CA2244959A1 - Gene expression in plants - Google Patents

Abstract

The invention provides methods and means for expressing multicistronic DNA
in eukaryotic cells and organisms, preferably plant cells and plants, particularly for translating multicistronic RNA. The methods and means of the invention can further be used for targeting an RNA to eukaryotic organelles, preferably plastids, particularly to chloroplasts. Eukaryotic cells and organisms, particularly plant cells and plants, transformed with such nucleic acids are also provided.

Description

Gene Expression in plants Field of the invention The present invention generally relates to the field of biotechnology in eukaryotes, particularly agricultural biotechnology and molecular biology of plant gene expression and translation. More specifically, the present invention relates to the use of RNA sequences functioning as internal ribosomal entry site (IRES) elements in eukaryotes, preferably in multicistronic messenger RNA molecules. The present invention also relates to the use of RNA
sequences as RNA tractor sequence for import of RNA in organelles, particularly chloroplasts.
Description of related art The development of transformation and gene expression technologies for plants has led to the development of plants with new agronomically important characteristics such as pest and pathogen resistance, herbicide resistance, improved nutritional value, or nuclear encoded male sterility for hybrid seed production. In most cases, these new traits were obtained by introduction of one chimeric gene encoding one protein.
For the next generation of biotechnological agricultural products however, the newly introduced traits will mostly be the result of expression of several transgenes. Resistance management strategies (aiming at preventing the development of pathogens resistant to the defense proteins expressed by plants) envision the coordinated expression of several defense proteins.
Likewise, the expression of proteins consisting of several peptides assembled in a specific quaternary structure (such as heterodimeric transcription factors, multimeric enzymes or enzymatic complexes) or the expression of different enzymes of a metabolic pathway for de novo production of metabolites in plants will often rely on coordinated expression of the genes encoding the different subunits.

Although introduction of different transgenes encoding the different subunits in plants is feasible by subsequent transformations with the different chimeric genes or by crossing plants containing the different chimeric genes, several drawbacks are associated with such approaches. In the first place, a large number of molecular analyses are required to identify those transgenic plant lines with the desired quantitative and qualitative (spatial and/or temporal) expression pattern for even one transgene, and this effort will only be multiplied upon introduction of the different independent chimeric genes.
Second, the loci containing the independently obtained transgenes in transgenic plants will mostly segregate in an unlinked fashion, thus potentially complicating further breeding strategies. Finally, coordinated expression of different genes will require the multiple use of a similar or identical regulating element, such as a promoter region, in the different transgenes, which might lead to unwanted gene-silencing.
As an alternative strategy it could be envisioned to include the different coding regions encoding the different proteins or polypeptides, whose coordinate expression is desired, in one multi-cistronic mRNA, whose production is controlled by one set of transcription-regulating elements (such as promoter regions and transcription termination signals) thereby eliminating at least the variation in transcription among the different components. This strategy requires however that the different cistrons can be translated in an efficient manner in plant cells.
Initiation of eukaryotic protein synthesis occurs by the two-step formation of a 80S initiation complex, consisting of the Met-tRNA, 40S and 60S ribosomal subunits at the AUG initiation codon of a mRNA molecule. The first step is the formation of a 43S pre-initiation complex consisting of the 40S ribosomal unit, bound to the ribosome association factors eIFIA and eIF3, which interacts with the methionine-tRNA/eIF2 complex (Browning, 1996). The second, rate-limiting, step consists of binding of the 43S complex to the mRNA. In the majority (90-95%) of eukaryotic mRNAs, which have a so-called cap-structure at their 5' end, the 43S pre-initiation complex is capable of binding to or near the cap-structure in cooperation with the eIF4F complex and scans along the mRNA in a 5' to 3' direction, until the first AUG codon is reached. If the first AUG lies within an optimal sequence context (Kozak, 1989) the complex pauses allowing the large ribosome subunit to associate and translation elongation to proceed. For efficient translation, the mRNAs should possess an accessible cap-structure and a relatively short 5' untranslated region without extensive secondary RNA structures. Further, the mRNA should be monocistronic or the tranlated cistron should be the first (upstream) cistron in a polycistronic mRNA. Translation of downstream cistrons could occur by ribosome re-initiation, by leaky scanning or by ribosome shunting.
However, cap-independent translation initiation of eukaryotic mRNA whereby the 43S pre-initiation complex does not bind at the 5' end, but rather to internal sequences has been identified in a number of viral RNAs and cellular RNAs from animals. These sequences are referred to as internal ribosome entry sequences (IRES) or sometimes as ribosome landing pads (RLP).
Although these IRES elements are mostly located on mono-cistronic RNAs and are used there to initiate translation from mRNAs with long 5' untranslated regions comprising several AUG codons, their inclusion in front of a downstream cistron in an artificial bi-cistronic mRNA allows translation of the second cistron (Pelletier and Sonenberg, 1988).
The best-characterized IRES elements are found on the naturally uncapped RNAs of picornaviruses (Belsham and Sonenberg, 1996; Jackson and Kaminski, 1995). IRES elements were also identified in human mRNAs, encoding immunoglobulin heavy chain binding protein (BiP), fibroblast growth factor 2 (FGF-2), insulin-like growth factor and eIF4G, platelet-derived growth factor B (PDF2/c-sis), proto-oncogene c-myc, vascular endothelial growth factor (VEGF) (Macejak and Sarnow, 1991, Vagner et al., 1995, Teerink et al, 1995, Gan and Rhoads, 1996, Bernstein et al., 1997, Nanbru et al., 1997, Stein et al., 1998), in the mRNAs encoding the homeotic proteins antennapedia and ultrabithorax of Drosophila melanogaster (Oh et al. 1992;
Ye et al. 1997) and in the mRNAs encoding TFIID and HAP4 proteins in Saccharomyces cerevisae (Izuka et al., 1994).

In plants, elements from viral RNAs which support internal initiation of translation in vitro have been reported for cowpea mosaic virus M RNA
(Verver et al. 1991; Thomas et al. 1991 ), plum pox potyvirus genomic RNA
(Riechmann et al., 1991 ), potato virus Y potyvirus RNA (Levis and Astier-Manifacier, 1993) and a tobamovirus RNA (Ivanov et al, 1997).
Basso et al. (1994) described the inclusion of the 5' non-translated region of turnip mosaic potyvirus RNA upstream of a ~i-glucuronidase gene for efficient translation of uncapped RNA after introduction into tobacco suspension cells, and suggested that ribosomes bound to an internal site within the TuMV 5' non-translated region.
Zelenia et al. (1992) described expression in vitro and in plant protoplasts of reporter genes preceded by the 5' non-translated alpha-beta leader of potato virus X genomic RNA despite the presence of upstream vector derived sequences and irrespective of the length of the spacer sequence preceding the reporter genes.
WO 97/49814 describes efficient cap-independent translation of both cistrons of a dicistronic RNA comprising the translation enhancing domain from STNV-2 in vitro.
Translation of cistrons located downstream of a 600 nucleotides (nt) long leader in the CaMV35S RNA, in permissive plant cells, has been documented to be initiated by cap-originated discontinuous scanning (direct transfer of the scanning complex from an upstream shunt donor site to a downstream shunt acceptor site, without scanning of the intervening region). This process could be inhibited by the insertion of an energy-rich stem structure at the 5' end of the RNA close to the cap-site of the original leader or close to the original cap site of the leader extended by 200 nt at its 5' terminus (Futterer et al., 1993).
Hefferon et al. (1994), Hefferon and AbouHaidar (1996), Hefferon (PhD
thesis, University of Toronto, 1995) and Hefferon et al. (1997b) all describe initiation of translation of the potato virus X coat protein from a dicistronic mRNA in transgenic potato plants by internal ribosome binding. Hefferon et al. (1997a) describe the expression of the PVY coat protein under the control of the PVX coat protein gene leader sequence.
Hefferon et al. (1996) described identification of a functional prokaryotic ribosome recognition sequence upstream of the coat protein gene of potato virus X.
Import of nuclear encoded proteins in chloroplasts has been well documented (reviewed in e.g. Keegstra, 1989 and Smeekens et al., 1990). However, less is known about import of RNA, particularly nuclear encoded RNA, in these organelles.
Schoelz and Zaitlin (1989) have described several lines of evidence to conclude that tobacco mosaic virus (TMV) RNA enters the chloroplast in vivo in directly inoculated or systemically infected leaves of tobacco plants. Only genomic length but not subgenomic length RNA was found in the chloroplast extracts.
The prior art is thus deficient in the lack of an effective means for allowing efficient translation of the different cistrons of a multi-cistronic mRNA in plant cells and plants, as well as in the lack of an effective means for targeting RNA
to eukaryotic organelles, preferably plastids, particularly chloroplasts. The present invention fulfills these longstanding needs and desire in the art. The identified IRES-like sequences from potex-viruses or carla-viruses, particularly from PVX, may be also used in other eukaryotic cells and organisms.
Summary of the invention The invention provides a method for producing a protein or peptide from essentially each cistron of a chimeric multicistronic RNA, preferably comprising from 2 to 10 cistrons in a plant cell, comprising the steps of including a heterologous sequence acting like an IRES (further named an Internal Ribosome Binding Site or IRBS herein) in each intercistronic region, wherein the IRBS element is capable of binding a translation initiation complex in the presence of an RNA sequence forming an energy-rich stem-loop structure at or near the 5' end of a test RNA molecule comprising the IRBS element in said plant cell; and introducing the chimeric multicistronic RNA in a plant cell. The IRBS element may further also be included in the 5' untranslated leader sequence upstream of the first cistron of the chimeric multicistronic RNA. It should be appreciated that the capacity of the IRBS
element to allow binding of a translation initiation complex in the presence of an energy-rich stem-loop structure at or near the 5' end of a test RNA is merely used as characterizing feature of the IRBS element and is in no way intended to limit the invention to those RNAs containing an energy-rich stem-loop structure at or near the 5' end of a useful RNA. It is also quite clear that such stem-loop structure is not needed for the functionality of the IRBS
elements in accordance with the invention.
Preferably, the cistrons of the multicistronic RNA encode pest resistance proteins or pathogen resistance proteins, particularly insect resistance proteins, more particularly insect resistance proteins selected from the group of insecticidal crystal proteins from Bacillus thuringiensis, vegetative insecticidal proteins from Bacillus thuringiensis, insecticidal toxins from Photorhabdus spp., insecticidal toxins from Xenorhabdus spp., insecticidal a-amylase and protease inhibitors, spider venom toxin or scorpion venom toxin.
Also, one of the cistrons of the multicistronic RNA preferably encodes a protein conferring herbicide resistance, more preferably a herbicide resistance protein providing resistance to glyphosate or glufosinate, particularly a enolpyruvylphosphate shikimate synthase or a mutant thereof or a phosphinotricin acetyltransferase.
Preferably the IRBS element comprises nucleotide sequences complementary to the 3'end of the 16S rRNA from E, coli. Particularly, the IRBS element comprises the ribonucleotide sequence corresponding to the nucleotide sequence of SEQ ID No 1 from the nucleotide at position 120 to the nucleotide at position 396 or the ribonucleotide sequence corresponding to the nucleotide sequence of SEQ ID No 1 from the nucleotide at position 1 to the nucleotide at position 396 or the IRBS element comprises a nucleotide sequence with a sequence identity from about 60% to 100 % to the ribonucleotide sequence corresponding to the nucleotide sequence of SEQ ID
No 1 from the nucleotide at position 1 to the nucleotide at position 396.
The invention further provides a method for coordinated production of polypeptides in a plant cell, comprising providing plant cells with a chimeric gene including the following operably linked DNA sequences:
a) a plant-expressible promoter region;
b) a transcribed DNA region, yielding upon transcription a multicistronic RNA
comprising in each intercistronic region between the cistrons encoding said polypeptides a heterologous IRBS element, wherein said IRBS element is capable of binding a translation initiation complex in the presence of an RNA
sequence forming an energy-rich stem-loop structure at or near the 5' end of a test RNA molecule comprising said IRBS element in said plant cell; and c) a 3' transcription termination signal which functions in said plant cells.
Preferred plant-expressible promoter regions are selected from the group of plant-expressible promoters recognized by RNA polymerase I, promoters recognized by RNA polymerase II, promoters recognized by RNA polymerase III, or promoters recognized by single subunit bacteriophage RNA
polymerases.
In another embodiment, the invention provides a DNA molecule comprising the following operably linked DNA elements:
a) a plant-expressible promoter;
b) a transcribed DNA region, yielding upon transcription a multicistronic RNA
comprising in each intercistronic region between the cistrons encoding the polypeptides a heterologous IRBS element, wherein the IRBS element is capable of binding a translation initiation complex in the presence of an RNA
sequence forming an energy-rich stem-loop structure at or near the 5' end of a test RNA molecule comprising the IRBS element in the plant cell; and c) a 3' transcription termination signal which functions in plant cells.
In yet another embodiment, the invention provides a plant cell, a plant or a seed comprising the chimeric DNA of the invention.
The invention further provides a method for introducing a chimeric RNA
molecule, such as an antisense RNA, into the plastid, preferably a chloroplast, of a plant cell comprising the steps of including a heterologous ribonucleotide sequence in the chimeric RNA with a sequence identity from about 60% to 100% to the ribonucleotide sequence corresponding to the nucleotide sequence of SEQ ID No 1 from the nucleotide at position 1 to the nucleotide at position 396 or to the nucleotide sequence of SEQ ID No 1 from the nucleotide at position 1 to the nucleotide at position 121 and introducing the chimeric RNA in the plant cells. The RNA may be encoded by a chimeric gene integrated in the nuclear genome.
The invention also relates to a method for producing a protein of interest in a plastid of a plant cell, comprising integrating a chimeric gene in the nuclear DNA of said plant cell, whereby the chimeric gene comprises the following operably linked DNA sequences:
a) a plant expressible promoter region;
b) a DNA region encoding a ribonucleotide sequence with a sequence identity from about 60% to 100% to the ribonucleotide sequence corresponding to the nucleotide sequence of SEQ ID No 1 from the nucleotide at position 1 to the nucleotide at position 396 or the nucleotide sequence of SEQ ID No 1 from the nucleotide at position 1 to the nucleotide at position 121;
c) a heterologous DNA region encoding a protein of interest, preferably a protein conferring herbicide resistance, more preferably a protein providing herbicide resistance to glyphosate or glufosinate, particularly a enolpyruvylphosphate shikimate synthase or a mutant thereof or a phosphinotricin acetyltransferase; and d) a 3' transcription termination signal which functions in the plant cells.

The protein of interest may also be an enzyme involved in lipid metabolism or a protein involved in photosynthesis.
The invention also provides a method for selecting plant cells producing a protein of interest to a high level, comprising the steps of I) providing a population of plant cells with a chimeric gene comprising the following operably linked DNA regions:
a. a plant expressible promoter region;
b. a first cistron consisting of a coding region, encoding a polypeptide of interest;
c. an intercistronic region comprising a DNA region encoding a heterologous IRBS element, wherein the IRBS element is capable of binding a translation initiation complex in the presence of an RNA
sequence forming an energy-rich stem-loop structure at or near the 5' end of a test RNA molecule comprising the IRBS element in the plant cell;
d. a second cistron consisting of a coding region, encoding a selectable marker protein, preferably a binding protein for the selective agent; particularly a phleomycin or bleomycin binding protein selected from the group of phleomycin or bleomycin binding proteins encoded by E. coli transposon Tn 5, by Bacillus spp. plasmid pUB110 or by Streptomyces verticillus or Streptoalloteichus hindustanus; and e. a 3' transcription termination signal which functions in said plant cells; and II) selecting plant cells which are resistant to a high level of a selective agent against which said selectable marker protein provides resistance.
The invention also provides a means for producing in a plant cell 2 peptides or proteins encoded by one dicistronic RNA molecule, with one peptide or protein expressed in the plastids, preferably the chloroplasts, and the second peptide or protein expressed in the cytoplasm of said plant cell. Indeed, a dicistronic RNA in accordance with the invention, including an IRBS element of the invention, will result in the translation of the first cistron in the cytoplasm while the second cistron will be translated in the chloroplast due to the IRBS
element in the intercistronic region. Similarly, the two proteins can both be expressed in the chloroplast by providing an energy-rich stem-loop structure followed by the IRBS element located upstream of the first cistron.
The invention further relates to a method for expressing a protein in a plant cell, comprising the step of providing a plant cell with a chimeric DNA
including the following operably linked DNA elements:
a) a plant-expressible promoter;
b) a DNA region encoding a ribonucleotide sequence with a sequence identity from about 60% to 100% to the ribonucleotide sequence corresponding to the nucleotide sequence of SEQ ID No 1 from nucleotide at position 1 to the nucleotide at position 396;
c) a heterologous DNA region encoding said protein; and d) a 3' transcription termination signal functioning in said plant cells.
In yet another embodiment of the invention, a DNA is provided, comprising the following operably linked DNA sequences:
a) a plant-expressible promoter;
b) a DNA region encoding a ribonucleotide sequence with a sequence identity from about 60% to 100% to the ribonucleotide sequence corresponding to the nucleotide sequence of SEQ ID No 1 from nucleotide at position 1 to the nucleotide at position 396;
c) a heterologous DNA region encoding a protein of interest; and d) a 3' transcription termination signal functioning in plant cells.
The invention also provides methods for producing a polypeptide from each cistron of a chimeric multicistronic RNA in a eukaryotic cell, such as a human cell, comprising the steps of a) including a heterologous IRBS element in each intercistronic region, of a multicistronic RNA, wherein the IRBS element is selected from the group of an IRBS element having a sequence corresponding to the nucleotide sequence of SEQ ID No 1 from nucleotide at position 1 to the nucleotide at position 396, an IRBS element having a sequence corresponding to the nucleotide sequence of SEQ ID No 1 from nucleotide at position 120 to the nucleotide at position 396, an !RBS element from a potex virus or a carla virus, an IRBS element comprising a nucleotide sequence with a sequence identity from about 60% to 100% to the ribonucleotide sequence corresponding to the nucleotide sequence of SEQ ID
No 1 from nucleotide at position 1 to the nucleotide at position 396 and an IRBS element comprising a nucleotide sequence with a sequence identity from about 60% to 100% to the ribonucleotide sequence corresponding to the nucleotide sequence of SEQ ID No 1 from nucleotide at position 120 to the nucleotide at position 396; and b) introducing the chimeric multicistronic RNA
in a eukaryotic cell.
The multicistronic RNA molecule may be transcribed from a chimeric gene including the following operably linked DNA sequences:
a) a promoter region, functioning in a eukaryotic cell;
b) a transcribed DNA region, yielding upon transcription a multicistronic RNA
comprising in each intercistronic region between the cistrons a heterologous IRBS element selected from the above-mentioned group of IRBS elements, and c) a 3' transcription termination signal which functions in a eukaryotic cell.
The chimeric DNA yielding upon transcription the multicistronic RNA
comprising the selected IRBS elements, as well as eukaryotic cells comprising such DNA and non-human eukaryotic organisms consisting essentially of such cells are also objects of the invention.
The invention also relates to a method for expressing a protein in a eukaryotic cell, such as a human cell comprising the step of providing a eukaryotic cell with a chimeric DNA including the following operably linked DNA elements:
a) a promoter region which functions in a eukaryotic cell;
b) a DNA region encoding a ribonucleotide sequence comprising a heterologous IRBS element selected from the group of an IRBS element having a sequence corresponding to the nucleotide sequence of SEQ ID No 1 from nucleotide at position 1 to the nucleotide at position 396, an IRBS
element having a sequence corresponding to the nucleotide sequence of SEQ
ID No 1 from nucleotide at position 120 to the nucleotide at position 396, an IRBS element from a potex virus or a carla virus, an IRBS element comprising a nucleotide sequence with a sequence identity from about 60% to 100% to the ribonucleotide sequence corresponding to the nucleotide sequence of SEQ ID No 1 from nucleotide at position 1 to the nucleotide at position 396 and an IRBS element comprising a nucleotide sequence with a sequence identity from about 60% to 100% to the ribonucleotide sequence corresponding to the nucleotide sequence of SEQ ID No 1 from nucleotide at position 120 to the nucleotide at position 396;
c) a heterologous DNA region encoding the protein of interest; and d) a 3' transcription termination signal which functions in a eukaryotic cell, as well as to the chimeric DNA comprising the selected IRBS elements and to eukaryotic cells and non-human organisms comprising such chimeric DNA.

Brief description of the drawings Fig. 1. Analysis of PVX CP and RNA in transgenic plants. (a) Detection of PVX CP expressed in transgenic plants by Western blot of a 12.5%
acrylamide gel. Lanes 1-6 contain 50 Ng total protein extracted from leaf tissue of putative transgenic plant lines. Lane 7 contains 50 Ng protein extracted from a non-transformed plant. Lane 8 contains 100 Ng PVX native CP used as a positive control. (b) Northern blot analysis of total RNA
isolated from transgenic and non-transgenic plants, hybridized with a 32P-labelled cDNA fragment corresponding to the CP gene of PVX. Lane 1 contains an in vitro transcript of the PVX construct which is also expressed in transgenic plants. Lanes 2 and 3 contain 40 Ng total RNA extracted from leaf tissue of non-transformed and transgenic plants, respectively. Level of transcript is 100 ng for lane 1; 75 ng for lane 3.
Fig. 2. Analysis of PVX 8 kDa protein and RNA transcripts in transgenic plants. (a) Expression of the 8 kDa protein in transgenic plant line 304 on a 12.5% acrylamide gel. Protein extracts (50 Ng) from: leaf tissue of non-transformed and non-infected potato plants (lanes 1 and 2); from transgenic potato plant (lane 3); and from PVX-infected tobacco plants (lanes 4 and 5).
Antibodies were pre-adsorbed with non-transformed plant proteins prior to use, except in lanes 1 and 2. Lane 6 contains purified fusion protein (yIFN
and 8 kDa protein, molecular mass 17.3 kDa) extracted from E. coli. (b) Northern blot of total RNA isolated from transgenic and non-transformed plants, hybridized with a 32P-labelled cDNA fragment corresponding to the gene encoding the 8 kDa protein of PVX. Lanes are labelled as in Fig. 1 (b).
Fig. 3. Expression of CP and 8 kDa protein in tobacco protoplasts. (a) Schematic representation of transcripts derived from cDNA constructs used.
Arrows represent predicted sites for initiation of translation. Positions of the 5' terminus of transcripts, 8 kDa and CP genes are included. Xb, Xbal; Sc, Scal;
Sa, Sall; H3, Hindlll. (b) Western blot analysis of the 8 kDa protein expression in tobacco protoplasts. One fifth of the total extraction volume was loaded in each lane. Antibodies against the fusion protein were preadsorbed with non-infected, non-transformed tobacco leaf extracts prior to immunoblotting.
Protein extracts from protoplasts electroporated with full-length PVX RNA
(lane 1 ), PVX2 RNA (lane 2), PVX2' RNA (lane 3) and no RNA (lane 4) are included. (c) Western blot analysis of CP expression in tobacco protoplasts.
Protein extracts from protoplasts electroporated with full-length PVX RNA
(protein sample diluted 10-fold) (lane 1 ), PVX2 RNA (lane 2), PVX2' RNA
(lane 3), PVX3 RNA (lane 4), no RNA (lane 5). (d) RNA stability assay. One fourth of total RNA extraction volume was loaded in each lane. RNA extracts from protoplasts electroporated with PVX2 RNA (lane 1 ), PVX2' RNA (lane 2), and no RNA (lane 3). A cDNA corresponding to the 8 kDa gene was used as a probe. (e) RNA stability assay. RNA extracts from protoplasts electroporated with PVX2 RNA (lane 1 ), PVX2' RNA (lane 2), PVX3 RNA
(lane 3), no RNA (lane 4). Probe used corresponded to the CP gene.
Figure 4. Reporter gene activity in tobacco protoplasts. (a) Schematic representation of constructs used. Nucleotide positions of PVX sequence used are included. Xb: Xbal; Bm: BamHl; Ac: Accl; Tq: Taql; H3: Hindlll. (b) ~-Gal activity obtained from extracts of protoplasts electroporated with constructs in the presence or absence of a hairpin structure. SD are shown for five independent experiments. (c) Effect of PVX CP leader sequence on relative CAT activities. Level of monocistronic construct PVXCAT was set at 100 % in this study.
Figure 5. Analysis of PVX gene products in chloroplasts.
A. Western blot analysis. PVX CP-specific antisera was used for immunoblotting. Lane 1: protein extracted from chloroplasts of non-transformed plants pre-incubated in the presence of PVX CP, following proteinase K treatment, Lanes 2 and 3: proteins in chloroplasts and whole leaf extracts, respectively, purified from non-transformed plants. Lanes 4 and 5:
protein from chloroplasts and whole leaf extracts, respectively, purified from transgenic plants.

B. Northern blot analysis. A 32 P-labeled cDNA probe corresponding to the CP gene of PVX was used for hybridization. Lanes 1 and 2: RNA isolated from whole transgenic plants and purified chloroplasts of transgenic plants, respectively. Lanes 3 and 4: RNA isolated from whole non-transformed plants and purified chloroplasts of non-transformed plants, respectively. Lane 5:
RNA purified from chloroplasts of non-transformed plants preincubated with PVX RNA, following RNase treatment.
Figure 6. Expression of PVX CP from transgenic protoplasts.
A. Immunoprecipitation of cytoplasmatic and chloroplast proteins from transgenic protoplasts. Serial 1:5 dilutions are presented. Cytoplasmic lysates and chloroplastic preparations immunoprecipitated with actin, P700 and PVX CP antisera in the presence or absence of chloramphenicol.
B. Immunoprecipitation from non-transformed protoplasts. Samples labeled as in A.
Figure 7. A. Leader sequences used in PAP expression studies. Nucleotide sequences of the S/D-like region of PVX (PVX"~-PAP), PVX sequence containing the nucleotide substitutions (PVXm-PAP) and S/D region (S/D-PAP) are in bold.
B). Nucleotide sequence comparison of PVX 25K and CP gene leader sequence. Region of sequence homology is indicated in bold.
Figure 8. Immunoblot analysis of PAP expressed in E. coli.
A. Dot blot analysis. Lane 1, E. coli cells containing vector S/D-PAP
(sense orientation of PAP gene); Lane 2, E. coli cells containing vector PVX"' -PAP (mutated boxes); Lane 3, E. coli cells containing vector S/D-PAP-A
(antisense orientation of PAP gene); Lane 4, 1 Ng PAP purified from pokeweed plants; Lane 5, E. coli cells containing vector PVX"~-PAP.
B. Western blot of PAP expression.
Lane ~ ; 0.5 Ng purified PAP; Lane 2; S/D-PAP; Lane 3; S/D-PAP-A, Lane 4;
PVX"~-PAP, Lane 5; PVXm-PAP.

Detailed description of the invention "Comprising" or "including" as used herein are to be interpreted as specifying the presence of the stated features, integers, steps or components as referred to, but does not preclude the presence or addition of one or more features, integers, steps or components, or groups thereof. Thus, e.g., a nucleic acid or protein comprising a sequence of nucleotides or amino acids, may comprise more nucleotides or amino acids than the actually cited ones, i.e., be embedded in a larger nucleic acid or protein. A chimeric gene comprising a DNA region which is functionally or structurally defined, may comprise additional DNA regions.
"Encoding" may either refer to the transcription process alone, (including post-transcriptional events) or to both transcription and translation of the DNA or region said to be encoding . Thus, a DNA may be encoding an RNA such as the IRBS elements of the invention or may be encoding an RNA which is further translated into a peptide, polypeptide or protein.
The current invention is based on the one hand on the unexpected finding that inclusion of the about 400 nt ribonucleotide sequence preceding the coat protein coding sequence of a potex virus, particularly of potato virus X, preferably of the potato virus X obtainable at the ATCC under deposit number PV-54, in the intercistronic region of a bicistronic mRNA wherein the two heterologous cistrons each encode a reporter protein (i.e., ~3-galactosidase and chloramphenicol acetyltransferase), allows in plants the efficient translation of both reporter cistrons to yield similar levels of reporter proteins.
On the other hand, it was unexpectedly found that in transgenic potatoes, comprising a chimeric gene of an about 1.2 kb fragment of PVX (comprising the coat protein cistron as well as the previously mentioned about 400 nt sequence) linked to a CaMV35S promoter, the transcribed RNA and the translated coat protein could be detected in the chloroplasts of the transgenic plants.

Thus, in a first aspect of the invention, methods and means are provided for the production of peptides, polypeptides or proteins from each cistron of a chimeric multicistronic RNA in a plant cell or plant. As a particular embodiment of this first aspect, methods and means are provided for selecting plant cells and plants with a high expression of a peptide, polypeptide or protein of interest.
In a second aspect of the invention, methods and means are provided for targeting an RNA molecule to the plastids, preferably the chloroplasts, of plant cells or plants. Particularly, methods and means are provided for the production of peptides, polypeptides or proteins in chloroplasts of transgenic plants, whereby the chimeric genes encoding the peptides, polypeptides or proteins of interest are not integrated in the chloroplast genome, but are preferably integrated in the nuclear genome. These methods do not require the inclusion of a transit peptide in the protein or polypeptide of interest which needs to be targeted to the chloroplasts.
In another aspect of the invention, novel DNA sequences and methods are provided which allow the cap-independent translation of uncapped RNAs in plant cells.
According to the first aspect of the invention, a method for the production of polypeptides or proteins from different cistrons, preferably all cistrons, of a chimeric multicistronic RNA in a plant cell or a plant, is provided, whereby a heterologous IRBS element is inserted in each intercistronic region of the multicistronic RNA.
As used herein "cistron" defines a nucleotide region coding for a single polypeptide, which can be a naturally occurring peptide or protein or a mutant peptide or protein including a chimeric protein or a fusion protein. As defined, cistron can refer to either a DNA sequence or an RNA sequence encoding a single polypeptide, as will be understood from the context of the description by the person skilled in the art.

A "multicistronic" or "polycistronic" RNA, as used herein, is an RNA molecule comprising at least two cistrons. It is expected however that the invention can be equally applied to RNAs containing more than two cistrons. For practical reasons, the number of cistrons in a multicistronic RNA should maximally be ten, preferably maximally five, particularly three.
An "intercistronic region" is the nucleotide region between two cistrons.
Besides an IRBS element, the intercistronic region may comprise other nucleotide sequences. It is preferred however that the intercistronic region is not too long, so as not to interfere with the transcription by the RNA
polymerase if the multicistronic RNA is transcribed from a chimeric DNA.
Likewise, it is preferred that the intercistronic region does not comprise sequences interfering with transcription, such as transcription termination signals or promoter-like sequences for the appropriate RNA polymerase.
Suitable IRBS elements for the methods and means of the invention are those ribonucleotide sequences which are capable of binding a translation initiation complex from plant cells, when incorporated in a test RNA molecule further comprising an RNA sequence forming an energy-rich stem-loop structure at or near the 5' end of that test RNA molecule, upstream of the IRBS element.
To assay the binding of the translation complex, the IRBS element can be operably linked to a reporter coding sequence (included upstream of that coding sequence) such as chloramphenicol acetyltransferase, ~3-glucuronidase, ~3-galactosidase, luciferase, green fluorescent protein, neomycin phosphotransferase or similar reporter proteins. After introduction of the test RNA in plant cells, either direct or indirect by introduction of a DNA
capable of being transcribed to yield the test RNA, and preferably in a transient way, the level of the reporter protein produced can be assayed, by methods such as but not limited to enzymatic activity or by direct specific protein quantification methods such as ELISA. The level of translated protein is directly related to the number of translation initiation events, and hence to the binding of the translation initiation complex to the IRBS element.
However, other methods of assaying the binding of a translation initiation complex to an RNA molecule comprising the IRBS element, preferably in a direct way, are available in the art (see, e.g., Davies and Abe, 1995).
A translation initiation complex from plant cells, as used herein, encompasses all translation initiation complexes from plant cells, including the eukaryotic 43S translation initiation complex, as well as the translation initiation complexes found in plastids, particularly chloroplasts, and mitochondria.
As used herein, a stem-loop structure, is an RNA region with a nucleotide sequence comprising two subsequences capable of base-pairing according to conventional base pairing rules yielding a stem structure, separated by a third subsequence forming the loop. Preferably, the stem-loop structure is quite stable, more preferably the formation of the stem-loop structure would result in a decrease of Gibb's free energy of at least about 20 kcal/mol hairpin, particularly about 30 kcal/mol hairpin. Particularly the stem-loop structure has the sequence of SEQ ID No 2.
Preferred IRBS elements comprise the regions of about 400 nt, particularly the regions of about 280 nt located upstream of the coat protein encoding cistron (or open reading frame) from potex viruses including but not limited to asparagus virus 3 (AV-3), cactus virus X (CVX), cassava virus X (CsVX), clover yellow mosaic virus (CIYMV), commelina virus X (ComVX), cymbidium mosaic virus (CymMV), foxtail mosaic virus (FoMV), hydrangea ringspot virus (HRSV), lily virus X (LVX), narcissus mosaic virus (NMV), nerine virus X
(NVX), papaya mosaic virus (PapMV), pepino mosaic virus (PepMV), plantago severe mottle virus (PISMV), plantain virus X (PIVX), potato aucuba mosaic virus (PAMV), potato virus X (PVX), tulip virus X (TVX), viola mottle virus (VMV), white clover mosaic virus (WCIMV), artichoke curly dwarf virus (ACDV), bamboo mosaic virus (BaMV), barley virus B1 (BarV-B1), boletus virus (BOIV), cassava common mosaic virus (90) (CsCMV), centrosema mosaic virus (CenMV), daphne virus X (DVX), dioscorea latent virus (DLV), lychnis potexvirus malva veinal necrosis virus (MVNV), nandina mosaic virus (NaMV), negro coffee mosaic virus (NeCMV), parsley virus 5 (PaV-5), parsnip virus 3 (ParV-3), parsnip virus 5 (ParV-5), rhododendron necrotic ringspot virus (RoNRSV), rhubarb virus 1 (RV-1 ), smithiantha potexvirus (SmiV), strawberry mild yellow edge-associated virus (SMYEaV), wineberry latent virus (WLV), and zygocactus virus (ZV).
Since carla viruses are closely related to potex viruses, it is expected for the purposes of the invention, use to the same effect can also be made of the 400 nt and 280 nt IRBS sequences located upstream of the coat protein encoding cistron from carla viruses, including but not limited to American hop latent virus (AHLV), blueberry scorch virus (BISV), cactus virus 2 (CV-2), caper latent virus (CapLV), carnation latent virus (CLV), chrysanthemum virus B
(CVB), dandelion latent virus (DaLV), elderberry virus (EV), garlic common latent virus (GCLV), Helenium virus S (HVS), honeysuckle latent virus (HnLV), hop latent virus (HpLV), hop mosaic virus (HpMV), hydrangea latent virus (HdLV), kalanchoe latent virus (KLV), lilac mottle virus (LiMV), lily symptomless virus (LSV), Alstroemeria virus, mulberry latent virus (MLV), muskmelon vein necrosis virus (MuVNV), Nerine latent virus (NeLV), Hippeastrum latent virus, Passiflora latent virus (PLV), pea streak virus (PeSV), alfalfa latent virus, poplar mosaic virus (PopMV), potato virus M
(PVM), potato virus S (PVS), pepino latent virus, red clover vein mosaic virus (RCVMV), shallot latent virus (SLV),Sint-Jem's onion latent virus (SJOLV), strawberry pseudo mild yellow edge virus (SPMYEV), as well as, Anthriscus virus (AntV), Arracacha latent virus (ALV), artichoke latent virus M (ArLVM), artichoke latent virus S (ArLVS), butterbur mosaic virus (ButMV), caraway latent virus (CawLV), Cardamine latent virus (CaLV), Cassia mild mosaic virus (CasMMV), chicory yellow blotch virus (ChYNMV), Chinese yam necrotic mosaic virus (ChYNMV), cole latent virus (CoLV), Cynodon mosaic virus (CynMV), daphne virus S (DVS), Dulcamara virus A (DuVA), Dulcamara virus B (DuVB), eggplant mild mottle virus (EMMV), eggplant virus, Euonymus mosaic virus (EuoMV), fig virus S (FVS), fuchsia latent virus (FLV), garlic mosaic virus (GarMV), Gentiana virus (GenV), Gynura latent virus (GyLV), Helleborus mosaic virus (HeMV), impatiens latent virus (ILV), lilac ringspot virus (LacRSV) plantain virus 8 (PIV-8), prunus virus S (PruVS), Southern potato latent virus (SoPLV), white bryony mosaic virus (WBMV), cassava brown streak-associated virus (CBSaV), cowpea mild mottle virus (CPMMV), Psophocarpus necrotic mosaic virus, groundnut crinkle virus,tomato pale chlorosis virus, and Voandzeia mosaic virus.
Particularly preferred IRBS elements comprise short nucleotide stretches with complementarity to the 16S rRNA of E, coli, particularly to nucleotides 126-132 or 371-376 of the 16S rRNA of E. coli. Quite particularly these short nucleotide stretches can function as a Shine-Dalgarno sequence in E. coli, when operably linked to a cistron. Examples of such sequences are represented in SEQ ID No 3 from nucleotide 9 to 24, or SEQ ID No 4 from nucleotide 13 to 24. Preferably, these nucleotide stretches with complementarity to the 16S rRNA of E, coli contained in the particularly preferred IRBS elements of the invention are located in the region of about 5 to about 50 nucleotides upstream of the ATG of a coding sequence, particularly about 5 to 20 nucleotides upstream of the ATG of a coding sequence, more particularly about 10 nucleotides upstream of the ATG of a coding sequence which is desired to be translated.
Especially preferred IRBS elements comprise a nucleotide sequence corresponding to the nucleotide sequence of SEQ ID No 1 from nucleotide 1 to nucleotide 396 or the nucleotide sequence of SEQ ID No 1 from nucleotide 120 to nucleotide 396.
The IRBS element comprising a nucleotide sequence of SEQ ID No 1 from nucleotide 1 to nucleotide 396 still comprises an open reading frame corresponding to an 8K polypeptide encoded by PVX (Huisman et al. 1988).
It is expected that the translation of that 8K polypeptide can be inhibited by introducing an artificial stopcodon, preferably at or near the translation initiation codon of that 8K polypeptide, without interfering with the functioning of the resulting sequence as a translation initiation element in plants.
Cistrons located downstream of the first cistron in a multicistronic RNA can only be translated if provided with a suitable translation initiation signal, such as an IRBS element. Thus, when it is stated that an IRBS element should be comprised in each intercistronic region, it is clear that such an IRBS element should only be included in the intercistronic region located upstream of each cistron which needs to be translated, or that by omitting or including an IRBS
element in a particular intercistronic region, translation of the downstream cistron can be turned off or on.
It is expected that the IRBS elements will comprise short sequences of about 20 nucleotides, preferably of about 30 nucleotides, particularly of about 50 nucleotides which are important for the function of the IRBS elements, and therefore I RBS elements comprising a nucleotide stretch of 20 consecutive nucleotides, preferably about 30 consecutive nucleotides, particularly about 50 consecutive nucleotides, more particularly about 100 consecutive nucleotides corresponding to the sequence of SEQ ID No 1 from nucleotide 1 to nucleotide 396, are also encompassed by the invention.
It is also expected that not all nucleotides of an IRBS element corresponding to the sequence of SEQ ID No 1 from nucleotide 1 to nucleotide 396 or from nucleotide 120 to 396 are equally important for the function of the IRBS and can be altered (i.e. deleted or substituted). Therefore, the invention also encompasses IRBS elements comprising a nucleotide sequence with a sequence identity of at least about 60%, preferably 75%, more preferably at least about 80%, particularly at least about 90% with the ribonucleotide sequence corresponding to the nucleotide sequence of SEQ ID No 1 from the nucleotide at position 1 to the nucleotide at position 396 or with the ribonucleotide sequence corresponding to the nucleotide sequence of SEQ ID
No 1 from the nucleotide at position 120 to the nucleotide at position 396.
For the purpose of this invention, the "sequence identity" of two related nucleotide or amino acid sequences, expressed as a percentage, refers to the number of positions in the two optimally aligned sequences which have identical residues (x100) divided by the number of positions compared. A gap, i.e. a position in an alignment where a residue is present in one sequence but not in the other is regarded as a position with non-identical residues. The alignment of the two sequences is performed by the Wilbur and Lipmann algorithm (Wilbur and Lipmann ,1983) using a window-size of 20 nucleotides or amino acids, a word length of 2 amino acids, and a gap penalty of 4.
Computer-assisted analysis and interpretation of sequence data, including sequence alignment as described above, can be conveniently performed using available software packages such as the programs of the IntelligeneticsT"" Suite (Intelligenetics Inc., CA).
It goes without saying that IRBS elements suitable for the invention, also encompass the regions of about 280 nt; particularly the regions of about 400 nt upstream of the coat protein open reading frame, isolated from variant PVX
isolates, such as PVX strain Hb (Genbank Accesion nr X72214), the resistance breaking strain characterized by the nucleotide sequence of Genbank Accesion nr M95516, a resistance breaking strain isolated from Argentina (Genbank Accesion nr Z34261 ), the South American isolate characterized by the cDNA sequence of X55802, strain X3 characterized by the cDNA sequence of D00344, or other such sequences which can be identified, e.g., in the various databases.
As used herein a "heterologous" region of a DNA or RNA is an identifiable segment of DNA or RNA within a larger DNA or RNA molecule, which is not found in association with the larger molecule in nature, particularly in a plant cell. In a particularly preferred embodiment, a heterologous region of DNA or RNA with respect to the IRBS elements of the invention, is a DNA or RNA
which is not originating from a plant virus, preferably not from a potyvirus.
It is clear that an IRBS element can be encoded by a DNA region, and in a context dependent way, a DNA-IRBS element and an RNA-IRBS element may both be referred to as IRBS element.
It should further be clear that a multicistronic RNA may comprise different IRBS elements, included in different intercistronic regions of one multicistronic RNA.
It also goes without saying that the multicistronic RNA can be produced from a chimeric multicistronic DNA, preferably stably integrated in the plant nuclear genome. Thus, in another embodiment of the first aspect of the invention, a method is provided for the production, preferably by coordinated expression, of the different polypeptides encoded by a polycistronic chimeric gene, in a plant cell. The polycistronic chimeric gene of the invention comprises a plant expressible promoter region and a suitable 3' transcription termination signal which functions in plant cells, operably linked to a transcribed DNA region, which when transcribed results in a multicistronic RNA comprising a heterologous IRBS element in each intercistronic region upstream of a cistron encoding a polypeptide of interest.
As used herein, the term "plant-expressible promoter" means a promoter which is capable of driving transcription in a plant cell. This includes any promoter of plant origin, but also any promoter of non-plant origin which is capable of directing transcription in a plant cell, e.g., certain promoters of viral or bacterial origin such as the CaMV35S or the T-DNA gene promoters. A
whole range of plant-expressible promoters is available to the person skilled in the art and includes constitutive, tissue-specific or inducible promoters such as but not limited to seed-specific promoters (e.g. W089/03887), organ-primordia specific promoters (An et al., 1996), stem-specific promoters (Keller et al., 1988), leaf specific promoters (Hudspeth et al. ,1989), mesophyl-specific promoters (such as the light-inducible Rubisco promoters), root-specific promoters (Keller et a1.,1989), tuber-specific promoters (Keil et aL, 1989), vascular tissue specific promoters (Peleman et al,. 1989), meristem specific promoters ( such as the promoter of the SHOOTMERISTEMLESS
(STIR gene, Long et al., 1996), primordia specific promoter (such as the promoter of the Antirrhinum CycD3a gene, Doonan et al., 1998) or the promoter of the gene disclosed in European Patent publication "EP"
0332104, or the promoter of the gene disclosed in WO 90/08826.
In addition to promoter regions recognized by RNA polymerase II, the methods and means of the invention also allow the use of promoters which result in uncapped RNAs, since translation which depends for its initiation on IRBS elements can also proceed in a cap-independent way.

The terms "cap", "capped", "uncapped" and "cap-independent" as used herein, refer to the structural modification which can be found at the 5' end of eukaryotic RNAs. The cap is a guanosine-triphosphate, methylated at the 7 position of the purine base and linked to the initial 5' nucleotide of the RNA
by a 5'-5' linkage.
Thus, suitable plant-expressible promoter regions for the methods of the invention include promoter regions recognized by RNA polymerase I
(normally involved in rRNA production), RNA polymerase III (normally involved in the production of small RNAs) or by single subunit bacteriophage RNA polymerases. It is clear that in the latter case, the appropriate bacteriophage RNA polymerase needs to be provided in a functional and properly located way to the plant cell comprising the chimeric multicistronic RNA for transcription. Such promoters are described in PCT publication W097/49814, which is hereby incorporated by reference thereto. Particularly preferred is a promoter having the consensus sequence for a T3 promoter, as described in US Patent 5,037,745 or a T7 promoter having the consensus sequence for a T7 promoter, as described by Dunn and Studier (1983; J. Mol.
Biol. 166: 477-535).
If the multicistronic RNA is uncapped, it is preferred that a sequence allowing cap-independent translation of the first cistron is included in the multicistronic RNA , preferably in the 5'UTR, if translation of that first cistron is desired.
Such a sequence can be an IRBS element as provided by the invention, but alternatives such as the translation enhancing domains from viral origin (as described in W097/49814) can be used.
Suitable 3' end regions include transcription termination signals and may comprise polyadenylation signals (e.g., of the octopine synthase gene [De Greve et al., 1982], of the nopaline synthase gene [Depicker et a1.,1982] or of the T-DNA gene 7 [Velten and Schell, 1985] and the like [Guerineau et al., 1991; Proudfoot ,1991; Safacon et al., 1991; Mogen et al., 1990; Munroe et al., 1990; Ballas et al., 1989).

In the case of transcription by a polymerase different from RNA polymerase II, such as transcription by a bacteriophage single subunit RNA polymerase, it is preferred that a suitable terminator for that RNA polymerase is included, such as e.g. the T3-~ or the T7-~ terminator, as described in W097/49814.
The nucleic acid molecules of the invention may further include other operably linked regulatory elements such as untranslated leader sequences (e.g.
cab22L leader from Petunia or the omega leader from TMV (Gallie et al.
1987), plant translation initiation consensus sequences (Joshi, 1987), introns (Luehrsen and Walbot 1991), and the like).
It is clear that the methods of the invention can be used to express different kinds of cistrons from a multicistronic nucleic acid, and it is believed that there is no limitation as to the polypeptide encoded by the cistrons. Preferred applications are the production of pest resistance proteins and/or pathogen resistance proteins from multicistronic RNA in plant cells. Particularly preferred pest resistance proteins are insect resistance proteins such as the insecticidal crystal proteins (ICP) from Bacillus thuringiensis (Bt), particularly a Bt ICP having insecticidal activity to at least one insect species. Especially preferred is a truncated Bt ICP, comprising the minimal toxic fragment.
Particularly preferred Bt ICP are CRYIAbS, CRY9C , CRYIBa, CRY3C, CRY3A, CRY1 Da and CRY1 Ea. As used herein, CRY1 Ab5 represents the CRYIAb described by Hofte et al.(1986); CR1~9C represents the CRYIH
described by Lambert et al. (1996); CRY1 Ba represents the CRYIB described by Brizzard and Whitely (1988); CRY3C represents the CRYIIID described by Lambert et al. (1992); CR1~3A represents the CRYIIIA described by Hofte et al. (1987); CRY1 Da and CRY1 Ea represent the bt4 and btl8 encoded ICPs, respectively, described in WO 90/02801, according to the classification proposed by Crickmore et al, Abstract presented at the 28th annual meeting of the Society for Invertebrate Pathology, 16-21 July 1995.
Other preferred insecticidal resistance proteins are the vegetative insecticidal proteins from B. thuringiensis, insecticidal toxins from Photorhabdus or Xenorhabdus spp., insecticidal a-amylase and protease inhibitors (Hilder et al. , 1987; Huesing et aL 1991 ), spider venom toxin or scorpion venom toxin.
In a particular embodiment of the first aspect of the invention, a method is provided for the selection of plant cells and plants producing a protein of interest to a high level. Thereto, plants are provided which comprise a chimeric multicistronic DNA according to the invention, wherein the last cistron of that multicistronic RNA encodes a selectable marker protein.
Selection of plant cells or plants which are resistant to a high level of a selective agent against which the selectable marker gene provides resistance, yields a population of plant cells or plants comprising a large proportion of cells or plants which also express the upstream cistrons encoding the polypeptides of interest to a high level. The selection process may be iterative, preferably with increasing concentrations of the selective agent.
The selection procedure may be preceded by a mutagenesis protocol performed on the pool of plant cells or plants, such as but not limited to irradiation with UV or ionizing radiation or treatment with known mutagenic chemicals.
Alternatively, mutagenesis by transposon or T-DNA tagging may be used. A
high concentration of selective agent should be interpreted as a concentration falling within the higher range of concentrations to which a plant cell transformed with the selectable marker gene, preferably under control of a constitutive promoter such as a nos promoter or a CaMV35S promoter , is resistant. Although selectable marker proteins such as phosphinotricin acetyltransferase, neomycin phosphotransferase II, gentamycinactetyl-transferase may be used, preferred selectable marker proteins are marker proteins which inactivate the selective agent by binding to it, preferably in a stoichiometrical manner, such as the bleomycin (phleomycin) binding proteins encoded by E. coli transposon TnS, the Bacillus spp plasmids of the pUB110 family and the phleomycin binding proteins from Streptomyces verticillus or Streptoalloteichus hindustananus (Sugiyama et al. 1994).
It is known that the identified nucleic acid sequences from PVX function as an IRBS in rabbit reticulocyte lysate and it is thus expected that IRBS elements selected from the group of: an IRBS element having a sequence corresponding to the nucleotide sequence of SEQ ID No 1 from nucleotide at position 1 to the nucleotide at position 396, an IRBS element having a sequence corresponding to the nucleotide sequence of SEQ ID No 1 from nucleotide at position 120 to the nucleotide at position 396, an IRBS element from a potex virus or a carla virus, an IRBS element comprising a nucleotide sequence with a sequence identity from about 60% to 100% to the ribonucleotide sequence corresponding to the nucleotide sequence of SEQ ID
No 1 from nucleotide at position 1 to the nucleotide at position 396 and an IRBS element comprising a nucleotide sequence with a sequence identity from about 60% to 100% to the ribonucleotide sequence corresponding to the nucleotide sequence of SEQ ID No 1 from nucleotide at position 120 to the nucleotide at position 396 can be used in eukaryotic cells, such as animal or human cells, and non-human eukaryotic organisms in similar embodiments as described above for plant cells. It goes without saying that, where appropriate, suitable promoter regions and transcription termination signals functioning in the target eukaryotic cells have to be employed.
According to the second aspect of the invention, methods and means are provided for the introduction of RNA into organelles of eukaryotic cells, preferably plastids, particularly chloroplasts, by inclusion of a heterologous RNA tractor sequence into the RNA to be translocated.
A preferred RNA tractor sequence is the region of about 400 nt, located upstream of the coat protein encoding cistron (or open reading frame) from a potexvirus or a carlavirus. Non-exhaustive lists of potex viruses and carla viruses have been mentioned elsewhere in this application. Apparently, a region comprising the first about 120 nt of this region, can be used to the same effect. Particularly preferred RNA tractor sequences are the regions of about 400 nt located upstream of the coat protein encoding cistron from the various PVX strains or the first about 120 nucleotides of these regions, particularly a ribonucleotide sequence corresponding to the sequence of SEQ
ID No 1 from the nucleotide at position 1 to the nucleotide at position 396, or a ribonucleotide sequence corresponding to the sequence of SEQ ID No 1 from the nucleotide at position 1 to the nucleotide at position 121, or a ribonucleotide sequence having at least about 60%, preferably at least about 75%, more preferably at least about 80%, particularly at least about 90%, to about 100 % sequence identity to such an RNA tractor sequence.
It is also possible to use an about 1400 nt RNA tractor sequence from PVX
spanning the sequence of SEQ ID No 1 as tractor sequence. Preferably, the RNA of interest to be targeted to the organelles, preferably to the plastids, is inserted immediately in front, i.e. upstream of the coat protein cistron.
Using the RNA tractor sequences of the invention it thus becomes possible to introduce an RNA comprising a sense sequence or an antisense sequence, preferably a antisense sequence, corresponding to an endogenous plastid gene, such as the large subunit of the ribulose biphosphate carboxylase. In a another embodiment of the invention, the RNA to be introduced in the plastids comprises a ribozyme or encodes an RNA capable of binding a protein. The latter embodiment may be useful for titrating regulatory RNA binding proteins of a plastid and thus indirectly influencing the endogenous plastid RNA
normally binding to such RNA.
It is now also possible to deliver an RNA comprising a coding sequence for a polypeptide of interest, which further comprises an operably linked RNA
tractor sequence and which is preferably transcribed from a nuclear encoded chimeric gene, into plastids of a plant cell, preferably into the chloroplasts of a plant cell. Therefore a chimeric gene is provided integrated in the nuclear DNA of a plant cell, comprising the following operably linked DNA sequences:
a) a plant expressible promoter region;
b) a DNA region encoding an RNA tractor sequence;
c) a heterologous DNA region encoding a protein of interest; and d) a 3' transcription termination signal which functions in the plant cell.
When using the mentioned sequence of about 120 nucleotides of a potex virus or of a carla virus as RNA tractor sequence for delivering a protein or polypeptide encoding RNA to the plastids or chloroplasts of a plant cell, it is preferred that the protein or polypeptide encoding cistrons be equipped with suitable signals for translation in those plastids or chloroplasts. This could be achieved e.g. by inserting the above mentioned Shine and Dalgarno like sequences (or the like) upstream of those cistrons.
The methods and means of this aspect of the invention are thus an alternative for the import of proteins and peptides in plastids, particularly in chloroplasts, via the inclusion of a so-called transit peptide in the imported proteins or polypeptides.
Preferred heterologous DNA regions encode a protein conferring herbicide resistance, preferably providing resistance to glyphosate or glufosinate, such as a mutant enolpyruvylphosphate shikimate synthase or a phosphinotricin acetyltransferase. Other preferred heterologous DNA regions encode enzymes involved in lipid metabolism or in photosynthesis. The RNA which is introduced in the plastids, preferably the chloroplast, may be multicistronic.
In a further embodiment of this invention, the identified IRBS elements of the invention (or the Shine and Dalgarno like sequences thereof) can be put to practical use for large scale expression of commercially valuable proteins or peptides in prokaryotic host cells, e.g., E. coli or Bacillus strains.
In a next aspect of the invention the novel IRBS elements from potex viruses or from carla viruses, preferably from PVX, particularly the nucleotide sequence comprising the nucleotide sequence of SEQ ID No 1 from nucleotide 1 to 396, from nucleotide 120 to 396 or their corresponding ribonucleotide sequence, can be used for cap-independent translation of a protein of interest in a eukaryotic cell, preferably a plant cell. To this end, a DNA region encoding a ribonucleotide sequence with a sequence identity from about 60% to 100% to the ribonucleotide sequence corresponding to the nucleotide sequence of SEQ ID No 1 from nucleotide at position 1 to the nucleotide at position 396 is operably linked to a eukaryotic promoter, preferably a plant-expressible promoter, to a heterologous DNA region encoding the protein and to a 3' transcription termination signal functioning in the eukaryotic cells, preferably plant cells. Preferably the DNA region encoding the IRBS element is joined in between the promoter region and the protein encoding region, so that in the resulting RNA , the IRBS element is included in the 5' untranslated region upstream of the cistron encoding the protein of interest.
Preferably the chimeric genes of the invention are accompanied by a marker gene, preferably a chimeric marker gene comprising a marker DNA that is operably linked at its 5' end to a plant-expressible promoter, preferably a constitutive promoter, such as the CaMV 35S promoter, or a light inducible promoter such as the promoter of the gene encoding the small subunit of Rubisco; and operably linked at its 3' end to suitable plant transcription termination and polyadenylation signals. It is expected that the choice of the marker DNA is not critical, and any suitable marker DNA can be used. For example, a marker DNA can encode a protein that provides a distinguishable "color" to the transformed plant cell, such as the A1 gene (Meyer et al., 1987) or Green Fluorescent Protein (Sheen et al., 1995), can provide herbicide resistance to the transformed plant cell, such as the bar gene, encoding resistance to phosphinothricin (EP 0242236), or can provide antibiotic resistance to the transformed cells, such as the aac(6) gene, encoding resistance to gentamycin (W094/01560).
Methods to introduce chimeric genes into plant cells and plants are well known in the art, and are believed not to be critical for the methods of the invention. Transformation results in either transient or stably transformed cells (whereby the chimeric genes are stably inserted in the genome of the cell, particularly in the nuclear genome of the cell). Methods to introduce RNA
molecules into plant cells are also well known (see Examples; WO 97/49814).
Although it is clear that the invention can be applied essentially to all eukaryotic cells and organisms, particualrly to all plant species and varieties, the invention will be especially suited for plants with a commercial value.
Particularly preferred plants to which the invention can be applied are corn, oil seed rape, soybean, lineseed, wheat, grasses, vegetables, alfalfa, legumes, a _ ' 32 plant of a Brassica spp., tomato, soybean, lettuce, cotton, rice, barley, potato, tobacco, sugar beet, sunflower, and ornamental plants such as carnation, chrysanthemum, roses, tulips and the like.
The obtained transformed plant can be used in a conventional breeding scheme to produce more transformed plants with the same characteristics or to introduce the chimeric genes of the invention in other varieties of the same or related plant species. Seeds obtained from the transformed plants contain the chimeric genes of the invention as a stable genomic insert.
The following non-limiting Examples describe the construction of chimeric multicistronic DNA and RNA molecules and the use of nucleic acids for the production of the polypeptides of interest in plant cells and plants. Unless stated otherwise in the Examples, all recombinant DNA techniques are carried out according to standard protocols as described in Sambrook et al. (1989) Molecular Cloning: A Laboratory Manual, Second Edition, Cold Spring Harbor Laboratory Press, NY and in Volumes 1 and 2 of Ausubel et al. (1994) Current Protocols in Molecular Biology, Current Protocols, USA. Standard materials and methods for plant molecular work are described in Plant Molecular Biology Labfax (1993) by R.D.D. Croy, jointly published by BIOS Scientific Publications Ltd (UK) and Blackwell Scientific Publications, UK.
Throughout the description and Examples, reference is made to the following sequences:
SEQ ID No 1: 3' end region of a cDNA of the PVX strain RNA spanning the coat protein encoding sequence.
SEQ ID No 2: nucleotide sequence of a suitable test hairpin.
SEQ ID No 3: wt sequence upstream of the coat protein.
SEQ ID No 4: mutant sequence of SEQ ID No 3.
SEQ ID No 5: sequence upstream of the about 25kDa encoding cistron of PVX .

Examples Example 1. The 8 kDa protein and coat protein are expressed from one dicistronic mRNA in transgenic potato plants For the construction of a plasmid encoding the dicistronic RNA under control of a CaMV35S promoter and potato transformation, the following protocol was used. cDNA was synthesized from PVX RNA by the method of Gubler &
Hoffman (1983), and sequenced to identify ORFS. A 1.2 kb cDNA fragment spanning the 3' half of the 12 kDa (180 nt) ORF, the 8 kDa (210 nt) protein open reading frame and the CP (1.0 kb) open reading frame was isolated by digestion with Xbal and SaA. The SaA site was blunt-ended using the Klenow fragment of DNA polymerase I and inserted into the Xbal and Smal sites of the plant expression vector pBINl9 (Bevan et al., 1984 NAR 12, 8711-8721) under control of a CaMV35S promoter. This vector was transformed into Agrobacterium tumefaciens strain LBA4404 by standard procedures (Horsch et al., 1985). Transgenic plants were obtained from potato tuber discs of Russett Burbank using the transformation method as described by Xu et al.
( 1995) Eleven lines of transgenic plants were generated which express the dicistronic construct consisting of both the 8 kDa and CP ORFs of PVX. These plants were subjected to Western blot analysis in the following way.
Protein extracts from transgenic leaf tissue were prepared and subjected to electrophoresis on an SDS-12.5% polyacrylamide gel (Laemmli, 1970).
Following electrophoresis, proteins were electrotransferred onto nitrocellulose filters and immunoblotted with different rabbit antibodies specific for either the 8 kDa protein or the CP of PVX. Protein was detected enzymatically using goat anti-rabbit IgG conjugated with alkaline phosphatase (Gibco BRL) as the secondary antibody. Plant protein concentrations were determined by UV
spectrophotometry. A serial dilution of known quantities of PVX CP spotted on the same filter was used to determine the quantity of PVX CP expressed in transgenic plants . The percentage of CP expressed in transgenic plants was then determined by comparing the CP levels to known concentrations on a Western blot as a fraction of total plant protein added.
Western blot analysis using antibodies specific for the PVX CP resulted in the detection of a protein comparable in size to the control PVX CP for some lines (Fig. 1 a, compare lanes 1, 2 and 4 with lane 8). No CP could be detected for the lines shown in lanes 3, 5 and 6, or in the non-transformed plant used as a control (lane 7). The level of accumulation of CP in transgenic plants was determined by comparison of protein samples from transgenic lines with serial dilutions of known quantities of PVX coat protein on an immunoblot. The CP
level varied within a range of 0.05-0.2% of total soluble protein among different transgenic plants. One typical transgenic plant line, designated 304, was chosen for further studies (Fig. 1 a, lane 1 ).
To determine whether the first ORF of the 8 kDa/CP dicistronic construct is also expressed in these transgenic plants, it was necessary to raise antibodies specific for the 8 kDa protein. Since this protein is relatively small and hydrophobic, it was fused with ~yIFN and over-expressed in E. coli.
Antibodies were raised against the purified 8 kDa-~yIFN fusion protein and utilized to detect the presence of 8 kDa protein in transgenic plant line 304, using standard techniques. A band, 7.8 kDa in size, is seen only in protein extracts from transgenic or PVX-infected plants (Fig. 2 a, lanes 3, 4 and 5) but not in non-transgenic or non-infected plants (Fig 2a, lanes 1 and 2). An extract containing the 8 kDa-yIFN fusion protein is depicted in lane 6, and was included as a positive control. Since the 8 kDa protein was prepared as a fusion protein in E. coli, the antibodies obtained are highly specific to the kDa protein and did not cross-react with any plant host proteins (Fig. 2a).
These antibodies were also preadsorbed to the extracts from untransformed plants as an additional precaution.
To determine whether the in vivo translation of both 8 kDa and CP takes place from full-length dicistronic mRNA transcripts or from fragmented but functional monocistronic mRNAs, transcript sizes were determined by Northern blot analysis.
RNA was extracted in the following way. Leaf tissue (0.4 g) from transgenic plants was frozen in liquid nitrogen and ground to a powder in a prechilled mortar. This powder was resuspended in 3 ml extraction buffer containing 0.2 M Tris-HCI pH 9.0, 0.4 M LiCI, 25 mM EDTA, 1 % SDS and 0. 1 M sodium acetate in DEPC-treated water. The solution was first extracted with an equal volume of Tris-HCI saturated phenol, followed by phenol-chloroform (1: 1 v/v), and two extractions with chloroform. The RNA was precipitated in two volumes of 95 % ethanol at - 20°C for 1 h, then pelleted by centrifugation at 5 800 g for 20 min. The pellet was washed with 70 % ethanol, vacuum-dried for 1 5 min, and redissolved in 100 NI of 0.1 M Tris-EDTA pH 7Ø
For Northern blot analysis, total RNA (40 Ng) extracted from leaf tissue of both transgenic and non-transgenic plants was loaded onto a 1 % agarose gel containing 10% formaldehyde in MOPS buffer pH 7.0, and subjected to electrophoresis. The RNA was transferred onto nitrocellulose filters overnight and incubated in a prehybridization solution containing 1 M NaCI, 5 mM
EDTA, 100 mM Tris-HCI pH 7.5, 0.1 % SDS and 100 mg/ml Homomix 1 (containing 2 g yeast RNA, 0.3 M KOH and 8.4 g urea in 20 ml total volume) for 4 h at 55 °C. Filters were hybridized overnight with denatured DNA
probes containing genes encoding either the 8 kDa protein or the CP of PVX. Probes were labelled with [a-32P]dATP (3000 Ci/mmole) by random priming according to the protocol of Feinberg & Vogelstein (1983). Filters were washed once in 6 x SSC and 1 % SDS at 55 °C for 20 min, and twice in 1 x SSC and 0.1 %
SDS
at 55 °C for 20 min. They were dried and exposed to X-ray film (Amersham RPN 30) for 3-5 days. To determine the amount of PVX RNA which could be detected by Northern blot analysis, a serial twofold dilution of a known quantity of PVX RNA (1 Ng) was spotted onto the same nitrocellulose filter and used to estimate the amount of PVX RNA expressed in transgenic plants.
Two non-overlapping cDNA probes corresponding to the genes encoding the 8 kDa and CP, respectively, were used in this study. A single prominent band of 1.3 kb, identical in size to the full-length in vitro transcript (1.26 kb), was , 36 detected in total RNA extracted from leaf tissue of transgenic plants using either cDNA probe (Figs 1 b and 2 b, lanes 1 and 3). No other PVX-specific bands were detected in these lanes or from RNA extracted from non-transformed plants (Figs 1 b and 2 b, lane 2). PVX control RNA (1-10 ng) can be detected under the same hybridization conditions.
Example 2. The CP is expressed from a dicistronic mRNA by internal ribosome binding To determine whether the 8 kDa and CP are expressed from the dicistronic construct by internal ribosome binding, tobacco protoplasts were electroporated with transcripts derived fror:~ various cDNA constructs of PVX
(Fig 3a).
Two cDNAs, one similar to the dicistronic construct expressed in the transgenic plants (PVX2), and the other representing an artificial subgenomic mRNA of the PVX coat protein (PVX3), were cloned into plasmid pBS+
(Stratagene) under the transcriptional control of the T7 promoter. The 5' terminus of PVX2 is located approximately 180 bases upstream of the ATG
codon of the gene encoding the 8 kDa protein. PVX3 was derived from a Scal and Hindlll double digest of the original PVX cDNA. The 5' terminus of the corresponding RNA transcript is 155 bases upstream of the AUG codon of the CP gene. A sequence expected to form a stable hairpin (5' TGCTTTCTACAACCCCCCGCGGGGTCGACCCCCCGGGGGGTCCCGGGG
CCAC 3'; SEQ ID No 2) was introduced in front of the dicistronic construct PVX2 to generate PVX2' . Capped, in vitro transcripts were synthesized by T7 RNA polymerase as described by the manufacturer (Promega).
Protoplasts were prepared from uninoculated Nicotiana glutinosa leaves according to the method of Otsuki & Takebe (1972), and electroporation was carried out as described by Luciano et al. (1987). A 450 NI suspension of protoplasts (1 X 106) in electroporation buffer (330 mM sorbitol, 1 mM
potassium phosphate pH 7.0, 150 mM KCI) was electroporated using a ProGenerator II electroporation unit (Hoefer Scientific Instruments) at 950 NF, 130 V pulse amplitude and 3.5 rnm electrode gap; 6 Ng of each in vitro transcript as well as full-length PVX RNA were used. Protoplasts were incubated for 24 h in incubation media as described by Luciano et al. (1987).
Protoplasts (5 x 104) were collected by centrifugation at 5000 g for 10 min, ground on ice in 2 X cold Laemmli buffer, and centrifuged at 4°C and 10000 g for 10 min. Five independent experiments were carried out for each construct, using approximately 1 X 104 protoplasts per sample. PVX 8 kDa and CP expression were determined by Western blot analysis. RNA stability of each construct in protoplasts was assessed by Northern blot analysis, using RNA isolated at the same time as protein was extracted and prepared in the RNA extraction buffer described previously.
Expression of both 8 kDa and CP was determined by Western blot analysis using antibodies specific to the 8 kDa and CP (Fig. 3 b, c). Protoplasts electroporated either with purified PVX RNA or in the absence of RNA were included as positive and negative controls, respectively (Fig. 3b, lanes 1 and 4, Fig. 4 c, lanes 1 and 5). Expression of both 8 kDa and CP was detected in protoplasts electroporated with the dicistronic 8 kDa/CP transcript PVX2 (Fig.
3 b, c, lane 2). While no 8 kDa protein could be detected from protoplasts electroporated with RNA from PVX2' containing the hairpin structure (Fig. 3 b, lane 3), the level of CP expressed from the same construct was virtually unaffected (Fig. 3 c, lane 3). The CP was expressed in protoplasts electroporated with the artificial subgenomic transcript for the CP PVX3 (Fig.

c, lane 4). CP expression was also detected even when the in vitro transcripts were uncapped; however, 8 kDa protein expression was not detected.
RNA stability was assessed from the protoplast system 24 h post electroporation by Northern blot analysis (Fig. 3d, e). Again, no fragmented RNA transcripts were detected from protoplasts expressing CP from dicistronic transcripts in the presence or absence of the hairpin structure (Fig.
3d, e, lanes 1 and 2). RNA corresponding to the artificial subgenomic construct (PVX3) was found to be the appropriate size (0.9 kb) (Fig. 3e, lane 3). No PVX-specific RNA transcripts could be detected from non-electroporated protoplasts used as controls (Fig. 3d, lane 3, e, lane 4).

Example 3. Use of the PVX IRBS element to express a heterologous dicistronic mRNA comprising two reporter genes.
The ability of the PVX RNA derived from the non-coding region upstream of the CP ORF to allow translation of a downstream cistron of a bicistronic mRNA comprising two heterologous cistrons encoding the reporter proteins (i-galactosidase ((i-Gal) and chloramphenicol acetyltransferase (CAT) was examined in the following way.
A 0.4 kb Xbal and Taql cDNA fragment of PVX (nt 1 to nt 396 of SEQ ID No 1 ) containing the sequence upstream of the ATG codon of the PVX CP gene (including the 8 kDa ORF and 177 nt upstream of this ORF) was placed between ~-Gal and CAT reporter open reading frames by blunt-end ligation, and is referred to as ~PVXCAT. The Taql restriction site is located 7 nt upstream of the ATG codon of the CP gene. An Xbal-Taql cDNA fragment was also inserted in the reverse orientation to generate XVPCAT, used in this study as a negative control. A sequence expected to form a stable hairpin (SEQ ID No 2) was introduced in front of construct (iPVXCAT, to generate (i'PVXCAT. The a~PVXCAT construct was generated by Acd and Taql digestion of the PVX fragment removing a fragment corresponding to nt 120-396 of SEO ID No 1). The used RNAs are depicted in a schematic way in Fig 4a. All reporter gene constructs were under the transcriptional control of the T7 promoter and T7 transcripts were generated as recommended by the manufacturer (Promega). The (uncapped) RNAs were used to electroporate protoplasts as described in Example 1. ~-Gal and CAT activities were determined by standard procedures (Miller, 1972; Gorman et al., 1982). The results are represented in Fig 4b.
Insertion of a sequence expected to form a stable hairpin upstream of the ~-Gal cistron suppressed ~-galactosidase activity in ~'PVXCAT to background levels, indicating that this structure had effectively blocked translation (Fig. 4 b, compare constructs ~3PVXCAT and ~OPVXCAT to a'PVXCAT). However, CAT activity was found both in the presence or absence of the hairpin structure (Fig. 4c, compare constructs aPVXCAT and ~i'PVXCAT to PVXCAT).
Deletion of a portion of the PVX sequence in construct (3~PVXCAT resulted in a dramatic reduction in CAT activity to background levels (Fig. 4c), while the ~i-Gal activity was unaffected. No CAT activity was observed from the construct XVPCAT containing the PVX fragment in the reverse orientation.
Example 4. PVX-specific CP and RNA transcripts expressed from a nuclear encoded chimeric gene in transgenic potato are located in chloroplasts.
To determine whether in the transgenic plants of Example 1, the PVX RNA or CP is present in chloroplasts, these organelles were purified on a Ficoll gradient from the transgenic potato plants described in Example 1, in the following way.
Transgenic and non-transformed potato leaves (5 g) were harvested and homogenized in 30 ml of cold grinding buffer (50 mM HEPES-KOH pH 7.3, 330 mM mannitol, 0.1 % BSA, 1 mM MgCl2, 1 mM MnCl2, 2 mM Na2EDTA, 1 mM DTT). Homogenate was filtered through 3 layers of cheesecloth and the filtrate was pelleted at 5000 g for 5 min. The pellet was resuspended in 1 ml grinding buffer, overlaid on a 50% Ficoll gradient and subjected to centrifugation at 13,000 g for 10 min. Intact chloroplasts (lower band) were collected with a syringe and washed three times with 50 mM HEPES-KOH pH
8.0, and 330 mM mannitol. The suspension was incnt,atPr~ .r, hnth R~laco 0 (10 Ng/ml) and proteinase K (200 Ng/ml) on ice for 30 min to ensure that no cytoplasmic RNA or protein remained associated with the chloroplasts. EDTA
was added to 1 mM and the chloroplasts were rewashed in resuspension buffer and subjected to electrophoresis on a 12.5% polyacrylamide gel.
Protein was extracted by grinding the chloroplasts in Laemmli buffer and immunoblotted with rabbit antibodies specific for the CP of PVX. RNA was purified from ground chloroplasts by extraction with phenol and subjected to Northern blot analysis.

The isolated chloroplasts were treated with both RNase and protease to remove any externally associated cytoplasmic RNA or protein, and tested for the presence or absence of PVX gene products (Figure 5). PVX CP was detected from both total leaf extracts (Figure 5A, lane 5) as well as from purified chloroplasts (Figure 5A, lane 4) of transgenic plants by Western blot analysis. No PVX CP was found in either the leaf extract or purified chloroplasts of nontransformed potato used as controls (Figure 5A, lanes 3 and 2).
Similarly, PVX RNA was observed from both total leaf RNA and RNA isolated from purified chloroplasts of transgenic, but not from nontransformed plants, by Northern blot analysis (Figure 5B, compare lanes 1 and 2 with lanes 3 and 4). To ensure that all viral gene products are derived from within the chloroplasts, and are not merely externally associated with the organelle, a purified chloroplast suspension from non transformed potato was preincubated for 30 min with 50 ng of both PVX CP and RNA prior to RNase and protease treatment (Figures 5A, lane 1 and figure 5B, lane 5). No RNA or protein was detected in these reconstitution experiment.
PVX coat protein was identified in transgenic potato leaf tissue by colloidal gold labeling. Antibodies directed towards the PVX coat protein were preabsorbed with extracts from non-transformed plant tissue prior to labeling.
Gold particles accumulated within selected areas of the chloroplasts. Gold particles were also found within the cytoplasm and large vacuole of transgenic plant tissue. Few gold particles were found within non-transformed potato tissue used as a negative control.
Protoplasts were generated from these transgenic plants and used to determine whether PVX CP synthesis by chloroplast ribosomes is possible (Figure 6). Protoplasts incubated in the presence or absence of chloramphenicol were tested for production of PVX CP as well as chloroplastic and cytoplasmic-derived proteins by immunoprecipitation and dot blot analysis. The level of actin, a cytoplasmic protein, remained constant in the presence or absence of chloramphenicol (Figure 6A). Actin levels were drastically reduced upon incubation of protoplasts with 10 Ng/ml cycloheximide. Chloroplasts prepared from protoplasts ground in extraction buffer and treated with RNase and protease to remove cytoplasmic derived gene products were tested for PVX CP expression (Figure 6A, lane 3). PVX
CP was detected only from chloroplasts of cells grown in the absence of chloramphenicol (Figure 6A, lanes 3 and 4). P700, a chloroplast-specific protein complex belonging to Photosystem 1 (PSI), was also detected from the chloroplast preparation in the absence of chloramphenicol (Figure 6A, lanes 5 and,6). No actin could be detected from prepared chloroplasts in the presence or absence of chloramphenicol, indicating that the proteins detected from these samples are chloroplast-derived (Figure 6A, lanes 7 and 8). In addition, no PVX CP was detected from chloroplast prepared from uninfected non-transformed plants used as negative controls (Figure 6B, lanes 3 and 4), while actin and P700 levels remained similar to levels detected in protoplasts generated from the transgenic lines (Figure 6B lanes 1 and 2, 5 and 6).
Example 5. The sequence upstream of the PVX CP leader sequence comprises prokaryotic-like ribosome recognition sequences.
Nucleotide sequence comparisons.
Sequence complementarity was identified (using the programme SEQAID) between a portion of a nucleotide stretch encompassing thirty-three nucleotides upstream of the AUG codon of the CP RNA and nucleotides 126-132 and 371-376 of 16S rRNA in E. coli. Upon further sequence comparison of the PVX genome, a similar stretch of nucleotide sequence complementarity was located between a similar region upstream of the initiation codon of the gene encoding the 25K protein and the CP gene leader sequence (Figure 7B).
Expression of PAP in E. coli with PVX CP gene leader sequence.
A series of oligonucleotide primers (Fig 7A) were designed and placed in front of the gene encoding PAP, as leader sequence and inserted into the Xbal and Hindlll sites of plasmid P1 PL (Rommens et al., 1983). P1 PL contains a synthetic sequence from a bacteriophage early promoter which can be readily expressed in E. coli. Included are: PVX'~, a thirty-three nucleotide primer containing the sequence immediately upstream of the CP gene of PVX.
PVXm, containing nucleotide substitutions within this sequence, and S/D, containing the classical Shine-Dalgarno sequence. All constructs were confirmed by sequence analysis.
Expression of PAP was determined using both dot and Western blot analysis (Figure 8). PAP, a ribosome-inactivating protein, is lethal to both eukaryotes and prokaryotes. However, when constitutively expressed in E. coli, PAP can accumulate within inclusion bodies where it remains sequestered and is thus prevented from inactivating cellular ribosomes. PAP expression from the construct containing PVX'~-PAP and S/D-PAP was determined to be 1.3 mg/L
and 4.0 mg/L, respectively (Figure 8A, lanes 1 and 5, and Figure 8B, lanes 2 and 4). PAP levels were greatly reduced (0.2 mg/L) from PVXm-PAP, containing the mutated leader sequence (Figure 8A, lane 2, Figure 8B, lane 5). Purified PAP and cells expressing the PAP gene in the antisense orientation were used as positive and negative controls, respectively (Figure 8A, lanes 4 and 3, Figure 8B, lanes 1 and 3).
Example 6. Use of the PVX IRBS element to express a downstream cistron of a heterologous dicistronic mRNA in chloroplasts The ability of the PVX sequence upstream of the CP ORF to allow transport to, and translation of a downstream cistron, of a dicistronic mRNA comprising two heterologous cistrons encoding the reporter proteins Renilla Luciferase and Firefly Luciferase or the two insecticidal crystal proteins cryl Ab and cry9C in chloroplasts is examined in the following way.
The IRBS element of PVX (nt 1 to nt 396) of SEQ ID No 1 is amplified from the cDNA clone pHX117A and cloned in the vector pGEM-T Easy (Promega).
A 0.4 kb EcoRl cDNA fragment is cloned in the EcoRl site of pGVE7 (CaMV35S promoter-cab22L leader-Renilla luciferase ORF-Firefly Luciferase ORF-3'35S) between the Renilla Luciferase (Rluc) (Promega) and Firefly Luciferase (Luc) (Promega) reporter open reading frames (pGVEl8). To resemble the correct nucleotide spacing between the IRBS element and the ATG of the Luc gene a combined deletion/insertion overlap extension PCR is performed on pGVEl8 leading to pGVE21. As a control the plasmids pGVE3 (35S promoter-cab22L leader-Firefly Luciferase ORF-3'35S) and pGVEl5 (35S promoter-cab22L leader-Renilla Luciferase ORF-3'35S) are used. The used plasmids are depicted in a schematic way in Table I. All the PCR-based cloning steps are controlled by sequencing analysis. The plasmids are introduced in tobacco protoplasts by electroporation as described in Meulewaeter et al. (1992). Chloroplasts and proteins are isolated as described in Example 4. RNA is isolated as described in Jacobs et al. (1997).
The Rluc and Luc activities are determined by the Dual-Luciferase Reporter Assay System (Promega) and measured using the TD-20/20 Luminometer (Turner Designs).
The Rluc and Luc activities of extracts of total protoplasts, isolated chloroplasts and the cytoplasmic fraction are determined. In protoplasts electroporated with pGVE21 (PVX IRBS element), pGVE7 and pGVEl5 Rluc activity is detected in total protoplasts and the cytoplasmic fraction.
Luciferase activity is detected in the total and chloroplastic fraction of protoplasts electroporated with pGVE21 (PVX IRBS element) and in total and cytoplasmic fractions of protoplasts electroporated with the Luciferase control plasmid pGVE3. No significant Luciferase activity is detected in protoplasts electroporated with pGVE7 (no PVX IRBS element) and the Rluc control plasmid pGVEl5. The Luciferase activity data are confirmed with Western blot analysis of the LUC protein. Northern blot analysis of the different fractions shows that the pGVE21 RNA, and not the RNA encoded by the other genes, is targeted to the chloroplast.
In pGVE21, the cab22L is replaced by a sequence forming an energy-rich stem-loop structure followed by the PVX IRBS element (pHGVE21). Upon introduction of this plasmid in tobacco protoplasts by electroporation both Rluc and Luc are expressed in chloroplasts.

In pHGVE21 the Rluc is replaced by the crylAb coding region encoding a toxic truncated protein from amino acid position 1 to amino acid position 616 and Luc by the cry9C coding region encoding a toxic truncated protein from amino acid position 1 to amino acid position 658 (pHGVE21 BT, see Hofte et al. (1986) and Lambert et al. (1996) for the sequence of the CrylAb and Cry9C proteins, respectively). Upon introduction of this plasmid in tobacco protoplasts by electroporation both crylAb and cry9C are expressed in chloroplasts.
The same results are obtained in transgenic maize or tobacco plants containing the construct with Rluc and Luc as open reading frames or with the construct containing the open reading frames of truncated fragments of the Bt genes cryl Ab and cry9C.
Table I
PGVE3: P35S>cab22L>Luc>3'35S
PGVE7: P35S>cab22L>Rluc>Luc>3'35S
PGVE15: P35S>cab22L>Rluc>3'35S
PGVE21: P35S>cab22L>Rluc>PVX IRBS>Luc>3'35S
PHGVE21: P35S>stemloop>PVXIRBS> Rluc>PVX IRBS>Luc>3'35S
PHGVE21BT: P35S>stemloop>PVXIRBS>crylAb>PVXIRBS>cry9C>3'35S

References An et al. (1996) The Plant Cell 8, 15-30 Ausubel et al. (1994) Current Protocols in Molecular Biology, Current Protocols, USA.
Ballas et al. (1989) Nucleic Acids Research 17: 7891-7903 Basso et al. (1994) J. Gen. Virology75: 3157-3165 Belsam and Sonenberg (1996) Microbiol. Reviews 60(3): 499-511 Bernstein et al. (1997) J. Biol. Chem. 272: 9356-9362.
Bevan etaL (1984) Nucl. Acids Res. 12: 8711-8721 Brizzard and Whitely (1988) Nucl. Acid Resarch 16: 4168-4169 Browning (1996) Plant Mol. Biol. 32:107-144 Crickmore et aG(1995) Abstract presented at the 28th annual meeting of the Society for Invertebrate Pathology, 16-21 July.
R.D.D. Croy (1993) Plant Molecular Biology Labfax, jointly published by BIOS
Scientific Publications Ltd (UK) and Blackwell Scientific Publications, UK.
Davies and Abe (1995). Methods Cell Bio150, 209-222.
De Greve et al. (1982) J. Mol. Appl. Genet. 1: 499 Depicker et al.(1982) J. Mol. Appl. Genet. 1: 561 Doonan et al. (1998) in "Plant Cell Division" (Francis, Duditz and Inze, Eds.) Portland Press, London.
Dunn and Studier (1983) J. Mol. Biol. 166: 477-535.
Futterer et al. (1993) Cell 73: 789-802 Gallie et al. (1987) Nucl. Acids Res. 15: 8693-8711 Gan and Rhoads (1996) J. Biol. Chem. 271: 623-626 Gorman et al. (1982) Molecular and Cellular Biology 2: 1044-1051 Gubler & Hoffman (1983) Gene 25: 263-269 Guerineau et al. (1991 ) Mol. Gen. Genet. 226:141-144 Hefferon (1996) PhD thesis University of Toronto.
Hefferon and AbouHaidar (1996) Abstract presented at the Xth International Congress of Virology 11-16 August 1996 Hefferon et al. (1994) Abstract presented at American Society for Virology meeting of July 9-13, 1994 Hefferon et al. (1996) Abstract presented at the American Society for Virology meeting of July 13-17, 1996 Hefferon et al. (1997a) Theor. Appl. Genet. 94: 287-292.
Hefferon et al. (1997b) J. General Virology78:3051-3059.
Hilder et al. (1987) Nature 330: 160-163 Hofte et al. (1986) Eur. J. Biochem. 161: 273-280 Hofte et al. (1987) Nuc. Acids Res. 15: 7183 Horsh et al. (1985) Science 227: 1229-1231 Hudspeth et al. (1989) Plant Mol Biol 12, 579-589 Huesing et al. (1991 ) Plant Physiol. 96: 993-996 Huisman et al. (1988) J. Gen. Virology69: 1789-1798 Ivanov et al. (1997) Virology 232: 32-43 Izuka et al. (1994) Mol. Cell Biol. 14: 7322-7330 Jackson and Kaminski (1995) RNA 1: 985-1000 Jacobs et al. (1997) Plant J. 12 885-893 Joshi (1987) Nucleic Acid Research 15, 9627-9639 Keegstra (1989) Cell 56, 257-253 Keil et al. (1989) EMBO J. 8, 1323-1330 Keller et al. (1988) EMBO J. 7, 3625-3633 Keller et al. (1989) Genes Devel. 3, 1639-1646 Kozak (1989) Journal of Cell Biology 108: 229-241 Laemmli (1970) Nature 227: 680-685 Lambert et al. (1996) Appl. and Env. Microbiol. 62: 80-86 Lambert et al. (1992) Gene 110: 131-132 Levis and Astier-Manifacier (1993) Virus Genes 7: 367-379 Long et al. (1996) Nature, 379, 66-69 Luciano et al. (1987) Plant Science 51: 295-303 Luehrsen and Walbot (1991) Mol. Gen. Genet. 225: 81-93, Macejak and Sarnow (1991 ) Nature 353: 90-94 Meulewaeter et al. (1992) J Virol. 66. 6419-6428 Meyer et al. (1987) Nature 330: 667 Miller (1972) Experiments in Molecular Genetics, pp 352-355. Cold Spring Harbor, NY; Cold Spring Harbor Laboratory.
Mogen et al. (1990) Plant Cell, 2: 1261-1272 Munroe et al. (1990) Gene, 91: 151-158 Nanbru et al. (1997) J. Biol. Chem. 272: 32061-32066 Oh et al. (1992) Genes and Development 1: 1643-1653 Otsuki and Takebe (1972) Virology49:188-194 Peleman et al. (1989) Gene 84, 359-369 Pelletier and Sonenberg (1988) Nature 334: 320-332 Proudfoot (1991) Cell, 64:671-674 Riechmann et al. (1991 ) Virology 185, 544-552 Rommens et al. (1983) Nucl. Acids Research 11: 5921-5940 Safacon et al. (1991 ) Genes Dev 5: 141-149 Sambrook et al. (1989) Molecular Cloning: A Laboratory Manual, Second Edition, Cold Spring Harbor Laboratory Press, NY
Schoelz and Zaitlin (1989) Proc. Natl. Acad. Sci. 86: 4496-4500 Sheen et al. (1995) The Plant Journal8: 777-784 Smeekens et al. (1990) TIBS 15: 73-76 Stein et al. (1998) Mol. Cell. Biol. 18: 3112-3119 Sugiyama et al. (1994) Gene 151: 11-16.
Teerink et al. (1995) Biochim. Biophys Acta 1264: 403-408 Thomas et al. ( 1991 ) J. Virology 65: 2953-2959 Vagner et al. (1995) Mol. Cell Biol. 15: 35-44 Velten and Schelf (1985) Nucl. Acids Res. 13: 6998 Verver et al. (1991 ) J. Gen. Virology72: 2339-2345 Wilbur and Lipmann (1983) Proc. Nat. Acad. Sci. U.S.A. 80: 726 Xu et al. (1995) Plant Cell Reports 15: 91-96 Ye et al. (1997) Mol. Cell Biol. 17: 1714-1721 Zelenia et al. (1992) FEBS Lett 296: 267-270 - 47a -SEQUENCE LISTING
(1) GENERAL INFORMATION:
(i) APPLICANT: MOUNIR ABOUHAIDAR, ET AL.
(ii) TITLE OF INVENTION: GENE EXPRESSION IN PLANTS
(iii) NUMBER OF SEQUENCES: 5 (iv) CORRESPONDENCE ADDRESS:
(A) ADDRESSEE: SMART & BIGGAR
(B) STREET: P.O. BOX 2999, STATION D
(C) CITY: OTTAWA
(D) STATE: ONT
(E) COUNTRY: CANADA
(F) ZIP: K1P 5Y6 (v) COMPUTER READABLE FORM:
(A) MEDIUM TYPE: Floppy disk (B) COMPUTER: IBM PC compatible (C) OPERATING SYSTEM: PC-DOS/MS-DOS
(D) SOFTWARE: ASCII (text) (vi) CURRENT APPLICATION DATA:
(A) APPLICATION NUMBER: CA 2,244,959 2 0 (B) FILING DATE: 22-SEP-1998 (C) CLASSIFICATION:
(vii) PRIOR APPLICATION DATA:
(A) APPLICATION NUMBER:
(B) FILING DATE:
(viii) ATTORNEY/AGENT INFORMATION:
(A) NAME: SMART & BIGGAR
(B) REGISTRATION NUMBER:
(C) REFERENCE/DOCKET NUMBER: 75749-4 (ix) TELECOMMUNICATION INFORMATION:
3 0 (A) TELEPHONE: (613)-232-2486 (B) TELEFAX: (613)-232-8440 (2) INFORMATION FOR SEQ ID NO: l:
(i) SEQUENCE CHARACTERISTICS:

- 47b -(A) LENGTH: 1186 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) (iii) HYPOTHETICAL: NO

(iv) ANTI-SENSE: NO

(vi) ORIGINAL SOURCE:

(A) ORGANISM: Potato virus X

( ix) FEATURE

(A) NAME/KEY: mist feature (B) LOCATION: 178..387 (D) OTHER INFORMATION: /note= "Op en readingframe for 8K protein"

(ix) FEATURE:

(A) NAME/KEY: mist feature (B) LOCATION: 401..1111 (D) OTHER INFORMATION: /note= "Open frame for reading PVX

coat protein"

2 (xi) SEQUENCE DESCRIPTION: SEQ ID NO:
0 l:

- 47c -(2) INFORMATION FOR SEQ ID N0:2:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 52 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single 2 0 (D) TOPOLOGY: linear (ii) MOLECULE TYPE: other nucleic acid (A) DESCRIPTION: /desc = "oligonucleotide with a hairpin forming sequence"

(xi) SEQUENCE DESCRIPTION: SEQ ID N0:2:

(2) INFORMATION FOR SEQ ID N0:3:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 36 base pairs 30 (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: other nucleic acid (A) DESCRIPTION: /desc = "Oligonucleotide comprising S/D like sequence upstream of PVX
coat protein"

(ix) FEATURE:

(A) NAME/KEY: misc_signal (B) LOCATION: 9..24 4 0 (D) OTHER INFORMATION: /note= "Sequence with complementarity to the 3' end of - 46d -the 16S rRNA of E. coli"
(xi) SEQUENCE DESCRIPTION: SEQ ID N0:3:

(2) INFORMATION FOR SEQ ID N0:4:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 34 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: other nucleic acid (A) DESCRIPTION: /desc = "Oligonucleotide comprising S/D like sequence upstream of PVX coat protein (mutant form)"
(ix) FEATURE:
(A) NAME/KEY: misc-signal (B) LOCATION: 13..22 (D) OTHER INFORMATION: /note= "Sequence with complementarity to the 3' end of 2 0 the 16S rRNA of E. coli"
(xi) SEQUENCE DESCRIPTION: SEQ ID N0:4:

(2) INFORMATION FOR SEQ ID N0:5:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 42 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: linear 3 0 (ii) MOLECULE TYPE: other nucleic acid (A) DESCRIPTION: /desc = "Sequence upstream of the open reading frame encoding the 25K
protein of PVX"
(vi) ORIGINAL SOURCE:

- 47e -(A) ORGANISM: Potato virus X
(ix) FEATURE:
(A) NAME/KEY: mist feature (B) LOCATION: 9..35 (D) OTHER INFORMATION: /note= "Sequence with complementarity to the sequence upstream of the coat protein cistron"
(xi) SEQUENCE DESCRIPTION: SEQ ID N0:5:

Claims (61)

1. A method for producing a polypeptide from each cistron of a chimeric multicistronic RNA in a plant cell, comprising a) including a heterologous IRBS element in each intercistronic region, wherein said IRBS element is capable of binding a translation initiation complex in the presence of an RNA sequence forming an energy-rich stem-loop structure at or near the 5' end of a test RNA molecule comprising said IRBS element in said plant cell; and b) introducing said chimeric multicistronic RNA in said plant cell

2. The method of claim 1, wherein said IRBS element is further also included in the 5' untranslated leader sequence upstream of the first cistron of said chimeric multicistronic RNA.

3. The method of claim 1, wherein said chimeric multicistronic RNA
comprises from 2 to 10 cistrons.

4. The method of claim 1, wherein said chimeric multicistronic RNA
comprises two cistrons.

5. The method of claim 1, wherein said cistrons encode pest resistance proteins or pathogen resistance proteins.

6. The method of claim 5, wherein said pest resistance proteins are insect resistance proteins.

7. The method of claim 6, wherein said insect resistance proteins are selected from the group of insecticidal crystal proteins from Bacillus thuringiensis, vegetative insecticidal proteins from Bacillus thuringiensis insecticidal toxins from Photorhabdus spp., insecticidal toxins from Xenorhabdus spp., insecticidal .alpha.-amylase and protease inhibitors, spider venom toxin or scorpion venom toxin.

8. The method of claim 7, wherein said insecticidal crystal proteins from Bacillus thuringiensis are selected from the group of CRY1Ab5, CRY9C, CRY1Ba, CRY3C, CRY3A, CRY1Da and CRY1Ea.

9. The method of claim 1, wherein said IRBS element comprises sequences complementary to the 3'end of the 16S rRNA from E, coli.

10. The method of claim 1, wherein said IRBS element comprises the ribonucleotide sequence corresponding to the nucleotide sequence of SEQ ID No 1 from the nucleotide at position 120 to the nucleotide at position 396.

11. The method of claim 10, wherein said IRBS element comprises the ribonucleotide sequence corresponding to the nucleotide sequence of SEQ ID No 1 from the nucleotide at position 1 to the nucleotide at position 396.

12. The method of claim 1, wherein said IRBS element comprises a nucleotide sequence with a sequence identity from about 60% to 100 % to the ribonucleotide sequence corresponding to the nucleotide sequence of SEQ ID No 1 from the nucleotide at position 1 to the nucleotide at position 396 or to the nucleotide sequence of SEQ ID No 1 from the nucleotide at position 120 to the nucleotide at position 396.

13. A method for coordinated production of polypeptides in a plant cell, comprising providing said plant cell with a chimeric gene, said chimeric gene including the following operably linked DNA sequences:
a) a plant-expressible promoter region b) a transcribed DNA region, yielding upon transcription a multicistronic RNA comprising in each intercistronic region between the cistrons encoding said polypeptides a heterologous IRBS element, wherein said IRBS element is capable of binding a translation initiation complex in the presence of an RNA sequence forming an energy-rich stem-loop structure at or near the 5' end of a test RNA molecule comprising said IRBS element in said plant cell; and c) a 3' transcription termination signal which functions in said plant cell.

14. The method of claim 13, wherein said IRBS element is further also included in the 5' untranslated leader sequence upstream of the first cistron of said chimeric multicistronic RNA.

15. The method of claim 13, wherein said multicistronic RNA comprises from 2 to 10 cistrons.

16. The method of claim 15, wherein said multicistronic RNA comprises 2 cistrons.

17. The method of claim 13, wherein said cistrons encode pest resistance proteins or pathogen resistance proteins.

18. The method of claim 17, wherein said pest resistance proteins are insect resistance proteins.

19. The method of claim 18, wherein said insect resistance proteins are selected from the group of insecticidal crystal proteins from Bacillus thuringiensis, vegetative insecticidal proteins from Bacillus thuringiensis insecticidal toxins from Photorhabdus spp., insecticidal toxins from Xenorhabdus spp., insecticidal .alpha.-amylase and protease inhibitors, spider venom toxin or scorpion venom toxin.

20. The method of claim 19, wherein said insecticidal crystal proteins from Bacillus thuringiensis are selected from the group of CRY1Ab5, CRY9C, CRY1Ba, CRY3C, CRY3A, CRY1Da and CRY1Ea.

21. The method of claim 13, wherein said IRBS element comprises sequences complementary to the 3'end of the 16S rRNA from E. coli.

22. The method of claim 13, wherein said IRBS element comprises the ribonucleotide sequence corresponding to the nucleotide sequence of SEQ ID No 1 from the nucleotide at position 120 to the nucleotide at position 396.

23. The method of claim 22, wherein said IRBS element comprises the ribonucleotide sequence corresponding to the nucleotide sequence of SEQ ID No 1 from the nucleotide at position 1 to the nucleotide at position 396.

24. The method of claim 13, wherein said IRBS element comprises a nucleotide sequence with a sequence identity from about 60% to 100 % to the ribonucleotide sequence corresponding to the nucleotide sequence of SEQ ID No 1 from the nucleotide at position 1 to the nucleotide at position 396, or to the nucleotide sequence of SEQ ID No 1 from the nucleotide at position 120 to the nucleotide at position 396

25. The method of claim 13, wherein said plant-expressible promoter is selected from the group of plant-expressible promoters recognized by RNA polymerase I, promoters recognized by RNA polymerase II, promoters recognized by polymerase III, or promoters recognized by single subunit bacteriophage RNA polymerases.

26. A DNA comprising the following operably linked DNA elements:
a) a plant-expressible promoter b) a transcribed DNA region, yielding upon transcription a multicistronic RNA comprising in each intercistronic region between the cistrons encoding said polypeptides a heterologous IRBS element, wherein said IRBS element is capable of binding a translation initiation complex in the presence of an RNA sequence forming an energy-rich stem-loop structure at or near the 5' end of a test RNA molecule comprising said IRBS element in said plant cell; and c) a 3' transcription termination signal which functions in a plant cell.

27. The DNA of claim 26, wherein said IRBS element is further also included in the 5' untranslated leader sequence upstream of the first cistron of said chimeric multicistronic RNA.

28. The DNA of claim 26, wherein said multicistronic RNA comprises from 2 to cistrons.

29. The DNA of claim 26, wherein said cistrons encode insect resistance proteins selected from the group of insecticidal crystal proteins from Bacillus thuringiensis, vegetative insecticidal proteins from Bacillus thuringiensis insecticidal toxins from Photorhabdus spp., insecticidal toxins from Xenorhabdus spp., insecticidal .alpha.-amylase and protease inhibitors, spider venom toxin or scorpion venom toxin.

30. The DNA of claim 26, wherein said IRBS element comprises sequences complementary to the 3'end of the 16S rRNA from E, coli.

31. The DNA of claim 26, wherein said IRBS element comprises the ribonucleotide sequence selected from the group consisting of: a ribonucleotide sequence corresponding to the nucleotide sequence of SEQ ID No 1 from the nucleotide at position 120 to the nucleotide at position 396, a ribonucleotide sequence corresponding to the nucleotide sequence of SEQ ID No 1 from the nucleotide at position 1 to the nucleotide at position 396, a ribonucleotide nucleotide sequence with a sequence identity from about 60 % to 100 % to the ribonucleotide sequence corresponding to the nucleotide sequence of SEQ ID No 1 from the nucleotide at position 1 to the nucleotide at position 396, and a ribonucleotide nucleotide sequence with a sequence identity from about 60% to 100 % to the ribonucleotide sequence corresponding to the nucleotide sequence of SEQ ID No 1 from the nucleotide at position 120 to the nucleotide at position 396.

32. The DNA of claim 26, wherein said plant-expressible promoter is selected from the group of plant-expressible promoters recognized by RNA
polymerase I, promoters recognized by RNA polymerase II, promoters recognized by polymerase III, or promoters recognized by single subunit bacteriophage RNA polymerases.

33. A plant cell comprising the DNA of any one of claim 26 to claim 32.

34. A plant consisting essentially of the plant cells of claim 33.

35. A seed comprising the DNA of any one of claim 26 to claim 32.

36. A method for producing an RNA of interest in a plastid of a plant cell, comprising the step of integrating a chimeric gene in the nuclear DNA of said plant cell, said chimeric gene comprising the following operably linked DNA sequences:
a) a plant expressible promoter region b) a DNA region encoding an ribonucleotide sequence with a sequence identity from about 60% to 100% to the ribonucleotide sequence corresponding to the nucleotide sequence of SEQ ID No 1 from nucleotide at position 1 to the nucleotide at position 396 or to the nucleotide sequence of SEQ ID No 1 from the nucleotide at position 1 to the nucleotide at position 121;
c) a heterologous DNA region encoding said RNA of interest; and d) a 3' transcription termination signal which functions in said plant cell.

37. A method for introducing a chimeric RNA molecule into the plastid of a plant cell, said method comprising the following steps:
I) including a heterologous ribonucleotide sequence in said chimeric RNA
with a sequence identity from about 60% to 100% to the ribonucleotide sequence corresponding to the nucleotide sequence of SEQ ID No 1 from nucleotide at position 1 to the nucleotide at position 396 or to the nucleotide sequence of SEQ ID No 1 from the nucleotide at position 1 to the nucleotide at position 121; and II) introducing said chimeric RNA in said plant cell.

38. The method of claim 37, wherein said chimeric RNA comprises an antisense RNA sequence for an endogenous plastid gene.

39. A method for producing a protein of interest in a plastid of a plant cell, comprising the step of: integrating a chimeric gene in the nuclear DNA of said plant cell, said chimeric gene comprising the following operably linked DNA sequences:
a) a plant expressible promoter region b) a DNA region encoding a ribonucleotide sequence with a sequence identity from about 60% to 100% to the ribonucleotide sequence corresponding to the nucleotide sequence of SEQ ID No 1 from nucleotide at position 1 to the nucleotide at position 396 or to the nucleotide sequence of SEQ ID No 1 from the nucleotide at position 1 to the nucleotide at position 121;
c) a heterologous DNA region encoding said protein of interest; and d) a 3' transcription termination signal which functions in said plant cell.

40. The method of claim 39, wherein said plastid is a chloroplast.

41. The method of claim 40, wherein said protein of interest is a protein providing herbicide resistance.

42. The method of claim 41, wherein said herbicide resistance protein provides resistance to glyphosate or glufosinate.

43. The method of claim 42, wherein said protein is an enolpyruvylphosphate shikimate synthase or a mutant form thereof.

44. The method of claim 42, wherein said protein is a phosphinotricin acetyltransferase.

45. The method of claim 39, wherein said protein is an enzyme involved in lipid metabolism.

46. The method of claim 40, wherein said protein is involved in photosynthesis.

47. A method for selecting plant cells producing a protein of interest to a high level comprising the steps of:
I) providing a population of plant cells with a chimeric gene, said chimeric gene comprising the following operably linked DNA regions:
a. a plant expressible promoter region;
b. a first cistron consisting of a coding region, encoding a polypeptide of interest;
c. an intercistronic region comprising a DNA region encoding a heterologous IRBS element, wherein said IRBS element is capable of binding a translation initiation complex in the presence of an RNA
sequence forming an energy-rich stem-loop structure at or near the 5' end of a test RNA molecule comprising said IRBS element in said plant cell;
d. a second cistron consisting of a coding region, encoding a selectable marker protein; and e. a 3' transcription termination signal which functions in said plant cells;
and II) selecting plant cells which are resistant to a high level of a selective agent against which said selectable marker protein provides resistance.

48. The method of claim 47, wherein said selectable marker protein is a binding protein for said selective agent.

49. The method of claim 48, wherein said selectable marker protein is a phleomycin or bleomycin binding protein selected from the group of phleomycin or bleomycin binding proteins encoded by E. coli transposon Tn 5, by Bacillus spp. plasmid pUB110 or by Streptomyces verticillus or Streptoalloteichus hindustanus.

50. A method for expressing a protein in a plant cell, said method comprising:
providing a plant cell with a chimeric DNA including the following operably linked DNA elements:
a) a plant-expressible promoter;
b) a DNA region encoding a ribonucleotide sequence with a sequence identity from about 60% to 100% to the ribonucleotide sequence corresponding to the nucleotide sequence of SEQ ID No 1 from nucleotide at position 1 to the nucleotide at position 396;
c) a heterologous DNA region encoding said protein; and d) a 3' transcription termination signal functioning in said plant cell.

51. A DNA comprising the following operably linked DNA sequences:
a) a plant-expressible promoter;
b) a DNA region encoding a ribonucleotide sequence with a sequence identity from about 60% to 100% to the ribonucleotide sequence corresponding to the nucleotide sequence of SEQ ID No 1 from nucleotide at position 1 to the nucleotide at position 396;
c) a heterologous DNA region encoding a protein of interest; and d) a 3' transcription termination signal functioning in plant cell.

52. A plant cell or seed, each comprising the DNA of claim 51.

53. A plant consisting essentially of the plant cells of claim 51.

54. An isolated RNA or DNA molecule having a nucleotide sequence with a sequence identity from about 60% to 100% to the ribonucleotide sequence corresponding to the nucleotide sequence of SEQ ID No 1 from nucleotide at position 1 to the nucleotide at position 396 or corresponding to the nucleotide sequence of SEQ ID No 1 from nucleotide at position 120 to the nucleotide at position 396.

55. A method for producing a polypeptide from each cistron of a chimeric multicistronic RNA in a eukaryotic cell, comprising a) including a heterologous IRBS element in each intercistronic region, of said multicistronic RNA, wherein said IRBS element is selected from the group of an IRBS element having a sequence corresponding to the nucleotide sequence of SEQ ID No 1 from nucleotide at position 1 to the nucleotide at position 396, an IRBS element having a sequence corresponding to the nucleotide sequence of SEQ ID No 1 from nucleotide at position 120 to the nucleotide at position 396, an IRBS
element from a potex virus or a carla virus, an IRBS element comprising a nucleotide sequence with a sequence identity from about 60% to 100% to the ribonucleotide sequence corresponding to the nucleotide sequence of SEQ ID No 1 from nucleotide at position 1 to the nucleotide at position 396 and an IRBS element comprising a nucleotide sequence with a sequence identity from about 60% to 100% to the ribonucleotide sequence corresponding to the nucleotide sequence of SEQ ID No 1 from nucleotide at position 120 to the nucleotide at position 396; and b) introducing said chimeric multicistronic RNA in said eukaryotic cell.

56. A method for coordinated production of polypeptides in a eukaryotic cell, comprising providing said cell with a chimeric gene, said chimeric gene including the following operably linked DNA sequences:
a) a promoter region, functioning in said eukaryotic cell;
b) a transcribed DNA region, yielding upon transcription a multicistronic RNA comprising in each intercistronic region between the cistrons encoding said polypeptides a heterologous IRBS element, wherein said IRBS element is selected from the group of an IRBS element having a sequence corresponding to the nucleotide sequence of SEQ ID No 1 from nucleotide at position 1 to the nucleotide at position 396, an IRBS element having a sequence corresponding to the nucleotide sequence of SEQ ID
No 1 from nucleotide at position 120 to the nucleotide at position 396, an IRBS element from a potex virus or a carla virus, an IRBS element comprising a nucleotide sequence with a sequence identity from about 60% to 100% to the ribonucleotide sequence corresponding to the nucleotide sequence of SEQ ID No 1 from nucleotide at position 1 to the nucleotide at position 396 and an IRBS element comprising a nucleotide sequence with a sequence identity from about 60% to 100% to the ribonucleotide sequence corresponding to the nucleotide sequence of SEQ ID No 1 from nucleotide at position 120 to the nucleotide at position 396; and c) a 3' transcription termination signal which functions in said eukaryotic cell.

57. A method for expressing a protein in a eukaryotic cell, said method comprising:
providing said eukaryotic cell with a chimeric DNA including the following operably linked DNA elements:
a) a promoter region which functions in said eukaryotic cell;
b) a DNA region encoding a ribonucleotide sequence comprising a heterologous IRBS element selected from the group of an IRBS element having a sequence corresponding to the nucleotide sequence of SEQ ID
No 1 from nucleotide at position 1 to the nucleotide at position 396, an IRBS element having a sequence corresponding to the nucleotide sequence of SEQ ID No 1 from nucleotide at position 120 to the nucleotide at position 396, an IRBS element from a potex virus or a carla virus, an IRBS element comprising a nucleotide sequence with a sequence identity from about 60 % to 100% to the ribonucleotide sequence corresponding to the nucleotide sequence of SEQ ID No 1 from nucleotide at position 1 to the nucleotide at position 396 and an IRBS
element comprising a nucleotide sequence with a sequence identity from about 60 % to 100% to the ribonucleotide sequence corresponding to the nucleotide sequence of SEQ ID No 1 from nucleotide at position 120 to the nucleotide at position 396;
c) a heterologous DNA region encoding said protein; and d) a 3' transcription termination signal which functions in said eukaryotic cell.

58. A DNA comprising the following operably linked DNA sequences:
a) a promoter region which functions in a eukaryotic cell;
b) a DNA region encoding a ribonucleotide sequence comprising a heterologous IRBS element selected from the group of an IRBS element having a sequence corresponding to the nucleotide sequence of SEQ ID
No 1 from nucleotide at position 1 to the nucleotide at position 396, an IRBS element having a sequence corresponding to the nucleotide sequence of SEQ ID No 1 from nucleotide at position 120 to the nucleotide at position 396, an IRBS element from a potex virus or a carla virus, an IRBS element comprising a nucleotide sequence with a sequence identity from about 60% to 100% to the ribonucleotide sequence corresponding to the nucleotide sequence of SEQ ID No 1 from nucleotide at position 1 to the nucleotide at position 396 and an IRBS
element comprising a nucleotide sequence with a sequence identity from about 60 % to 100% to the ribonucleotide sequence corresponding to the nucleotide sequence of SEQ ID No 1 from nucleotide at position 120 to the nucleotide at position 396;
c) a heterologous DNA region encoding said protein; and d) a 3' transcription termination signal which functions in said eukaryotic cell.

59. A DNA comprising the following operably linked DNA elements:
a) a promoter region, functioning in said eukaryotic cell;
b) a transcribed DNA region, yielding upon transcription a multicistronic RNA comprising in each intercistronic region between the cistrons encoding said polypeptides a heterologous IRBS element, wherein said IRBS element is selected from the group of an IRBS element having a sequence corresponding to the nucleotide sequence of SEQ ID No 1 from nucleotide at position 1 to the nucleotide at position 396, an IRBS element having a sequence corresponding to the nucleotide sequence of SEQ ID
No 1 from nucleotide at position 120 to the nucleotide at position 396, an IRBS element from a potex virus or a carla virus, an IRBS element comprising a nucleotide sequence with a sequence identity from about

60% to 100% to the ribonucleotide sequence corresponding to the nucleotide sequence of SEQ ID No 1 from nucleotide at position 1 to the nucleotide at position 396 and an IRBS element comprising a nucleotide sequence with a sequence identity from about 60% to 100% to the ribonucleotide sequence corresponding to the nucleotide sequence of SEQ ID No 1 from nucleotide at position 120 to the nucleotide at position 396; and c) a 3' transcription termination signal which functions in said eukaryotic cell.
60. A eukaryotic cell comprising the DNA of claim 58 or claim 59.

61. A non-human eukaryotic organism consisting essentially of the cells of claim 60.