation or fiber seeding, the cells may be implanted intraperitoneally, usually by injection into the peritoneal cavity through a large gauge 20 needle (23 gauge).

A variety of other encapsulation technologies have been developed that are applicable to the practice of the present invention (see, e.g, Lacy et al., 1991; Sullivan et a/., 1991; WO 91/10470; WO 91/10425; WO 90/15637; WO 90/02580; U.S. Patent 5,011,472; U.S. Patent 4,892,538; and WO 89/01967, each of the foregoing being 2~ incorporated by reference).

Lacy et a/. (1991) encapsulated rat islets in hollow acrylic fibers and irnrnobilized these in ~lgin~te hydrogel. Following intraperitoneal transplantation of ~ , . .

W O 97/26357 PCT~US97/00787 the encapsulated islets into diabetic mice, normoglycemia was reportedly restored.
Similar results were also obtained using subcutaneous implants that had an a~lo~liately constructed outer surface on the fibers. It is therefore contemplated that engineered cells of the present invention may also be straightforwardly "transplanted"
5 into a m~mm~l by similar subcutaneous injection.

Sullivan etal. (l991) reported the development of a biohybrid perfused "artificial pancreas", which encapsulates islet tissue in a selectively permeable membrane. In these studies, a tubular semi-permeable membrane was coiled inside a protective housing to provide a con~ lent for the islet cells. Each end of the o membrane was then connected to an arterial polytetrafluoroethylene (PTFE) graft that extended beyond the housing and joined the device to the vascular system as an arteriovenous shunt. The implantation of such a device co~ it-il-g islet allografts into pancreatectomized dogs was reported to result in the control of fasting glucose levels in 6/10 ~nim~l~ Grafts of this type encapsulating engineered cells could also be used in accordance with the present invention.

The company Cytotherapeutics has developed encapsulation technologies that are now commercially available that will likely be of use in the application of the present invention. A vascular device has also been developed by Biohybrid, of Shrewsbury, Mass., that may have application to the technology of the present 20 invention.

Implantation employing such an encapsulation technique are pler~.led for a ariety of reasons. For example, transplantation of islets into animal models of diabetes by this method has been shown to significantly increase the period of normal glycemic control, by prolonging xenograft survival compared to unencapsulated islets 2~ (O'Shea and Sun, 1986; ~ritschy etal., 1991). Also, encapsulation will prevent uncontrolled proliferation of clonal cells. Capsules cont~ining cells are implanted (~o~imately l,000-10,000/animal) intraperitoneally and blood samples taken dailyfor monitoring of blood glucose and insulin.

W O97/26357 PCTrUSg7/00787 An alternate approach to encapsulation is to simply inject glucose sensing cellsinto the scapular region or peritoneal cavity of diabetic mice or rats, where these cells are reported to form tumors (Sato et al., 1962). Implantation by this approach may circumvent problems with viability or function, at least for the short term, that may be 5 encountered with the çnc~rs~ tion strategy. This approach will allow testing of the - function of the cells in experimental ~nim~l~ but obviously is not applicable as a strategy for treating human diabetes.

Engineering of primary cells isolated from patients is also co~ nll~lated as described by Dr. Richard Mulligan and colleagues using retroviral vectors for the lo purposes of introducing foreign genes into bone marrow cells (see, e.g., Cone et al., 1984; Danos et al., 1988). The cells of the bone marrow are derived from a common progenitor, known as pluripotent stem cells, which give rise to a variety of blood borne cells including erythrocytes, platelets, lymphocytes, macrophages, and granulocytes. Interestingly, some of these cells, particularly the macrophages, are capable of secreting peptides such as tumor necrosis factor and interleukin 1 inresponse to specific stimuli. There is also evidence that these cells contain granules similar in structure to the secretory granules of ~ cells, although there is no clear evidence that such granules are collected and stored inside macrophages as they are in ~3 cells (Stossel, 1987).

It may ultimately be possible to use the present hexokinase-inhibition technology in combination with that previously described by one of the present inventors (U.S. Patent 5,427,940, incorporated herein by reference) in a manner described for clonal cells to engineér primary cells that perforrn glucose-stimulated insulin secretion. This approach would completely circumvent the need for 2~ encapsulation of cells, since the patient's own bone marrow cells would be used for the engineering and then re-implanted. These cells would then develop into theirdifferenti~ted form (i.e., the macrophage) and circulate in the blood where they would be able to sense changes in circulating glucose by secreting insulin.

., _ .. _ .. . .

The following examples are included to demonstrate preferred embodiments of the invention. It should be appreciated by those of skill in the art that thetechniques disclosed in the exarnples that follow represent techniques discovered by the inventors to function well in the practice of the invention, and thus can be5 considered to constitute preferred modes for its practice. However, those of skill in the art should, in light of the present disclosure, appreciate that many changes can be made in the specific embodiments that are disclosed and still obtain a like or similar result without departing from the spirit and scope of the invention.

o EXAMPLE I
Expression Vectors The present example describes expression vectors that have been found to be particularly useful in the context of the invention.

Initial expression plasmids were based on pCB6 and pCB7 (Brewer, 1994).
These plasmids utilize the strong promoter/çnh~ncer of the human cytomegalovirus(CMV) immediate-early regulatory sequence capable of driving expression of inserted genes of interest. Efficient polyadenylation of transcribed messenger RNAis directed by the human growth hormone polyadenylation sequence. pCB6 encodes the neomycin resistance gene conferring resistance to the neomycin analog G418 whilepCB7 encodes the hygromycin resistance gene. Both resistant markers are transcribed by the SV40 early promoter.

A second expression plasmid was constructed with many of the same elements as pCB6. The open reading frame of the neomycin resistance gene was arnplified with the polymerase chain reaction from pCB6 (Brewer, 1994) using oligos 25 CCGGATCCCATGATTGAACAAGAT (SEQ ID NO:23) and CCAAGATCTCGCTCAGAAGAACTC(SEQID NO:24). The resulting 816 bp wO 971263s7 PCTNS97/00787 amplified product was restricted with BamHI and BglII and subcloned into the BamHI
site of pCMV8, generating pCMV8/NEO/hGH PolyA.

pCMV8 was derived from pCMV4 (Anderson et al., 1989) following removal of the alpha mosaic virus 4 RNA translational enhancer and replacing it with the5' leader sequence of the adenovirus tri-partite leader (+14 to +154 of major late transcript) fused to a hybrid intron composed of the adenovirus major late transcript 5' donor site and a 3' splice site from a variable region immunoglobulin gene frn~n and Sharp, 1982).

A portion of the gene encoding the 5' transcribed leader of the human glucose o regulated protein 78 (GRP78) was amplified using the polymerase chain reaction from pThu6.5 (corresponding to bases 372 to 594, Ting and Lee, 1988) using oligos CCGGATCCAGGTCGACGCCGGCCAA (SEQ ID NO:25) and CGAGATCTTGCCAGCCAGTTGG (SEQ ID NO:26), generating a construct with the sequence of SEQ ID NO:10. The 5' leader of human GRP 78 has been shown to direct int~rn~l initiation of translation allowing for construction of functional polycistronic genes in m~mm~ n cells (Macejak and Sarnow, 1991).

The 235 bp amplified product (SEQ ID ~O:10) was restricted with BamHI and BglII and subcloned into the BamHI site of pCMV8/NEO/hGH PolyA generating pCMV8/IRES/NEO/hGH PolyA. Unique restriction endonuclease sites exist (5' SalII
XbaIJ BamHI 3') for subcloning fr~ment~ into this expression plasmid between theCMV promoter/intron and the internal ribozyme entry site/NEO elements. cDNAs or other open reading frames cloned into these sites are transcribed from the CMV
promoter into a bicistronic message cont~ining the cDNA as the upstream open reading frame and neomycin resistance (NEO) as the downstream open reading frame.
Both open reading frames are tran~l~ted efficiently, linking neomycin drug resistance and expression of the upstream gene of interest.

W O9~126357 PCT~US97/00787 A final expression plasmid was designed for expression of genes of interest.
The 5' elements found in pCMV8 composed of the 5' leader sequence of the adenovirus tri-partite leader (+14 to +154 of major late transcript) fused to a hybrid intron composed of the adenovirus major late transcript 5' donor site and a 3' splice s site from a variable region immunoglobulin gene (~ n and Sharp, 1982) was removed by endonuclease restriction by SnaBI and BamHI and ligated into SnaBI and BgllI restricted pCB6 (Brewer, 1994), generating pCB61intron. SnaBI cuts uniquely in both plasmids at identical positions in the CMV promoter sequence.

pCB6/intron has several unique endonuclease restriction sites for subcloning o fragments downstream of the intron sequence and upstream of the hGH PolyA
sequence (5' XbaI/KpnIlMluIlClaIlBspDI/XbaIlBamHI 3'). The neomycin resistance gene is transcribed using the SV40 promoter from an independent transcriptional unit encoded on the plasmid (Brewer, 1994).

EXAMPLE II
The N-terminal Domain of Hexokinase Inhibits Hexokinase Binding to Mitochondria The present example describes truncated hexokinase compositions and methods for displacing hexokinase from mitochondria, thus inhibiting the enzyme.These methods and the protein constructs used in this manner form one aspect of the so-called "dominant negative" strategies and proteins of the invention.

A. Materials and Methods 1. Expression Plasmids An EcoRl/ NcoI fragment corresponding to bases 1 to 1452 of rat hexokinase I
c~NA (SEQ ID NO:6; Schwab and Wilson, 1989) was isolated encoding the first 455 amino acids of hexokinase I (SEQ ID NO:7). SEQ ID NO:7 represents the entire N-t~rrninzll half of the protein and should fold into a stable domain cont~ining the hexokinase I non-catalytic, regulatory domain as well as the mitochondrial binding domain targeting hexokinase I to the outer mitochondrial membrane (Polakis and s Wilson, 1985).

The 1463 base fragment was treated with Klenow fragment to blunt the ends, and ligated into pCMV8/IRES/NEO/hGH PolyA that had been digested with XbaI and Klenow treated. The resulting plasmid, pCMV8/HKNterm/IRES/NEO, will express the 455 arnino acid hexokinase domain with an additional 33 novel amino acids that o are in frame as encoded by the plasmid. The neomycin resistance gene is encoded in the downstream open reading frarne.

Alternatively, the same Klenow treated 1463 base fragment was ligated into pCB6/intron that had been previously digested with XbaI and treated with Klenow.The resulting plasmid, pCB6/intron/HKNterm, will express the 455 amino acid hexokinase domain with an additional 27 novel amino acids that are in frame as encoded by the plasmid. The neomycin resistance gene is independently transcribed off of the SV40 promoter.

2. Cell Culture RIN 1046-38 cells (Gazdar eta/., 1980; Clark eta/., l990b) were grown in 20 Medium 199 with Earles salts, Co~ g 11 mM glucose and supplem~ntçcl with 5%
fetal calf serum (Mediatech, Washington, D.C.), lOOmilliunits/ml penicillin and 100 ~g/ml streptomycin. Cells were passaged once a week using 0.05% trypsin-EDTA solution and kept under an atmosphere of 95% air and 5% CO2 at 37~C. The human embryonic kidney cell line, 293, was obtained from the American Type 25 Culture Collection, Bethesda, Maryland (ATCC CRL 1573) and cultured as recornmended.

3. Stable Transfection of Cell Lines Cells were transfected by electroporation (BTX, Inc., San Diego, Ca., Electro Cell Manipulator 600) using 10-20 x 106 cells/ml with expression plasmids at a concentration of 30~1g/ml in a 0.2 cm cuvette at settings of 165-170 volts and s 450-500 ,uF. Initial drug selection of stable transformants was done using 500 ~glml active fraction G418 (Geneticin, Gibco Life Sciences) for 10 days without media changes.

4. Northern Analysis Total RNA from RIN cell lines grown in vitro was isolated using RNAzol B
o RNA Isolation Reagent (Cinna/Biotex Laboratories Int., Friendswood, TX). 10 llg - total RNA was resolved on methyl mercury/1.5% agarose gels as described (Bailey and Davidson1 1976). Gels were subsequently stained with ethidium bromide (l~lg/ml in 0.5 M N~I4CH3CO2) to visualize RNA for integrity and loading consistency. RNAwas electro-transferred to nylon membranes as described for primer extension protocol. Membranes were hybridized with a full-length digoxigenin-labeled antisense probe corresponding to the rat hexokinase cDNA (SEQ ID NO:6) made using Genius 4 RNA Labeling Kit (Boehringer Mannheim, Tn~ n~polis, IN) and T7 polymerase.

5. Western Analysis of Hexokinase Cells were grown to 85%-9~% confluence and then washed twice with PBS.
Cells were harvested into 200 ,ul of Cell Lysate Solution, cont~ining 10 mM Tris, pH 7.5, 150 mM NaCl, lmM EDTA, 0.1% Triton, lmM DTT, and protease inhibitors AEBSF, aprotinin, leupeptin, each at 1 ~g/ml. Cells were sonicated two times each for 10-15 seconds on ice. Protein concentration was measured using Bio-Rad W 097126357 PCTrUS97/00787 Bradford Assay Kit. 10-20 llg of protein was heated at 80~C for five minutes before loading onto 10% SDS-PAGE gel.

Proteins were then transferred onto PVDF membranes. The membranes were first pre-hybridized with 3% BSA in 10 mM Tris, pH 7.5, 150 mM NaCI solution for5 I hour at room temperature. Membranes were incubated with hexokinase I polyclonal antibody (John E. Wilson, Michigan State University) overnight at 4~C at a 1 :2000 dilution.

Goat anti-rabbit IgG conjugate alkaline phosphatase was used as the second antibody (Sigma, St. Louis, Mo., No. N-7375) for two to four hours at 1:8000 o dilution. The color reaction was performed with substrates b-naphthyl acid phosphate ~Sigrna, St. Louis, Mo., No. N-7375) and a-dianisidine, tetrazotized (Sigma, St.Louis, Mo., No. D-3502) in 0.25 ml of 1 M MgC12, and membranes were developed in 0.6 M sodium borate, pH 9.6.

B. ~esults 5 1. Clones Expressing the N-terminal Domain of Hexokinase I

Stable G418 resistant clones of RIN 1046-38 transfected with pCB61intron/HKNterm were screened for expression of the hexokinase N-tçrmin~l half by western analysis as described. A protein of 482 amino acids with a predicted molecular weight of 55 kD was expected.

Five clones were identified with high level ~xl~ression of a novel protein of this size detected by western analysis using a hexokinase I specific antibody (FIG. 1).
Endogenous hexokinase I is present in all five clones as well as in the parentalRIN 1046-38 and an independent RIN 1046-38 clone, GK-8, which overexpresses rat glucokinase. There is no crossreactivity of the hexokinase I antibody with any other 2s protein in the 50 to 70 kD range, including rat glucokinase as shown in the GK-8 lane.

All five clones express the hexokinase N-terminal half protein at levels higher than endogenous hexokinase I. Overexpression is expected to be required to dislodge mitochondrial bound endogenous hexokinase.

2. I~ffects of the N-terminal Domain of Hexokinase I

The effects of ovelexl iession of the hexokinase N-terminal half on endogenous hexokinase in RIN cells are analyzed using the hexokinase enzymatic assay procedure described in detail by Kuwajima etal., (1986) and Becker etal., (1994), each incorporated herein by reference.

Unlike the chimeric hexokinase/g}ucokinase proteins described in Example III, 0 the hexokinase N-termin~l half is enzymatically inactive, but is competent to bind to mitochondria and dislodge endogenous hexokinase. This is expected to have the result of lowering the overall hexokinase activity in RIN cells.

The enzymatic assay results are shown in Figure 7. When the activity was compared among the cell lines in each fraction at lmM glucose, no difference in glucose phosphorylating activity can be detected. However at glucose concentrations below 0.5 mM, at least one clone, BGll9/2.15, showed a 50% decrease in HK
activity when compared to parental RIN 38 cells or R5C.I-17 cells (R5C.I-17 is aclonal cell line which has human insulin introduced into RIN 38 cells). In all cases, HK is more active in mitochondrial enriched fraction than cytosolic fraction, both in N' terminal HK protein expressing cells and in RIN cells suggesting mitochodrialbound HK has a higher specific activity, presumably through the direct access toenergy generating source.

EXAMPLE III
Hexokinase-Glucokinase Chimeras Inhibit Hexokinase Binding to Mitochondria This exarnple describes chimeric hexokinase-glucokinase enzymes that function to displace hexokinase from mitochondria, thus inhibiting hexokin~e, and also provide an active glucokinase enzyme to a cell. These methods and the protein constructs are a second aspect of the dominant negative strategies and proteins of the invention.

A. Materials and Methods o 1. Expression Plasmids A second hexokinase dominant negative strategy involves e~,uressing a hexokinase I/glucokinase fusion protein. An EcoRIlNcoI fragment of the hexokinase I cDNA encoding the first 455 amino acids was fused in frame to an NcoI/BamHI fragment from either pGKL l or pGKB 1 (Quaade et al., 1991) encoding either the entire rat liver glucokinase or rat islet glucokinase open reading frame, respectively.

SEQ ID NO:8 is the resulting 2911 base sequence encoding a 919 arnino acid fusion protein con~i~ting of the N-ter~ninal 455 arnino acids of hexokinase I and the entire 465 arnino acid sequence of liver glucokinase (SEQ ID NO:9). SEQ ID NO:l 1 20 is the resllltin~ 2911 base sequence encoding a 919 arnino acid fusion protein consisting of the N-t~rmin~l 455 amino acids of hexokinase I and the entire 465 arnino acid sequence of islet glucokinase (SEQ ID NO:12).

The EcoRl/ BamHl fragment encoding SEQ ID NO:8 and SEQ ID NO:ll was ligated into EcoRl and BarnHl restriction endonuclease digested pCB6, 25 generating pCB6/HK-liverGK and pCB6/HK-isletGK, respectively. Stable transfectants from these plasmids are selected in G418.

W 097/26357 PCT~US97/00787 2. Western Analysis of Glucokinase Cells were grown to 85%-90% confluence and then washed twice with PBS.
Cells were harvested into 200 ~11 of Cell Lysate Solution, cont~ining 10 mM Tris, pH 7.5, 150 mM NaCI, lmM EDTA, 0.1% Triton, lmM DTT, and protease inhibitors A~BSF, aprotinin, leupeptin, each at 1 llg/ml. Cells were sonicated two times each for 10-15 seconds on ice. Protein concentration was measured using Bio-Rad Bradford Assay Kit. 10-20 ~Lg of protein was heated at 80~C for five minutes before loading onto 10% SDS-PAGE gel.

Proteins were then transferred onto PVDF membranes. The membranes were lo first pre-hybridized with 3% BSA in 10 mM Tris, pH 7.5, 150 mM NaCl solution for I hour at room temperature. Membranes were incubated with a glucokinase -polyclonal antibody raised against a glucokinase/glutathione-S-transferase fusion protein produced and purified from E. coli as recommended by supplier (PharmaciaBiotech, Uppsala, Sweden).

&oat anti-rabbit IgG conjugate ~lk~line phosphatase was used as the second antibody (Sigma, St. Louis, Mo., No. N-7375) for two to four hours at 1:8000 dilution. The color reaction was performed with substrates b-naphthyl acid phosphate ~Sigma, St. Louis, Mo., No. N-7375) and a-dianisidine, tetrazotized (Sigma, St.
Louis, Mo., No. D-3502) in 0.25 ml of 1 M MgCl and membranes were developed in 20 0.6 M sodium borate pH 9.6.

Methods of cell culture, transfection and northern analysis are performed as described in Exarnple II.

W O 97n63~7 PCTAUS97/00787 B. Results 1. Chimeric Hexokinase/Glucokin~s in Transient Transfection For transient transfection studies, cDNAs encoding chimeric hexokinase/glucokinase proteins con~ in~ of the N-terminal domain of hexokinase I
s (amino acids 1-455) linked in frame to either the full length liver isoform ofglucokinase (HK-liverGK, SEQ ID NO:8) or the islet isoform of glucokinase (HK-isletGK, SEQ ID NO:11) were cloned into pAC.CMV.pLpA.

This vector is commonly used for ple~ lion of recombinant adenoviruses, but is also useful for transient ~x~res~ion studies because of its strong CMV promoter o and its bacterial origin of replication which allows its propagation in bacteria.
pAC.CMV.pLpA and methods for its use have previously been described in detail (Gomez-Foix et al., 1992; Becker et al., 1994b, each incorporated herein by reference).

Plasmids cont~ining DNA encoding either intact islet glucokinase, 5 hexokinase I or one of the two hexokinase/glucokinase chimeras were introduced into the human embryonic kidney cell line 293, using Ca2PO4 co-precipitation. After incubation with the plasmid DNA, cells were cultured for an additional 48 hours.Cells were harvested and crude extracts prepared for assay of glucose phosphorylating activity, using a radioisotopic assay that monitors conversion of U-l4C glucose to U-14C glucose-6-phosphate. The extract buffer and assay procedure have previously been described in detail (Kuwajima et al., 1986; Becker et al., 1994; each incorporated herein by reference).

Assays were performed at 3 and 20 mM glucose. At the lower glucose concentration, hexokinase activity is m~xim~l while glucokinase activity is very low.
2s At the higher concentration, glucokinase activity is increased to near m~xim~l The assay was also performed in the presence and absence of 10 mM unlabeled glucose-6-WO 971263~7 PCTAUS97/00787 phosphate (G6P). In the presence of G6P, low Km hexokinases are inhibited, but glucokinase is not.

As shown in FIG. 2, these assays provide important pieces of information.
First, expression of all three expressed enzymes (islet glucokinase, native HKI and 5 HK-isletGK) causes a clear increase in glucose phosphorylating activity in 293 cell extracts relative to untransfected control cells. Second, there is a sharp increase in enzyme activity at 20 mM glucose relative to 3 mM glucose for all three expressed enzymes. Finally, glucose-6-phosphate has no significant effect on the activity measured in the presence of ov~ ,c~,essed native glucokinase.

o For the HK-isletGK chimera, G6P inhibits approximately 40% of the activity measured at 20 mM glucose. A similar result was observed for 293 cells transiently transfected with the HK-liverGK chimera, with approximately 20% of the activity measured at 20 mM glucose inhibitable by G6P. While possibly significant, the effects of G6P on the glucose phosphorylating activity of the chimeras is much less than the 90% inhibition typically seen with ovelcx~lessed hexokinase I (Becker et al., 1994; Becker et a/., 1996).

These data demonstrate that the chimeric proteins are active enzymes, and that they behave like glucokinases in two key respects: they have a high apparent Km for glucose, as evidenced by the sharp increase in activity at 20 mM glucose relative to 3 mM glucose; and they are poorly inhibited by glucose-6-phosphate relative to native hexokinase. These fin-ling~ predict that ~ es~ion of the chimeric proteins in cells will displace the native hexokinase from the mitochondria, replacing the low Km activity with a high Km activity that is insensitive to G6P inhibition.

2. Stable Expression of Chimeric Hexokinase/Glucokinases Stable clones of RIN 1046-38 transfected with pCB6/HK-liverGK were anaiyzed for e~l~lei,sion of the fusion protein. Western analysis using a glucokinase W O 97126357 PCT~US97/00787 specific antibody was used to screen individual clones. A novel fusion protein with an expected molecular weight of 105 Kd is expected to be produced with the identical erl~ymatic characteristics of the fusion protein produced transiently in 293 cells. A
total of 18 individual clones were analyzed. Two stable RIN clones, BG 139/2.01 and 139/2.18 were found to express the fusion protein, as demonstrated in the western analysis of extracts using a glucokinase specific antibody (Figure 8).

The glucose phosphorylating activity was measured in BG 139/2.01 and 139/2.18 in the same way as in the transient transfection experiment in which U-l4C
glucose-6-phosphate (G6P) formation was monitored. The results are shown in o Figure 9. Assays are performed at 3 mM and 20 mM glucose concentration. At 3 mM
glucose concentration, both of the clones BG139/2.01 and BG139/2.18 have essentially the sarne phosphorylating activity as parental RIN 38 cells have. At 20 mM glucose concentration, although the phosphorylating activity did not reach to the same level as that of glucokinase overexpressed clone 40/110, the activity increased about ten fold in these two clones compared with that in RIN 38 cells.

Glucose usage was also measured in these chimeric protein expressing cell lines. At glucose concentrations of 0.5 mM and above (including 1, 3, and 20 rnM), no difference can be detected in glucose usage. However at glucose concentration of 0.01, 0.05 and 0.5 mM, up to a 50% decrease of glucose usage is seen in BG139/2.18 20 and BG139/2.1 cells compared to parental RIN 38 cells (Figure 7).

Insulin secretion in these cell lines were measured under stimnl~t~l conditions (2 mM IBMX) in the presence and absence of 2mM 5-thioglucose. Figure 10 shows that both clones, BG139/2.18 and BG139/2.1, have a m~im~l insulin secretion at lmM glucose in the presence of 2mM 5-thioglucose. This is in comparison to RIN 38 cells which reach maximum insulin secretion at 0.25 rnM under the same conditions.

3. Chimeric HK/GK protein expression in Glut2 expressing RIN cells W O 97126357 PCT~US97/00787 Previous data has shown that Glut2 and /or glucokinase expression plays an important regulatory roles in glucose stimulated insulin secretion in engineered RIN
cells (Ferber, et al., 1994). Coexpression of the chimeric HKJGK fusion proteins in a Glut2 expressing RIN cell line should give a further ~nh~n~.ement of glucose 5 stimulated insulin secretion. pCB6/HK-liverGK was introduced into a RIN cell line previously engineered for high Glut2 expression (Ferber, et al., 1994). Currently, 23 monoclonal cell lines have been isolated and are being screened for chimeric HK/GK
expression. Assays including HK and GK glucose phosphorylation, glucose usage, and insulin secretion will be performed as described above.

lo EXAMPLE IV
Glucokir~e Expression Inhibits Hexokinase The present example concerns the demonstration that the expression of glucokinase in m~mm~ n cells inhibits hexokinase.

A. Materials and Methods Rat glucokinase expression plasmid, a 1763 bp fragment encoding islet/RIN
glucokinase cDNA corresponding to bases 180 to 1927 of the published sequence (Hughes et a/., 1991), was cloned into pCB7 generating pCB7/GK. Stable transforrnants of pCB7/GK are selected in 300 ,ug/ml hygromycin for 14 days without media changes.

The cell culture, stable transfection of cell lines, and western analyses of glucokinase were perforrned as described in Examples II and III. Glucokinase activity and glucose usage assays were perforrned according to standard methodology.

B. Results RIN 1046-38 cells were transfected with pCB7/GK ar d stable clones 25 o~el~x~ ssing rat glucokinase were identified. Individual clones were screened by W 097/26357 PCT~US97/00787 western analysis using a glucokinase specific assay. RIN 40-2c represents a pool of clones ove~ essing rat glucokinase and was used for subsequent experiments.
Glucokinase enzymatic activity increased from 3.94 + 1.3 U/g in the parental cells to 21.6 + 2.2 U/g in the glucokinase transfected line.

In the studies of FIG. 3, glucose usage was measured at low ( 1 rnM) and high (20 rnM) glucose by ~-lmini~tration of [5-3H] glucose to R~N 1046-38 cells of intermediate passage nurnber (passage 40). As would be expected in cells with abundant low Km hexokinase activity, the rate of glucose usage is similar at the low and high glucose concentrations. O~/ere~ ssion of glucokinase in RIN 40-2c cellso resulted in a 60% decrease in glucose usage at 1 mM glucose relative to the untransfected control cells, while glucose metabolism at 20 mM glucose was unchanged. These results are consistent with the concept that overexpression of glucokinase leads to inhibition of low Km hexokinase activity in the transfected cells, which in turn reduces the rate of glucose metabolism at low glucose concentrations.

EXAMPLE V
Trehalose-6-Phosphate Synthase Expression Inhibits Hexokinase The present exarnple concerns the e~l,.es~ion of trehalose-6-phosphate synthase in m~mm~ n cells in order to inhibit hexokinase.

A. Materials and Methods 1. Trehalose-6-Phosphate Synthase Expression Plasmid The open reading frame of the S. cerevisiae gene CIF1, encoding trehalose-6-phosphate synthase, was amplified with the polymerase chain reaction from pMB14 ~corresponding to bases 249 to 1765 of published sequence; Gonzalez etal., 1992)using oligos CCCGGATCCCACATACAGACTTATT (SEQ ID NO:28) and 2~ CGGGATCCTCAGl~ lGGTGGCAGAGG(SEQIDNO:29). Theresulting 1534 .. , , . . _ .

W O 97/26357 PCTrUS97/00787 base fragment (SEQ ID NO: 1 ) was restricted with BamHI and ligated into the BamHI
site of pCMV8/IRES/NEO/hGH PolyA generating pCMV8/TPS/IRES/NEO.

The CMV promoter drives transcription of a bicistronic messenger RNA with yeast trehalose-6-phosphate synthase encoded in the upstream open reading frame 5 (SEQ ID NO:2) and the neomycin resistance gene encoded in the downstream open reading frame. Stable transfectants from this plasmid are selected in G418.
Alternatively, the 1434 base BamHI fragment was ligated into the BamHI site of pCB6/intron, generating pCB6/intron/TPS. Stable transfectants from this plasmid are again selected in G418.

o 2. Northern Analysis Northern analysis of trehalose-6-phosphate synthase transcripts in cell lines was performed as described in Example II above for hexokinase message detection.Filters were hybridized with a full-length digoxigenin-labeled antisense probe corresponding to yeast trehalose-6-phosphate synthase (SEQ ID NO:1) made using s Genius 4 RNA Labeling Kit (Boehringer Mannheim, Tndi~n~polis, IN) and T7 polymerase.

Cell culture and stable kansfection of cell lines were performed as described above in Example II.

3. Thin Layer Chromatographic ~LC) Assay The trehalose produced in cells expressing trehalose-6-P synthase (TPS) was detected by a thin layer chromatographic (TLC) assay using sillica coated plates and a solvent mixture of n-butanol:pyridine:H2O =15:3:2. Standard glucose and trehalose have an Rf of 2.5 and 1.0 respectively under these conditions. Detailed methods for the trehalose TLC assay are described in Piper and Lockheart (1988). Sample 2s p~el)a,d~ion was done as follows. RIN cells overexpressing TPS were grown in P150 petri dish until confluent. Cells then was washed twice in PBS solution and thencultured in 14C glucose cont~ining Hank's solution for an hour. Cells were washed again thoroughly to get rid of the unincoporated radioisotope and then collected by scraping off the dish. 25 1ll 10% trichloroacetic acid (TCA) was added to the cell s pellet. Cell extract was kept in a shaker for an hour at room temperature to extract trehalose. Samples were then centrifuged at high speed for 10 minutes. The supern~t~nt was spotted directly onto the silica plate for the TLC assay.

4. TPS Fusion Protein and Antibody Production A glutathione-TPS(GT-TPS) fusion protein was produced in E.coli as an o antigen. The TPS cDNA encoding the full length protein coding sequence on a blunt BamHI site was ligated into the E.coli expression vector pGEX4T-1 at SmaI site (from Pharmacia Biotech.). Competent E.coli XL-1 Blue cells were transfected with this construct and colonies cont~ining TPS in the correct oritentation were selected by restriction mapping. Purification of the E.coli expressed TPS was done as follows.
Cells were grown in 2x YT and 100 ~Lg / ml carbanocillin until they reached an OD600 of 0.3-0.5. 1.5 mM IPTG (final concentration) was added into the culture for 2 hours.
Cells were harvested at 4000 rpm for 10 minutes. Cells were then suspended into 4 ml lysate buffer cont~ining 10 mM Tris-HC1 pH 7.4, 150 mM NaCl, 1 mM EDTA, Aprotinin 1 ~lg / ml, Leupeptin 1 ~lg / ml, AEBSG 10 ',Ig / ml and 0.5% tween 20.
20 Lysozyme (1000 units/ ml final) and DNAse (100 unit / ml final) were added to the cells. The cells were incubated on ice for 30 minlltes followed by sonication two times each 15 seconds on ice. The lysate was clarified by centrifugation at 13000 rpm at 4~
C for 30 minutes. Supernatant was collected for colurnn purification of the induced GT-TPS fusion protein. Prepacked glutathione Sepharose 4B column (from Pharmacia25 Biotech) was used following the instruction provided by the company. Two ml supern~t~nt of cell lysate was loaded into the column via gravity flow. The column was washed three times with 10 ml PBS. TPS protein was eluted with 2 ml elution buffer co~ in~ 10 mM reduced glutathione, 50 ~11 thrombin (at 1 unit / llm) and .

Il]

PBS. Two miligrams Purified TPS protein at concentration 1 mg / ml was used to raise antibody in rabbits. Polyclonal antibodies were raised by TANA Laboratory, Inc.

B. Results TPS expression is detected by western analysis using the polyclonal antibody s raised against e.coli expressed TPS as described in materials and methods. TPS can be expressed in RIN cells at varying levels. Western analysis detects a single 60 kD band which is absent in parental RIN 38 cells.

TLC assay results in Figure l l showed that trehalose-6-P synthase (TPS) expressing R~N cells (BG 120) produced trehalose which most likely is the lO dephosphorylation product of trehalose-6-P produced by TPS. Semiquative measurement showed there to be 5-10% extractable trehalose present in these cells relative to the glucose level in these cells. The control RIN 38 cells did not show any trace amount of trehalose suggesting trehalose is made only from cells expressing TPS.

5Glucose phosphorylation and usage assays in the TPS expressing cells are under investigation.

EXAMPLE VI
Hexokinase Ribozymes Inhibit Hexokin~e This example relates to the ~se of hexokinase-specific ribozymes for inhibiting 20hexokinase.

W O 97/263~7 PCT~US97/00787 A. Materials and Methods 1. Hexokinase Ribozyme Expression Plasmids Three separate ribozyme constructs were made directed at target sequences of rat hexokinase I and/or rat hexokinase II. The first ribozyme is encoded by oligo 1 (CTAGACTCCATGCTCTGATGAGTCCGTGAGGACGAAACGTTCTGGTTCG;
SEQ ID NO:29) and oligo 2 (GATCCGAACCAGAACGTTTCGTCCTCACGGACTCATCAGAGCATGGAGT;
SEQ ID NO:30). Bases 3 through 14 of oligo 1 are complimentary to bases 417 to 407 of the published rat hexokinase I messenger RNA (Schwab and Wilson, 1989) 0 while bases 37 to 48 of oligo 1 are complim-ont~ry to bases 405 to 394 of rathexokinase I. Bases 15 through 36 of oligo 1 encode a synthetic ribozyme based on the catalytic domain of the satellite RNA of tobacco ringspot virus (Forster andSymons, 1987).

Once this oligo is transcribed, an RNA (SEQ ID NO:3) with the following components is generated: (i) an internal 22 base highly conserved catalytic domain;
(ii) capable of base pairing to the specific sequences of rat hexokinase I, 5' and 3' of the catalytic domain; (iii) and catalyzing cleavage of the rat hexokinase message at a defined cleavage site between bases 406 and 407 of the rat hexokinase I message.
Oligos 1 and 2 are complimentary in their sequence, ~nn~.~lin~ together to give 20 a double stranded DNA duplex with an XbaI endonuclease restriction site overhang at one end and a BamHI endonuclease restriction site overhang at the other end. Theannealed oligos are ligated into pCMV8/IRES/NEO/hGH PolyA that has been restricted with XbaI and BamHI, generating pCMV8/HKR I BO 1+2/IRES/NEO.

The second ribozyme is encoded by oligo 3 2~ (CTAGATCATGGTCCCCTGATGAGTCCGTGAGGACGAAACTGTGTCATG;
SEQ ID NO:31) and oligo 4 (GATCCATGACACAGTTTCGTCCTCACGGACTCATCAGGGGACCATGAT;

W O 971263S7 PCTrUS97/00787 SEQ ID NO:32). Bases 5 through 15 of oligo 3 are complimentary to bases 736 to 725 of the published rat hexokinase I messenger RNA (Schwab and Wilson, 1989) and are also compliment~ry to bases 841 to 831 of rat hexokinase II messenger RNA
(Thelen and Wilson, 1991). Bases 38 to 47 of oligo 3 are complim~nt~ry to bases 723 s to 714 of rat hexokinase I and bases 829 to 820 of rat hexokinase II. Bases 16 through 37 of oligo 3 encode the same synthetic ribozyme as oligo 1, above, which is based on the catalytic domain of the satellite RNA of tobacco ringspot virus (Forster andSymons, 1987).

This second ribozyme (SEQ ID NO:4) will catalyze cleavage of the rat o hexokinase I message between bases 724 and 725 and cleavage of the rat hexokinase II message between bases 830 and 831. As in the above example, oligos 3 and 4 are compliment~ry in their sequence, ~nne~ling together to give a double stranded DNA duplex with an XbaI endonuclease restriction site overhang at one end and a BamHI endonuclease restriction site overhang at the other end. The annealed oligos are ligated into pCMV8/IRES/NEO/hGH PolyA that has been restricted with X~aI and BamH1, generating pCMV8/HKR I BO3+4/IRES/NEO.

The third ribozyme is encoded by oligo 5 (CTAGAGTTCCTCCAACTGATGAGTCCGTGAGGACGAAATCCAAGGCCAG;
SEQ ID NO:33) and oligo 6 20 (GATCCTGGCCTTGGATTTCGTCCTCACGGACTCATCAGTTGGAGGAACT;
SEQ ID NO:34). Bases 6 through 15 of oligo 5 are complimçnt~ry to bases 1698 to 1689 of the published rat hexokinase I m~ssenger RNA (Schwab and Wilson, 1989) and are also complimentary to bases 1804 to 1795 of rat hexokinase II messenger RNA (Thelen and Wilson, 1991). Bases 38 to 48 of oligo 5 are complimentary to 25 bases 1687 to 1677 of rat hexokinase I and bases 1793 to 1783 of rat hexokinase II.
Bases 16 through 37 of oligo 5 encode the same synthetic ribozyme as oligo 1, above, which is based on the catalytic domain of the satellite RNA of tobacco ringspot virus (Forster and Symons, 1987).

This third ribozyme (SEQ ID NO:5) will catalyze cleavage of the rat hexokinase I message between bases 1688 and 1689 and cleavage of the rat hexokinase II message between bases 1794 and 1795. As in the above example, oligos 5 and 6 are compliment~ry in their sequence, ~nn~ling together to give a double stranded DNA duplex with an XbaI endonuclease restriction site overhang at one end and a BamHI endonuclease restriction site overhang at the other end. Theannealed oligos are ligated into pCMV8/IRES/NEO/hGH PolyA that has been restricted vvithXbaI and BamHI, genPr~tin~ pCMV8/HKRIBO5+6/IRES/NEO.

The three ribozyme expression plasmids utilize the CMV promoter to drive 0 expression of multifunctional messenger RNAs with the ribozyme placed upstream of the open reading frame of the neomycin re~i~t~nce gene. Stable transfectants from these plasmids are selected using G418.

2. Northern Analysis Northern analysis of ribozymelIRESlNEO transcripts in cell lines was 15 performed as described above in Example I using a full-length digoxigenin-labeled ~nti~çn~e probe corresponding to the neomycin resistance gene (control template supplied in Genius 4 Kit, Boehringer ~nnheim, Tn~ n~polis, IN).

Cell culture and stable transfection of cell lines were performed as described above in Example I.

20 B. Results Ribozymes are used to specifically target the downregulation of an endogenous gene product in engineered cell lines. Three ribozymes have been designed with the capacity to anneal to and enzymatically cleave either the hexokinase I andlor hexokinase I message. Enzymatic cleavage is based on the h~nnmerh 25 ribozyme structure designed into the three constructs (Forster and Symons, 1987).

Efrat etal. (1994) reported the results of studies in which a ribozyme was designed to target and down-regulate glucokinase. The result of glucokinase down-regulation was impaired glucose-intl~lced insulin secretion. Higher glucoseconcentrations than normal were required to elicit insulin secretion. This is the opposite result from that of the present example, where a normal glucose-in-luced insulin secretion is expected.

The hexokinase ribozyme transgenes are expressed in RIN1046-38 cells as bicistronic messages of approximately 1100 base pairs. The ribozyme is encoded 5' to the inteTn~l ribozyme entry site and neomycin resistance gene which ensures that 0 clones resistant to G418 will also express the ribozyme.

Northern analysis using a probe specific for the neomycin resistance gene of RIN 1046-38 cells transfected with pCMV8/HKR I BO1+2/IRES/NEO demonstrates high level expression of the transgene at the expected size in two independent polyclones (EP1 13/lA and lB) as compared to parental cells (FIG. 3).

EXAMPLE VII
Hexokinase Inhibition Slows Cell Growth This example relates to the use of hexokinase inhibition and its effects on cellgrowth.

A. Materials and Methods 1. Construction of gene replacement vector A portion of the rat hexokinase I (HKI) gene was subcloned in a lambda Charon 4A (John Wilson, Department of Biochemistry, Michigan State University, East T~n.~ing, MI). The 15 kb clone encnmp~c.~erl exon 1, about 0.2 kb of intron 1, and about 14.8 kb of sequence ~ sllcaln of exon 1. Sequence and maps of this clone aided in the mapping of the HKI gene and in the isolation of homologous isogenic W 097/26357 PCT~US97/00787 sequences from RIN genomic DNA. The novel 1082 base sequence of the non-transcribed rat HKI genomic DNA as well as the first 170 bases of HKI transcribed DNA (Schwab and Wilson, 1989) is given as SEQ ID NO:43. A plasmid vector providing positive and negative selection was employed as well (Dr. Joachim Herz at s the University of Texas Southwestern Medical Center, Department of Molecular Genetics, Dallas, Texas). pPolIIshort-neobPA-HSV-tk is derived from the pGEM3Zf(+) backbone and contains a neomycin phosphotransferase gene (positive selection) and two tandem copies of herpes simplex virus thymidine kinase gene (HSV-tk) that provide negative selection in the presence of gancyclovir (Ishibashi et a~., 1993). pPolIIshort-neobPA-HSV-tk was modified to create pAT9 by creating a unique Not I site 5' of the Neo cassette (FIG. 5). A 873 base pair fragment was amplified from RIN genomic DNA using oligos TTTC:~CCCTCGAGCACCGCCCGGAACAGTACC (SEQ ID NO:36) and GTTGCGCCTCGAGCATGCTGACGGTGGGGG (SEQ ID NO:37) to provide a 5 short arm of homology to the HKI gene. The sequence extends 5' from the first methionine of exon 1 and is flanked by engineered X71oI sites.

In addition, a 1121 base fragment was amplified from RIN genomic DNA
using oligos GTTGGACTCGAGAGTCACCTAAGGGCCTATG (SEQ ID NO:38) and GTTGCGCCTCGAGCATGCTGACGGTGGGGG (SEQ ID NO:37), providing a 20 longer short arm to serve as a positive control for screening for homologous recombinants by PCRTM. The 873 and 1121 base pair PCRTM fr~ment~ were restricted with X~oI and subcloned into pAT9 at a unique ~oI site which is flanked by the Neo c~sette and the copies of HSV-tk (FIG. ~), generating pAT21 and pAT22respectively.

2s Southern blot analysis in RIN 1046-38 genomic DNA with a probe within exon 1 revealed a 16 kb KpnI fragment. This fragment was enriched by sucrose density ultracentrifugation, modified with adapters to create fl~nking NotI sites, and subcloned into lambda Dash II (Stratagene, La Jolla, CA). Recombinant phages W O 971263S7 PCT~US97/00787 cont~ining the fragment were isolated by plaque screening. The 16 kb NotI fragment was cloned into the unique NotI site of pAT22 to provide a long arm of homology to the HKI gene (FIG. 5), generating pAT23, the HK1 repl~cçment vector.

2. Cell culture, electroporation, and drug selection s Various cell lines derived from the rat insulinoma RIN 1046-38 line (Clark etal., 1990b) were grown in Medium 199 with Earle's salts, cont~inin~ 11 mM
glucose and 5% fetal bovine serurn. Exogenous DNA was introduced into the cells by electroporation. RIN cell lines were grown to 50% to 75% confluence, harvested by trypsinization, washed once with phosphate-buffered saline (PBS), and resuspended in o PBS for counting. For each electroporation, 1 x 107 cells were pelleted by centrifilgation at 1000 rpm for 2 minlltes and resuspended in 0.4 ml cold Electroporation Buffer (85.5 mM NaCl, 6.1 mM glucose, 2.5 mM KCl, 350 mM
Na2HPO4, 10 mM Hepes, pH 7.0). DNA was added to the cell suspension to achieve a final concentration of 50 micrograms per ml. DNA was electroporated into cells in a 2 rn~n cuvette at 170 volts and 510 microFaradies using an Electro Cell Manipulator 600 (BTX, Inc., San Diego, CA) Cells were plated in non-selective medium and cultured for 2 to 3 days. Medium cont~ining G418 at a final concentration of 500micrograms per ml was used to select for clones integrated with the neomycin resistance marker. Following positive selection in G418, gancyclovir at a final concentration of 6 ~lM was used to selectively kill clones expressing HSV-tk.
Gancyclovir was applied for 3 days; cells were then m~int~ined in medium containing G418.

3. PCRTM assay for targeted recombinants Following positive selection in G418 and negative selection in gancyclovir, 2s clones were grown until visible by the naked eye. Individual colonies were picked, dispersed in trypsin, and divided between duplicate cultures in 96-well plates.

W 097/26357 PCT~US97/00787 Following 10 to 15 days in culture, cells of one duplicate were rinsed in PBS and lysed by incubation at 37~C for 8 to 12 hours in fifty microliters of Lysis Buffer (16.6 mM arnrnonium sulfate, 67 mM Tris-HCI, 6.7 mM MgCl2, 5.0 mM
2-mercaptoethanol, 6.7 ~LM EDTA, 1.7 ~M SDS, 50 ~Lg/ml proteinase K, pH 8.8;
s Willnow and Herz, 1994). Five microliters of lysate were used as a template in a 25 ~l polymerase chain reaction (PCRTM3 in 16.6 mM ammonium sulfate, 67 mM
Tris-HC1, 6.~ mM MgCl2, 5.0 mM 2-mercaptoethanol, 6.7 ~M EDTA, 1 mM each dNTP, 80 ~lg/ml BSA, 0.8 ~lg/ml of each primer, and 2.5 units Taq DNA polyrnerase.
The arnplification program consisted of 92~C for 40 seconds, 57~C for 40 seconds, o 75~C for 1 minute (40 cycles) and a final extension for 5 minutes at 75~C. The oligonucleotides used to amplify disrupted HKI included a primer in the 3' end of the Neo cassette (5'GATTGGGAAGACAATAGCAGGCATGC3' SEQ ID NO:39, primer 1, FIG. 5 Ishibashi et al., 1993) and a primer in the HKI gene upstrearn of the putative recombination site (5'AGTCGCCTCTGCATGTCTGAGTTC3' SEQ ID
NO:40, primer 3, FIG. 5). The plasmid pAT22, cont~ining the longer short arm of homology, served as a positive control in this PCRTM reaction. A second control PCRTM reaction was also included using primer 1 and a primer in the HKl gene downstream of the recombination site (5'CTTGAGCTCTTACATGGTGTCACG3' SEC~ ID NO:41, primer 2, FIG. 5). This control PCRTM reaction should detect both20 homologous and random integrants of the HK1 replacement vector. Recombinants detected in the first screen were confirmed in a second PCRTM reaction for which no positive control plasmid exists. The absence of such a control negates the possibility of a false positive due to cont~min~tion. The primers in this secondary screen were primer 1 and primer 4 (5'TCCCCAGGCGTGGGGTAGAAG3' SEQ ID NO:42), an 25 oligonucleotide upstrearn of the recombination site in the HKI gene (FIG. 5). PCRTM
products were analyzed either by gel electrophoresis or a slot blot assay. For e}ectrophoresis, reaction products were fractionated in 1% agarose gels in Tris-borate/EDTA buffer (9 mM Tris-borate, 0.2 mM EDTA). DNA was visualized by staining in ethidium bromide. For slot-blots, reaction products were denatured in W O 97/26357 PCTrUS97/00787 0.5 N NaOH, 1.5 M NaCl, neutralized in 1.0 M Tris-HCl, pH 7.5, 1.5 M NaCl, and transfer to a nylon membrane using a 96-well blot ~alal~ls (Scheichller and Schuell, Keene, NH). DNA was cross-linked to the membrane and HKI amplified products were detected by hybridization with 32P-labeled oligonucleotides complement~ry to s HKI and int~ l to primers used in the amplification reaction. Positive clones were replated in 96-well dishes to obtain densities of one cell per well. These clones were allowed to grow and assayed by PCRTM with the primers described above. This cycle of dilution cloning was repeated until all clones of a plating were positive in the assay.

4. Genomic Southern analysis 0 RIN clones that were positive by PCRTM for an disrupted allele of HKI were assayed by genomic Southern. Genomic DNA was isolated using reagents and protocols of the QIAamp Blood Kit (catalog number 29104, Qiagen, Inc., Chatsworth CA). Five to ten micrograms of DNA were digested with enzymes as indicated and fractionated through 0.8% agarose gels using TEAN buffer (0.04 M Tris-HCl, 0.025 M sodium acetate, 0.018 M NaCl, 25 mM EDTA, pH 8.15). Electrophoresis was conducted for 12 to 16 hours at 25 to 35 volts with recirculation of the buffer from the positive to the negative electrode. ~NA was visualized by staining withethidiurn bromide. DNA in the gel was denatured for 30 minutes in 0.5 N NaOH, 1.5 M NaCl. Following neutralization in 1 M Tris-HCl, pH 7.5, 1 M NaCl for 30 minlltes, DNA was transferred to a nylon membrane (Hybond-N+, ~mer,ch~m) in 10x SSC (lx SSC = 0.15 M NaCl, 0.015 M sodium citrate) and cross-linked to the membrane by ultraviolet radiation (UV Stratalinker 2400, Stratagene, Inc.).
Radiolabelled probes (32p) for hybridization to and detection of genomic fragments were synth~ci7e~1 as directed using the rediprime Random Primer Labeling Kit (RPN
2s 1633, Amersham Life Sciences). Membranes were prehybridized and hybridized in Rapid-hyb Buffer (NIF939, Amersham Life Sciences). All incubations and washes wo 97126357 PCT/USg7/00787 were performed in a Micro-4 Hybridization Oven (Hybaid Limited). Membranes were exposed to X-OMAT, AR5 film (Kodak) for periods of time as indicated.

B. Results Prior to construction of a gene replacement vector, a comparison was made of s the copy number of HKI alleles in rat versus RIN genomic DNA. DNA was digestedwith XbaI, Southern blotted, and probed with a radiolabelled fragment from intron 1 of the HKI gene. Autoradiography revealed e~uivalent signals derived from the rat and RIN HKI gene fragments. Presu~nably, these signals correspond to diploidy ofthe HKI gene in both the rat and RIN genomes. This conclusion is supported by data 0 that show RrN-derived cell lines to have m~int:~ined a diploid state in their chromosomes. Karyotype analysis of RIN 1046-38 showed a distribution 35 to 40 chromosomes with the normal rat compliment being 42 chromosomes.

The HKI replacement vector (FIG. 5) was transfected into R~N cells in three separate electroporations (EP): EP81, EP86, EP95. These electroporations differ 5 from each other in their temporal distributions, the identity of the parental cell line, and the number of clones screened from each (Table 3). EP81 was derived from a low passage RIN 1046-38 cell line. Of the 500 colonies screened, none were positive for disruption of an HKI allele. RIN-52/17, a RIN 1046-38 derived clone, was the parental line in EP86. One positive clone was detected a screen of about 970 20 colonies. RIN-52/9, a cell line that expresses high levels of rat glucokinase and is resistant to hygromycin, was used as a parental line in EP95. About 3200 clones were screened by PCRTM for the presence of a disrupted HKI allele. None were positive.

Potentially, the loss of an HKI allele could result in a growth disadvantage andthereby lead to a lower frequency of detecting HKI gene replacement events. To 2~ negate a potential metabolic disadvantage conferred by loss of HKI activity, efforts were made to create parental cell lines that overexpress rat glucokinase. Such parental lines could potentially serve two functions: first, to prevent metabo}ic stress should phosphorylation of glucose became rate-limiting in transformed cell lines with ~limini.ehed HKI activity; and second, to restore a high Km glucose-phosphorylating activity to the RIN lines to shift glucose-responsive insulin secretion towards a more physiological range. RIN-52/17, the parental cell line in EP86, had previously been ele~ poldled with a plasmid conferring hygromycin reeiet~nçe and cont~ining a copy of the rat glucokinase (GK) cDNA. RIN-52/17 was hygromycin resistant and was thought to express moderate levels of glucokinase from the transgene. Subsequentdata confirmed reSi~t~nce to hygromycin, but disproved e~ ion of GK from the transgene (Tab}e 3). About 1000 individual clones were screened from EP86. From 0 this screen one clone, 86/X4, was positive by PCRTM. Clone 86/~4 was initially identified by amplification with primer 1 and primer 3. The molecular weight of the amplified product was equal to that derived from the plasmid control. Confirrn~tion of this clone as cont~ining a disrupted HKI allele was obtained by amplification with primer 1 and primer 4. No plasmid control exists for this PCRTM reaction; therefore, the product is not the result of cont~min~tion.

Electroporation (EP) of RIN Cell Lines with a ~1 Replacement Vector EP Parental line DrugR,Parental Transgene Clones screened +by PCRTM
81 RIN 1047-38 (-) (-) 500 0 86 RIN 52-17 HygroR (-) 970 95 RIN 52-9 HygroR rat GK 3200 0 Targeted disruption of HKI was attempted in various RIN lines, in the absence of presence of high levels of expression of rat glucokinase (GK) from a transgene.
20 Cells expressing the transgene were first selected for resistance to hygromycin (HygroR) and then assayed by Western blotting for ~ es~ion of exogenous rat GK.

The original positive culture of 86/X4 was passaged several times prior to dilutional plating for ~eceseing the purity of the clonal population. 197 individual W 097/26357 PCTrUS97tO0787 colonies were cultured in 96-well plates, allowed to grow to 50-70% confluence, tryp~ini7~1, and split into duplicate cultures. Cells from one set of cultures were lysed and screened by PCRTM using primers 1 and 3 and then reaction products were analyzed by a slot assay. Two clones were confirmed as COI~t~ g a disrupted allele s of HKI. This result suggests two things. First, the original culture that was identified as 86/X4 was a polyclonal rather than a monoclonal population. Second, the clonecont~inin~ the disrupted allele of HKI seems to have a growth disadvantage compared to other cells in the population. This latter possibility is supported by observations of the growth rates of the purified HKI replacement clone. The pure 86/X4 grows o significantly slower (about one-half as fast) than clones randomly integrated with the repl~crm~nt vector.

Additional data verifying the identity of clone 86/X4 were derived by analysis of genomic DNA by Southern blotting (FIG. 6). DNA was digested with EcoRl and NotI, blotted, and hybridized with a probe upstream of the recombination site (hatched ~5 rectangle, FIG. 5). DNA from RIN 1046-38 cells (lane 1) and from RIN-52/17 randomly integrated with pAT23 (lane 2) produce a predicted signal of about 5.5kb in the autoradiograph. This signal corresponds to a homozygous, wild-type HKI gene.Clone 86/X4 produces two autoradiographic signals in the genomic Southern (lane 3):
a ~.5 kb signal corresponding to a wild-type allele and an additional signal (about 4.6 kb), indicative of a HKI allele that has homologously recombined with the replacement vector.

EXAMPLE VIII
Genomic Site-Directed Mut~Eenesis with Ol~onucleotides The inventors have previously demonstrated that derivative cell lines of the 2s RIN 1046-38 cell line are capable of performing homologous recombination bydisrupting an allele of the hexokinase I gene. Feasibility studies are currentlyunderway to determine if RDOs or DNA oligonucleotides can be used for the purpose of targeted gene disruption in RIN and other cell lines. Two test systems have been designed for testing oligonucleotides: the disruption of the neomycin phosphotransferase transgene, and the disruption of the glucose kansporter, type 2 (GLUT-2). As a prelimin:~ry experiment to testing RDOs or DNA oligonucleotides, protocols for efficient delivery of DNA into RIN cell lines by electroporation have S been optimi7~

A. Optim;7~tion of transfection of RIN cell lines.

A number of transfection protocols were tested on RIN 1046-38 cell lines including a variety of electroporation conditions and multiple kinds of liposome-mediated transfection. All protocols, except one set of electroporation conditions, 0 failed to produce transfection efficiencies of greater than 5%. Protocols were optimized for delivery of exogenous DNA to RIN cells by electroporation using two types of DNA: a plasmid vector encoding beta-galactosidase (,B-gal) that is transcribed from the CMV promoter, and a DNA oligonucleotide (62mer) that had been radiolabeled with 32P-dCTP. One set of electroporation conditions resulted in 25 IS - 40% transfection of the total cell population as det-o~rnined by colorometric, cytochemical assays for ~-gal activity (Bassel-Duby et al., 1992). Cells were grown to about 80% confluence in Medium 199/ 5% fetal calf serum/ 11 mM glucose (Growth Medium) and were re-fed with fresh Growth Medium one day prior to electroporation. Cells were harvested by trypsinization, counted, pelleted by centrifugation at 1000 rpm for 5 minuets, and resuspended in Growth Medium at a density of 2 x 107 cells/ml. 0.5 ml of cell suspension was mixed with 60 1ll of the following DNAs: either 10 ~g of ~-gal plasmid or 40 nM of oligonucleotide and 110 ~lg of sonicated salmon sperm DNA. The cells plus DNA were mixed gently, transferred to a 0.4 mM cuvette, and electroporated at 600 ~lF, 250 volts using and 2~ Electro Cell Manipulator 600, BTX Electroporation System. The electroporated cells were removed from the cuvette and diluted into 25 - 30 mls of 37~C Growth Mediumcont~ininp S mM butyrate. Following incubation for 12-16 hours at 37~C, 5% CO2 in the growth medium with butyrate, cells were washed once with growth medium, and .. . . .

W 097/26357 rCTrUS97/00787 m~int~ined in growth medium. In the case of cells transfected with ~-gal, cells were m~int~ined 48-72 hours following transfection and fixed with 0.5% glutaraldehyde for 10-15 minllte~ for cytochemical detection of ,B-gal using the 5-bromo-4-chloro-3-indoyl-~-D-galactopyranoside (x-gal) as a substrate (Bassel-Duby et al., 1992).

s To determine if conditions optimized for plasmid DNA would translate to efficient uptake of oligonucleotides, the above electroporation protocol was applied to a 62mer DNA oligonucleotide that had been radiolabeled with 32p using the Redi-prime Random Primer labeling Kit (Amersham Life Sciences). Oligonucleotide (40 nM) was electroporated into cells. Cells were analyzed post-transfection at 0, 3, 6, 0 and 24 hours in two ways. First, total radioactivity in the media, cytoplasmic cellular fractions, and nuclear cellular fractions was detf rmined by scintillation counting,.
And second nucleic acids were harvested from cellular fractions by phenollchloroform/isoamyl extraction and fractionated through clen~tllring polyacrylamide (PAG) gels (Ebbingh~ et al., 1996).

There was a marked enhancement in nuclear radioactivity in the presence of electroporation as compared to control cells that were mixed with oligonucleotide but not electroporated. In the presence of electroporation, about 29, 55, and 66% of total intracellular counts segregated to the nuclear fraction at 0, 3, 6, and 24 hours, respectively. In contrast, only 1 - 24% of total intracellular radioactivity was detected in the nuclear fraction through the 24 hour time point. It was also observed that intact, ap~a~e~lly full-length oligonucleotide could be extracted from cells which had been eletroporated, as evidenced by fractionation on d~n~-ring PAG gels and autoradiography. Extracts from cells that had been mixed with the oligonucleotide but not electroporated did not yield detectable oligonucleotide by this method of analysis suggesting that radioactivity that was detected in the non-electroporated cellular fractions was derived from the exchange of radiolabel, not from the oligonucleotide.

_ .

From these studies it has been concluded that the electroporation protocol described above is a preferred method for kansfecting both plasmid DNA and oligonucleotides into RIN cells.

B. Disruption of the neomycin phosphotransferase (NPT) transgene 5 by RDOs.

Multiple RIN cell lines are available that have been engineered to contain an integrated copy of the NPT gene. An RDO for disruption of transgenic NPT has been designed that is complementary to nucleotides to 54 to 78 of NPT counting the "A" of the first methionine as 1. Further, the RDO contains a single base change relative to o the wild-type NPT (A to C at position 66). If gene conversion by the RDO is successful, a T will converted to a G, Tyr22 will be converted to a stop codon, resistance to G418 will be lost, and a unique Mae I restriction site will be intoduced.
The RDO also contains features previously described such as self-annealing hairpin loops at each end, and 2'-O-methylation of the ribose sugars. The sequence of the s RDO with these features is (5' to 3' and referred hereafter as AT142):
GCTATTCGGCTAGGACTGGGCACAATTTTuugugcccagTCCTAgcc~ cGC
GCGTTTTCGCGC (SEQ ID NO:44), where large caps represent DNA residues and small, bold letters indicate RNA residues.

RIN cell lines with a single integrated copy of NPT will be electroporated, as 20 described in materials and methods, with varying concentrations of RDO AT142. 4 to 6 hours following transfection genomic DNA from pools of transfectants will be analyzed for detection of a T to G conversion at position 66 of the NPT transgene.
Following isolation of genomic DNA, the first about 200 base pairs of the NPT
transgene will be amplified by the polymerase chain reaction (PCR) using 25 oligonucleotides that flank position 66. Following amplification, PCR products will be digested with Mae I to determine if any gene conversions have occured. If the case of successful gene inactivation by the RDO, the PCR product will be digested into two bands. The wild-type NPT transgene PCR product will be resistant to Mae I

digestion. If NPT gene disruption is detectable by PCR/Mae I digestion, small pools of clones will be analyzed for loss of resistance to G418. Following electroporation, cells will be plated into 96 well plates at densities of 3 to 5 cells/well. 3 days following electroporation, cells will be exposed to G418, and each well will be scored for the presence of cell death.

C. Disruption of trangenic GLUT-2 in RIN and 293 cell lines.

RIN cell lines and 293 cell lines have been engineered to express high levels of a transgenic GLUT-2 transporter as detailed herein above. The presence of this transporter confers sensitivity to the cytotoxin streptozotocin (STZ), and thereby lo provides a means of negative selection (Schnedl et al., 1994). Both RIN and 293 cell - lines that express high levels of a GLUT-2 transporter will be transfected with RDOs designed to target and disrupt transgenic GLUT-2, and 4 - 6 hours later cells will be exposed to cytotoxic levels of STZ. Surviving clones will be analyzed for the presence of an inactivated GLUT-2 transgene by analysis of genomic DNA. In the case of the targeted inactivation of transgenic GLUT-2, leucine at position 10 will converted to a stop codon as a result of a T to A conversion, and a unique Avr II
restriction site will be created in the transgenic GLUT-2. This unique site can be detected by the amplification of genomic DNA that flanks the site by PCR, followed by digestion of the amplified DNA with Avr II. One such RDO that potentially 20 accomplishes the targeted disruption as described above is the following sequence:
TCACCGGAACCTAGGCTTTCACTGrrTTTacagugaaagCCTAGguuc~E;ul.gaG
CGCGTTTTCGCGC (SEQ ID NO:45), where large capitals represent DNA residues and small bold letters represent RNA residues.

Attempts to disrupt trangenic GLUT-2 will also be made with non-chirneric 2s DNA oligonucleotides that contain phosphorothioate modified backbones to enhance stability. It has been reported that inclusion of phosphorothioate derivatives within the DNA backbone decreases sensitivity to nucleases (Vosberg and Eckstein, 1982;Monia et al., 1996). Oligonucleotides have been designed that should selectively W O 97/26357 PCTrUS97/00787 target the transgenic GLUT-2 by spanning an area of homology that is interrupted in the endogenous GLUT-2 gene by an intron. If targeting and modification of the GLUT-2 transgene are sllcces~ l, glutamine at position 35 will be converted to a stop codon, and a new AflII site will be introduced into the DNA at this position. Four DNA oligonucletides will be çx~mined for the ability to target and disrupt the transgenic GLUT-2:

oligo name: AT157 (5'to3') &sGTTCCTTCCAGTTCGGATATGACATCGGTGTGATCAATGCACCTTAAGA
GGTAATAATATCCCATTATCGACATGTTTTGGGTGTTCCTsC(SEQID
NO:46), oligo narne: AT158(5' to 3') GsAGGAACACCCAAAACATGTCGATAATGGGATATTATTACCTCTTAAGGT
GCATTGATCACACCGATGTCATATCCGAACTGGAAGGAACsC(SEQID
NO:47), oligo name: AT159(5' to 3') GsGATATGACATCGGTGTGATCAATGCACCTTAAGAGGTAATAATATCCCA
TTATCGACATsG(SEQIDNO:48), and oligo narne: AT160 CsATGTCGATAATGGGATATTATTACCTCTTAAGGTGCATTGATCACACCG
ATGTCATATCsC(SEQIDNO:49).

Each of above the 4 oligonucleotides have phosphorothioate modifcations in the baclcbone near the 3' and 5' ends as indicated by "s" in the sequence. Oligonucletides will be introduced into cells both as single-stranded molecules and as double-stranded complexes. The following oligonucletide pairs contain complementa~T sequences and ~11 form duplexes: AT157-AT158, AT157-AT160, AT158-AT159, and AT159-ATl 60. Cell lines that express high levels of transgenic GLUT-2 ~,vill be electroporated with oligonucleotides as described above, and exposed to levels of STZ
that are lethal to cells expressing non-disrupted transgenic GLUT-2. Genomic DNA

W O97/26357 PCTrUS97/00787 of surviving cells will be analyzed for the precense of disrupted transgenic GLUT-2 by arnplification of DNA cont~ining the putative mutation by PCR, followed by digestion with Afl II.

* * 7t All of the compositions and methods disclosed and claimed herein can be made and executed without undue e~e.;lllentation in light of the present disclosure.
While the compositions and methods of this invention have been described in terrns of preferred embofliment~, it will be app~[~lll to those of skill in the art that variations may be applied to the composition, methods and in the steps or in the sequence of steps of the method described herein without departing from the concept, spirit and scope of the invention. More specifically, it will be a~palellt that certain agents that are both chemically and physiologically related may be substituted for the agents described herein while the sarne or similar results would be achieved. All such similar substitutes and modifications al)l)al~lll to those skilled in the art are deemed to be within the spirit, scope and concept of the invention as defined by the appended claims.

REFERENCES

The following references, to the extent that they provide exemplary procedural or other details supplementary to those set forth herein, are specifically incorporated herein by reference.

Adarns etal., "Porin interaction with hexokinase and glycerol kinase: Metabolic microcon~p~llllentation at the outer mitochondrial membrane," Bioch Med.
Met. Biol., 45:271-291, 1991.

~<1çlm~n et al. DNA 2:183, 1983.

. .

W O 97/26357 PCT~US97/00787 Altman et al., Diabetes, 35:625-633, 1986.

Anderson et al., "Cloning, structure, and expression of the mitochondrial cytochrome P-450 sterol 26-hydroxylase, a bile acid biosynthetic enzyme," J. Biol. Chem., 264:8222-8229, 1989.

Arora, et al., J. Biol. Chem. 268:18259-18266, 1993.

Asafari, M., Janjic, D., Meda, P., Guodong, L., Halban, P.A. and Wollheim, C.B.
"Establi~hment of 2-mercaptoethanol-dependent di~le..~ ed insulin-secreting cell lines," Endocrinology 130:167-178, 1992.

Baichwal and Sugden, "Vectors for gene transfer derived from animal DNA viruses:o Transient and stable expression of kansferred genes," In: Kucherlapati R, ed.
Gene transfer. New York: Plenum Press, pp. 117-148, 1986.

Baijal, J. E. et al., Arch. Bioch. Biophys., 298:271-278, 1992.

Bailey and Davidson, "Methylmercury as a reversible denaturing agent for agarose gel electrophoresis," Anal. Biochem., 70:75-85, 1976.

Becker et ai., "Differential effects of overexpressed glucokinase and hexokinase I in isolated islets: Evidence for functional segregation of the high and low Km en7ymes," J. Biol. Chem., 271:390-394, 1996.

Becker et al., "Ov~lc~lcssion of hexokinase I in isolated islets of Langerhans via recombinant adenovirus," J. Biol. Chem., 269:21234-21238, 1994a.

Becker et al., "Use of recombinant adenovirus for metabolic engineering of m~mm~ n cells," Methods in Cell Biology, 43:161-189, Roth, M., Ed. New York, Academic Press, 1994b.

Bell, e~ al., "Chara ;l~ ion of the 56-kDa subunit of yeast trehalose-6-phosphate synthase and cloning of its gene reveal its identity with the product of CIF 1, a regulator of carbon catabolite inactivation," ~ur. J. Biochem., 209:951-959, 1992.

Benvenisty and Neshif, "Direction introduction of genes into rats and expression of the genes," Proc. Nat'l Acad. Sci. USA, 83:9551-9555, 1986.

Berzal-Herranz, A. et al., Genes and Devel., 6: 129-134, 1992.

Blasquez et al., Trehalose-6-phosphate, a new regulator of yeast glycolysis that inhibits he~cokin~es," FEBSLett. 329:51-54, 1993.

Brewer, "Cytomegalovirus plasmid vectors for permanent lines of polarized epithelial cells," In: Methods in Cell Biology, 43:233-245, Roth, M., Ed. New York, 0 Academic Press, 1994.

Burch, et al., "Adaptation of glycolytic enzymes. Glucose use and insulin release during fasting and refeeding." Diabetes 30:923-928, 1981.

Cech et al., "In vitro splicing of the ribosomal RNA precursor of Tetrahymena:
involvement of a guanosine nucleotide in the excision of the intervening sequence," Cell, 27:487-496, 1981.

Chang et al., "Foreign gene delivery and expression in hepatocytes using a hepatitis B
virus vector," Hepatology, 14:134A, 1991.

Chen and Okayama, "High-efficiency transfection of m~mm~ n cells by plasmid DNA," Mol. Cell Biol., 7:2745-2752, 1987.
~0 Cho~,vrira, B.H. et al., "In vitro and in vivo comparison of hammerhead, hairpin, and hepatitis delta virus self-processing ribozyme cassettes." J. Biol. Chem., 269:25856-25864, 1994.

Chowrira, B.H. et al., Biochemistry, 32:1088-1095, 1993.

W O 97/26357 PCT~US97/00787 Clark et al., "Islet cell culture in defined serum-free medium," Endocrinology, 126:1895-1903, l990a.

Clark etal., "Modulation of glucose-in(l~lce~l insulin secretion from a rat clonal beta-cell line," Endocrinology, 127:2779-2788, l990b.

Coffin, "Retroviridae and their replication," In: Virology, Fields et al. (eds.), New York: Raven Press, pp. 1437-lS00, 1990.

Cone, et al., Proc. Natl. Acad. Sci. U.S.A., 81 :6349-6353, 1984.

Couch et al., "Immunization with types 4 and 7 adenovirus by selective infection of the intestinal tract," Am. Rev. Resp. Dis., 88:394-403, 1963.

o Coupar et al., "A general method for the construction of recombinant vaccinia virus expressing multiple foreign genes," Ge~qe, 68:1-10, 1988.

Crea et al., Proc. Natl. Acad. Sci. U.S.A 75:5765, 1978 Danos, et al., Proc. Natl. Acad. Sci. U.S.A., 85:6460-6464, 1988.

Dubensky et al., "Direct transfection of viral and plasmid DNA into the liver or spleen of mice," Proc. Nat'l Acad. Sci. USA, 81 :7529-7533, 1984.

Efrat et al., "Conditional transformation of a pancreatic beta cell line derived from sgenic mice expressing a tetracycline-regulated oncogene," Proc. Natl.
Acad. Sci., USA, 92:3576-3580, l99S.

Efrat, etal., "Murine insulinoma cell line with normal glucose-regulated insulin secretion," Diabetes, 42:901-907, 1993.

Efrat, etal., "Ribozyme-mediated attenuation of pancreatic Beta-cell glucokinaseexpression in transgenic mice results in impaired glucose-induced insulin secretion," Proc. Natl. Acad. Sci. USA, 91:2051-2055, 1994.

Efrat, S., Linde, S., Kofod, H., Spector, D., Delannoy, M., Grant, S., ~n~h~n, D. and B~kk~ckov, S., "Beta-cell lines derived from transgenic mice expressing a hybrid insulin gene- oncogene," Proc. Natl. Acad. Sci. US~ 85:9037-9041, 1988.

s Ei~henl~llb, R., J. Bacteriol. 138:559-566, 1979.

Eipper, B.A., Stoffers, D.A. and Mains, R.E. "The biosynthesis of n~w.~ Lides:
Peptide alpha-amidation," Annu. Rev. Neuroscience 15:57-85, 1992.

Epstein, et aZ., "Expression of yeast hexokinase in pancreatic beta-cells of transgerlic mice reduces blood glucose, enhances insulin secretion, and decreases Io diabetes," Proc. Natl. Acad. Sci. USA, 89:12038-12042, 1992.

Fanciulli et al., Glycolysis and growth rate in normal and in hexokinase-transfected NIH-3T3 cells," Oncology ~es., 6(9): 405-409, 1994.

Fechheimer et al., "Transfection of m~mm~ n cells with plasmid DNA by scrapeloading and sonication loading," Proc. Nat'l Acad. Sci. USA, 84:8463-8467, 1987.

FelgnerandWilson,Arch. Bioch. Biophys., 182:282-294, 1977.

Ferber et al., "GLUT-2 gene transfer into insulinoma cells confers both low and high affmity glucose-stimulated insulin release," J. Biol. Chem., 269:11523-11529, 1994.

Ferkol et al., FASEB J., 7:1081-1091, 1993.

Fiek et a~., "Evidence for identity between hexokinase-binding protein and the mitochondrial porin in the outer membrane o3~ rat liver mitochondria,"
Biochim. Biophys. Acta, 688:429-440, 1982.

W O 97/26357 PCT~US97/00787 Forster and Symons, "Self-cleavage of plus and minus RNAs of a virusoid and a structural model for the active sites," Cell, 49:211-220, 1987.

Fraley et al., "Entrapment of a bacterial plasmid in phospholipid vesicles: Potential for gene transfer," Proc. NatqAcad Sci USA, 76:3348-3352, 1979.

Fricker, L.D., "Carboxypeptidase E," Ann. Rev. Physiology 50:309-321, 1988.

Frie~ nn, "Progress toward human gene therapy," Science, 244:1275-1281, 1989.

Fritschy et al., Diabetes, 40:37, 1991.

Frougel et al., "Familial hyperglycemia due to mutations in glucokinase," N. Engl. J.
Med., 328: 105-112, 1993.

o Gazdar et al., "Continuous, clonal, insulin- and somatostatin-secreting cell lines established from a transplantable rat islet cell tumor," Proc. Na~l. Acad Sci.
USA, 77:3519-3523, 1980.

Gelb, B. D., Adams, V., Jones, S. N., Griffin, L. D., MacGregor, G. R. and McCabe, E. R., "Targeting of hexokinase l to liver and hepatoma mitochondria, " Proc.
Natl. Acad. Sci. USA, 89:202-206, 1992.

Gerlach et al., "Construction of a plant disease resistance gene from the satellite RNA
oftobacco Ringspotvirus," Nature (London), 328:802-805, 1987.

Ghosh-Chou&ury et al., "Protein IX, a minor component of the human adenovirus capsid, is es.~nti~l for the packagmg of full-length genomes," EMBO J., 2{) 6:1733-1739, 1987.

Ghosh and Bachhawat, "Targeting of liposomes to hepatocytes," In: Wu G. and C.
Wu ed. Liver ~ e~es, targeted diagnosis and therapy using specific receptors and ligands. New York: Marcel Dekker, pp. 87-104, 1991.

. . .

CA 02248638 1998-o9-o9 W 097/26357 PCT~US97100787 Gomez-Foix et al., "Adenovirus-mediated transfer of the muscle glycogen phosphorylase gene into hepatocytes confers altered regulation of glycogen metabolism," J. Biol. Chem., 267:25129-25134, 1992.

Gonzalez etal., "Molecular cloning of CIFl, a yeast gene necess~ry for growth ons glucose," Yeast, 8:183-192, 1992.

Gopal, "Gene transfer method for transient gene expression, stable transfection, and cotransfection of suspension cell cultures," Mol. Cell Biol., 5:1188-1190, 1985.

Gossen, M. and Bujard, H., "Tight control of gene e~ ion in m~mm~ n cells by o tetracycline-responsive promoters," Proc. Natl. Acad. Sci. USA 89:5547-5551, 1992.

Graham and Prevec, "Manipulation of adenovirus vectors," In: Gene Transfer and Expression Protocols, Murray, E.J., ed., Humana, New Jersey, vol. 7, 109-128, 1991.

Graham and van der Eb, "A new technique for the assay of infectivity of human adenovirus S DNA", Virology, 52:456-467, 1973.

Graham et al., "Characteristics of a human cell line transformed by DNA from human adenovirus type 5", J. Gen. Virol., 36:59-72, 1977.

Gross, D.J., Halban, P.A., Kahn, C.R., Weir, G.C. and Villa-Komaroff, L., "Partial diversion of a mutant proinsulin (B10 aspartic acid) from the regulated to the con~Liluli~e secretory paLllway in tr~n~fecte~l AtT-20 cells," Proc. Natl. Acad.Sci. USA 86:4107-4111, 1989.

Grunhaus and Horwitz, "Adenovirus as cloning vector," Seminar in Virology, 3 :237-252, 1992.

W 097/26357 PCT~US97/00787 Hakes et al., "Isolation of two complementary deoxyribonucleic acid clones from a rat insulinoma cell line based on similarities to Kex2 and furin sequences and the specific localization of each transcript to endocrine and neuroendocrine tissuesin rat," ~ndocrinology, 129:3053-3063, 1991.

Halban et al., "Abnormal glucose metabolism accompanies failure of glucose to stimulate insulin release from a pancreatic cell line (RINmSf)," Biochem. J., 212:439-443, 1983.

Harland and Weintraub, "Translation of m~rnm~lian mE~NA injected into Xenopus oocytes is specifically inhibited by antisense RNA," J. Cell Biol., 101:1094-o 1099, 1985.

Haseloff, T. and Gerlach, W.L. "Simple RNA enzymes with new and highly specific endoribonuclease activities." Nature, 334:585-591, 1988.

Hermonat and Muzyczka, "Use of adeno-associated virus as a m~mm~ n DNA
cloning vector; tr~n~ ction of neomycin resistance into m~mm~ n tissue culture cells," Proc. Nat'l. Acad Sci. USA, 81 :6466-6470, 1984.

Hersdorffer et al., "Efficient gene transfer in live mice using a unique retroviral p~ck~ging line," DNA Cell Biol., 9:713-723, 1990.

Herz and Gerard, "Adenovirus-mediated transfer of low density lipoprotein receptor gene acutely accelerates cholesterol clearance in normal mice," Proc. Nat'l Acad. Sci. USA 90:2812-2816, 1993.

Horwich et al. "Synthesis of hepadenovirus particles that contain replication-defective duck hepatitis B virus genomes in cultured HuH7 cells," J. Virol., 64:642-650, 1990.

Hosokawa, et al., "Upregulated hexokinase activity in isolated islets from diabetic 90% pancreatectomized rats." Diabetes, 44:1328-1333, 1995.

W O 971263S7 PCT~US97/00787 Hughes et al., "Engineering of Glucose-stimulated Insulin Secretion and Biosynthesis in Non-islet Cells", Proc. Natl. Acad. Sci. US,4, 89:688-692, 1992.

Hughes etal., "Transfection of AtT-20jns Cells with GLUT-2 but Not GLUT-1 Confers Glucose-stimulated Insulin Secretion", J. Biol. Chem. 268:15205-15212, 1993.

Hughes, S.D., Quaade, C., Milburn, J.L., Cassidy, L.C., and Newgard, C.B., "Expression of normal and novel glucokinase rnRNA's in anterior pituitary and islet cells," J. BioL Chem. 266:4521-4530, 1991.

Tn~ ki, N., Gonoi, T., Clement, J.P., Namba, N., In~7~wa? J., Gonzalez, G., 0 Aguilar-Bryan, L., Seino, S. and Bryan, J., "Reconstitution of IKATP: Aninward rectifier subunit plus the sulfonylurea l~ce~or," Science 270: 1166-1170,1 995.

Ishibashi, S., Brown, M.S., Goldstein, J.L., Gerard, R.D., Hammer, R.E., and Herz, J., "Hypercholesterolemia in Low Density Lipoprotein Receptor Knockout Mice and its Reversal by Adenovirus-mediated Gene Delivery," J. Clin. ~nvest 92, 883-893, 1993.

Ishihara, H., Asano, T., Tsukuda, K., Katagiri, H., Inukai, K., Anai, M., ~ih-çlli, M.?
Yazaki, Y., Miyazaki, J. and Oka? Y., "Overexpression of hexokinase I but not GLUT1 glucose transporter alters concentration dep~.n-l~nre of glucose-stim~ te~l insulin secretion in pancreatic beta-cell line MIN6," J. Biol. Chem.
269:3081-3087, 1994.

Jones and Shenk, "Isolation of deletion and substitution mllt~nts of adenovirus type 5," Cell, 13:181-188, 1978.

Jonsson, J., Carlsson, L., Edlund, T., and Edlund, H., "Insulin-promoter-factor 1 is 2s required for pancreas development in mice," Nature 371 :606-609, 1994.

W 097/26357 PCTrUS97/00787 Joyce, "RNA evolution and the origins of life," Nature, 338:217-244, 1989.

Kabir and Wilson, "Mitochondrial Hexokinase in Brain: Coexistence of Forms Differing in Sensitivity to Solubilization by Glucose-6-Phosphate on the Same Mitochondria," ~lrch. Biochem. Biophys., 310(2):410~16, 1994.

Kaneda et al., "Increased expression of DNA cointroduced with nuclear protein in adult rat liver," Science, 243 :375-378, 1989.

Karlsson et al., EMBO J., 5:2377-2385, 1986.

Kato et al., "Expression of hepatitis b virus surface antigen in adult rat liver," J. Biol.
Chem., 266:3361-3364, 1991.

o K~llfm~n and Sharp, "Construction of a modular dihydrofolate reductase cDNA gene:
Analysis of signals utilized for efficient expression," Mol. Cell. Biology, 2:1304-1319, 1982.

Kim and Cech, "Three rlimen~ional model of the active site of the self-splicing rRNA
precursor or Tetrahymena," Proc. Natl.'Acad. Sci. USA, 84:8788-8792, 1987.

Klein et al., "High-velocity microprojectiles for delivering nucleic acids into living cells," Nature, 327:70-73, 1987.

Knaack et al., "Clonal Tn~l1linl~ma Cell Line That Stably ~71int~in~ Correct Glucose Responsiveness," Diabetes, 43:1413-1417, 1994.

Kruse, F., Rose, S. D., Swift, G. H., Harnmer, R. E., and MacDonald, R. J., "An endocrine-specific element is an integral component of an exocrine-specific pancreatic enhancer," Genes Dev. 7:774-786, 1993.

Kuwajima et al., "The glucose-phosphorylating capacity of liver as measured by three independent assays," J. Biol. Chem., 261:8849-8853, 1986.

CA 02248638 l998-09-09 Kyte and Doolittle, J. Mol. Biol., 157:105-132,1982.

Lacy et al., Science, 254:1782-1784,1991.

Lacy, et al., Ann. Rev. Med., 37:33-40,1986.

Le Gal La Salle et al., "An adenovirus vector for gene transfer into neurons and glia in the brain," Science, 259:988-990,1993.

Leonard, J., Peers, B., Johnson, T., Ferreri, K., Lee, S., and Montminy, M. R., "Characle~ ion of Som~tc-st~tin Transactivating Factor-1, a Novel Homeobox Factor That Stim~ t~s Somatostatin Expression in Pancreatic Islet Cells," Mol ~ndocrinol. 7:1275-1283,1993.

Levrero et al., "Defective and nondefective adenovirus vectors for expressing foreign genes in vitro and in vivo," Gene, 101:195-202,1991.

Liang et al., "Effects of alternate RNA splicing on glucokinase isoform activities in the pancreatic islet, liver, and anterior ~iluil~y," J. Biol. Chem., 266:6999-7007,1991.

Liang, et al. "Glucose regulates glucokinase activity in cultured islets from rat pancreas." J. Biol. Chem., 265:16863-16866,19gO.

Lieber and Strauss, "Selection of efficient cleavage sites in target RNAs by using a ribozyme expression-library." Mol. Cell. Biol., 15:540-551,1995.

Lin et al., "Pit-1-dependent ~iLui~ r cell proliferation involves activation of the growth hormone releasing factor receptor gene," Nature, 360:765-768,1992.

Linden et al., "Pore protein and the hexokinase-binding protein from the outer membrane of rat liver mitochondria are identical," FEBS Lett., 141:189-192, 1982.

Macejak, D. G. and Sarnow, P., "Internal initiation of translation mediated by the 5' leaderofacellularmRNA," Nature 353:90-94, 1991.

Madsen, et al., Proc. Natl. Acad. Sci. U.S.A., 85:6652-6656, 1988.

Mann et al., "Construction of a retrovirus p~CI~ging mutant and its use to produce helper-free defective retrovirus," Cell, 33:153-159, 1983.

Marie et al., "The pyruvate kinase gene is a model for studies of glucose-dependent regulation of gene expression in the endocrine pancreatic Beta-cell type," J:
Biol. Chem., 268:23881-23890, 1993.

Markowitz et al., "A safe packaging line for gene transfer: Separating viral genes on o two different plasmids," J. Yirol., 62:1120-1124, 1988.

Matchinsky, "Glucokinase as a sensor and metabolic signal generator in pancreatic Beta-cells and hepatocytes," Diabetes, 39:647-652, 1990.

Mathupala etal., "Glucose catabolism in cancer cells," J. Biol. Chem., 270:16918-16925, 1995.

Mayo, "Molecular cloning and expression of a pituitary-specific receptor for growth hormone-releasing horrnone," Mol. Endocrinol., 1734-1744, 1992.

Meglasson and ~ t~cllin.cky, "Pancreatic islet glucose metabolism and regulation of insulin secretion," Diabetes Metab. Rev., 2: 163-214, 1986.

Messing et al., Third Cleveland Symposiurn on Macromolecules and Recombinant DNA, Editor A. Walton, Elsevier, Amsterdam, 1981.

Michel and Westhof, "Modeling of the three-~limen~ional architecture of group I
catalytic introns based on colllp~dlive sequence analysis," J. Mol. Biol., 216:585-610, 1990.

W O 971263S7 PCTrUS97/00787 Miller, C. P., McGehee, Jr., R. E., and Habener, J. F., "IDX-l: a new homeodomain transcription factor expressed in rat pancreatic islets and duodenurn that transactivates the somatostatin gene," EMBO J. 13: 1145-1156, 1994.

Miyazaki, Araki, et al, "Establishment of a pancreatic beta cell line that retains glucose-inducible insulin secretion: special reference to expression of glucose transporter isoforms," Endocrinology, 127(1):126-32, 1990.

Moore, H.-P. H., Walker, M. D., Lee, F. and Kelly, R. B., "Expressing a human proinsulin cDNA in a mouse ACTH-secreting cell. Intr~cellnl~r storage, proteolytic processing, and secretion on stimulation," Cell 35:531-538, 1983.

0 Newgard and McGarry, "Metabolic coupling factors in pancreatic Beta-cell signal transduction," Ann. Rev. Biochem., 64:689-719, 1995.

Newgard et al., "Glucokinase and glucose transporter expression in liver and islets:
implications for control of glucose homeostasis," Biochem. Soc. Trans., 18:851-853, 1990.

Nicolas and Rubinstein, "Retroviral vectors," In: Vectors: A survey of molecularcloning vectors and their uses, Rodriguez and Denhardt (eds.), Stoneham:
Butterworth, pp. 494-513, 1988.

Nicolau and Sene, "Liposome-mediated DNA transfer in eukaryotic cells," Biochim. Biophys. Acta, 721:185-190, 1982.

20 Nicolau et al., Methods in Enzymology 149:157-176, 1987.

O'Shea and Sun, Diabetes, 35:943-946, 1986.

Ohlsson, H., Karlsson, K. and Edlund, T., "IPF1, a homeodomain-cont~ining transactivator ofthe insulin gene," EMBO J. 12:4251-4259, 1993.

7 PCT~US97/00787 Palukaitis, P. et al., "Characterization of a viroid associated with avocado sunblotch disease." Virology, 99: 145-151, 1979.

Paskind et al., "Dependence of moloney murine leukemia virus production on cell growth," Virology, 67:242-248, 1975.

Peers, B., Leonard, J., ~h~rrn~ S., Teitelman, G., and Montminy, M. R., "InsulinExpression in Pancreatic Islet Cells Relies on Cooperative Interactions between the Helix Loop Helix Factor E47 and the Homeobox Factor STF-l," Mol Endocrin. 8:1798-1806, 1994.

Pelletier and Sonenberg, "Tnt~rn~l initiation of translation of eukaryotic rnR~A0 directed by a sequence derived from poliovirus RNA," Nature, 334:320-325, 1988.

Perales et al., Proc. Natl. Acad. Sci. USA, 91 :4086-4090, 1994.

Perriman, R. et al., "Extended target-site specificity for a hammerhead ribozyme."
Gene, 113:157-163, 1992.

Perrotta and Been, Biochemistry 31: 16, 1992.

Piper, P. W. and Lockheart, A., "A temperature-sensitive mutant of Saccharomycescerevisiae defective in the specific phosphatase of trehalose biosynthesi~ " FMSMicrobiology Letter 49:245-250,1988.

Polakis and Wilson, "An intact N-t~rmin~l sequence is critical for binding rat brain hexokinase to mitochondria," Arch. Biochem. Biophys., 236:328-337, 1985.

Potter et al., "Fnh~ncer-dependent expression of human k irnmunoglobulin genes introduced into mouse pre-B lymphocytes by electroporation," Proc. Na~'l Acad. Sci. USA, 81 :7161-7165, 1984.

W 097/263S7 PCTAUSg7/00787 Printz, R. L., Koch, S., Potter, L. R., O'Doherty, R. M., Tiesinga, J. J., Moritz, S. and Granner, D. K., "Hexokinase II mRNA and gene structure, regulation by insulin, and evolution," J. Biol. Chem. 268:5209-5219, 1993.

Prody, G.A. etal., "Autolytic processing of dimeric plant virus satellite RNA."
Science, 231, 1577-1580, 1986.

Quaade et al., "Analysis of the protein products encoded by variant glucokinase transcripts via expression in b~ct~ria " FEBS ~ett, 280:47-52, 1991.

Racher et al., Biotechnology Techniques, 9:169-174, 1995.

Radvanyi et al., "Pancreatic beta bells cultured from individual preneoplastic foci in a l 0 multistage tumorigenesis pathway: a potentially general technique for isolating physiologically representative cell lines," Mol. Cell. Biol., 13(7): 4223-4232, 1993.

Ragot et al., "Efficient adenovirus-mediated transfer of a human minidystrophin gene to skeletal muscle of mdx mice," Nature, 361 :647-650, 1993.

Reinhold-Hurek and Shub, "Self-splicing introns in tRNA genes of widely divergent bacteria," Nature, 357:173-176, 1992.

Renan, "Cancer genes: current status, future prospects, and applicants in radiotherapy/oncology," Radiother. Oncol., 19:197-218, 1990.

Rich et al., "Development and analysis of recombinant adenoviruses for gene therapy of cystic fibrosis," Hum. Gene Ther., 4:461-476, 1993.

Ridgeway, "~lammali~n expression vectors," In: Rodriguez RL, Denhardt DT, ed.
Vectors: A survey of molecular cloning vectors and their uses. Stoneham:
Butterworth, pp. 467-492, 1988.

W O 97/26357 PCTrUS97/00787 Rippe et al., "DNA-mediated gene transfer into adult rat hepatocytes in primary culture," Mol. Cell. Biol., 10:689-695, 1990.

Rosenfeld, Siegfried, Yoshimura, Yoneyama, Fukayama, Stier, Paakko, Gilardi, Stratford-Perricaudet, Pernr~ et, Jallat, Pavirani, Lecocq, Crystal, s "Adenovirus-mediated transfer of a recombinant a 1 -antitrypsin gene to the lung epitheliurn in vivo," Science, 252:431-434, 1991.

Rosenfeld, yo.chimllra, Trapnell, Yoneyama, Rosenthal, Dalemans, Fukayarna, Bargon, Stier, Stratford-Perricaudet, Perricaudet, Guggino, Pavirani, Lecocq, Crystal, "~n vivo transfer of the human cystic fibrosis transmembrane conductance regulator 0 gene to the airway epithelium," Cell, 68:143-155, 1992.

Roux et al., "A versatile and potentially general approach to the targeting of specific cell types by retroviruses: Application to the infection of human cells by means of major histocompatibility complex class I and class II antigens by mouse ecotropic murine le-lk~mia virus-derived viruses," Proc. Natl. Acad.
I 5 Sci. USA, 86:9079-9083, 1989.

Santerre et al., "Insulin synthesis in a clonal cell line of simian virus 40-transformed hamster pancreatic beta-cells," Proc. Natl. Acad. Sci. USA, 78:4339-4343, 1981.

Sarver, et al, "Ribozymes as potential anti-HIV-1 therapeutic agents," Science, 247:1222-1225, 1990.

Sato et al., Proc. Natl. Acad. Sci U.S.A., 48:1184-1190, 1962.

Sauer, B., Meth. En~ymol. 225:890, 1993.

Scanlon et al., "Ribozyme-mediated cleavages of c-fos mRNA reduce gene expression of DNA synthesis enzymes and metallothionein," Proc Natl Acad Sci USA, 2s 88:10591-10595, 1991.

W O 97/26357 PCT~US97/00787 Schwab and Wilson, "Complete amino acid sequence of rat brain hexokinase, deduced from the cloned cDNA, and proposed structure- of a m~mm~ n hexokinase,"
Proc. Natl. Acad. Sci. USA, 86:2563-2567, 1989.

Schwab and Wilson, "Complete amino acid sequence of the Type III isozyme of rat hexokin~e7 cle~ ce~ from the cloned cDNA," Arch. Biochem. Biop~lys., 285:365-370, 1991.

~himi7:1l et al., "Control of glucose phosphorylation and glucose usage in clonal ins-llinorn~ lines," Diabetes, 37:563-568, 1988.

Sioud et al., "Preforrned ribozyme destroys tumour necrosis factor mRNA in hurnan 0 cells," .JMol. Biol., 223:831-835, 1992.

Smeekens and Steiner, "Identification of a human insulinoma cDNA encoding a novel m~mm~ n protein structurally related to the yeast dibasi processing protease Kex2," J: Biol. Chem., 265:2997-3000, 1990.

Smith and Wilson, Arch. Bioch. Biophys., 287:359-366, 1991.

Steiner, D. F., Smeeken~ S. P., Ohagi, S., and Chan, S. J., "The new enzymolo~ of precursor processing endoproteases," ~ Biol. Chem. 267:23435-23438, 1992.

Stossel, T., In: The Molecular Basis of Blood Diseases, Chapter 14, pp. 499-533, W.
B. Saunders Co. Philadelphia, PA, 1987.

Stratford-Perricaudet and Perricaudet, p. 51-61, In: Human Gene Transfer, Eds. O.
Cohen-Haguenauer and M. Boiron, Editions John Libbey Eurotext, France, 1991.

Stratford-Perricaudet et al., Hum. Gene. Ther. 1 :241-256, 1990.

Sullivan ef al., Science, 252:71~-721, 1991.

wO 97126357 PCT/US97/00787 Symons, R.H. "Small catalytic RNAs." Ann. Rev. Biochem., 61:641-671, 1992.

Symons, R.H., "Avocado sunblotch viroid: primary sequence and proposed secondarystructure." Nucl. Acids Res., 9:6527-6537, 1981.

Temin, "Retrovirus vectors for gene transfer: Efficient integration into and expression sof exogenous DNA in vertebrate cell genome," In: Gene Transfer, Kucherlapati (ed.), New York: Plenum Press, pp. 149-188, 1986.

Thelen and Wilson, "Complete arnino acid sequence of the Type II isozyme of rat hexokinase, deduced from the cloned cDNA:Comparison with a hexokinase from Novikoff ascites tumor," Arch. Biochem. Biophys., 286:645-651, 1991.

oThompson, J.D. etal., "Ribozymes in gene therapy." Nature Medicine, 1:277-278, 1995.

Thorens, B. M., "Expression cloning of the pancreatic betacell receptor for the gluco-incretion hormone glucagon-like peptide 1," Proc. Natl. Acad. Sci. USA
89:8641-8646,1992.

5Ting and Lee, "Human gene encoding the 78,000-Dalton glucose-regulated protein and its pseudo gene: Structure, conservation, and regulation," DNA, 7:275-286, 1988.

Top et al., "Tmmnni7~tion with live types 7 and 4 adenovirus vaccines. II. Antibody response and protective effect against acute respiratory disease due to 20adenovirus t,vpe 7," J. Infect. Dis., 124:155-160, 1971.

Tur-Kaspa et al., "Use of electroporation to introduce biologically active foreign genes into primary rat hepatocytes," Mol. Cell Biol., 6:716-718, 1986.

Usdin, T. B., Mezey, E., Button, D. C., Brownstein, M. J. and Bonner, T. I., "Gastric inhibitory peptide receptor, a member of the secretin-vasoactive intestinal W 097/263S7 PCT~US97/00787 peptide receptor farnily, is widely distributed in peripheral organs and the brain,"
Endocrinology 133:2861-2870, 1993.

Varmus et al., "Retroviruses as mutagens: Insertion and excision of a nontransforming provirus alter the ex~ssion of a resident transforming provirus," Cell, 25:23-36, 1981.

Voss-McGowan, M. E., Xu, B. and Epstein, P. N., "Insulin synthesis, secretory competence, and glucose utilization are sen.~iti7~d by transgenic yeast hexokinase,"J. Biol. Chem. 269:15814-15818, 1994.

Wagner et al., Science, 260:1510-1513, 1990.

o White and Wilson, Arch. Bioch. Biophys., 259:402-411, 1987.

White and Wilson, Arch. Bioch. Biophys., 277:26-34, 1990.

Whitesell etal., "Transport and Metabolism of Glucose in an Insulin-Secreting Cell Line"BTC-1," Biochemistry, 30(49):11560-11566, 1991.

Willnow, T.E., and Herz, J., "Homologous Recombination for Gene replacement in Mouse Cell Lines," Me~hods in Cell Biology 43 pt A:305-334, 1994.

Wilson, "Brain hexokinase: A proposed relation between soluble-particulate distribution and activity in vivo," J. Biol. Chem., 243:3640-3647, 1968.

Wilson, "Hexokin~es," In: Reviews of Physiology, Biochemis~ry and Pharmacology, Pette, D. (Ed.), 126:65-174, 1994.
~0 Wilson, "Ligand in~ ced confirrn~tions of rat brain hexokinase: Effects of glucose-6-phosphate and inorganic phosphate," Arch. Biochem. Biophys., 159:543-549, 1973.

Wilson, "Regulation of m~mm~ n hexokinase activity," ln: Regulation of Carbohydrate Metabolism, Beitner, R. (Ed.) Vol. 1, CRC, Boca Raton, 45-81, 1985.

Wong et al., "Appearance of b-lactamase activity in animal cells upon liposome mediated gene transfer," Gene, 10:87-94, 1980.

Wu and Wu, "Evidence for targeted gene delivery to HepG2 hepatoma cells in vitro,"
Biochemistry, 27:887-892, 1988.

Wu and Wu, "Receptor-mediated in vitro gene transfections by a soluble DNA carrier system," J. Biol. Chem., 262:4429-4432, 1987.

0 Wu and Wu, Adv. Drug Delivery Rev., 12:159-167, 1993.

Xie and Wilson, "Rat brain hexokinase: the hydrophobic N-terminus of the mitochondrially bound enzyme is inserted in the lipid bilayer," Arch. Biochem.
Biophys., 267:803-810, 1988.

Yang et al., "In vivo and in vitro gene transfer to m~mm~ n somatic cells by particle ~5 bombardment," Proc. Nat'l Acad. Sci. USA, 87:9568-9572, 1990.

Yuan and Altman, "Selection of guide sequences that direct efficient cleavage of mRNA by human ribonuclease P." Science, 263:1269-1273, 1994.

Yuan, Y. et al., "Targeted cleavage of mRNA by human RNase P." Proc. Natl. Acad. Sci. USA, 89:8006-8010, 1992.
~0 Zelenin et al., "High-velocity mechanical DNA transfer of the chlor~mrh~nicolacetyltransferase gene into rodent liver, kidney and m~mm~ry gland cells in organ explants and in vivo," FEBSLett., 280:94-96,1991.

U.S. PatentNo. 4,196,265 U.S. Patent No. 4,554,101 PCTrUS97/00787 U.S. Patent No. 4,888,286 U.S. Patent No. 4,892,538 U.S. PatentNo. 4,959,317 U.S. Patent No. 5,011,472 U.S. Patent No. 5,354,855 U.S. Patent No. S,399,346 U.S. Patent No. 5,427,940 o WO 90/15637 CA 02248638 l998-09-09 W O 97l26357 PCT~US97/00787 SEQUENCE LISTING

(1) GENERAL INFORMATION:
s (i) APPLICANT:
(A) NAME: Board of Regents, The University of Texas System (B) STREET: 201 West 7th Street (C) CITY: Austin (D) STATE: Texas (E) COUNTRY: USA
(F) POSTAL CODE (ZIP): 78701 l~ (A) NAME: Betagene, Inc.
(B) STREET: 2600 Ste~mons Frwy, Ste. 125 (C) CITY: Dallas (D) STATE: Texas (E) COUNTRY: USA
(F) POSTAL CODE (ZIP): 75207 (ii) TITLE OF INVENTION: METHODS AND COMPOSITIONS FOR INHIBITING
HEXOKINASE
(iii) NUMBER OF SEQUENCES: 49 (iv) COMPUTER READABLE FORM:
(A) MEDIUM TYPE: Floppy disk (B) COMPUTER: IBM PC compatible (C) OPERATING SYSTEM: PC-DOS/MS-DOS
(D) SOFTWARE: PatentIn Release #1.0, Version #1.30 (EPO) (vi) PRIOR APPLICATION DATA:
(A) APPLICATION NUMBER: US 08/588,983 (B) FILING DATE: 19-JAN-1996 .

CA 02248638 l998-09-09 o o o o o o o o o o o o o sD s~ ~ ~ ~ ~D N CS~ ~r O sS) s~ s'D
r~ r In sD s~ r--C ~ V E~
V
¢ C, ;) rt ~ , J
C J 0 ~ r rt ~, C ~ ~ 3 J
J : ~ ~ ~ s ' ~ ~ -S :~
C .) ~ C V
S~rr ~ C' I¢ ~
r~ C~ ~ ~ " J ~ ~ r Ct, ~ O ~ - r .. 7 '.~:
CV ~ ~ J ~ r~
S~lE- ~ rJ fl~f~ f~ fS -~ r~) fS ~
fI _~1 Cr~:~; r~ Uf ! C ~ ~ t. 3 ~- ~ ~ c Jr_f~ C) ~ f~
or. ~ ~ ~r~E~ ~_ fI~
f~ ~ ,~Ir~ r_ _l ~ J ~fS~) ~. ~fS ~1 S-i H ~ ~ :f~f~ C~)fS~~ fS ~) ~) fS
rl - ~l _ U CfS
C01IS -I f~. ~¢E-l ~_ JE~ ¢ C
~- n P, ~ ~ . . .
H J ~ r~)rnC_ fI ~ ~ c~ Cl~ J

--I a) ~ fIC_ C C ~ U - C~' t.) _ 1.i~ fS '~
.. -I U~ V '~ CfI ~ r ~E-l S r ~ ~ c O n ~ ~ rJ ~ rs ~ _ ~ J ¢ _ ~ t f~ ~ fl ~; -I R O s - ' - fS~ _ , ~If' ~ C_ 'r c~ ., ~ S fS ~ ~_ ~ f~ I ~ _ ~ ~ ~ ~, tn, ~ Cj f' _ C~ _ fS
H ~ ~ C rn ~ ' ~ _ C~ ~ C~fS~ J E-~ C, f' fS f~ Sl f ~ C.~~I f r O~ fS~ fS f~.fS C~ ~ fI _)C ) f¢ ~ fS
cn ~ li3 C) r S ~ C 1 ¢ Cl fI
~ U ~ ~- Z 1 1 C ~ fS ~ '7 ¢ ~1 C ~ r O U 1~ f~ O f~
~4 W ~ P ~ ~~i ~, J ~ S ~ ~ fS
U ~ E-l O U fl~I fS , _ J ~ f' ~ f' O Z ~ Z fS~) fS f~ f-S ~~ _)fC'S J ~- f¢~
H ~ fS C C ~ .) fI ~ , r~ ~ U
E-l 01 f~ m u ~ olfl~ J fS t.~ C f _' E-~ ~ U
f~ 1~3 ~ ~ _ _ ~
cn cn :~ U fS ~ O E- ~ '3 E-~ ;) ~ fS ~ ;~ f O ~ _ J ) H X I _ f l r ~ ~

-~ r U ~ - _ J ~ E-sE-~ ~ C~ C' oooooooooooo~
O~D NCO ~ O~D ~Ct~ ~ O
o o,I N~ r~) ~ ~In U~

3 r .~ ~ ~ r ~ ~ ~ ~ ~~ ~ U ~ ~ -c f_~f~ J ~ ~ r~
r_ _ ~ ~I r ~ J

r~ U
C ~ J ' ~J

r~
E~ U
E~ U
ft ~
f' .~ C,~ J tft _? t E~
~: ~ tft _~ t ~ fl J ~ E- t ~r Cr?tt ~ ~ ~ C ~ ~ ~ t t ft ? r ~ft'r~ ft ~ J fI f~
f' ?~rl Cl Er.~ -I f~EC~ uu ~a ft' Et 2 ~ t ~ J t f' f C U ~- ~?
:~ E-ft~fI~C, 5~ t ~ ~ ~? ~ _? E- ~ J
~~ UCl ~ -5 t ~ _ -? _? f l _~ o -~ EtCl ~ _ J t t r 5 7 t ~ a rl _f ~ E- -~ 3 -'? t '? C o 3 _Etr~ t ,5rI C? J ~ t Jftl fI ft Cl ~ 2 o~ f ~ '~ ~ ~-tft ~~? E- ~ C~ C'? ~ ~_ f ~ ~ ftU~ ? ?-~ CO
~?f' J C ~ ~ f~~3 ~? tr ~ ~ t O c~? ~ ~ O
f.~ ft I ' f"I? t ~ f' r _ ~ ?~ f~ ~t 3 c ~ ~ ft ~ t ~ J f_ J ~t Z ~3 ?~ U~ EOt ~1ft ~ Et ~_ t~_~ U ~~ f'_~ t Et a f l~ m ~? ~
r t t t '? E- ~~3 ~~ f. - t f~ ~U t f j~
J t t - f' r~Et - ,~ -J t ' ~ rtU5 ~ I J~
f~ft ~ r~
- r~ _ tt ,~ ~5 r~ C t Etft ~ E~ t ~;J ~ t t J r _ . _ . . . . _ .

CA 02248638 l998-09-09 W O 97/26357 PCTrUS97/00787 o o~ ~o ~ o C
V ~ ~ V ~ CD V ~ E~ ~ s h O ~ U~ In Cl~ H V ~r ~ ~ ~ H C~ ~ V E~ ~ 1 S~ H h 5-1 ~ I~ 1 U2 15 0 ~ r H
o ~ ~ ~ O ~ o o ~ o ~ ~ r a ~ ~ ~ H E-~
H ~ O ~ a) H
~I V H

O ~ O ~ ~ O
1 ~ ~ ~ ~ H r ~ ~ ~ ~ ~
a~ V V ~ a) ~ V
o ~1 ~
~ ~ ~ ~ V V ~ V ~ ~ I V
z s ~ s ~
~ H E~ V
~~ ~ ~ h n~ O
~ ~ o ~ a) ~ S ~ r~ O

-rl ~ Cq ~ S ~ S S ~r W O 97n6357 PCTrUS97/00787 ~ ~ o ~ ~ o V ~ ~ ~ ~ ~ ~ H
H ~'J ~ H ~ ~ ~ r ) 1 ~ O ~ ~ o o ~, o u~ 1 0 J~
O U~ O ~ p~
o ~ ~ ~( o o a~ ~ o u~
h ~ u~ ~ h r~ h a) ,~
p~ H ~ .'¢ N ~ H
h ~ h ~ _I O ~ o ~ O
~ ~ X ~ h W m ~ h i~ ~ m h ~ :~ O
ri Q ~ .C Ul W ~1 ~D S ~ h 0 ~r X ~ ~ 0 N E-~ H
t:n o u~ o h ~ ,1 ~ a) o ~ ~ '~ ~ ) N

P~ O :~ ~ o t~ 1 0 o _I h h h ~ h ~ h S a~
,I h ~ ~ N h V ~ N
,~ O a) ~ o ~ O ~
t~ Ln P, h h ,1 ~ h C) m H N > S

h ul O ~ :~ ~ ~ ~ ~
::' E~ C~ N U7 V f~ l N .¢ > ~ ~1 ~ W m ~ h Cq ~ N ~ ( O
~¢ H U~ ,~ N ~ H ~

, CA 02248638 l998-09-09 W 097126357 PCTrUS97/00787 o ~ o ~ ~ ~5 o ,~ o ~ s~ a) ~ a ~ o H H ~¢ q" E~ ~>
(~ o ~ O

0 ~ ~ O ~~
V H ~
O
~ Z
u~ C~ ~ f~ ~ ~ ~ ~ cn ~ C
a~ ~ o ~ ~ h H C
~ ~q ~ a~ h w f~ ~ ~ .¢ ~ f~ ~- h a ol c 1 ul b) ~ h S-l r l 15 ) ~1) h ~ ~ Cl aJ t~ ~I r1 C~ al ~ ~ s ~ ~ F~Cl U~ ~ t~ U~ ~ ~r ~ ~
h ~ Q a o ~ a~ ~ ~ r c ~ ~ ~ t V ~ ~ c~ V ~ c) ~ ~ ~ Q l R ~
h h ~ r- ~ ~
U~C~ - W V 1 ~) ~D h U~ ~d O P~ U~ h h ~ Q O ~
~ u, V ~ ~ ~ cn o v ~ f~ o O r l a) ~ h Ul ~.1 h h Z t t~ o ~1 h ~ ,~ r l .~ Z; Z ~ ~ ~n E~
tl~ ~f ~, cI E~ ~ ~ OH ~ J7 a o ~ h ~ ~. O ~Q h E~ ¢ m ~ ~ Ol V
h U~ U) h O Q, O h 11 ) h O ~ ~ V
h ~1 a) ~ rl -rl E-~n v ~ E~ t~ t~ ZH X
~ _ .... . .

W 097/26357 PCTrUS97/00787 o~
~r f .. ~ C
- Y
~ f.~ ~ f O 1::: 0 fI
Z ~ Z cI
a c Q C_ al H fl H fI
c al ~ r~
n -r~ ~ ~ n -r~
~r ~ Id rc~ f~ rO 1 m I ~D r--~ p~ r-l r ~I tl~ r~ r .. , t~ ., .. - ~- -~ v ~ ~ - al ~.) r-O r C) t~ a~ Z _ ~ r. ~ a Z r O n~l~ a z - u~ , o , z - a\ ~ O ' z ~
P ~ n ~ ~ ~ a ~, cn H _ a ~n ~ 1 _ H _ a ~n . 1 ~ H ~\ a u~ _ O~ f ~ ~ Z '' ~ ~ 01 ~ 'r V 01 1 ~1 Z ~-a ~ w ~ ~ ~
~: P O ~ P O ~ a o ~ c E-, ~ ~ ~ ~ ~ r~y c E-~ ~ ' r ~ C~ ~ ~ Z ~-~
O C7 ~ ~:1 0 ~ O C~ ~3 11; 0 ~ O cr) 1i3 ~S O
~ ~q Z 11~ 4 ~ Z P~ r 3 z P P~ ~
C~ O U J U ~ >~O C~' CJ ~ >~ O
~ z ~ ~ ~n ~ ~ ~ O ~ ~ ~ m ~ ~ c ~ Z ~ ~ ~n ~
H ~ H _ _ -- _ ~C_ H
m u a ol ~ E~ 01 f~ m u a o~ ol ~ m û
~n m ~ ~ ~n n ~ n O ~ ~ ~ ~ ~ ~ ~ O
-- X - Z X ~ ~ Z
H ~~, H
~ r~
_ ~ _ _ . , ~

o o o o o o o o o o o o o o o o o ~ ~ ~ ~ o ~ ~ r~ ~ o ~ r~ ~ ~ o w ~

V U ~J ~¢~ ~ ¢ ~ ~ C~ -C, V C_ C~ ~ V _ _~ C, '' r - ~ J
f~ C~ C
¢ ~ ~ ~¢ J ~ ~ V ~ ~ 3 V ~~ c~ r _ V
i ~ ¢ J 3 ~ ~ ~ 3 J E~ a ¢ c~ R
~D ¢ ~ C ~¢ J -~ ~ ~ C V R _ VR! V ~¢ V
rj - ~ v ~ R V ~ _ ¢ f~ V ~ , .. r~ I ~ ¢ ~ Sf~
Z ~ R ~ ~ R --rl ~ ~~ R r~
~ , , ~ J t -~ C ~ ~ C' a ~ c ~ J ~ C, ~ r R _ ~ r~
H 3 -' E-l ~ ) r~ R -~ , i r ~ 5 ~ ~ r, r-r~ c ~ r ~ R¢ ~R, ~ ~,) r ~ t J ~ J ~ -rD ':t ~ R¢ ~ Vr~ ,¢ ~ ~ ~ r f ~ ~ R¢ -:1 V
~ V C ~ rd~; R :~ r~ d ~ ~ ~ ¢
v ~ ~ r ~ r ~ _ _ rd Z ~_~ ~¢ _ C ~ -~ R 1 _ J
~ r J -~ I v ~ ~ ~ ~ J rlr~
r_ - ~ r~
-Ir~ J ~ -I R¢ ~ r R~ r _ . r ~,~ , R¢ .~ ¢
- 1 ~5 ~ R ~ ~ _ V -~ ~ CJ
J f~ ~ R¢ ~ _ C ~ 5 ~ c) ~::
,¢ .¢ ~ ~ 3 V 3 ~ ~ ~¢ ~ R 1~ 1¢ R¢
3 J ~ V -~ :~ V ~ V _ ~ ~ ~ V
¢ ~ C '~C3 ~ ¢ - ~ C ~ ¢
-I rJ 3 C ) R J ~ _ i5 R ~ ~ O !) r ~ ~ c -~ C J ~~
~1 _ R -~ 1 J-- ~ ~ : r Z ~ ~ C ~ _ C ~ C ~ ,¢ ~ ~ ~ : c C ~ _ Cl ~ ~ ~ V ~ ~ C ~~ C J
.5 ~ c J _ C ~ f~ R¢ E-~ C J C _ ~ ,¢ ~
CJ ~ E- V E-l R ~r~ ~ . V J
r~ ~ ~ V ~ ~ ~ ¢ C) ~ i5 C ~ R ~ ~ ~ r ~JC E-~ V R~ 5 -~ ~ r~ CJ - i~ J ~ V ~ r~d ~ R R ~5 ~
J 5 _ , ~ ~ J ~ J - C~ C, ~ ~ c V ~ ~ _ V ~ r~

W 097/26357 PCTrUS97/00787 o o o o o o o a~ ~ o ~o ~ ~ ~r O ~1 ~ ~ ~ r ~ ~
r-l r I r-l ~I r-l ~I r-l ~--I
h ~ ~ C.
r~
f _ ~ S
r~ ~3 r ~ cn J ~ 3 ,~ ~J ~c~ ~ O r J f S r~ r c J
C, -~ ~ C~

r~ f.~ S :>~ S
E~ ~ _ V f- ~
V _ ~
f~, ~ c~ ~,C~ ~ ~ ~ O 0 h -~ ~ !) f~C, J J f~ C, J O h h h -I ~ ~ flr.~ - Z ~ :~ Lr) r~
fI _ r _~ _ ~J fI ~f ~ rcs H
O ~ ~ rr ~rr ri r-l ~ ~L) o ,) ~ ~ r~ ~r~ ~- U O~ f~ .~ ~ ~
Fr-l ~r rr~ JfI rE~~ ~ O n a~ P~ ,a u - r~ ~) 7r, r~ rc1 s ~ - ~ f ! H
r~ : ~ - - ~~, O t. ~r ~ ~r~ ~ z V ~ ~ I J ~ J Z ~ E u a o ~ 0 P~
f~ _ E- _ ~r, -1 ~ a ~ rn-, -~ ~ H l¢
t~ fl E~fl J ~ ~ V H ~ U~ 0 rn ~
f fl E-l rr fl ~ 0! f ~ r-l ;~ ~ fE~ ¢ E~ S ~ V ; V u7 ~I H
r~ ~ rJ~ .q o J E~ f. ~ ~ C r _ J ~ C~ E-l ~~ Z ~ r-l ~ O a r ~ r~ r, :.!7 0 V Eq ~ O
C ~ C ~ C r ~4 ~3 Z P
[ f f r~" -- r z z ~ l ~O r~ r~ r a r- ~ f~rJ ~ ~ ~r H
f' U ~î r ~ ~ ~ r E~ 01 1¢ ~ r a o~
~; ~ ~ ~ ~ ~ ~ r~l r-l ~1 J u cr ~ rn rn H C~ C5 5 f~ rJ .1 0 ~ ~
.,~ rr ,~ _, rJ -r1 r-l ~ ¢ ~¢
r ~ _ H
r r- ~r r~ r_) 3 ~ ~ r_ r CA 02248638 l998-09-09 W O 97/263S7 PCT~US97/00787 a~ o ~ o .¢ > a~ H P~ H
s o ~ o V ~ V
t~ ~ ~a) ~I N ~ ~ ~ aJ ~ O G
CQ O ~ , O

h ~ ~ o ~ ~ ~ ~ ~ o E-l U) H ~ ~ ~ V ~ V ~ f~ E~ 5- ~ ~
1 o (~ u o U~ t' ~ ~ H ~ ~ ~ a H
h ~ a u~ .D H _I ,~ ~1 V ~ H
O ~ O
o .-1 u~ a) Ul ~ ~ h ~ ~1 V ~ V
. 1 ,:1 ~ r C4 ~1 ~ ~ H C~ ~ H
~1 0 U~ 0 ~1 ~:1 Pl ~0 H > ~¢ ~ ~ ~1 U7 ~ H

CA 02248638 l998-09-09 ul ~ O ~ ~1 0 h ~lS u~ ~ ~ O ~1 ~I S ~ ,C ~1 ~ U~ lQ O aJ

O ~ O ~ ~ o v ~ ~ ~ v ~u~
~ O ~ O bq ~ _I 5 ~ O

V ~ ~ ~ :> X
~ ~ ~ o ~ u~ ~ o s~

~ O O ~ o ~ ~
'¢ V ~1 V ~ 1'~ C4 H ~ H ~ 7 ~ V
~ 1 s a) o U~ ~ O ~ O ~ ~ ~ O Cq O
X V N V ~ 1 H U~
H ~ ~
~ O ~ O
r V ~ V
U H H V 1~ ~ V U~

W O 97~6357 PCT~US97/00787 o o o o o o o o o o N ~ ~r O ~D r~ 0 ~ O
r~ ~1 ~ ~ rl ~ ~r u ~o V

V ~ r- ~
~ r~ r~ t V ~ ~ J ~ ~ '~
~ r , _ r~ r r~ ~ ~ r, ~ r r~ _ r J ~ ~ ~' ~ v ~
r ~ ~ _ ~5 ~¢ I
~ J ~ ~ ~ ~
r ~ ~J ~ r~ J r~ ~
U ~ ~ v rJJ J ~ ~ J~ r- ~
r1 0 Ll H ~ ~ -I f~ r r r Ol J ~J ~ r~ rJ
~- ~ O. ,. ~i r~ r~
r) ~ ~- ~ _ V ~ J J
o,r, ~ J ~ - V
R Q O , ~ V
r~ ~ ~J ~- ~ ~ ~ _ ~ _ E~ ~ ~ _ J
rn ~ -, r~
H - ~~I a. r,q ~ ¢ r~ _ ~ rr _, ,¢ ~ ~I f ~
r~ ~ ~- ~ r~ r J
O ~ ~~ O ~' ,~
h r-l ~ ~ Z 11 -~ ~J ~~_, rl r5 ~ ~ o r~ o _J ~ J ) r ~ 1 J -~
~ ~ Z P~ 3 _ ~ ~ r rn v ~ ~ o v - ~ ~r ~ ~ ~ ~ J
z ~ E~~n E~ Z J -I , ~ ) r ~ ~
~ ~ ~ ~ P~ J _ ~ J C ;~ r J U
rl >~ O EH~ 01 ~ m rJ ~ a ~ 5 ~ J ~ r V ~ ~ rn r:n ~J rJ ~J ~ ~ ~ V ~ ~
J ~ E- J 5 t~ ~i O ~ C J ~2 3 :~
,~ . ) J -I r :~ ~
H X J ~~. r r .J
5 ?
~I rl ~ J ~ r1 J
-- r~ ~. J J r , oooooooooooooooooo r~l r~o ~r o ~ ~ 0 ~ o ~D ~ CO ~r o ~ r~ r~
~D r.~ ~ r~ r~ a~ o o ~ ~ ~ r ~ ul Ul ~ ~D

~ r~ - ~ 7 c - - r- v J ~ ~ r3 u c~ ~ J ~ 7 c~ ~ ~ - ~ J~ ~ ~ 2 ,~ r - r~ r2 ~ ~ f ¢ _ r~
r~ -- _ C ) --, -~ -- ~ r2 2~ _ ri -~ rl ~ -I (' ~ ~ ~7 c.~ ~7 ~ ~7 ~ r2 .7 V C f' ~ ~ ~ 7 ~ ~ ~ ;7 J ~ c ~ r r;
~, r E~ f2 f2~ r~ _ fl f~ f.~ -I
~~ 3 ~.7 f2 7 ~ ~ fl u ~ J ~ c~
- J ~ c ~ ~ _ J r~ ~ c c u ~ ~ v t f~~2 ~ ~ f~ ~ 3 ~ - fl ~ r~ c u ~ J ~ ~ f~
i _ - _ r ~ _ ri t ~ ~ r.
fl ~ ;i ---r ~i _ t'~ J C, ~_ : f2 _ -- ~ _ _ f~ C fl -I _ E-~ ~ _ C~, ~ ~ .7 ~: ~- 7 c~ ~ c c ~~ _ f2~ I Cr, _ _~ _~
- C ~ t3~ 3 ~ L~ L 3 c~ r r~
C, rL~ ~ fl i' L r_ -I .5 ~ f~ r.
C ~5 ~ ~ _~ f5 _ r~ rI ~S ~
~ 3 ~ L -' ~ r~ ~ fI U
~ fl r~ L ~ t fS' ~ ~ rl ~ ~ ~ _ L _ _ ~ L'i C~ C
r~ rJ 3 ~ f~ ~ r ~ fI c ~ ~ fI u ~ 3 ~ ~ J CJ 3 J rl ~ 3 ~ -3 ~ ~ , J - L~ . u r ~ I _ - -3 I - J
r~ :~ r~ ~ r~
~ ~ 3 ~ J ' _ C V ~ ~ C, ~1~ L U L _ ~ ~ ~ r~ V
~ r~ L~ f~ r' r~ ~ C,r' rl ~ ~ ~ L ~
f l '5 C rl f~ f-' f f~ f~ ' 3 c ~ f~ E-~~ v ~ ~ r~ ~ r~ ~ u f' u ~ ~ 3 _ ~ c L
L ~ c - J ~ ~
rJ ~ S ~ c~ ~ ~ 3 L~ r~ ~S ~ c ~ , ~ L- c~
--I L ~ ~ ~ f~r_ ~ ~ rl ~ f;l CJ
fl C 5~ r _.~ r' _~ -r~
tr r r. ~I~ C rS
J C _f~ f¢~I r¢ L ~ r_ O E-l I r~ f¢ f~ E-:~ Crl rr.~ ~ f¢ U C1 _ 3 C1 f'i r' U C
U fSfl ~ L f¢ ~ 3 C ~ ~ '~ r~ t'J C L'~ ~ t U fSE- ~ ~I fl; r- ~C fS ~~ ~ 3 ~ rl ¢ - E-~ rSt ~ 3 - 3f~fS ~ ~ '3 ~ ~5 ~ E-fS -~ J~) , ~3 _f~ _ tr U rSL ~ , ~ ~ ~ _'S ~ ~ ~ _ ~ tr,'~ ~ C ) t, ~ C _ ,~ ~r r fS rl 3 , fl -If' ~ ~ ,-- fS _ ~~ E-U t~5 L ~I L r~ ) fi fS rS rl C~ ' 3E~ t, ~ ~ L

.. . . . _ .

W 097/26357 PCT~US97/00787 o o o o o o o o o o o o o o o o o o ~ o u~ ) d' O ~D N a~ ~ O ID ~ CS~ ~ O
r~ n O r-l r-l ~ N r)~ ~ ~ Il ~Dr t~ t _ J ~ r~ r~

1: - ~ ~ ~ U U ~ ~, ~ C'~

V ~ r~ J _ E~ V ~ F~ -~ C' ~¢ , V
'~ Cl ~ V '- ~ C~ ~C '~
:~ V
C C ~ C
,~ _ ~ ' tf~ - ~~ _ -~ C
u ~ c ~ ~ c ~ c u ~ ~ 3 ~ ~ ~ u E~ ~ ¢ ~ ~ V ~ - ¢
- r ~ _ - J ~C r ~ -- ~ ~ -- ~
r ~ ' - - ~t -- '' ~ ~ _ ~
C ~ ,J
~ ~ J_ ~ , r ~ J ~ : C '~
U ~~ C _ - _ ¢ E~

r'~ C ~ U fS f~[ ~ VV ~~ ~ E- _ '!7 rS C~ V
~r~ V r ~ ~ _C ~ V
t ~ ~ ~ fS ~ Vr~ rS ~ ~
V rr fS ~ fSrr J f~r _ E-~ - ~ ~ fS ~ _ ~r~ ~ ~ J _ _~ r ¢ ~ , , _ ~ ~ t V
¢ I¢ ~ ~¢ fS ~ r, ~ r ¢ ~ , V U ~ U C ~ V~a t~
~J - fS f ! V ~ V J C
~;' C s -s ~ E~ r~ fS ~ ¢ ~ V
C _ _ ~ ~¢ ,t~
S C rl r~ V r~ C ' _ ~ J
r_ - ~ _ ¢ ~ r ~ - f~ ~ ~ _ U :
~ r_ - f~ r t ~ ~ - f~ ~
~ I C ~ rS ~

CA 02248638 l998-09-09 W 097/26357 PCTrUS97/00787 o o ,~
tD C~
' ~ o ,~
o~ o t~
V ~ ~ ,~
~ s ~
~t~ ~ ~ o , :~ V
t ~ t~ S ,~
o,~ ,~
r V ~ O ~ r ~ O

Z ~ ~ ~ O
'' V U~ ~
r~ f~ ~ H ~ O
t~ rJ 0~ f ~ tl~ U) ,~ 3 1 .. ~ t~ ~ ~- ~ f~ H ~ ~ ~H r3 - z ~ ~ t) a ZO
3 ~ o ,~
rn , ~~ ~ H ~ ~ rn ~ v ~_ H - 0~ 0 U:) r J f1 J r~
r3 ~ ~ ~H f~ ~ ~ rD
J ~ ~ r3 ~.
$ $ C: O
3 v ~, ~O r t~ ~ ~ O ~ ~ O

t o r~
._ , z z, ~ ~ rn ~ ~ H t~
~ ol~ m rJ ~ o~ ~ t~ ~ ~
-- t~ r~ r~ r~ r~ O ~ r~
r J ~ rn rn H V Vt~ ~ ~ ~
~ ~ ~ O _ _ L~ O ~
r J ~ z '~ x ~ t~ ~ H
~~ !) H
v 3 ~
V

. .

O In ~ o ~Q ~ o E~ ~ ~ V ~ U U ~CJ
Ul 0 ~ ~ V V Ul -~
~I S ~ ~ S r~
D. H l¢ ~1 'I ~ ~ U 5' 5~ ~I V ~¢
:~ O ~ O r~ O

N ~ ~1 ~ 0 r-1 0 U~ 1) a.) 0 Dq O ~ O ~ S ~ >, ~I S ~ ~ S S aJ ~ ~ ~ ~ ~1 ~ ~
~ ~ 5 h V 0 ~ O ~1 ~ o~, S S r ~ 1~ ~ S ~1 ~ U~
S ~ ~ ~ ~1 ~ ~ ~~ ~D a~
H ~ ~1 1¢ U V C~) U ~1 ~
u~ O ~ 1 ~ ~ O ~ O
u~-,1 ~ to S a.) u~ U~ O .C S ~ S

V ~ ~ ~1 U
a~ :5 ~ o ~ v ~ op~
f:l H ~ 1 U a~ ~ H ~ ~ V l¢
h ~1 ~ ~ --I S ~1~1 ~ ~ S
:~ ~) Lll C~ ~ V V E-~ H H 1~
~ O ~ ~, ~1 0 01 ~ ~ O
r3 H V ~ U ;~ ~ V N U

UJ O Irl td U~ /JU ~ -1 h U~
~ S r H V ~ ~1 ~ W
~ O U~ O
U~ S ~IS ~ >~ ~ G) ~ S ~

~¢ X ~¢ H U~ I¢ H l¢ U ~ U H H

W O 97/263~7 PCT~US97/00787 ~3 0 ~ O ~ O
O ~ 1 0 o ~ ~ o o ~ 1) 0 ~ Ll O :~

S ~ S ~ r ~S h o u~ ~ o ~I S r~ 0 0 H h S u~
0 ~ S ~ ~ h ~ ~
S ,~ ~ 1~ ~ H H E-~ 1 5 H
v ~ ~ o h 0 h h ,1 0 0 t:

r ~ h :>. u~ a) ~ ~
~ o O a) b- ~ ~ o ~ ~ O
,1 ~ ~I h ~ h ~ O a~ a) ~I Q) ~I t~ r C~ ~ ~ ~ H ~ H ~ r~
h u~ h h u~ O
,i s ~ ,i ~ -,1 s au o h u~ ~ ~
:~ ~ h O ~ ~ 0 0 ul O O ~ h 0 ~ ul ~ ~ S a) 0 ~ ~
u~ o ~ " Q, ::1 h o ~ :~ ~ ,1 ~ o h u~ q h ~ h ~ m O ~ ~ ~ 0 ~ a) ~ ~ ~ S ~ ~D

CA 02248638 l998-09-09 ~ ~ 0 ~Q ~ O ~ ~ _I ~ ~ O L~
tn 0 S ~ ~ ~D 0 ~ ~ r 0 s~

u~ o ~ ~ ca 0 0 S~ O
0 ~ ~ :~ ~ S S 0 s ~ U~ 0 o s~
o o~ 0 ~ o ~ ~, r ~ S 0 S tQ
~ ~I h ~ .C ~ 0 ~1 ~) 0 ,s ~ 111 V a~ ~ H ~ U
tJ~ O :1 ~ 0 S-l Sl O ~ 0 ~i ~ 3 0 S-l 0 ,~ 0 u~ ~ In 0 V ~ U~ ~ ~ fS V ~ U~
3 ~ Q, V ~1 ~ ~ 0 ~ C) 0 U~
0 ~1 0~1 0~ ~ 1 0 0 tO ~1 ~1 U~
5~ a 0 3 0 ~ V
r1 S.l ~ ,~ ~1 0 0 ~1 ~1 U~ 0 V ~'S H 1:l ~ V V ~¢ S
E~ V U V ~ u ~ ~ ~D ~ V E~
a o 3 ~ O bl (lS

3 to 3 3 0 Ln 0 0 ~1 0 ~1 ~ D 0 ~ 0 ~1 ~ d' (a V ~ U) Ul ~ ~ V
~ o ~ ~ ~ 0 0 o ~ o o ~ q 0 ~ ~ ~D
~¢ V H H 10 3 ~ G 0 Q~
0 ~1 0 ~ rl a~
H .¢
~ o ~ s~ ou~
V V E-l u~ m V E~
1 tJI O 3 ~ J 0 J~ ~Jl0 IJ') ~, ~1 ~ h O al ~ ~D .C 0 o ~ n o V C~ 0 0 ~ O 0 r ~ 0 ~
u~ ~ o Q, ~ ~ ~ ~ tn ~1 a) ~ o O CQ U~ ~ 0 ~ ~1 ~ ~ 0 S~ h ,~
C~ V ~) t' ~ H ~ E-' 0 L~ O ~ ~ o ~a ~ 0 ~ ,~ ~ 0 c) ~ ,, ~ ,, .
r H ~ ~ ~ 0 ,1 0 ~ U 0 ~1 0 ~ O ~ O ~

H ~ ¢ V ~ 0 o ~ O
0 u~ ~1 ~ ~ 0 V V ~ ,:1 r' V ~ V > H 0 ~ U~ V
o ~ ~ ~ ~ ~ o 0 U~ 0 ~ ~ ~ ~ 0 ~ V r' ~ V Pl ~ H 0 V ~ V :~ ~ ~ ~ r ~ 0 ,:~
o o~ ~ o ~ ~ o ~ 0 U? U~ s~ o t) ~ ~ U V P~ H ~ C U~ 0 ,~ ~ 0 o o? m ~ ~ ,~ 0 ~1 u~ ~ ,1 c~ 5 5 1' ,~¢ ~ V ~ V ~~ V ~C ~ V

W O 97/26357 PCTrUS97/00787 s~ o ~ Cq cn ~ C~
,I Ql a~ ~, -, t -~ ~n c~ J
Cq ~ ~ o r ~

H

~ ~ r r .c r~ ~ ~ n ..
IQ a) o ~ o H ~ ~ ~ U E-V ~ a~
ta H ~ J 5.
~n ~ ~ o~ ~ ~- 0 o n ~ ~ ~ ,I n o ~ a . ~n -t ~ ~ z ~ ~ ;
C
H ~rn ,_ t _~
E ~ ~n .. ~ V ~n ~-,~ o a~ ~- Z ~ r~
O C~ 1 0~ ~ _J ~ O
1~ liil Z ~ ~ _ t ~, ~ z O ~ rr J _) C
~ Z Z ~ E~ rn Et Z~' r~ Z ~; ~
Et ~ 'n ~ ~ H ~ ~ ~ ~ ~ ~ Et ~' ~ t H ~ --o~ ~ m o ~ o~ ~ . Et ~ ~ o n rn r~ ~ ~ rn ~ O ~ ~ ~ - - O
cn 0 :~ V ~ Z X I _ -'' _ H

~,r' t ~I

W O 97/26357 PCT~US97100787 16g o o o o o o o o o o o o o o o ~ ~ 0 ~r o ~ c~ ~ O ~ ~ a~ ~ o ~ r r CD a~
c r c ~ r -r ~ ~ ~ C~

~r ~ C C~ 3 f, ~ ~ ~ r~ ~ r~
r ~ ~ r~ ~ ~ r~ r~
r~ ~S ~ ¢ L ~ .!) E- ~ ~
J ~ ~)~) r ~ u ~ ~ E~ - _ ~ f~ ,J
J ~ J r~
~ ~ ~ 3 '¢ -1~ 12r2 lC5 t2r_ ~ ~C
H ~5 t~ C15 ~ -I r _ C U l¢ ~ Uf~C) ~t ~ f.~ _f.~ V ~: J5 ~- ~ r2 f~ r ~ 3r3~ E-~Zi ~ C f~ ~ ~ ~1~; ~f~ ~ I ~r~ r2 ~ ~ t_ t_ ~ t '3 Cf~ ~ 3 H 5 E~ C
C) t~ t_tJ'3 U t5 ~ 1¢ ~ r~ J ~~ ~
tJ~ rn r2 ~15 f~c Ur ~ l¢ - -I.7 C12'3 ~5 1¢
rl C ~ ~ U t_ I¢
r~ ,r ~ ) .~fi~ C C~ r~J
al u~ az ~; ~ u f ~ ~ ~ J ~ r ~13 _1 ~I O ; _ ~ 2 U ~r~ ~~ ~.) C r~~
~ ~- ~ ~ : J ~ ~ ~ r~ r~
-, rn r ~~ ~ - ¢ -I f ~ r~
c rn r~ 3 ~ ~ r ~ ~ ~ r ~¢
r- 1~ ~ 3r~ ~ 3f~r~ ~r_ r_ ¢ _ ~~ t_ OE-l r2 E-~
~il V ~ 7 I¢ r5 ~ E-3 ~ 1¢ ¢ ~ F_ f~ ~ ' ~3 -) '~?, r¢ ~:~trl 3 ~ c u¢ ~3 t W ~; O J ~~ U ~) _ cr~ t r2 r~
P1 K D~ U ~ J ~ C ~ _ ~ r ~ E-l O U ~ ¢ S _ r2 ~ r2 r~ Jr2 -~ _ C r~
E-l U~ 'Z _) ~ U 3 C J C~: I¢ r2 ~ 2 C r _ _ _ ~r5 5 U J ~ ~J r2 r2 ~U ~ J r!3 C r~
m u ~ ~cl ~ ,¢ ~ c ~ f~ :~C3 ~ .
r~ U ~ :) ~ ¢ J ~ ~Cl r2 f:l U C
: ) C E~ - ~~ 3 ~ J 3 U f E- ~3 r2 ~) r2 E-~ _ ~ ~ J I¢!3 :~) ~f2 C !I C
-rl .) ~ t) _ )J ~ ~ ~ 3 C~
X ~ ¢ 13 ~ V
~ r~, f: r2r~
~1 5 3~ J
U C
U13 J ~ V ) ~3 ~ r2 ~3 t3E~ ~3 t CA 02248638 l998-09-09 W O 97~6357 PCTAUS97/00787 oooooooooooooooooo o ~ ~ ~ ~ o ~ ~ m ~ o ~ N
,~ ~ ~ ~ ~ ~ ~ ~ ~ ~ r ~ r~
~ r~ r~ r~ r~ r~ r~

r_ - _ r ~ _ ~ C ~ ~ J
r- J ~ ~C~ J ~ , r J
¢ J ' ~ ~ ~ ~ ~ ~ t J J
J .~ C ~ _ _l _ _ r . . ~ r r, J J
J ~ J ~ ~ ~ J J C ~ ~
~ r ~ r_ C C ~ ~; J t ~ ~ r_ J t J ~ ~, ~ ~ r ~_ rJ ~ J
_ J ~: ~ r_ r rJ J r ~ r ~ .¢ ;~ ~ J C_ J ~ r_ U ~~ r~ ~ ~ r_ - ~ r ~ ~ J V ~ ~ C
- _ _ ~ ~ r ~ ~ J r _ _ ~ ~ J r ~ ~ J ~ J ~ r r .~ _ I¢ C ~ ~ C ~ J ~ C
,¢ u ~¢ :) C) ,iC C ~C~ C
r~ J ~ C
~ J ~ . _ r~
C ~ J J ~ J ~ ~. J _ r: ~ ~ C J ~ ~
~ ~ ~ - _ ~ r~ _ - ~ - - I¢
~_ I ~ ~ , ~ ~ _ ' : _ ~ J _ ~ I J fS
C ~ ) J ~ ~ _ C ~ ~ _ ~ C ~ r .~ J U ~ ~ r ~ _ _ _ J J ~ J C~ ~ ~ _ ~ U ~ _ ¢ C~ ~ U ~ ~ 3 J ~ ~ ¢ ~
r ~ ~ ~ J ~ ~ ~ J ~
~ U ~ J - ~ ~
'~7 ~ '7 _ _ ~7 _ J r'7 ,~ ~ , _ E- _ _ t J t ~ ~ t ' F~ t F., C ~ ~ ~'t Et ~t J J :)'7 _ C '7 ~ ~ J ~~
V ~ r C, U ~ _ t ''7 3 ~ V :~ ~ C '7 C-V ~ , ~ E~ V ~ J t t _Et ~ C E~ t ~
,¢ ~ E~ ¢ Et 3 ~'7 ~ E- V V ~ U
¢ r~7 J U ~ ~) ~7 E- 17 _,7 rr ~ ¢ ~ C C3 3 , , E~ C E t C .~ ~ J . ~ 3 c ~ ~ r.
J J 3 r. r r_ J C '~ _ -J _: C ~'7 C ~ V
t t -I fl, f ~f5t ~ r~ _ t ~ tJ t V J E~ -~:C t ~ ~ 3 C J r~ J Et ~ ,¢
J ~7 ~ r_ C J V ~ ~, 7 C ~ ~ C t V ~_ ,¢ ~ ~ r ~ ~ J E~ E- ~: ~ J ~¢ ~
V J ~ c: C3 r_ V V ~'7 U ~ Et C7 c ~: U C
C ~7 C E- J t J V Cr 7~3 V ¢ C U E-~¢ ~ t C ~ t ~ J E~ , E- t C C
'7 _ '7 ~ ~ ~ 3 '7rJ ~ ) I ~ t C C~ ~ C
.~7 -~7 - ~ 3 J t U _ J r r_ J ~ C7 t f:~ t _ .~ J - - C _ - _ ~ J _ r~
J ~ J ~ _ ~ _ _ ~ _ ~ t 'JC ~ t -~ t ~7 _ _ C:~ J E- t ~ t r_ V ~ J ~ ~7 ~ ,5 II ~ ~ . C ~ ~: C
~7Ft ~¢ ~7 J tr_ C r_ C ~ - Et t - J Et r_ WO 97/263~7 PCT/US97/00787 ooooooooooooooo,~
~ O ~ ~ O ~D ~ a) ~ o r~',¢~ ' C 3 ¢
r'~ J~ ~ I S '' ' ' .. ,~ _ 1¢ ~ ¢ ~ ~
I¢, ~ ¢

7 ~O ~ ~ r~ S C
c~ VC) E~
c ~ c~ -3 c~ C
c~ c ~ ~
_I r~ f~ , ~ ~ ~ I¢ ~ r _c~
J C, L ~ ~ J ~ C V I¢ C' ~ U
~ r~ r ~ ~ ~ r r ~ u r, r u r~
L ~ ) L r ~ L -) r ~ L
r rr _ ~ r~ r r' rC r r ' -~ r~
C ~~ r_ Cr_ r C ~ ~ ~ rl ~ .3 ~
g~ r ~ C ~ _ C ~ ~ ~ r _ ~ J
E~ C ~ L- ~ ~ ~ C~
r~ 1 r, r- ~~1 ~ C ~ _ _ t' ~ C J~c ~ c ~ ~' _ r~ ,.~ .~

L ~¢ -?c~r~ r~ c~ rr J

r~ r~ ~ ~ r _ _~ ~ - r ~r~r C~ U
_ _ r r r' rJ r r~ r - E-~ r~ ~ rC~) J

CA 02248638 l998-09-09 W 097/263S7 PCTrUS97/00787 h o cn ~ ~~ a~ W E~

cn H P~ H
~) 3 U~ O ~ 0~

o o ~ ~1 W H
h O ~1 . 0 ~ h ~1 ~ O aJ ~.~ ~1 .C O a o ~ h ~ op, s~
Z ~ ~ u~ O ~1 .~
u~ a 1~5 H ~ O ~ O ~
~ o u~ h o u~
'' '- V 01 f, ~ ~ f~ f~ r ~I f~

fl~ H E-l Ul H
O ~ rJ -r~ ~I Z
Z ~ V ~ O ~ P. h 0~ ~ H f~ f~ 1' V f~ H
H ~ O CO r-E ~ ~ _ V m ~ H f~ f.~ f~ C ~
U~f ~ r U E~ ~ ~ ~ ~ o G) ~ I O _I lQ
O V ~ f1~ 0 f~ ~ f~ fl Z P~
U ~ O U l~ 1 U) O U) tl5 Z zi ~ E~ z ~~ h ~ ~
O ~ ,~ fl ~ H ~ 1 1 ~ ,~ ~ ~I H f H
01 fl~ m c~ ~ ol ~ O
U~ C12 H V V V u~ E~ f3 f~ > H
O -- -- ~ ~ ~ ~ O
Z -- X 'S ~ f~ f~ f~ H ~ f3 :C
H ~
._ -CA 02248638 l998-09-09 W O 97n63s7 PCT~US97/00787 ~ o ~ ~o ~ ~ o ~ ~ o h V ~ ~ ~ ~ U

o ~ ~ 5 0 :~ V ~ a h ~ r .¢ ~ I¢ C.) V U)u~ V
O ~ . V O
N~I r~ J O ~ ~1 h ~ H h O ~ ~ 1 0 R. ~ o h ~ ~ ~ ~ h V ~ ~ h ~
E~ H > ~ ~¢ U ~ S
, O S~ O ~ U~ ~

O ~ O ~ ~ ~ ~ ~ O O
o ~ ~ h a) a) Ln ~ ~ ~ ~ h ~n h ~ ~ S ,~ ~ ~ h S ~ ~ .C t~
E-l H H ~ h ~ P, H
P- ~1 0 tJl ~ ~ o m ~ ~1 tJ~ S~ h u~
h S S r ~1 h h H C~ ¢ h h tq ~ h u~ h o ~ ~ n o ~ >~

.'¢ ~ U~ I¢ H ~¢ ~ ~ ~ H H

W 097126357 PCTrUS97100787 o ~ oQ, ~ a~

O~1 ~ O ~ Q O

~ ~ ~ o ~ ~ ~ o v ~ u~ ~ ~ v ~ ~
I O ~ ~ Q~ o ~ v ~ ~~ ~ v v 1~ ~ H H E~ ¢ H C/~ V U~ V
Cq ~ O h ~ ~1 0 ~11~ O O
~ u~ ~ ~ ~ V 5 S 0 Lt') :~ ~) h ~, ~ m 5 V ~ U ~7 V ~ E~ ~ V
o ~ ,1 o 0 H ~ H ~ r~) ~ V C~ V U~
S~ ~q h h m O ~, n~tQ u~
O ~~ ~ O ~ 1 tJl O ~1 , ~ o ~ ~ U~ ~ ~ O
c~ V ~ ~ ~ ~r ~ V ~ E~

W 097/26357 PCTrUS97/00787 U~ ~ O ~ ~ O J~ O
~:1 V Ln ~ > V ~ ~ r U~ o ~ o V ~ In ~ E~ ~ ~ V ~ ':C

~1 o ~ O ~ ~ ~ U~ ~ O
V r -; H ~ J V C~ V r a) s~ s~ o ~ ~ ~ ~ ~ o r u~

U) Ul ~ H ~¢ P~ H ~D
o :~ ~ p, ~ ~1 0 ~ ~
~ ~ ~¢ H ~ ~D V C) ~ W

V Ln U ~ U ~ V C~ H
~ ~ o ~ o ~ ~ o V ~ V ~ ~ V r o ~ ~ C
V P~ 1 ~ V ~ V V E~
o u~ O ~ V
H H U~
-l $ Lr~ V ~ H ~ V ~D
~1 0 ~ h ~ U~ U~ O U~ O U~
V E~ $ ~ ¢ U V ~D U
u~ V q) v ~ ~ v v u~
V ~ ~: r CA 02248638 l998-09-09 W 097/26357 PCT~US97/00787 ,q o h ~ o ~ c~
~ .~ ~ h ~1 a) a~
V V~ co V
~ ~n h ~ h m u~ r E~ C 5 5~ U2 0 ~ h O tJ~ O

V V ~ r ~ V P. u~ ~ CD V P~ H
Q ~ ~ ~ o h ~ ~ O
~¢ V ~ E~ r ~ f~
1 ~Q, u~ ~ h ~ h ~ ~ h h 0 ~ ~ hU~ o~ ~ 0 0 ~: ~ r ~ ~
H ~ r ~ cn ~ h V ~ E~ Cq V O ~ h ?~ O ~ ~
S r H ,~ V a) V V H ~:1 H ~D
,t ~ r 1:1 V V ~ O co ~ ~ ~ V
Q~ ~ 5 ~ ~ 0 :5 0 J~ h ~n V ~1 r V > h ~ S U~
5-, s., ,~ s~ In ~ S~ ~ ~ ~ In O ~ 0 ~ ~ 0 0 r ~ a) S~ ~ 0 m h h ~ U~ r V ~n ~ V
0S~ O ~ ~ 0 ~ u~ o O
a) ~ ,1 r ~ ~
V ~ cq r ~ ~ V

~D N ~1 ~1~ 0 H 0 0 0 1--l a) 5 0 r V ~ V > H 0 ~ U~ V ~ E-' 0 '¢
~ O ~ ~ C O U~ O
_I ~r 0.-1 S u~ ~1 ~ ~ a) :~ ~) ~ o t l C~ VD~ I¢ H ~ V U~ ~1 ~ V a~
C4 V ,~ r ~ 0 ~ h o ~ 0 o s~ o ~1 S~ ~ S r S ,~ 0 h ~
V P~ V P. r h H V ~ U~ 0 ~ ~¢ V
1 0 ~I tQ ~1 ~ ~ ~D 0 ~
V ~V r ~ ~:C ~ V u~ ~ ~ V

WO 97/26357 PCTtUS97/00787 o o o o o o o o o o o co ~r o ~ ~ c~ ~ O ~D

~' J ~ C r, I¢ -Ia~ ¢ ~ I¢
g - F~ _ J
~~ r ~ J~ _ r ;~ ~ ¢ J ~ 3 C 1~ y ~

u -~ ~ ~ ~ l¢ ~' v ,. ~ a) ~ c u z ~ R O ~~ r I _ ~r~ _ 7 - ~ a r~
~D r ~ ~ ~ r~ ~ 3 rJ~ .3. ~- ~ v r ~ ~ ~ ¢ ~ ~ r~ ~ ~ ~ v O ~ r7 c K U ~ ~- Z ~ ~ ¢ ~
O~ W ~ O -~ r~
u2 ~ U ~ ~ E~ O U
u ~ o ~ _ ~ ¢ ~ J~
01 ~ m û ~ ol :~ ~ u c ~ ,¢~ -- _ _ _ ~
,¢ ~rn u7:~ ~ C ~ V ~ ~ c u ,¢ C
U~ O ~,_ ~) ~C ,~ ;,) . ~ C C' U
>~ ~ rl -- X ~ ~ J ~~ r~
~ ~ ¢ ~ ~ F ~ ~ ~ C

o o o o o o o o o o o o o o o o o o a: ~ o ~D ~ CO ~r o ~ ~ ~ ~ o ~D
r r a) G~ a~ o o ~ N ~ 'r In 1~ o r C ~ ~ ( f¢ ~ ~ ) ~ J E- E- C_ ~ ~ r' .¢ '~
I¢ ~ , J ~ V ~ J t CJ C fl '~
U ~ U J ~ ~ C C' C '' C, _ J ~) C, C, f~ _ r~
V 5~ C J I ~ ~ a ~ c _ f~ !~ J r~
C _ ~' C, ~ ~) _ ~- ~ J E- -~ C, .~ J ~ _ f~ J~ 3 ~I C_ J _ ~ ~ ~:1 _ _ _ ~ 1¢ -I ,~
Cl J~~ ~ O C ~ fl J_J C' ~ _C_ ~ J
¢ C l¢ r~S l¢ C' ~ V f~ ~1 :~1ClV ~ C~ '- ~ - V C V ~1 U V - J :J f' C ~ , V ~ ~ J
J ~ ~ -' -:~ ~ f- ¢ ~C
V V r J ~ J cl ~ ~ __ C _:~ ~C' J
~ ~¢ E-~ -' J ~ J ~ '' _ C I C~
'' V f~ '' ~ ~ I¢ :~) J~ _ -I . r~, f~ C, E~ V ~ r~~) V ~ C~
V f~ f¢ __ ~ J ~ f~~ ~' E-~ U ~ 15 _~ J O J ,fi C ~!
E~ C l¢ J ~ ~ f~ ) C ~ 5 f~ ~) J C ~ r~ 5 _ O ~.f~ ~ - C ~C, -~
C, i -':) ~ C, !) '. ~ _ C~ _ _ J -_ C; . ' '~
,fi,fi -- ~ - : - ~ J ~r~ ~ _ r~ ~r~ ~
fi C _ _ c,~ I r~ J
f _ ~ _ C r~ r -~
C- ~ ~ 3 - rt ,f~ ),f C, ~ r~lr~

C C C ~ ~ ~ c, _ C~) J r~c, J ~ J
~ ~ C r l,' ~ C CJ J ~¢ ~ C~ ~ ;.) C, C, r ~ r¢ ~, ~ ~ - ~ ~J ~ c~ c J
:~ ~) C ~ ) ~ r~ J _ _ ~ r~ ~ ~' -~ ~) C ~ _ ~ ~ 5 J _~) r~ r~
~, r ~ r ~ ~ ~ ~ r~ _ r _ ~ ~ _ *
- -~ r 1~:1 C _ ~ !~ _fi c, _ _ ~ J ~ ~ f ~~ _ ~ 5 ~ r.~ _ ~ r~l ~ ? f C :~) E- f5 C f ~ C _ !) Jf~ ~ r r~ r C J C, E- E~ _ O VC_ J ? J '~
C :~ C~ ) V J
C E~ -I ¢ - V C f~ f¢ ~ U ~ ~ ¢ ~ I¢ ~ r~
~ U ~ ~ : V f~ ~ ~C C C~ r C ~ J ~ r~ ~ f~ ~ ~I C C ~ _ ~ f- ¢
~_lf~ r~ c, J _ 3 _ ~3 7 _ c t c, ~ _ c ~ r~
f~ f.~ _ r r5 ~ f J
C ~ fi C C, ~ ~ ~ C ~ ~ ~ r~
f~ ~ C :~ C ~: CJ E~ ~ -~ f~,J
~ ~5 CJ C~ ~ Cl f3 E-~ ~ V
~ C U C~ C~ ~ V C_ C ~ ~ V
. C C~ f-- ~ ~ ~ r~ C
~i C C~ fi - 1:~ f~ 5 ~ fi ,~ C r~ , r ri , C _ ~ r _ -- ~)~1 f ~ ~~ _ r-~ _ C r~ ~ J -~ J t fi f~ - ~ ~ f~ C ~I r' ~ ~ r~
f ' ? C C, _ V 15 ~ V:~ J ~: : C
f' ~ CJ C; ~ Cl ,~5 ~ V f¢

CA 02248638 l998-09-09 oooooooooooooooooo O ~D~ CO~r o U~ ~a) ~ o ~D C~ Q ~ O ~O ~
Qtl) O~a~ O~Ir~ D r-t~ Q
r-~~I r~ri ~ ~ ~ r'l ~~ ~~ t~ ~ ~~ ~ ~

3 ~ . ,r L; ~ c ~ - r ~ r ~ ~ ~ 7 ~,,~ 7 ~

~ , ,~ c~ ~ ~
g 3 o ~ g ~ JJ ~ r 7 C~¢ '17 V J
~, ~ ~ rcr cr ~ ~cr r~ 7 c ~ 7f~ ~~ c~ 3 ~ ~c E~
C~ V ~ '7 ~ JCJ ~
~ ~rJ V~7 ~ Cl ~F CV J ~ ~CJ ¢ ~
,1 J J -~ C~1 ~ ~ ¢ ~ 3 _~ 7I -I 17 ~ J
J ~ - ?c~ r~ ~rr ~ ~7 ~; 7 J
~ ~7 ~ J ~) ~ J
-I ~ ~ V~[ _ ~ -l-~ ~_ f5!) ~7C
~ ~ U1~ V ~rl r ~ 17~ 3 Cr, J17C~ _ J ~ICJ r~ l¢ C ¢ CE- I¢ _ E-I¢ C
_~_1 _1 ¢ 17r~ 17 ~ CC f~.~ C, ¢ C
J ~l7 17 r ~~ ~c ~ 7 c -J 3 ~ - - 7 r~ 7 r~ r ~ ~

~¢ ~ ~ 7 ~ 7 ~1¢ ~7 ,¢ ~ -~ ~, r~ V 1¢ -!7 ~ V ~ ~¢ J ~ '7 ~ C ) c~ ~ ~ '7 ~ C~ V ''7 ~ E~ C, CJ :~ E- ) I¢ U C, C 17_~r J~ ¢ U¢ ~73 E- ~ ~ , C' J ~ 17 C~
r.~ '17 ~ ~ ~r ~ 17 ~:_ 1¢~ ¢ -l'7''7 ~ C,-~ C -'7 ~:~~ C:
R, ~ _, 3; ~17 ~ J C,~ _r1~ 17 C-I C
c~ J_~ ~ ~¢r~ ~ '7 E~~ ~
V ~ ;) V '7'7.S C J C~ 3C :) C ~U ~ C, VC 7 JE~ 1¢~1 1¢ V'~I~lU ~)U E-~ r E-I¢ ~
E- ¢ V -l ~ ~; E-~ '7 ~ E~ ~ I¢ C~ - ~ V _~
C ~ 7~7'~7 V~7 -~ ¢ ~V E- _ ~ ¢ -1 ~ - ,r~ - ''7 ~ ~ J - C~~ E-r r~ 17 r.,I ~ ¢ .I - ''7 .c: ~~ ¢ - r; r ~~ ~ ~
,C~' C 7 ~'' ~ ~~ J
v ~ ~ c3 ~~ 3, CA 02248638 l998-09-09 W O 97126357 PCTrUS97/00787 o o o o o o o o o o o o o r 0 ~ O ~D ~ 0 ~r o ~D r~ ~ ~r o 0 ~ O O ~1 ~I N r~

tJ ~ 3 J C J C J E~
J C - ~ ~ C ~
J ~ r~ ~ J
J r J ~ r' _ -- ~ ~ r r ~ r~ r ~r ~
r ~ ) ~r~ ~ l J U~~ r ~ C ~ C ~t -' ~ C: S ~C~
,~ ~. r ~ r_ -~ _ C
V~) r~ r~ r C f~
t ~ r~
J -~ rr ~ r~
J ~ V '' E~
J r~ ~ r r~
J ~ ~ ~ v u _ r~ ~~¢ V J , E-3~~ _ C E~ J ~~_-1 r5r~
r~ J ~ a ~ 3 ~ .~
~ ~ ~ ' J V C r~
F~ ~_ J C ~ ~ ~ ~1 ~
rl ~ J C -I r J~ ) J -~ _ r~ O ~r-l ~r-l z E u ~ h_~ a u~
rl r~ _ f5 _ ~!~ 7 H ~ O rn ~ r~l F~ ~3 -If~ V L Vf ~ -l 3V U V Ll f ~ O , a~ E Z
iS ~ ~l L ~ I¢ C~ n f ~- ~ W
3 ~ Cl f~ ~ V Jf3L _ ~ r ~ a -I L~ C~ , r ~ L E~
~l ~ C f~ r ~ O V ~ i~
~ f ~ r ~ Z F~ Fr~
rl ~ -I f_ ~~1 ~r1~ -I U ~
J U ~ -I - r:l 5 L _~1 ' L -I Z ~i ~ E-~rn ~_ ~ C r ~ ~ ~ - r o ~r~
f~ J _ C _) L _ ~ ~ - ~ H
C f¢ L _.)f~ J C J 1 3 _ J ~ O! ¢ F4 V
f~ ~ L~ ~ E- 1¢ ~ ~ ''1 V'~ ~ ~ V ~ rn r~ f~Cl J '~ ~ L~ S F~
r~ f.~ J ~ 3~~ V O
f~ . r~ ~ V J ~ r L ~ ~ ~ E-l ~ -r~
.)r l. _ _ ¢ -I ~ ~ f~ Z
r~ ' L ~ ~~lr.~, H
J ~ ~ C
J ~ , L
V J J L C O ~ -I ~ L ~ 3 ~ J

. ~

~ h n ~ ~ n ~ o n n ~ ~ ~ ~ o >, U~ 0 0 0 u~ h ~ ~_ H Pl H f~
~ ~ ~ n ~ ~ ~ o ~ n ~ ~
0 ~ o ~1 ~ ~I h ~1 ~
V ~ V ~ 1 ~ U .~1 n ~ ~ o n h ~ 0 ~~ n o ~ h S ~ ~ 0 0 ~ ~ ~ .C
a~ h 0 1~ h ~ V
h 0 ~1 ~1 0 Lt~ h h ~tJI h :>~ 0 ~1 ~ ~ 0 ~ o ~1 ~ 0 0S~ 0 0 0 0 ~ r O ~ h h O P~ h ~1 u~ ~ 0 S~ 0 h u~ O,~
U~ ~ ~I C) P- ~ H
~ L~ o ~ 0 :S
O U~ S~ 0 ~d 0 h ~ ~¢ H E-l Ul H V ~ ~ V ~I V
0 5 ~ h ~ ~: 0 :~ ~ o 0 ,In a~ a) o ~ n ,~ 0 H l¢ I¢ U~ r V ~ H ~ 1 ~ H .CI
- ~ n 0 ~ n O
h h 0 u~ ~ n V V V LS- ~ 1 H a ~ ~ 0 ~ ,~ U P~
O ~ I h ~ ~ ~ O
~ _ ~ ~ o 0 0 ~ ~ ~ o ~ n 0 o f~ v ~ v ~ ~ ,¢
O t~ ~ ~ 0 ~ O L~
0 0 rl h ~1 ~1 " ~1 w ~ ~ 1 ~ H
h ~ o u~
tl~ H V V V Ul E~
0 0 ~ ~ u~ ~ h n h ~ ~ ~ ~ ~ ~ ~ ~

_ W O g7126357 PCTrUS97/00787 o U~ ~ o ~ ~ o V ~ V ~ ~ V ~ r ~ ~ V ~: V ~
o ,~ o ~ o h 0~ r V C~ V
O~ O ~ o ~ '? I¢ N ~ ~1 C) V r~ V ~) C
;~ H E-~ ¢ V
O P~ h (~1 ~ O O~

V V V ~ ~ ~ 5 o ~ o 1 O~

o 0~ O O a) V ~ ~ H ~ I¢ V .¢ V ~ 4 H
U V E~ H H ~'1 E-~ ~ P~ H E-l ~
~1 o ~ ~ ~ ~ ~ o ~ o > ~ ~ C1 ~ ~ ~ ~ V ~ 1 ~ H U~
V ~ ~ V
Lq ~ o ~ ~ Q o ~:1 H ~ V ~'3 V H H V ~ r~ V U~

W 097/26357 PCTrUS97/00787 O ~ h O

o ~ tn ~ 3 ta o ~

h O 0 01 ~I t'~ 0 0~ ~ O

o ~ ~ ~ ~ ~ o s ~ Q) O
O ~ ~1 0 ~1 ~ O 0 ~1 H ~ 111 ~ ~ . O ~ O
~¢ H ~ ~1 ~1 C~ U) ~ H ~ C1 C~ U~ V

O ~Q O O ~ ~ ~ 01 0 O h o ~ D~

o ~1 ~ ~ ~ ~ o ~ O

CA 02248638 l998-09-09 W O 97126357 PCTrUS97/00787 o ~ ~ o ~ n ~ o >. ~D W >.~1 ~ ~ ~ H ~ V~ N G~
E~ U~ ~ ~ ~ ~ ~ ~o ~ U ~ U f~ r cn ~ Ul O ~q ~ ~ ~ U 1~ V V ~, ~ ~
H P~ 11 ) H ~ P~ ~ .¢ r rn ~ ~ o u~ > tn ~ O o a~ r ~ 0 :: ~ V o U U~
U ~D ~ U ~n h O S-N a) 1~ ~1 ~1 ~ O
W ~ ~ r ~ E~

S~ o ~ ~ O ~ h ~ D~ ~ ~

~ p~ H ~ ~1 U ~ V ~ C7 h ~ O ~ O ~I C) ~¢ ~ u~ ~ H ~
U~ O ~ O ~ ~ O Q, 1~ Lll H H ~ C1 V ~D c~ ~ ~ V Cl r U P~ U V ~ ~D ~ H ~ r h O ~ p~ U~ ts~ ~. O

r~ h ~ ~ r >
o ~:: o s~ O

H H P~ 5) E-l ~ ~ H
1 H ,~ 1--I N a5 U7 ~ ~ ~ O ~1 H ~ H r ~

.. , ,, . . _, _ W O g7126357 PCTrUS97/00787 ~ o S~ o ~ ~

:~ o C) ~ o ~ ~ h ~ o H ~ H t~
O ~ ~ O tQ

r cn tn C~ V ~ ~ .:1 o ~ ~ ~ a) a~ o H ~ Cl~ > E-l .'3 U~
o ~ h ~ ~ ~ o ~ ~ ~ ~
~: r ,~ u~ V V ~ H
H p~ r V
a) o ~ U2 0 U~
V 1-l V H r V ~ U ~ ~¢

P~ H ca V V ~~ V S P~ H
tl) O ~ G) h ~ ~,q O ~ O ~. o h h ~ ~o ~ a) a) :~ ~ ,~ ~n -,1 h ~ o a~
,~¢ r ~ H Cl~ V a~ U~
V ~ r C~ ~ H ~ 1 a) ~ h ,1 O a1 ~ ~ ~ ~ O U~
J V OD ~ ~ V
tll u~ tn h In ~ h ,t ,~ 5~ ~ co h ~ al h ~. ~D ~ a) ,1 ~t H ~ r ~ H ~ ~ V Cq V

CA 02248638 l998-09-09 WO 97/26357 PCTrUS97/00787 ooooooooooooo ~~ ~ o U~ ~ ~ ~ o ~, ~ ,¢ ,~ ~ ,¢
~ - ~ U r~
C _ ~ J I ~ , ~ J
V E~ l¢ ~ ~ ,¢ ~ r V E~ J ~1 ~ V
U '~ ~ :~ C
~ u ~ ~ ~ 3 ~ ~
~ C
-l _ t. I J
~~ C _ ~ U C ~ J :~
In , .
.. ~ r J r ~ r o -- ~ . ~ ~ -- ~ r~ -- ~ ~ ~ ~
Z _~ - ~ - r ~ ~ ~ .
u~ a ~ J
H _ J ~ ~ J ~ V ;~) .. .. ~ a)0~ '¢ ~ '¢
~I J ~ ~ '~ r~n J '~ rr :) ~ ,¢ ~ J r_ _ V '~
~¢ ~
n v ~ J - J fS ') ~ [
O n , J r ~J ~ ~ r ~ ~ ~ ~
m ~, rn, ~ J J ~ ~ _ r ~¢ ~~_ r~ a rn, 1 ~ J,~ J E- 7 ~:
r,_ E ~ ~ ~ ~V~
a ~ r - ~
r~r~ ~- W Cl ~ ~ ~ ~ V r,_ ~ U J ~ ~:
; r~ C~
V _rJ f~ r o ~ ,CI ~ ~ o~ w ~ ~ . r r - J ~ ., ~ r z ,Uz ~ ~ E~ ~0,U ~ ~ ~ - J
O ~ ~ ~ ., ~ ,~ r H ~ _ _ _ ~ p ~ ~ ~ r~ ~ ~ CC~ C ~ C r E~ m v ~ ol ~ J ~ - ~ 5 ~ VC~ J r r u~ r~ ~ ~' U ~ ,~t ¢ ~ V ~ r~
Y r '~ ~V :J r~ -~ ~ V ) ~ ~ ~ J
Z X ~ - ~
r ~rJ l¢ ~ ~ ~ C
N r~ V U r J rV ~ r J E~

CA 02248638 l998-09-09 W O 97/26357 PCT~US97/00787 o o o o o o o o o o o o o o o o o o ~ o ~ ~ ~ ~ o ~ ~ r~ ~ o ~ ~ r~ ~ o ~
co o~ a~ o o ~1 ~ ~ f~ > r~ ct~ CD

r ~ r~ ~ V
- c _ 3 ~ ~ ~ 3 - J ~ ~ r~
J ~ 1 J ~1 _ 3 r~ J I ~ ~ _ ~ 3 ~ ~ ~ ~ ~ c ~ ~ J ~ ~ ~
3 ~ 3 J ~ ~ ~ r ~ c rr~ ~ 3 - ~ ~ ~ c r~ ~ ~ r~ r ~ _ 3 3 r, r~ ~ ~ c~ c r- r~ c~ 3 r~
~ 3 ~ ~ ~ ~ r ~ r. ~ 3 ~ r c ~ t ~ r ~ ~ ~ ~ i3 3 c ~ _ ~ V ~ r_ ~ _ ~ J ~ C C
r_ ~ c E~ r f~ - C r r C~C_ f' ~ ~ C; r J I ~r~
r_ ~~ C ~ C_ ~ ~C_ _ ~ _ C _~ lC C, E~ J ~ ~ ~ r~ C E- ~ ' ~ C
r_ ~ ) V ~ JE~ C3 :C J 3~'C_ C- ~ rJ ,¢ J ~ C3 ~ C_ f~ -- -- ~~ ~ ~ --C_ ~ _ ~ E~
~ ~ ~ c ~ ~ :C,C_ '~;
r~1~:1 C~
3 E~ C'' 3 ~ C ' 3 J ~ E~ C _ ~ C3 ~; C~ ~ ~ J

:~ U I ~ ~ _ U1 ~ ~ c_ C3 ~ ~ 3 ~ r rC ~ ' _ ~ : ) 3 J _ _ _ r , ~ ~ : ~~ ,5 _ r- ~ J ~ r,~; , 3 J ~ ~~ J J,~ - ~ ~ ~ ~ _ _ J ~ CC~~ ~ 'r~ -~ J ~ ~ ~
r~ , CE~ ~ _ C ~ :~
C, E~ ~ J ' ~ ~ C
U _ ~ jC3 ~ C~ O , CC~
r3 J V ~C ~ l7 C~ C ~ ~JC~ r C
ICCl ~ ¢ ~ C a r ~ 3 ~ r ~ a - J
r~ ~ C~7 ,_7 ~ 3 ~~ C r - ~ ~_, _ ¢ ~ ~ ~~ J 17 r f~ I -~ ~ , _ -I
~1 ~~ _7 ~ ~ _ 3_7 ~ -- _ 3 ~ ~ 17 ~ 3 r ~ ~1 17 r~C~C C C 3 J ~ ~ 17 3 ~ ~~ C
~ ~ J J J ~ 17 ~~ 0 3 f~ C ~ 17 3 ~I CJ
-3 ~ 1¢ 1¢~ 7 E-~ r -If3 ~ C7 ~ ~ r~
rr17 _I ~ 3~, rC _ 3 ~ ~ ~C~ ~ C 3 r~ t ~.C~17 r~1 C
" ~ ~ ~~ ~ ~ ~ 3 , r - I C ~C r C ~ J ~ ~ ~ c J ~ C~ C

.... .

CA 02248638 l998-09-09 W 097/26357 rCT~US97100787 o o o o o o o o o o o o o o o o oo oo~r o ~ 1 ~ ~ o u~ N ~ ~1( ~ ~ t~CO

') V ~ '¢ -~ _ V '~ ¢ I¢ C'' V¢ ~ J ~) - Cl 3 ~ Y
r ~ 3 r~ _ ~: ~ ' -' J~C ~ J
V ~ C ~ J ~ IC ~
C ~ -( J t~ ~ ~ I¢ J ~ Cl C~_ Cl '~V ~ ~: C ~ ¢ ~ J
D - ~ ¢ ~ ¢ ~ 3 ~ J

? ~ ~, J
C ~ C C ~ _ J
J C ~_ J ~ ~ e? _ ~ J
¢ ~ ¢

, ~ ~r ~J. R ~ r_1 ~~ -I ~F~3 J
J~ ~ r~ ~ J
r ?~J ~ ,~ r~ ?
f~ t~ J ~~ CE~ ~ I¢ C' ~ J
CE~ I¢ ~ I¢I¢
C _J ~ .? ~ C
1¢ rC, ~ J ~ _~ -~t _ _ C,~ JJ
~) r I __ r O C C C h J~) C C~) !) ~~ C~3 C ~ J~ E-( C' J c C ~I h ~1 !) C~C' ~ :~
V ' ~ ~ C~ U ' U~ C ~ U - -I
C ~ h h h ~~ ~ rl 1~r~ V h E- ~~ .) C r~ _ U ~ V
~ _ _ r. ~ ,¢ ~ ~ r~ ~ r ~~ ~ C ~ , C r, ,~ r, ,, h ~ ~ ~ L ~ r .
R J ~ ~ v ,¢ ~ U ~ C ~ ~¢ '~ VV
¢ ,¢ ~ C ~ ~ J ~ _ ~ ~ C ,¢ C
J ~ U ~ ~ r R C) C
C-- J~ J C~
th _ ~ : ) h ~ l ~ I¢ C' CA 02248638 l998-09-09 W O 97/26357 PCTrUS97/00787 o o o o o o o o o o o Ln O ~D ~ CO ~ O ~D ~'; ~ ~ O r~
o o ~1 ~I r~

~ U ~¢r ~ ,¢
J ~ UVf~ J
J I -~t) ~ r r ~ ¢
J J U ~ JE~
¢ E~ J
~ V ~ ~ rJ~4 V'~l ~ U ¢
t ~ r.~ I¢ _ V ~1~ ) r~
r4 r~ V J ~¢ ~I r-- ~1 ~ r3 ~ ~ ¢ _ J Jt, r ~ c ~ ~ _~ J J
r ~ ~ ~ ~ J ~~ C ~
J -I-~ t 4 r r~l .) ~l~ r~
~ r ~ ~ ~ '' V l ~ ~r~ ¢ E~
-I E- ~ ' r.~)-4 ~~ 1¢ '.!) ¢
r ' ~
r, -I r r ~ ~I V
,~ ~J ~ -' ¢ ¢ ~ V ''~
C ¢ V -~~ '¢ ~ V t t ~ rr ~ E- r-l t C U ~ ~ ~ J V fI -I ft -- o "~ t U U ~1 . ~7~ 1 -I O r r1 ~rl c -~ ~ ~ r~ z ~ E t~
~ ~ fl ~' ~_ fl ~ ~ '7 ~H - t' O tn _ f~ ~ ~ ~ r_ f' . t ~ r-t ~ ~i r3 ~ ~ ~ r_ r ~ ol I ~ ~~ z -3 ru, ~ ~ 3 ,3 r fI ~ ~ ~ ' r, ~ ,E~ a ~

~ - ~ ~ r ~ I ~ o V W o - 7 ~ ~ ~ Z ~ ~ t~
, , ,~ r~ V ~ ~ E~ O
~ _ ~7 -!7 ~ I ~ ~ ~ ~Z Z ~ ~ ~ ~
f~ I¢ J g -4 ' , _ r ~ ~ _~H ~ ~ ~ ~ ~
r ~ I¢ V ~ ~ _. J ~ !7 ~ 3 ~ o~ ¢ m u Q
~ V '~ -~ r~ I¢ ¢
E- ¢ ~ ~ U E~ ~ f~4 '7 ~ ~ _ ty f ~ E- f¢ '7 U ~ ~ ~ ~
I17 fIr ) 3 ~
3~ - f ~ r¢,~ , ~f~ H
_~ _ 7 fI 1 ~ f3fI r ~ E-r ~ E- ~ ~7 E-~r~ t f¢ ~ 7 E~ f¢ ~ fI:1 ~ V

W 097126357 PCT~US97/00787 o ~ ~ o V u~ V ~ ~ ~ ~ ~ V ~ ~

~ ; V ~ ~ H ~ H ~ P~ ~1 tn ~ O
V ~ V ~ V '~ ~ V ~ V

OD ~v ~ v E~
r ~ V
C O _I ~ o S aJ r O ~ ai o) O p~
a ~ v H al ~ ~ ~1 0 h 01 ~ o H .~ H E-l 111 E-l V V ~ f~ ~I V P-V E~ cn r V ~ H ~ ~ ~-1 tn r ,~ ~
n CD V ~ , V ~I
- C3 _I O ~ _1 0 ~ U~ O ~ _i V ~ I V V
o u~ 0 ~n u~ ~ V V V u~ H H ~
m X s ,~ V

W O 97/26357 PCT~US97/00787 o U~ ~ o ~ ~ o Ul u~ U~ ~ C ~ ~ ~ ~n o ,~ o ~ V ~ ~ ~ o :~

, O n~ J) O t~
V ~ S
H E-~ C S V
R. ~ h o U1 V v~ V
~I H ~ '1 H H _ ,~
O 5~ O V U~ , o O
I¢ ~ E~ I V ~ 5~ 1 V ~) V ~ V C~ ~
~. ~ V ~1 0 ~ ~ O O G) tn V r1 E ~ ¢ V ~ H ~~

V ~ E-~ H H ~E-~ ~ ~4 H ~n ~ ~¢ _ _I o ~ ~ ~ O :S ~ S h O

h a~ h ~ 5~ ~ r I h >.
V ~ ¢ s ~ V ~ H 1~) h o o ~ ~ Q O

U~ V ~ ~ H aJ ~¢ '¢ ~' h a) ~ 1 o ~ 5 ~ h u~ ~ ac c~) t~ V H H ~

CA 02248638 l998-09-09 W O 97/26357 PCTrUS97/00787 O ~~ O ~ ~ O ~ h o V u) V ~ ~1 H

~¢ H ,'¢ ~ U~ ~ h ~,~ O 0~ o S~ ta o ~ ~ O ~
v ~ h t~ v Ll ) V ~ > W ~ s~ I¢ ~ u 1 o o ~ a~ ~ ~ ~ o ~1 ~ a) ::'~ H ~ ¢ ~ > W ~ V

D~ O O

a~~ o ~ ~ o ~ o o O ~ ~ ~ ~ o ~ ~ 5 o ~ ~ o ~ o tJ) h ~ u~ o W O 97/263S7 PCTrUS97/00787 0 o ~ ~ o o ~ V ~ ~ ~ ~ u V u ~: r P~ V
P~ Ul ~ V ~ V ~ V
~ o ul ~ ~n ~ o o ~ O
r ~
u v ~ ~ ~ ~ ~ r ~ o ~ ~ ~ 0 ~
V ~ ~ ~ ~ ~ ~ ~ u ~o V U u~ E~
O ~ O
'I ~ ~ ~ ~ ~ 0 ~ 'I ~ o ~ a~ a~
V E~ D ~ > V ~ V 1' V ~ ~:
v v ~ ~ ~ ~ ~ ~ ~ v ~ r v v s~ o ~ ~ ~ o ~ o a~ S ~ 0 u~
h Lt) ~ 1~ D V u~ V
,t ~ a) ~ a) 0 ~ 0 ~D V ~¢ V ~ H ~' 1) 0 ~ O ~ 0 ~J
r~ ~ ~ O ~ U~ lQ ~ .C a) 0 ~C ~ a H ~D V ~ ~ V ~ ~
O ~ ~ O O~ ::
H ~ V ~D V ~ :~ V t~ V
~1 ~ .C ~1 0 S-l 5: N .S
V Ul U ~4 V V V ~O ~ H :' ~ a, r ~
~: ~ o ~ o ~ ~ ~ o v v ~ ~ ~ u ~ v ~ ~ ~ v ~ ~ r ~ 0 ~ ~ r P~ ~ cn ul ~ V ~ V ~ ~ V
C~ O ~ ~ ~ ~
rl ~ 0 C a~
H H
~D ~~ ~ ul ~ N ~ 0~ ~ ~ 0 0 H ~ V V ~ r ~ v CA 02248638 l998-09-09 W 097/26357 PCT~US97/00787 ~ o s~ ~ o ~ ~

tD ~ o ~ ~ ) O
a~ .C c1~ ~ ~ h V t' H~:~ C,) ~:1 H ~I l¢ ~ U7 C.
~) ~ o n~ I o U~

s~ o H ,~ O
H u) ~ h UJ h O
~ O ~ O

H ~ 1 U
a) o u~ o ~q H r ~ S ~ ~ U
H U2 V l¢ CD V ~
Ul O ~ Iq O :~, O

~, r ~3 ~ H
~ r L~ ~: H
H ~ r ~¢ H 1~ ~ E-~ CD ~ U~

. _ .

W 097/26357 PCTnJS97/00787 o o o o o o o o o o o o o ~D ~ CD ~ O ~ ~ ~D ~ O

C, ~ ¢ ~ ~C~
J ~ 5 r J _ ~ ~ ~ r1~ .7 _ ~~) E- _ c ~ ~ C
C) ~ J l¢ U ~~~ . C~C, C~ ~~ J V ~~
E-l E- J ~ C~
~ E~ C~ - 5 -I
C~ C ~ f~ J
r~ ~ ~ C_ ~ ~ I¢
~J ~ _ _ ~ ~r~
J~~ r _~ ~r~ J
~ c r f~r~ -~ C~' C ~ J J~I C~
¢ ~ C~ C_ ~ E-C~ J E-l C ~
J C_C, ~ JE~
O ~ ¢
~ , ~ C _ ~ ~ J
, a ~~ ~ c ~ ~ , ~ c ~ r ¢E-~ C~ C--~
o~ r ~ C ~ ~ ,¢ J ~ Clr3~ -~
r n R. -- ~
r_l J ra 1U~ U 1 J ¢ C~ ~ C C ~Cl ~ C C
--I O ~rl Cl _ -I J Cl f ~ ~ C ~ E-~ J C_ E- ~ J E- J C r O ~ ¢ Z
Z -- .4 0-~ J - ~ ~7 ~ ~ _ -I C -I ~
a ~ , c ~r ~ J ~ J C ~~r~
CJ ~ r~ ¢
~ c ~ ~ _ v~ ~ ~-~ r~ c r U r U ~ r ~ - U c~
~ ~ ~0 ~ _ ,¢ Cr~ r ~.
O C~ C O : C ~ _C~
O U, ~ _ ~ _ C ~ _ _ _ ~ z ~ E~ u~ E~ ~ : ~ ~ ~ , r _~ c- ~
O ~ ~ , 5 r ~ ¢ f.~ _1 E~ ol ~: m û â ol ~ ~ J ~ rl J V V ~ ~ ~
~n u~ ~ ~ V E~ ~ ~ C
I¢ E- ~ 1 J !) .~ C
O ~ ,¢ ~ ~3 ~~ C; :~
~ ~ U ~ ~ J
Z X ~ E- E- E- I J _ ~ ~ r _ ,~
H -- ~ f~ r, f~ ~
- lC J J r r~ r:l E-~ C C ~~ ~) C~ ~~ _ r r C~ C ~

CA 02248638 l998-09-09 W O 97/26357 PCT~US97/00787 o o o o o o o o o o o o o o o o o o o ~ r o ~ ~ O ~D r.~l 0 ~ O ~D
o o ,~ O r.~
r~ ~1 ~ rl ~1 ~1 r-l ~1 ~1 ~i r~ ~I r-l ~ r l VE~ r ~ ~) ¢ O ~ ~ J ~~ V
V V ~ r~ r- ~ ~ _ ~ f~ r~
c ~ ~ ~ ~ ~ , ~ r~
r- r ~r' ~ r _~
,3 ~ r r J .~ -~ ~ r ~ ) ~ r'_~ _ J _ - J -~ C ~ r r ~ ) J ~ ¢
C rl ~ r_ V ~ ~ ~ _) C V
~~)V -I r~ 15 r~ C E-~ r~ ~~
3~~ r ~ r ~ r~ ~ _~
r r ~ ~ _ -I C ~ ~ ~ rJ ~ J
C ~ t J~r_ - S - t t ~-- _ t _ t r_ ~ t t r r r , ,) ~ r_ ~fS .1 t J
~ Jr_ ~ ~ I ~ ~ _ ~ _ t _ t r_ I ~ ~) a~5.'I ~ r ~ ~ t t r, ~r ~ ~r ~ C t t t UE~rr C r~ ) r3 C~ r l¢ r ~ f:I ~ J J
rJr~ E-r_ _ t V'~ r ~ 1¢ ~3 ~,J_ O t ~ ~ r ~ V
t .!) r r _, ~ ~¢ ~ r t t rr .~1 r, t V t t ~ ~ t t _~ r ~ r ~ - ~ EVt ¢ ~~1 ~ _) U t 7f~
f~_J l~t UrI ~ _ '7 1¢
U _r~ C U ~~) -rl t UFl; I) f~ r~ E ~ '' r ~
~ E-l ~ I¢ t ~ U E-~ t U r~
r~Vr~ rJ ;~ C ) ~ C l¢
t ~ t J ~ V ~~ ~ U t tr~ t O~J
t t~_ t 1~ t O ~ ~~ t t ~ t - ~ V ~ ~ t _ -~ ~ t ~
- r. ~ r r ~~ t t~1~ r -~ r _ 1 0r r t ta ~ ~ ~~ r _ ~ t ~ ~ ~ ~. t ~ ~¢ t ~ ~C~J J t r ~ t ~ t U
t C _E-' t ~) r ~ ~¢ t r V ~J t E-~ r ~ J~1 t C _r_ ~ ~ ~, t~3 C t :~_C ~ a r.~ r ~ ~ V ~:
cr,~ ~ t _r~, t '~ ~r ~ r~
t _:I t -- _ ~ ~ _ ~ trI _ t t r,, -~ -r --rr t.r t t a ~ IrJ c :~ J _ a t¢ ~r3 J ~ J J J t r_ ~ ~ r r_ ~ ~ r' r ~ ~t ~ ~) 3 ~ C t ~ ~ C t t r V
3 1t a ¢ J ~ ~ 3 ~ t J J E- U ~¢ r~
- _ t C 7 :~ t J J -- J ~ ~) rJ ~ V r t J r, ~ C r ~ ~ _ 1~ J J r l t t _ a ~- rr -, ~r J ~ r 3 , ~t ~ r ~ ~ r f.. rr -r Ja ~ r a E~ ~ : r :~ ~ t _. a -3 J

CA 02248638 l998-09-09 oooooooooooooooooo OU~ ~co ~O~D ~ 0 ~ O W N CD
Or~ N ~ 0 ~~ ~ D t' l' 0 tD
r-~ ~ N ~ ~ N(~

I¢ '~ :~ V U ~ ~ C ~ I¢
J ~ C C V
~ ~ 3 ¢ c ~ - ~ c~
J J '~ g ~ I ~J
C '~ V
f~ 3 J ~ J OC~
J ~ C' ~ ~ C~ C C~ C~ J ~ ,~CI
f3 r_ - r ~ ~ r ~ J _ _ _ _ ~ f~ ~ _r~ C _ 5~ _ J
U ~ J r~ J ~ ;~ ~ U J ~ fS .¢ ;~ r - U J 3 ~ U ~ C ~ J E- .~ r- ~ ,~
~ ~ J ~ rJJ ~ ~ ~J r,~
c~ r r ~ ~1 rJ ) ~ J
E~ r " ~ _CC ~ '~ J
U r r ~ fS J C ~ r~ ~ ~ r~
E- fS -I_' U r~ ~ fS-~
~ 5, r~ 3 ~ ~ c ~ -~ ~ J ~ r~ ~J r J ~ ~ _ ' C U _ J :~ ~3 ~' ~ ~ ~ r J ~ _~ ~ _ r ~ 7 5. ~.. _ ~ I ,) J

~ ,¢ ~ r3 ;¢ ~ ~ u J C ~ ~

f5 C -1 ,)~) C~ U Cl r E-~ U C C~ Cl C E-l ~r f l -~ ~J f¢ E~ :~J E- r . ~ U ~ ,~; V U fI E-- r~ r~ : ~ r ~ ~ ~ r r _ ~ fI ~ _ ~ f~ _ r~ fI r~. J ~ r cc ~ ~r r ~ fI -I ~ ' f~ ~ f¢ _ _ -~ J ~ fI
C J - - r ry Cl J ~J J ~ , fI
J J r ~ _ _ : u _ J ~ ~ J
,~ J ~ ~ ~ JrJ ~ J _ ~ J ~ J ~ ~ fI
c ~ r f¢ ~ )fl E- _E- U ~ ~r .¢ E-l ~ ~
r ~ ~ f¢ ~~ r ~ ~r r ~ fI ¢ ~ ~ J ~5 fl ~ r Cl , f~ ~ r~ ~ r C '~ r ~ J U '!
fI - _ r ~ ~ ~ ., ~ , rJ U ~ J
f~ I J r~ _fI :1~ J ~
_ ~ r ~ ~ ~¢ fI J 3 J
fI ~ ~ ~ ~ ~ J C~ ~ ~ ~ J fI ~ u ~

WO 97126357 PCTrUS97/00787 oooooooooooo~
o ~o ~ co ~ o ~~ r~ ~ o~D ~
O O ~ ~1 ~~1 ~)'Y ~ Lll ~DU~ ~o r~ r~l r~ r~lr~ ~ r l r J ;.) ~ ~ ~ J~ ¢f'~ f l rf5 - r~ ~f5 ~~ ,) r~t5 f~r5r _,~ 5 r, r: -~ J ~ C) ~ ~ C f5 r~ f~
: 3~~ r. f5 _ ~ 5 ~ r ~' ~ ~_ ~ _ f5~ f~ ~ 5 f' ~ ~
~~ ~ fl ~ r E-~ J ~ f- f' J 5~* u ~ ~ r r' ~ fl -J ~5 r '~ C ~ ~ C ~5 ~J ~ ~ f5 _ -I
f5 ~ C -E5- ~ 3 ~ ~rl Cr~ ~ f35 r~ fl :~ r ~ tC~ C ~ f~ ~I J ~
- r 3 C -~ rU rf5 f5 f' --I o C ~ L C5CV~ '~r~ C5 f' _ ~~

V ~J~ ~ C _ f; ~ ~r O rn r ~I J _ Clf'~~ ~~C ~ f' r~ ~ ~
J ~ C~ J E-~ -~ f' ~~ ~ E ~ ~

C ~ fC5r~ E~ Vr~ .- ~ ~ O
C ~~ .~~r~ ' J r: fl ~ V E- ~ f' 1~ U E-~
V f' r~ f C) V ~- OC~ ~,3 f~; O
fl - 3 ~ f' ~ f f5, ~ ~ ~ ~ ~
r_ J ~ f' -~ f' r. V ~ _ ~ u ~ O
r, ~ ~ f_ ~r~ L ~ r C~ f5 f' ~z ~z ~ rn E~
~ ~ C~Vu C J f5 Cl f~E~ U f C m rJ â
f5 V ~ ~J f5f5 fI V E-~ !1 J ~;rn C ~ - f5 V ~ _ ~f~
f5 f~ 5 _ f~ _ L ~ fl ~, 3 ~-r~
r_ - r ~, , ~ J - - ~ J H

W 097/26357 PCTrUS97/00787 o ~ ~ o . V ~ O ~ O ~ U~
O S~ O Ul U7 a~ o ~I v v ~ O o O ~ o O a) ~ ~ h 1' ~ ~
Z ~ O S~
~ V ~ V
H :~ O a) U~ O
~1~I S O ~ I S t~
V ~ P~ 1 V ~ cn U~ H V ~ Ul U~ C~
1 0 S O ~ ~I S In u~
r ,~ S ~D
o U? ~ O U~
O ~ ~ ~ -rl ~ O rl HV ~ V ~1 ~ H U~
tJ ~rS o ~ ~ h O
~Z ,~ S~ m ,~ a~ h S ~1 H t~ O O
,1 ~ ,~ _I oUl S ~ ~ ~ ~ ~ ~1 C) H 11~ 1 E-~ V ~1 ~) V
X ~ V V ~ V ' -W 0 971263~7 PCTrUS97/00787 rr, ~ ~ O ~ ~ h ~ tn O tQ ~1 V f~ f~, H E-l V f :C ~ U
~n V E~ V ~
u~ o a) P~ ~ ~ ~ ~ ~ ~ ~q V :~ ~ ~ V ~ V r~ X

~1 0 0 J ~ O
s V ~ ~ ~ , rt, ~i ~ ~ rn o ~ ~ h ~ ~ o S~ O
U ~ ~1 .¢ C.q E~ V ~ u~ H
V ~ ~ ~ V V ~~ ~ ~ V
~, ~ o ~ ~ o ~ o V ~ ~ V ~ ~ V VV E~
V E~ V ~ ~ ~ Vu~
~i 0 ~1 0 ~ O O ~ ~ O
H ~:~ H U ~ V ~ ~ H ~
U U~ H S ~ O ~ ~ t N
~ ~ ~ 0 ~I C~ Ul ~I n~ O
E~ ~ V E~ X ~ ~ ~ V
cn V ~ V ~ ~ V
S ~ ~ ~ o ~:1 U V ~ ~I H ~ E-~
V ~ ~ ~ ~C V E~

CA 02248638 l998-09-09 W O 97/26357 PCT~US97/00787 --l ~ o s~ ~ ~ o ~ ~ o O ~1 ~ 0 ~ 0 V ~ ~ V :>
O V ~ C~ ~ V 5: V ~ ~ ~ ~ cn ~ a) o ~ O ~
V ~ ~ P~ ~ ~ V E~ V
~:1 V c~ V ~ H E~ IS) ~, o nS Iq ~) ~1 ~ O ~ ~ V ~ o n~
h ~ ~ ~ o ~q ~ ~ V V E~ ~ ~ ~ V
5 o ~ ~ O
0 ~ ~ S 0 ~r ~ V v~ r V
O ~ O ~ U~ IJ Q
O b~ O ~ ~ ~ V ~ O

r ~ ~ 0 :~ nl O ~ al In ~1 ~ O h tO ~ 3 ~1 0 ~ ~ ~ 0 rC ~ s ~
~1 C~ ~ O ~ ~ ~ 0 _1 0 V
o ~ ~ O

o ~ ~ ~ o ~ o ~ . o o s~

~:1 V ~7 CQ V 1 Pl V

W 097/26357 PCTrUS97/00787 o :S lo ~ o ~ O _~ ~
V ~ ~ ~ r ~ H
h S~ V
r ~ ) S ~ ~ ~ r) a~
a ~ o ~ ~ ~ ~ V o ~ ~ n o V H C~ ~ S ~ r h ~Q O 1: ~ ~ ,1 0 E-~ V ~ ~ ~D ~ V E-~ H ~ r E~

O O ~ S~ ~ > tJl O ~ ~ ~ V S~ O
h r H H ~n ~ V ~ r D~ ~ O ~ O
H ~ ~ ~D V H

~ o ~ ~ ~ v v o h D~ U ~ r U~ ,¢
V U Vf~ ~D H P~ , 1 r H
O ~: O U~ O p~ O
V P~ U ~ U~ Cq r ~ o ~ ~ o ~ ~ C

H V ~ U~
V cq c~ V r ~ .¢

W O 97/26357 PCTrUS97/00787 o ~ ~ o bq O ~ ~ 0 ~ ~ a) .C ~

~ o ~ o ,:1 r c~ H ~ U
~1 0 ~ O O
H E~ r ~ ~7 ~ W t~

tn r: 5 a~ O ~1 ~ ~ ~ ~11 o u~
H C0 > ~
t~ ~I r~: r~l 11~ N ~ ~1 ~ ~ ~ o al 'C S t~ U ~ ~ ~
O ~ ~ O ~ S~ O

u~ o ~ o ~1 ,~ r ~ ~ 0 V Et co V
h ~ o cn c ~ ,1 ~ o m E~ ~) H ~ CD l¢ H ~ U
V u~ h tn u~
s~ o tn ~ ~

s s co a) .c W 097126357 PCTrUS97/00787 o o o o o o o o o o o o o CO ~ O ~D ~ a) ~r o ~D r~
r~ r~) r~

V ~ ¢ ~ V
V
r_ ~ f _, _, E~ V ~¢r-) ¢ ~c~ J
3 ~ C C : . C ~ ~ O
- -I ~ ; ' ~ C~' V
J ~ ¢
r ~ ¢
~- -J ~ 3 ~ J - ~ ~ ~ t ' 3 r~ _ U ':
3 r~
O - v ~ ~
: _ r~
i~ H _ C ~ r~ c _ ~ ~ l3 ~ r ~ a ~' - ~ ~ 3 ¢
n ~ ,_ rn ~ ~ ~ ~ r~ ~ ~ ¢
,~ ~ J ~ ~ ~ c O J: ~ ~ z ' _ ~
Z; - R O ~ r~

O~ z ~- ~ ~ ~ ~ . ~ ~ J ~ J
3 V r ~ ~ v ~ :~ a o J ~ t ~ ~

O ~" ~ O - J ~ ~ ~ q 3 _ ~ c ~ c ~ ~ z ~ ~ ~ ~ r~
U ~ ~ O U ' ~; Z ~ n E~ Z
o ~ ~ _ t H ~ C -~ V
ot ~ m u ~ ol ~ ~ i,3 ~ u ~ ~
rn ~n ~ ~ ~ U ~ ~ ~ r~ v ~ I¢
o ~ , , , C ~ 3 v J -~
- ,c ~ -~ X ~ ~ ~ r H - ~ ~ , ~ - : ~ ~ _ r ~ _ I¢ ~ u ~
- ~ v ~ ~ ,¢ ~ r~

.....

W O 97/26357 PCT~US97/00787 o o o o o o o o o o o o o o o o a~
~r o ~D ~ 0~r o ~D ~ CID ~ O ~D ~ rD ~ ~D
r~ o~ rs~ o o ~~ r~ O r~
~~ r~r~ r~ ~ r~ ~Ir~

t? ~ J_~ J

~ _ _ r ~ , ~ ~ C,~
J a ~ rC,~
r~ J ~ _ ~ r-C C
C f~ ~ rr ~ ~ ~ J 7 ~ -,~r.

r C, ~ ~ J ~ J ~ ~ S
C' ~ r~ ' C ' ~ ~ ~3 .
V J ~ rJ ~ J E~
~ r~ :.) r-C ~ J ~ r C .~ ~ r~ r~ ,5 C :~ r~ ~r ) J ~ r V
~¢ ~jr~ :~ r~:~ r.~ ~, , r~ h ~ _ : , s r _ J _ ~: .5 r J .~~ ~,r. ~ J
J ~ ~ J_ r~ ~ 3 ~ J
? r~ r r ~ r rJ rJ t t; 1 J E- ~ r ,~ ~ J ~ r~ r J ~ ~ r ~ ~

3 ~ ,5 3 ~ rJ
r~ rJ ~ ~ ~ r-~ ~ ~ r~ ~ ~ ~, ~ ~ r- r~ ~ ,~ ~ ¢ J
t ~ 3 ~ ~ r~ ~ 3 a ~ 3 ,~ L - ~ 3 ~ S f ~

~ 3 ~ ~ c3 r W O 97n6357 PCT~US97100787 o V
o s~ U~

o ~ ~ ~ ,1 ~ ,1 , V ~ r~ V ~ 'I ~ ~

h ~ ~ o ~ O ~ V
o _I o ~ . O ~ aJ ~
V ~ ~ V
z ~1 ~ u~ 1 o a~
m a 7J H I ~ O U~
~-~- V O~ ~ V V ~ ~ t~

O~ Z
Z - E v ~ o ~- In O U? _ ~
o~ z ~- t h ~1 U~ ~ ~- ~ ~ V t 5 ~ ~ O i ~ ~ o S~ Q, ~~- Z ~ - ~ ~ o ~ ~1 ~ O .~ U~
OV W l¢ o ~ h O CJ Q. a) h ~ :~ C~ h ZZ ~ Z U~ i0 h al ~1 o O~ W ~ H U~
H
~ol ~: m ~ ~ o~ Q o h ~ al a) O
W ~ ~
j~ ~ V ~ V .¢ H ~1 O
Z-- X ~ V ~ E-~ D V ~ .¢ V
H
--W O 97t26357 PCTrUS97/00787 o~ o ~ o ~ o V V ~ ~ ~ ~ CQ
V ~ V ~ E~ ~ ~ V a c~
~ ~ tQ O ~ O
u~ ~ ~ O~ S ~ ~I S
~a o ~1 _~
~:1 H ~ ~ ~.7 V >
O ~ O ~ O (I) ~
rl ~ ~ U~ ~ ~ ~ ~1 ~ ~-I ~ O S S
~¢ I¢ U ~ C) U t~

h to ~ ~ ~
,I r h ~ h :~ h m o u~ h h h ~ _~ O ~ ~ :1 ~ h o > ~ V ~ V V ~n ~ ~ ~ v V V N 1~
aJ o ~ h ~q O ~ ~ Q~ :~ ~ O h S u~ S
~ U ~ V ~ ~ V

E~ ,~ ,i H S U V V (~ V :~ H ~ I¢
:~ C o ~ h h ~ ~ o J~
S ~ d S ~ ~ ~ ~ aJ

q S a~ h 1~ ?~ ~ ~
C~l H ~ 1 V ~ ~ ~ ~ V
O ~1 ~ O
V V ~ V V ~ V ~ ~ V
o u~ ~ ~ ~ h ~ h h ~ ul h ~ ~ S ~ ~ ~ h ~ :> ~ o C.
P- ~1 ~ V V E-~ H ~

WO 97/26357 PCTrUS97/00787 ~Q O
q o ,~
~ V
H ~ U~ V ~ ~ E~ ~ ~
~:: o ~ tas~ o ~ v .¢ ~ H C~ U).:1 ~ 1 ~ V :~
:~ ~ ~ ~ ~ ~ U
a~ ~ o ~ o u ~ ~ ~ a V ~ ~ V ~ cn ~ V ~
. O h ~ Ul V ~ U~ V
h ~, ~ o S~ o t~ s ~n ~ ~ ~ ~ ~ V ~ ~ ~ n P~
~ O S~ tu OJ _~ tn _I ~ a) r rn ~ ~I r8 t~
V ~ U~ V [1~ H ~ ~ Ut U ~
O r nl al u t:n ~a) o _l ~ at ~ Z ~ R
H ~t ~ ,cl tn ~ H - a~ a ~
Ut G) ~J la~ O ~ ~ O O~ r z ..

h O ~ ~ ~ 0 Ul O a) H ~ C ~ O
~ ~ t~ 0' t.) ~ ~- ~ ~
t;n ~1 V V v H ~ ~ H > O ~ z ~ 0 O
1 ~ m UJ ~ tJl O ~ t~ ~ C.) 1~3 ~ ~ O
v ~ ~ ~ ~ v ~ ~ o ~
H ~) o ~ v s~ O E~ 01 ~ ~ U
a)(U ~u ~ ~ In ~ ~ ------~ cn u ~ ~r p~ ~n n _I o ~ u --I Q) S-l_I ao 1~ ~ UJ ~J ~ ~
~ ~n ~ V ~ ~ V ~r z -W 097/26357 PCT~US97/00787 ooooooooooooooooo ~D N ~ ~ O ~ N r~ ~ O ~D N r~ ~r O ~D N
,~ N ~ ~ ~ ~ ~ ~ ~ r r~ r~ ~ ~ o r ~ ~ r~ _ r ~ c r~ ¢~
3 ~ r r~ , r~
? ~ r ~ -c ~ r ~ c ~ ~ ~ r ~ r~ ~
rJ ~ ,~ rJ r ,~
r ~ ~ - ~ r- r ~ ~ ~ r r r r~ r ~ ~
r- ~ rr r~~~

N :~ ~- ~ r_ _) C~ ~ ~ O J C ~~ ~ ~ C rJ
J -~ "--~ . !¢
z ~ r~ , ~ J) J

O~ V C~ r- ~ '¢,~ E¢~I ~C -~
¢ Ci ~~ ~¢ ~ u ~~ u ~ ¢ ¢ ~ ~¢
u - ~ r ~ r~ ) rJ ~1 z ~ ? ~, ~ ) r~ - rr O C r , _ I I ~' ~ _ r r ,~ r, J

--r~ - ¢ ~ u y f ~ r~ J .~ J
¢ rE~ u '~ Ur~ -' rr~ r~
J U ~~ ) r~ U7 :7 -J r E-U , ~ r~ r~
Z ~ ~ J~ ~ r_ r_ r~ ~ ~. J~ ~ 3~ ,¢ ,¢ r E-:~ C~ r ~ r3 r~ r~ C
rJ~ i~ E ~rE?.~ 5 ? ? Cf~ y_ r U ~ u rE?
-,~ - U ~~ r. E- r '~ r/ ~r,:~ ~r~~ E ' r.
" r ,'~,~ C ~ -' ~
r J ~ r, ~ ~r_ W O 97/26357 PCTrUS97100787 oooooooooooooooooo co ~ o ~ ~ a~ ~r o ~ r o ~D ~ ~) ~ O
o ,1 ~ ~ ~ r~) ~ m u~ ~D ~ r a) c~ o ~
--1 ~ ~ ~1 ~1 ~ ~1 ~1 ~I r-l ~1 ~I r-l ~I r~ ~1 ~ N

~ ~ ~ r~ c ~ ~ r~ ~ r- ~ ~ r~ ~ ~ r~ r~ r~
r_ ~ r~ r- ~ ~ ~ r rr r~ rr r J ~ r_ ~1 _ ~ _~
J ~ ~ ~ ~ _ J _ r -- ~ _ 3 J ~ ~ J ~
r J ,~ ~ ~r, r~ r ~ ~r~
r 3 ~ ~ _ r~ ~ ~ ~ ~ C J
J ~ r~
r 1 rJ C
~ ~ r r U ~ r r~ ~ - r~
_I r_ _ ,~ ~r,~ ) ~ r_ -,7 'O ~~ 1 ' rJ
r ~ r~ r ~ 7 C _ ~ ~~ J _ ~ r~ r J I I _ J ~ ~' S ~~ ~ J
J ~ r rJ ~ ' _ _ C ~ ~ '7 ~ -~i7 ~ ~7 C1~ r S rr ~ ~r~
rJ V ~ ¢ V V ~ r ~ ~ v IS Vr7 V V
r~,~ _r~ r~r~ r~ E-~ ~ r~
C ; ~e V ~ ~rJ r r JI J ~ _ r ~ ~r , ~ ~ V r- ~ r ~~ ~ J - ;'7 - _ I J C r~ - r ¢ ~ ~ rr r R ~ r~
7~ rS _ r c r. ~ r ~ J _~: _ '7 !7 ~, :~r~
C~ J '7 '7 _r~ ISr~ ~: r ~ r ~ r rr 17 r~7 -:~ r u v J V :~ rJ~S
~7 J~ r ~ 7 .~ ~r~
~ ~ ~r r r~ 7 r~ 3 ~ ~5 r~ ~r~r~ ~ r~
7~ C J
'7 ;'7 ~ ~ - '7 ~ ~ C ~ : ~7 ~ _ --~ r_~ t ~~ r ~; r ~ s r~ 7 C ~~ _ r ~ V ~ ~ ~ r- r ~ C r ~ r~
~7 ~ ~ r_ ~ r~ r ~ ~ ~ r r 3 _ ~ ~ r rr ~ ~ -~ _ - ~ r~ ~ r_ . ~ ~ 7 1 L
J , _ r. I J V ~7 ~ ~ _ rt- - _ - ~ c C 7 C ~ -r ~ r~ _ ; , r~
~ ~ ~ J _, -I f~ --I r ~ h ,~
rr ~ J ~ r ~ ~ ~ ~ ~ r J ~ ~ C ~7 r ~ ~h r~ ~ ' r~ ~ ~h _ r ~ J ~¢ r J
r, r~ r, t,7 ~_ ~¢ ~ U ~ ~ :J ~ r~rJ l¢
J ~ ~ - ~ ~ rJ ~ ~ ~7 r~ C ~ ~ r~
~ I V t~ J ¢ r~ ~ _I r r~ ~ .
_ J ~ - r 1~ ~ ~ _ ~ ~ ~ rJ ~
_~ ~ , J_ _ ~ ~ ~ r~
r~ ~ _ J h -~ 17 ~ ~ I ,7 r~ . J _ : r~ ~ J ~ ~ ~ 7 r r _ 7 ~~:1 0 - ~ E~ -I r.~ ~ - h 3 C ~ hE-~ ~
~ V ~ ~ r J r J ~ ~7 1 ~ ~ _ V ~ J

CA 02248638 l998-09-09 o o o r m ~~ ~ ~1 o ~ ~~ ~ ~ m u a ~ J ~ ~ ~ o s~
a ~ a a ;~
o O
~ ~ ~ r C~ E~ ~ ..
N 1~
a :~ V ~~ o , :) V a~
O ~~ G

o ~ r~
J ~- ~- O 0~ t) V V ~ ~ t~
n ~ ~
r l r1 r ~ .. -~ ~ ~ S .- a~
~ ~ V O r. -rl -rl 1'~ ~;
~ ~ z - ~ ~ a o ~ r~ r ~ ~ r~ O
~~ r~ Ul ~r -~ V V U~ ~ r F~ H - U') O U~ r- ~

J c_ I 0~ Z ~ ~ ~ ~ r~ G) - ~ a' ~ r ~- ~ ~ V r J ~ C a o J t~ J ~ ~_ E-~ ~ ~ Z ~ _ rJ~ O O S~ r-l r~
~ r J ~ O zv ~ ~ ~0 a' ~ ~ a' v ~; -I ~ Z Z ~ E-l U~ ~ ~Z O r~ a) Ill r-t r~
H ~ H U~ V ~7 a ~: m tJ a ~ ro o ~ ~ ~ ~ ii r-l r~ G) ~rl O h r~ f~ V s ,c ~ J ~ O ~ ~ J.~ ~ r ~ -rl X s H
J ~ r~ H
J ~
N
J E-l CA 02248638 l998-09-09 W O 97~6357 PCTAUS97/00787 O ~ O
f3 V V ~ ~ ~ N ~ t~
V a~ 1 V ~ ~¢ ~ V V ~ N ~:1 ~ a) o ~ ~ o S~ o V - H ~I H ,~ ¢ ~ N
~1 0 :~ N rl ~1 ~1 ~1 U~ O ~1 ~ ~ ,~
V v~ V ~ H
5~ ~ u~ o u~ lQ O

;~ ~ 5 O ~ ~ ~ ~ ~ o o ~ ~ h a~ V ~ V ~ V ~

u~~ o (~ ~ h ~ O
~\ ~ :~ s ~ a) ~ o ~ ~ ~ _~
V ~ ~ ~ E~ ~ ~ ~ V ~ ~ V

a) o ~ q O
E~ h U
~1 ~1 ~ C~ h ~ J Ul F~ 0 ~ V ~ h ~ ,~ H 5 U V V ('I V
a3 h o h ~ O -~ h h _I o o .C tQ ~ ~ S
u~ H h ~ C --~ V tO h h V H ,¢ ~ ~n H V ~ ~
O ~ ~ ~ ~ J~ O ~ ~ ~, E-l V~c~H ~1 ~ V V .¢ 5 ~ ~ V V
>. h ~ h V V ~¢ U P~ H ~ V V h H ~ ~ h CA 02248638 l998-09-09 o ~ ~ o U~ o ~ ~ o ~ o ~ ~

o :~ o ~ o ~ IS O
.C ~ ~ ~ r~ CO C

~ o m ~ ~ ~ ~ o s~ o ~ O S~ o 3 ~ ~ O S~
C!~ P~ U~ IYl .¢ C~ H ~ d~
o ~ o h ~ ~ ~ H
H ~ ~ V h u~
o ~ Cq o H ~ ~U7 ~'1 ~ ~ C) H ~ ~ H
r ~ ~ h ,~
3 o ~ h ~ o ~ ~ o W 097/263~7 PCTrUS97/00787 ~ o ~
N ~ t_ ~r . . ~ - F~
a ~; ' H H
cq ~ F.
n ~ r n ~ n ,1 n ~ ~ n ~ -rl r~
~- ~ U ~, S ..
OJ: Q~ ; O ~: Q) ~ u ~ o Z - v~ Q:) :z - ro Q ~ ,~ Z ~ u~
a ~ n-~ rn-, ~ ~ a I ~
H _ Q cn _ 1 F~ H_ Q rn ,- 1 _ H
01 F ~ Z . . r F~C 0~ F t-- ~: ~~ r ~ Ol F t~l ~n t a ~ F~ ~n I .. a ~ F; ~n F ~-:~ a o E~ c a o ~ v E~ z; ~ a ~ ~ F.~
O C~t:3 F-~ O ~ O ~ ~ Fl O ~ O V
CJ ~ ~ E~ O ~ ~ O ~ ~ V
Z Z ~ ~ rn ~ z ~ Z Z ~ E~ ~n E~ Z ~ ~ Z Z
O ~ ~1 ~ O E~ O
H ~ ~ ~ ~ ~ ~ ,~ H ~ ~ ~ ~ ~ ;~ F.~ ~ H ~ ~
E-~ 01 F~l m ~ ~ o~ 0, F~ m c~ a ol ~ ol F~
F~ ~-- -- -- -- W F~ ~ -- -- -- Iy F l~ ~ --rn ~n ~ ~ rn ~nFI ~ ~ rn Ul O ~ ~ ) O ~ -- ~ ~ O
r1 ~D ~rl rl '~ ~ -rl -rl tJ ~~ ~ rl C~) ~5~~ X ~ Z ~ X C- ~ Z
H -- I H -- ~ -I H
~ _ ~ _ _ , _ CA 02248638 l998-09-09 U~
N t~ t~

Ul ~ ~
O Z Z
H H H
O~ h a O~ O~
r- W ~ rl r- ~i r ~ -rl r~
rl I _Ip~ rl ~ ~4 -rl 1~5 u z o J~ Z ~o 1~ 1 u Z
r tn r ~l F~ ~ ~'q '~ Cl~ r _~ ~ L R, u~, ~ E~
IL U~ r~ H _ a u~ , 1 H - a Ul r- 1 F C
r- W U ~ ~ r-p3 ~ V _Ul r- W ~ ~
!z ~- r C) 01 F ~ Z ~- ~t U01 f t~l Z ~- r E~
~ ~ ~ O r ~ ~ W
1~ ~ P. W C ~ W Z W ~ ~ W _ ~~ Z W ~ O ~ ~, ~ E~ O U ~ U W ~ E~ O U J U W ~ E~ O ~J ~
E~ u~ E~ Z C o Z ~ E~ ~ Z /~ o ~ r ------ ~) E-~ H p ~_ p _ H~___ ~, ~ r~ ~ J
-- j O -- -- ~ o rl _~ z r~ X ~ Z ~ X
-- rI H ~ ~ H ~ r ~ , _ CA 02248638 l998-09-09 W O 97/26357 PCTrUS97/00787 ~ ~ ~.
O O fl Z :z fS
fl a r H H r_ fl U~
.. .. ~a, O! .. .. ~ ~L 01 r' c~ n-,l ,- W a~ n-,l _ ~ o ~ ~ ~ ~ , r~n ~ J ~ ~ ~ ~ v ~ ~ ~r~
~- ~ r~ -, ~- r~ ~- ~ V -, ~- ) ~- ~ o -, o ~ ~ u z r-o ~ u ~; ~ o 1: a) ~ b~
Z ~.q o r~ ~z; tO O
(15 rj ~- -Ir~ ~ r~
aQ ~I ru~ R Q-rl cn r , ~ a I ~ ~~ rn ~, Ha u~ H a ~n,- ~ , H - a ~
0~ . N z; ~- ~ '' ol , ~ z; ~- ~ ~ o~ , ~ z ~-a ~ ~ ~ a ~ ~ ~ a ~

V~ f 1~3 C) r~ n f ''~ C~ r. '!1 rn ~ :: a o ~ a o ~ a o P~ ~ -- ~ P' ~ Z ;~ P1 ~ E~ ~
O C~ f. O ~ O r~ l O .~ O r~ ~ O
O V -I V ~ O ~ Jr_) ~ O
z z ~ ~ u~ E~ Z ~ Z z ~ ~ ~n E~ Z ~ z Z ~ ~ rn O ~ li3 ~ O ~ ~ ~ O ~
H ~ H ~ ~ ~ ~ ~~) ~ H ',~ ~ ~ ~ ~
E~ a rS m rJ a a ~ E~ o~ fS m r~ ~ ol ~ ~ O! fS m v a f~ ~ -- -- -- -- ~ ~ ~ -- -- _ -- ~ f~l ~ _ _ _ _ ~ rn cn J ~ tn cn ~f~ n O --~ ~ J o ~ ~ ~ o Z -- X - Z -- X r ~ --H -- ~ H -- ~ H
~ ._ CA 02248638 l998-09-09 o~ r~ CO
~r ~ ~

"
5' 5 t~ ~ _ FS
O ~
I r '' F5 rr~
O r~
Z ~ Z ~_ _ a ~ a C a H ~ H ~ H
o~ a ol c ~ ~ ~ a ol J ~ ~- ~
rl ~ rl FS --~ ~ -rl .) r ~- C ~- '-~ U
Z ~ o ~ Z .~) O 1 a) ~~ u z C o r. a O J Z ~ rJ~ a ~ J Z ~ u~ O C Z - ~0 ~~ ~ t ~ 'J t ~
a ~ R-r rn-- ~ ~ a ~ ~-, rn-, ~ _ a ~ ~-, H _ ~ H _a rn ,- ~ ~ H _ a _~ O~ F ~ Z ~ ~ 01 f ~ ~ ~ ~ t ~ 01 F
F ~- ~ t~3 C~ - ~3 C
~ $ ~ o . ~ $ ~a o J I C~ ~ _ !~ Ct~
--O C~ 1~1 O -I O C~ ~ F~
U _ c ~ ~ o ~ O ~ ~ C
Z I S ZZ ~ ~ rn ~ Z ~ Z Z ;J F:~ rn E~ Z Z
f5 H ~ H
~01 f5 E-~01 f~ ca u ~ ~~ ~ s~~~ f~ m u a ~I fC ~ o~ fS m rn r ~ rn rn '~ 5~ rn u~ rn ~_ C~ 5 r-l ~5 ~ .r~ ~rt S ~0~ r ~o X Z -- X - Z -- X~5 Z
-- H -- 5 H --_ H
_~ ~ f5 ~ _~
~ ~ r~

CA 02248638 l998-09-09 W 097/26357 PCTrUS97/00787 Ch, O) I~
d' F~
r~
~) y r~ -I r~
~- FI ~- ~ ~-O FI Oz ~ Oz C ~ H
C C~
a o~ a ol ~ ~- ~- 5~ a~ a w ~ n-,l _ w ~ n~
~Q FI r~ n ~ ~ ) n ~ ~ ~ - ~ ~ - U ~ s ~ ~ r ~ ~ ~ ~ ~~ . .
Z _ O J~ Z _ O J~ Z
O J Z ~ 10 a. O ~ Z ~ O
n ~, ~ R-r ~n ~, rD- 11 ~ H - a n,- 1 ~ H -a ~n_ ~ W ~ _ W _ F~
z. . ~ ~ 01~ ~ Z ~ ~ 'r -~ 01 F t~ Z ~ ~

Wn ~ a ~ rWn ~ ~-~w C P ~ ~ ~ c a o~
W Z P-~ ~ W -l ~, Z; W L~ ~ W ~.
E-~ OC.) FI ~ W ~ E-' O ~ ~ U ~ ~ O V FI
~n ~ Z; FI Z Z m E-l ~n E~ Z ~ Z z ~ ~ ~n E~ z c w ~ o w w :~
t~ ~ 01 E-l E-~ 01 F~ m c) ~o~ ol F~ m ~ Q o _ -- W F~ W F~ W -- -- _ _ W
rn ~ ~ ~n ~n ~ n ~n ~ ~ o ~ ~ 3 o ~ ~ 13 ~,1 - ~ ,1 -,1 3 ~ -,1 ,1 F~
X ~Z; -- X -~ z -- X '!~
-- F~ H -- J H --C ~ r~
-- ~) -- J

.

CA 02248638 l998-09-09 W 097/26357 PCTrUS97/00787 rl ~

.. ..
Z Z
H H
Ul U~ U) h a oZ v ~- ~- ~ ~ o~
~D n -rl r- ~ r n -,1 ,- ~ co cn -,1 ,-n r ~J r~ n :~ ~ U ~
~ rl ~ H Q~ rl ~~ ~ u r ~ ~- h U -,0 'J: C) (11 U Z _ O I O ~ u z ~ O c~
Z - C'~ O f Z Ul O ~ Ul , cn-, ' ~ p ~ ~, ~n -, ~ n -H _ ~ cn ,- ~ ~ H a ~n ,- ~ ~ H E- ~L cn ,-H r~ ~ O r-l ¦~-- ) C, _I r ol ,: ~1 I z ~~ r C, 01 ~ ~ ~ Z ~- ~ f~ O~ ~ ~ '' Z
~n ~ cn ~ n I ~- P ~
f~Z ~ p ,~ L J p~, ~ ~ z ,o~ L ~ ~, I Z ~. ¦
O ~ ~ ~ O ~ O ~ ~ ~ O ~r O C~ ~ ~ O
~1 Z 0. o' P. I:~i J ~4 ~ Z ~4 0~ ~ ~ - ~ ~i3 Z ~ C~ P~
U ~ ~ E~ O U U ~ O U I U ~1 ~ h O
O Z ~ cn E~ Z ~ Z ~ h cn h ~ o ~ 1 h cn E~
h ol ~: m û ~ 0l ~ H o~ ~ m û p ol ~ H
~, cn cn ~ s cn cn K J K ~ K
o ~ ~ ~ O --~ -- J O
rl -rl _~ ~ ~rl -rl J ~ rl H ~ ~ H ~ _ H
-1 -- .~ --W O 97/26357 PCTrUS97/00787 rl U~
r~ t~

O
.. .. ..
Z Z Z
H H H
~q ~Q tq o~ c ol ~ a ol ~- ~- ~
~ ~ r ~rl r- ~ O n ~rl r- ~ r~ n-,l ~ cn ~ ~ n ~ ~ ~ ~
~ rl -- ~-rl ~ Q~-r~
Z _~ O r: tl) ~15 Z O L ~ Z O L O 11 O ~ Z ~ O ~ Z -- U~ O Z - U~
-~ ~ a , ~, ~n- ~~ ~ ~ 7 R ~, ~n-, ~~ U ~t ~ ~ ~, rH _ ~ cn ~ 1 ~ H _ a u~ H _ ~, y ~ot ~ ' Z '' 'r ~ 01 f ~ I Z ~- Y V 01 ~ (~'t r. ~tn ~ ~- ~ V r. U ~n ~ ~- ~ V r ~ ~ ~ ~-U ~ ~ o I ~ O
U ~~ ~ ~- ~ ~ u E~ ~- ~ ~ U E~ ~-.~ OV ~ ~ O ~ O V ~ O ~ O V
U ~ ~ Z ~ E~ O U ~ U ~ ~ O U ~ U ~3 z ~ n ~ ~ ~ ~z ~z ~ ~ cn ~ z z ~ : o~ O [~ ~ ~ o p~
r~ H ~ _ _ _ _ r,~ ~ H ,~ _ _ ~ ~ ) H ~ ~ _ 0~ 01 ~ m u ~ o~ ol ~ m u ~ ol ~ ol ~ m ~n U ~ In cn c~ ~ tn cn ~ cn X C ~z ~l . - O
-- J H -- _ H --:~) H
-I N ~ N ~ N

CA 02248638 l998-09-09 W 097/26357 PCT~US97/00787 ~ ,1 o oo N N ~Ir~

~ Jr~

., .. _\;~ S
H N r'~) ~r ~ ~ r, -~
.. .. r r o o o r z z ,, U~
~_~ H h H _) f l Ul ~rl ~ ~ f~
r- tq N n rl r- 1~1 ~) r ~4 r- W
t~ ~n ~ J ~ ~ ~ ~n ~ a ) rn ~ ~ r u z O ~ ~ u z o J a ~a u z 3 o Z - U~ ~ ~ Z - R O ~ U f~
r,. ~ ~ I ~ ~ r rn ~r'~~ V ~~ .a ~r rn r ~~ ~ ~ N ~r ~n r -~ J fl f~
r- 1U H- ~ ;n r- ~ V O _ N r- _ V~ f~
~ nI w v r ~ rn ~ w v u 7 ¢ E~
Z ~ ~1 ~ t~; r ~ ~ 7 ~S E-~CI O ~ OC~ W fS O ~1 0 t~ lli ~ O I ~~

~Y t4tili~ 1 Z t4 tlc t4 ~ Z t4 t~ t4 In ~Z :1: ZZ ~ 1~ rn E~ z rZ Z .~ rn E~ Z ~ ~ r~
W~ Opil Wr~ O ~ f~
~ ~ ~ fS H~1 ~ ~ ~ ~ ~ ~r~ H ;~
U ~O~ O~ IS tl~ U ~ 01 ~ f~ t~ U ~ ~ ~ ~ j _ _ ~ f l ~ ~ ~ ~ ~ W fSli l W
rn~ ~rn rnc.~ ~ rn rn J tJ t~
~ O~ ~c: o ~
rlJ ~~rl -rl ~ 1~ ~rl~rl Jf ~ --X~ Z~ X ~ Z ~ X ~f~_ ~ H ~ _ H ~ Ir~, r~ _ _,cr ~~ N J N ~r.r~J
J ~ ~ _ r~

W O 97t26357 PCT~US97/00787 ooooooooooooooooo~
O ~ ~ O ~D ~r~ ~ O~ r o In m ~~D rrr~~ a~o o,~
~1 ~1~ ~I r-'~ f~rJ E~ 'J
3 ~ __ ~ rl3 r.~ f r -I -~ J I - -~ -~ ' r~ r _ ~ ~ _ -l_ -I - - f ~ ~ r~
J ~ f ~r~ r ~ J~: ~ ~ f ~¢ _ -l E~~, ~ _~ f"~ , ~ f U ~
~ J~ ~W ~r .r.~ c, r~
~5 ,f~ r ~ r~ ~ ~ JI ~ -r ~ ~ --J
,~ r3 ~ r~ ~ r ~ 3 ~ ~ J ~ c - r~ , -r r r ~ ~ c ~ r~~ 3 ~ 3 r u c ~ f~ r~ f~ 3 -3~ 3 J c ~ r ~ -r, ~ ~ ~ r ~ ~ u ~ rJ ~ , J
r 3 r c~ v ~ r, r~ cr3 r u r- c - u u r~ r_ ~ u ~ v ~ c~
u ~ ~ u r ~ c :
r E- _ 3 ~ , C ~) ~ ~ E- C
. .~ r~ _ r ~ ' ~ ~ ~
f ~ ~ ~ J C_ _ ~ 3 ~ : ~ _ _ _ 3 J J ~ ~ -r r~ C ~ 3 _ r: ~ ~ r r _ c ~ r ~ r ~ J ~ , r~ c - ~

U '~ Ci ~ U -~ rJ ,~ ~
J J ~ - ~ _ J ~ ~ r~ -- u ~ - ~ ~ ~ ~ 3 r~
- ~ r r f ,~ ) r' _ ~ f J
J ~ ~ r _~ J 3 _I J r _ O f:l r r r u ~ ~ ~ ~ ~ 3 ~ ~r ~ r r_ c, r~ U C ~ r r _~ ,f ~ _ rr' r, ~
r r~ J ~ ~ ~ r~ J c~ ~ u ~ ~ t J
f~ r~ r~ ~ r J ~ J 3 ~ -~
r_ f' ~ _ ~ 3 ~ ~ ~ ~ J
c, 3 ~ : J ~ ~ J ~ ~ ~ _ - J
C, ~ J J r J ~ J ~ ' ~~ :) _ _ _ _ _ a _ ~ ~ r~ ~ ~ _ _ _ c _ ~ r _ ~~ _ r ~ ~ r, r C ~ C, C, E~ ~:1 3 ~J 3 ~ J ~ ~ U
C3 ~ ~ - U V ~ J r ~ c ~ u ~ r~
C ~ ~ ,1 J' J r~ r ~ c~ 3 ~ r ,~ J ~ r ~ _ _ J J _ _ ~ ) _ ~t fl ~ V :~ ~ J . _ ~ J ~ _ r f t J ~ J ~ ~ ' : J ~ E~
J J ~ l 3 J ~ : ~ r u J ~ C3 ~ _ ~ r :~ 3 3 F~ 3 W O 97/26357 PCTrUS97/00787 o c~
~ ~D

E O,. ~. ~ L ~ , I . E O

H ~ r ~ ~ ~ u m û î~ ~ ~ m~ ~ m ~ - ~ 3a ~ m u ~ ~ ~ m H rl ~rl X -- J ~ ~ X

,~

W O g7/26357 PCT~US97/00787 O <J~ O

~r ~ ~
- r' ~_ Cl C C~
~C -E~
E~
I~ r ~U
U
_ p~ r~
O ~ = = r~ O ~
Z ~ ~ Z J
11 11 ~~
H ~ D ~ l~J ~) r~ H
~ I ~
01~ ~ 01 ~ ~rl _ J ~ = _ ~ O ~
¦ U)Z ~~ O ;~ U -r ~1 l ~ ~ ¦ r~ H ~ Z ~) v 11)0 -~ Z ~ o -~
R, ~ -,1 ~ ~-,1 ~ ~ R
E ~ 1 ~ H ~ a ~ ~ E ~ ~ E o o ~ ~ O r -~ Z _ ~ ~ ~ ~~ Z Z~ ~; Z
W O r J V~ 0 H ~ O H
X ~ . ~ ~ ~ ~ O
O ~ ~ ~cl; 0 1~ I r ~3 ~ C' V V ~ ~ E~ O ~i ~ C' E~ C E~ U J
z , Z~ n E-~ O P~ Z ~- O
~) ~ ~ O
m O~ v ~ a ~ m v ~ ~ ~ m ~~ ~ m ~O~ ~
v K J
3) 1~~ I X X --1 ~
--I X ~ :~ Z -- ~ X _) t~ _) H
_l ~ ~

E-~ -' -- 3 W O 97/26357 PCT~US97/00787 ~1 o t r~rr t Il .C,~
-~
r l?
~ ~ ) - ~1 0 ~
',1, t~ ) ~ C~
'D . 'O D ~ r~ H
Ul ~1 ~ ~ ~ 111 ~1 Ut a ~ ol ~ t;~ a t? Cl t -- t ~ ~ -- -- ~ ~ ~ ~ ) t -~
~, t~ t~a 'D Z 1 ~ ~ f~
., o ~ ~ o t, ~- ~ ~ ~ ~ r~ .
O ~ H a~ t ti-l O Z E- ~ O ~\ t~S Oq Z -- tIt t~ E~ Ut O ~n E-l Ul O fl C Z t/.t ~ ~ .0 ri ~- ul ~ f~ t~ ut . ~: t~ . --t fI f' ~ ~
- a , Q ~, ~ ~, ~.~ ~ ~ R ~.t ~ ~ f . ~ R ~, t~ ~ .- E ~ K E o K ~ fI C H a U.
O r ~ O r ~, O, f ,5~ ; z ..... .. .. ~ , E, ot , ~ Z
a ~ ~ z ~ ~ z ~, ~ ~ ~
U~ 1 ~ O H 113 0 H 1: E~ ~, t l.t f ~ ~
~ ~ t~ o ~ t~ ~ t~
-~ K U E-' ~- z ~ ~ E- K ~ K ~ K
~0 ~ vz ~i ~f~ O ~ fl ~3 fS f r o ~, E~ O ~ f~ c E~ ~ f~; c E~ u ,t u 1~
~ O Z ~ ~ un ~ ~ Z ~ O ~ Z ~ O Z fI ~ O ~ ~ ~ un E~ Y f~ m u a ~ f~ m a f3 f~ ~ a ~t c ~ ~ o~t f~ m u n ~ ~ ~ u ~ n -~ K C ~ K
O---- -- -- ~ 5 0 ~1 X X ~~ ~ rt Z--rl rl X r~ I Z
¢ H -- -- -- ' H
:J ~ ~. _ ~ ~i f -1 -- ~; t~, --o , dl I f~
'~ 7 r.

r--a c ~ ~1 JJ
._ _.
! ~~
~r ~

_Io Il N 11 ~ 11 N
d ) ~ ~~ tD
AD : ~ r' H~ 11 J_) ~1 - o r~ J ~ rn ~1 0 r~
- r~ 0~ a ~ r~ ~
- ~ ~ ~ O W rn -r ~,~ _ Z AD Z r~ Z
4~ 0 rn4~ 0 rn ~- r~ U -, S- q~ O rn H rv ¦ ~I H rD Z~ O t: ~) rrJ V~ r~ ¦ H rD
r~ E~ rnV ~ rr O - Z - rn a r,~
rQ N ~:C r~5rn . ~ rrJ ~ :~ ~ rr~ r .. ~ rn N 1:~ rr5 R -rl ~ s A ~ R -, rQ, ,1 . ~ A
E ~ ~ E ~ ~ ' ~: H_ rl rn ~ E ~ Z
~ o r ~o o ~ o r .~ .. ~ ~ .... ~ ~ V O~ r ~D r ~ ... ....
; Z ~ Z ~ ~ ~ Z Z
~ O H ~ ~ H r -Irn p, ~ ~ ~ C.~ ~-3 0 H
V _ _ ~; -- , s ~ ~ ~1~ O X H
~ U ~Z ~
O r~ O r~c o O ~ C E--~ ~ ~ C E--~ V--~ r~ o ~ ~ O E~
E~ ~ Z ~ O~: Z ~ O ~ ~ Z ~ ~ Et rQ E~ ~: Z ~1 0 m î: ~ ~c m ~o~ o~ .3. m u c~ ~ ~ m n g ~ ~n s, ~, o X X -~ I X
-~1 -~1 X -- z-- ,, r r~

W O 97/26357 PCTrUS97/00787 o ~1 .~ ~

.-- ~

a~
-[ ~
- .~ o z ~

o~ ~;
J o ~:
Z
O U~ ~
~I H

o r -z ~ _ O H ~ _, li3 ~ ~3, 1 -W
Z C ~ Z r m ~ a ~
.~ x ~

u

Claims (140)

CLAIMS:

1. A mammalian cell comprising an inhibitor of a low Km hexokinase, the inhibitor selected from:

(a) an agent that stimulates the production of trehalose-6-phosphate; or (b) a low Km hexokinase-specific ribozyme;

wherein said inhibitor is present in an amount effective to reduce the low Km hexokinase activity of said cell.

2. The cell of claim 1, wherein said cell comprises an agent that stimulates theproduction of trehalose-6-phosphate.

3. The cell of claim 1, wherein said cell comprises a low Km hexokinase-specificribozyme.

4. The cell of any preceding claim, wherein said cell comprises an agent that stimulates the production of trehalose-6-phosphate and a low Km hexokinase-specific ribozyme.

5. The cell of any preceding claim, wherein said cell has reduced low Km hexokinase activity relative to a parent cell from which it was prepared.

6. The cell of any preceding claim, wherein said inhibitor reduces the hexokinase I
activity of said cell.

7. The cell of any preceding claim, wherein said inhibitor reduces the hexokinase II
activity of said cell.

8. The cell of any preceding claim, wherein said inhibitor is introduced into said cell by means of a recombinant gene that expresses the inhibitor.

9. The cell of claim 8, wherein said inhibitor is introduced into said cell by means of a recombinant vector comprising a promoter operatively linked to a recombinant gene that encodes the inhibitor, the promoter expressing said inhibitor in said cell.

10. The cell of claim 8 or 9, wherein said cell comprises a recombinant gene that expresses a protein that stimulates the production of trehalose-6-phosphate.

11. The cell of claim 10, wherein said cell comprises a recombinant gene that expresses a trehalose-6-phosphate synthase enzyme.

12. The cell of claim 11, wherein said recombinant gene expresses a yeast trehalose-6-phosphate synthase (TPS1) enzyme.

13. The cell of claim 12, wherein said recombinant gene expresses a yeast TPS1 enzyme that includes a contiguous amino acid sequence from SEQ ID NO:2.

14. The cell of claim 13, wherein said recombinant gene includes a contiguous nucleic acid sequence from SEQ ID NO: 1.

15. The cell of claim 8 or 9, wherein said cell comprises a recombinant gene that expresses a low Km hexokinase-specific ribozyme.

16. The cell of claim 15, wherein said recombinant gene expresses a ribozyme that comprises a ribozyme catalytic domain from a hairpin ribozyme structure, RNase P, hepatitis delta virus, avocado sunblotch viroid virus, lucerne transient streak virus or tobacco ringspot virus.

17. The cell of claim 15 or 16, wherein said recombinant gene expresses a ribozyme that comprises a ribozyme catalytic domain linked to a nucleic acid sequence that is complementary to and binds to an RNA transcript of a hexokinase I gene.

18. The cell of claim 15 or 16, wherein said recombinant gene expresses a ribozyme that comprises a ribozyme catalytic domain linked to a nucleic acid sequence that is complementary to and binds to an RNA transcript of a hexokinase II gene.

19. The cell of any of claims 15 through 18, wherein said ribozyme comprises a ribozyme catalytic domain linked at each end to a hexokinase I or hexokinase II nucleic acid sequence.

20. The cell of any of claims 15 through 19, wherein said ribozyme comprises a ribozyme catalytic domain linked to a hexokinase I or hexokinase II nucleic acidsequence of between about 6 and about 30 bases in length.

21. The cell of claim 20, wherein said ribozyme comprises a ribozyme catalytic domain linked to a hexokinase I or hexokinase II nucleic acid sequence of between about 10 and about 15 bases in length.

22. The cell of any of claims 15 through 21, wherein said ribozyme comprises a ribozyme catalytic domain linked to a hexokinase I nucleic acid sequence that includes a contiguous nucleic acid sequence from SEQ ID NO:13 or a hexokinase II nucleic acid sequence that includes a contiguous nucleic acid sequence from SEQ ID NO:15.

23. The cell of any of claims 15 through claim 22, wherein said ribozyme comprises the contiguous nucleic acid sequence of SEQ ID NO:3, SEQ ID NO:4 or SEQ ID NO:5.

24. The cell of claim 8 or 9, wherein said cell comprises a first recombinant gene that expresses a protein that stimulates the production of trehalose-6-phosphate and a second recombinant gene that expresses a low Km hexokinase-specific ribozyme.

25. The cell of any preceding claim, wherein said cell is derived from a human cell.

26. The cell of any preceding claim, wherein said cell is a hybridoma.

27. The cell of any preceding claim, wherein said cell is derived from a cell capable of forming secretory granules.

28. The cell of claim 27, wherein said cell is derived from a neuroendocrine cell.

29. The cell of claim 27, wherein said cell is derived from a thyroid or pituitary cell.

30. The cell of claim 29, wherein said cell is derived from an AtT-20 cell.

31. The cell of claim 27, wherein said cell is derived from a GH-1 cell or a GH-3 cell.

32. The cell of claim 27, wherein said cell is derived from a pancreatic b cell.

33. The cell of claim 32, wherein said cell is derived from an insulinoma.

34. The cell of claim 32, wherein said cell is derived from a bTC, HIT or RIN cell.

35. The cell of claim 34, wherein said cell is derived from a RIN cell.

36. The cell of any preceding claim, wherein the low Km hexokinase activity of said cell is further reduced by interruption of a low Km hexokinase gene.

37. The cell of any preceding claim, wherein the low Km hexokinase activity of said cell is further reduced by providing to said cell an antisense RNA molecule that is complementary to and binds to a low Km hexokinase gene or RNA transcript.

38. The cell of any preceding claim, wherein said cell further comprises a selected recombinant gene that expresses a selected protein.

39. The cell of any preceding claim, wherein said cell secretes insulin.

40. The cell of claim 39, wherein said cell secretes human insulin.

41. The cell of claim 39 or 40, wherein said cell secretes insulin in response to a non-glucose secretagogue.

42. The cell of claim 41, wherein said cell secretes insulin in response to forskolin, dibutyryl cAMP or isobutylmethylxanthine (IBMX).

43. The cell of claim 39 or 40, wherein said cell secretes insulin in response to glucose.

44. The cell of claim 43, wherein said cell is an engineered cell that further comprises a recombinant insulin gene, a recombinant hexokinase IV gene or a recombinant GLUT-2 gene.

45. The cell of claim 44, wherein said recombinant insulin gene, hexokinase IV gene or GLUT-2 gene is introduced into the cell by means of a recombinant vector.

46. The cell of claim 44 or 45, wherein said cell comprises a recombinant insulin gene.

47. The cell of claim 46, wherein said cell comprises a recombinant human insulin gene.

48. The cell of claim 44 or 45, wherein said cell comprises a recombinant hexokinase IV gene.

49. The cell of claim 48, wherein said recombinant hexokinase IV gene is an islet isoform hexokinase IV gene.

50. The cell of claim 44 or 45, wherein said cell comprises a recombinant GLUT-2 gene.

51. The cell of claim 50, wherein said recombinant GLUT-2 gene is an islet isoform GLUT-2 gene.

52. The cell of claim 44 or 45, wherein said cell comprises two recombinant genes selected from the group consisting of an insulin gene, a hexokinase IV gene and GLUT-2 gene.

53. The cell of any of claims 44 through 52, wherein said cell comprises a recombinant insulin gene, a recombinant hexokinase IV gene and a recombinant GLUT-2 gene.

54. The cell of any of claims 43 through 53, wherein said low Km hexokinase activity is reduced to an amount effective to allow insulin secretion in response to an extracellular glucose concentration of between about 1 mM and about 20 mM.

55. The cell of any of claims 39 through 54, wherein said cell further comprises a glutamic acid decarboxylase gene.

56. The cell of claim 55, wherein said cell comprises a recombinant glutamic acid decarboxylase gene.

57. The cell of any preceding claim, wherein said cell is comprised within a population of like cells.

58. The cell of any preceding claim, wherein said cell is grown in contact with a solid support.

59. The cell of any preceding claim, wherein said cell is formulated in a pharmaceutically acceptable medium.

60. The cell of any preceding claim, wherein said cell is encapsulated in a biocompatible coating.

61. The cell of any preceding claim, wherein said cell is contained within a bioreactor.

62. The cell of any of claims 1 through 60, wherein said cell is comprised within an implantable medical device.

63. An artificial b cell device comprising a population of engineered cells in accordance with any of claims 43 through 54, the cells positioned within or encapsulated by a selectively permeable, biocompatible membrane or coating.

64. The device of claim 63, wherein said cells are microencapsulated.

65. The device of claim 63 or 64, wherein said cells are encapsulated in a hydrogel coating.

66. The device of claim 63 or 64, wherein said cells are encapsulated in an alginate coating.

67. The device of any of claims 63 through 66, wherein said cells are positionedwithin or encapsulated by a semipermeable capsule.

68. The device of any of claims 63 through 66, wherein said cells are seeded within a semipermeable fiber.

69. The device of any of claims 63 through 66, wherein said cells are positioned in a tubular semipermeable membrane positioned within a protective housing.

70. The device of claim 69, wherein each end of said tubular membrane is attached to an arterial graft that extends beyond said housing and joins the device to the vascular system of an animal as an arteriovenous shunt.

71. The device of any of claims 63 through 70, wherein said device comprises a population of between about 1,000 and about 10,000 engineered cells.

72. A composition comprising an inhibitor of a low Km hexokinase, characterized as:

(a) a recombinant vector comprising a promoter operably linked to a gene that encodes a protein that stimulates the production of trehalose-6-phosphate, the promoter expressing the protein in a mammalian cell; or (b) a low Km hexokinase-specific ribozyme or a recombinant gene or vector that expresses said ribozyme.

73. The composition of claim 72, comprising a recombinant vector that comprises a promoter operably linked to a gene that encodes a protein that stimulates the production of trehalose-6-phosphate, the promoter expressing the protein in a mammalian cell.

74. The composition of claim 73, wherein said recombinant vector comprises a gene that encodes a trehalose-6-phosphate synthase enzyme.

75. The composition of claim 72, comprising a low Km hexokinase-specific ribozyme or a recombinant gene or vector that expresses said ribozyme.

76. The composition of claim 75, comprising a recombinant gene or vector that expresses a low Km hexokinase-specific ribozyme.

77. The composition of any of claims 73, 74 or 76, wherein said recombinant vector comprises a promoter that expresses said protein or said ribozyme in a human cell.

78. The composition of claim 77, wherein said recombinant vector comprises a promoter that expresses said protein or said ribozyme in a pancreatic b cell.

79. A method for preparing a mammalian cell that has a reduced low Km hexokinaseactivity, comprising contacting a mammalian cell with a composition comprising an effective amount of an inhibitory agent characterized as:

(a) an agent that stimulates the production of trehalose-6-phosphate; or (b) a low Km hexokinase-specific ribozyme.

80. The method of claim 79, wherein said inhibitory agent is introduced into said cell by means of a recombinant gene that expresses the inhibitory agent.

81. The method of claim 79 or 80, wherein said cell comprises a selected recombinant gene that expresses a selected protein.

82. The method of any of claims 79 through 81, wherein said cell secretes insulin in response to glucose.

83. The method of claim 82, wherein said cell comprises a recombinant hexokinaseIV gene, a recombinant insulin gene or a recombinant GLUT-2 gene.

84. A composition in accordance with any of claims 72 through 78 for use in the preparation of a mammalian cell that has a reduced low Km hexokinase activity.

85. Use of a composition in accordance with any of claims 72 through 78 in the preparation of a mammalian cell that has a reduced low Km hexokinase activity relative to the parent cell from which it is prepared.

86. A method for producing insulin comprising the steps of:

(a) culturing an engineered cell that secretes insulin, the cell having a reduced low Km hexokinase activity and comprising an inhibitory agent characterized as:

(i) an agent that stimulates the production of trehalose-6-phosphate;
or (ii) a low Km hexokinase-specific ribozyme; and (b) obtaining insulin from the cultured cell.

87. The method of claim 86, wherein said engineered cell secretes insulin in response to a non-glucose secretagogue and said cell is cultured in the presence of a non-glucose secretagogue.

88. The method of claim 86 or 87, wherein said engineered cell secretes insulin in response to glucose and said cell is cultured in the presence of glucose.

89. The method of any of claims 86 through 88, wherein said inhibitory agent is introduced into said cell by means of a recombinant gene that expresses the inhibitory agent.

90. The method of any of claims 86 through 89, wherein said cell secretes recombinant insulin.

91. The method of any of claims 86 through 90, wherein said cell secretes human insulin.

92. The method of any of claims 86 through 91, wherein said cell comprises a recombinant insulin gene, a recombinant hexokinase IV gene or a recombinant GLUT-2 gene.

93. A cell in accordance with any of claims 39 through 61 for use in an in vitromethod of producing insulin.

94. Use of a cell in accordance with any of claims 39 through 61 in the preparation of a cell suspension for use in an insulin-producing bioreactor.

95. Use of a cell in accordance with any of claims 39 through 61 in an in vitro method for producing insulin.

96. A method of providing glucose-responsive insulin secreting capability to a mammal, comprising administering to a mammal in need of insulin secreting capability a biologically effective amount of a population of engineered cells that secrete insulin in response to glucose, the population comprising cells that have a reduced low Km hexokinase activity and which cells comprise an inhibitory agent characterized as:

(a) an agent that stimulates the production of trehalose-6-phosphate; or (b) a low Km hexokinase-specific ribozyme.

97. The method of claim 96, wherein said inhibitory agent is introduced into said population of engineered cells by means of a recombinant gene that expresses theinhibitory agent.

98. The method of claim 96 or 97, wherein said population of engineered cells are encapsulated in a biocompatible coating.

99. The method of claim 98, wherein said encapsulated cells are implanted intraperitoneally or subcutaneously.

100. The method of any of claims 96 through 98, wherein said population of engineered cells are implanted within a selectively permeable device that is connected to the vasculature of the mammal.

101. The method of any of claims 96 through 100, wherein said population of engineered cells secrete human insulin.

102. The method of any of claims 96 through 101, wherein said mammal is a human subject.

103. A cell in accordance with any of claims 43 through 54 for use in an in vivomethod of producing insulin.

104. Use of a cell in accordance with any of claims 43 through 54 in the preparation of a medicament for use in treating diabetes.

105. Use of a cell in accordance with any of claims 43 through 54 in an in vivo method for producing insulin.

106. A method for inhibiting the growth rate of a mammalian cell, comprising reducing the low Km hexokinase activity in said cell.

107. The method of claim 106, wherein the hexokinase I activity of said cell is reduced.

108. The method of claim 106 or 107, wherein the hexokinase II activity of said cell is reduced.

109. The method of any of claims 106 through 108, wherein said low Km hexokinaseactivity of said cell is reduced by interruption of a low Km hexokinase gene.

110. The method of claim 109, wherein said low Km hexokinase activity of said cell is reduced by gene interruption effected by homologous recombination.

111. The method of claim 109, wherein said low Km hexokinase activity of said cell is reduced by gene interruption effected by random integration.

112. The method of any of claims 106 through 108, wherein said low K m hexokinase activity of said cell is reduced by providing to said cell an antisense RNA molecule that is complementary to and binds to a low K m hexokinase gene or RNA transcript.

113. The method of any of claims 106 through 108, wherein said low K m hexokinase activity of said cell is reduced by providing to said cell a low K m hexokinase-specific ribozyme.

114. The method of any of claims 106 through 108, wherein said low K m hexokinase activity of said cell is reduced by providing to said cell an agent that stimulates the production of trehalose-6-phosphate.

115. The method of any of claims 106 through 108, wherein said low K m hexokinase activity of said cell is reduced by providing to said cell an agent that lacks low K m hexokinase activity and that displaces low K m hexokinase from mitochondria.

116. The method of claim 115, wherein said low K m hexokinase activity of said cell is reduced by providing to said cell an agent that lacks low K m hexokinase activity, that displaces low K m hexokinase from mitochondria and that has high K m hexokinase activity.

117. The method of any of claims 106 through 108, wherein said low K m hexokinase activity of said cell is reduced by providing to said cell a glucokinase enzyme.

118. The method of any of claims 106 through 117, wherein said cell is contactedwith a recombinant gene that expresses an agent that inhibits low Km hexokinase.

119. The method of claim 118, wherein said cell is contacted with a recombinant vector comprising a promoter operatively linked to said recombinant gene, the promoter expressing said gene in said cell.

120. The method of any of claims 106 through 119, wherein said cell is derived from a human cell.

121. The method of any of claims 106 through 120, wherein said cell is a hybridoma.

122. The method of any of claims 106 through 121, wherein said cell is a secretory cell.

123. The method of claim 122, wherein said cell is a neuroendocrine cell.

124. The method of claim 123, wherein said cell is an insulinoma cell.

125. The method of claim 124, wherein said cell is glucose-responsive cell.

126. The method of claim 125, wherein said cell secretes insulin in response to glucose.

127. The method of any of claims 106 through 123, wherein said cell is non-glucose-responsive cell.

128. The method of any of claims 106 through 127, wherein said cell further comprises a selected recombinant gene that expresses a selected protein.

129. The method of any of claims 106 through 128, wherein said cell is located within an animal.

130. A cell that has been manipulated to lower the activity of a low K m hexokinase for use in the preparation of a population of cells that exhibit a reduced growth rate.

131. A cell in accordance with any of claims 1 through 62 for use in the preparation of a population of cells that exhibit a reduced growth rate.

132. Use of a cell in accordance with any of claims 1 through 62 or claim 130 in the preparation of a slow-growing population of cells.

133. A method of producing a selected protein, comprising culturing a population of growth rate-inhibited cells that express said selected protein, the growth rate-inhibited cells having a reduced low K m hexokinase activity.

134. The method of claim 133, wherein said growth rate-inhibited cells express and produce insulin.

135. The method of claim 133, wherein said growth rate-inhibited cells express and produce an antibody.

136. A method of providing a selected protein to an animal, comprising administering to an animal a biologically effective amount of growth rate-inhibited cells that express said selected protein, the growth rate-inhibited cells having a reduced low K m hexokinase activity.

137. The method of claim 136, wherein said growth rate-inhibited cells are encapsulated in a biocompatible coating.

138. A cell that has been manipulated to lower the activity of a low K m hexokinase for use in the preparation of a population of cells for in vitro or in vivo protein production.

139. A cell in accordance with any of claims 1 through 62 for use in the preparation of a population of cells for in vitro or in vivo protein production.

140. Use of a cell in accordance with any of claims 1 through 62 or claim 138 in the preparation of a protein-producing population of cells.