CA2242633A1 - Transforming growth factor alpha hiii - Google Patents

Abstract

The present invention discloses transforming growth factor alpha HIII polypeptides and polynucleotides encoding such polypeptides. Also provided is a procedure for producing such polypeptides by recombinant techniques and therapeutic uses of the polypeptides which include stimulating wound healing, treating neurological disorders, treating ocular disorders, treating kidney and liver disorders and stimulating embryogenesis and angiogenesis. Also disclosed are antagonists against such polypeptides and their use as a therapeutic to treat neoplasia. Also disclosed are diagnostic assays for detecting altered levels of the polypeptide of the present invention and mutations in the nucleic acid sequences which encode the polypeptides of the present invention.

Description

W O 97/25349 PCT~US96/00149 TRANS~ GROWTH FACTOR ALPHA HIII

This invention relates to newly identi~ied polynucleotides, polypeptides encoded by such polynucleotides, the use of such polynucleotides and polypeptides, as well as the production o~ such polynucleotides and polypeptides. The polypeptide o~ the present invention has been putatively identified as a hllm~n transforming growth $actor alpha homolog. More particularly, the polypeptide of the present invention has been putatively identi~ied as transforming growth factor alpha HIII, sometimes herea$ter referred to as "TGFoc-HIII".
The invention also relates to inhibiting the action o$ such polypeptides.
~ ellular growth and differentiation appear to be initiated, promoted, m~; ntA; ned and regulated by a multiplicity o~ stimulatory, ; nh; h; tory and synergistic $actors and hormones. The alteration and/or breakdown o~
the cellular homeostasis mechanism seems to be a ~lln~m~nt~l cause o~ growth related diseases, including neoplasia. Growth modular factors are implicated in a wide variety o~ pathological and physiological processes including signal transduction, cell comml~n;cation~ growth and development, embryogenesis, immune response, hematopoiesis cell survival and dif$erentiation, inflammation, tissue repair and remodeling, atherosclerosis and cancer. Epidermal growth factor ~EGE), transforming W O 97/25349 PCT~US9G/00149 growth factor alpha (TGF~), betacellulin,;~ml~h;7~egulin, and vaccinia growth factor among other factors are growth and differentiation modulatory proteins produced by a variety of cell types either under normal physiological conditions or in response to exogenous stimuli and are members o~ the EGF family.
These peptide growth factors influence wound cells through autocrine and paracrine mechanisms. They also play important roles in normal wound he~l;ng in tissues such as skin, cornea and gastrointestinal tract and all share substantial amino acid sequence homology including the conserved placement of three intra-chain disul~ide bonds.
In addition, all the ~actors o~ this family bind to a 170,000 molecular weight trAn~m~mh~ane glycoprotein receptor and activate the tyrosine kinase activity in the receptor's cytoplasmic ~m~; n (Buhrow, S.A. et al., J. Bio.
Chem., 2~8:7824-7826 (1983)).
The receptors are expressed by many types of cells including skin keratinocytes, fibroblasts, vascular endothelial cells, and epithelial cells of the GI tract.
These peptide growth factors are synthesized by several cells involved in wound healiny including platelets, keratinocytes, and activated macrophages. These growth ~actors have also been implicated in both the stimulation of growth and dif~erentiation o~ certain cells, for example, neoplasia, and the inhibition of other types o~
cells.
Betacellulin is a 32-kilodalton glycoprotein that appears to be processed from a larger tr~n~ dne precursor by proteolytic cleavage. The carboxyl-terminal domain o~ betacellulin has 50~ sequence s;m~l~rity with that of rat transformin~ growth factor ~. Betacellulin is a potent mitogen ~or retinal pigment epithelial cells and vascular smooth muscle cells.
~ mrht~egu1in is a bi~unctional cell growth regulatory factor which exhibits potent ;nh;~;tory activity on DNA
synthesis in neoplastic cells, yet promotes the growth of certain normal cells. A wide variety of uses for -W O 97/25349 PCT~US96/00149 ~ amphiregulin have been assigned including the treatment o~
wounds and cancers. For example, amphiregulin has potent anti-proli~erative e~ects in vitro on several hllm~n cancer cell lines o~ epithPli~l origin. ~mph;~egulin also induces the proliferation o~ hllm~n foreskin ~ibroblasts as shown in United States Patent Application No. 5,115,096.
" TGF~ has pleiotropic biological e~fects. The production o~ certain members o~ TGF~ is synthesized by a number o~ oncogenically trans~ormed ~ibroblasts (Ciardiello et al., J. Cell. Biochem., 42:45-57 (1990)~, as well as by a variety o~ tumors, including renal, breast and squamous car~; n~m~, m~l ~no~ and glioblastomas (Derynck, R. et al., Cancer Res., 47:707-712 (1987)). There is direct evidence that TG~ expression can be a contributing factor in the conversion o~ a normal cell to its tumorigenic counterpart by analyzing transgenic mice in which tumor cells express high levels o~ TGF~ TGF~ transgenic ~n;m~l S
display a variety o~ neoplastic lesions, dependiny on the strain o~ mouse and the choice o~ promotor regulating TGF~
expression (Sandgren, et al., Cell, 61:1121-1135 (1990)).

TGF~ also plays a role in normal embryonic development and adult physiology (Derynck, R. Adv. ~ancer Res., 58:27-5 (1992)). TGF~ has been expressed in many tissues including skin, brain, gastrointestinal mucosa and activating macrophages. Accordingly, TGF~ is an important ~actor in controlling growth of epith~ l cells and h-as a role in wound healing. TGF~ has also been ~ound to be angiogenic (Schreiber, et al., Science, 232:1250-1253 ~1986)).
The polypeptide o~ the present invention has been putatively identi~ied as trans~orming growth ~actor TGF~-HIII. T_is identi~ication has been made as a result o~
amino acid sequence homology to hllm~n TGF~.
In accordance with one aspect o~ the present invention, there are provided novel mature polypeptides, as well as biologically active and diagnostically or therapeutically use~ul ~ra~m~ntS, analogs and derivatives WO 97/2~349 PCT~US96/00149 - thereo~. The polypeptides of the present invention are o~
hllm~n origin.
In accordance with another aspect o~ the present invention, there are provided i~olated nucleic acid molecules encoding the polypeptides o~ the present invention, including mRNAs, cDNAs, genomic DNAs as well as analogs and biologically active and diagnostically or therapeutically use~ul ~ragments thereo~.
In accordance with another aspect o~ the present invention there is provided an isolated nucleic acid molecule encoding a mature polypeptide expressed ~y the hllm~n cDNA contained in ATCC Deposit No. 97342.
In accordance with yet a ~urther aspect o~ the present invention, there are provided processes ~or pro~ucing such polypeptide by recombinant techniques comprising culturing recom~inant prokaryotic andJor eukaryotic host cells, cont~;n;ng a nucleic acid sequence encoding a polypeptide o~ the present invention.
In accordance with yet a ~urther aspect o~ the present invention, there are provided processes ~or utilizing such polypeptides, or polynucleotides encoding such polypeptides ~or therapeutic purposes, ~or example, to stimulate wound h~l ,ng to restore normal neurological ~unctioning a~ter trauma or AIDS dementia, to treat ocular disorders, to target certain cells, to treat kidney and liver disorders and to promote hair ~ollicular development, to stimulate angiogenesis ~or the treatment o~ burns, ulcers and corneal incisions and to st;m~ te embryogenesis.
In accordance with yet a ~urther aspect o~ the present invention, there is also provided nucleic acid probes comprising nucleic acid molecules o~ su~icient length to speci~ically hybridize to nucleic acid sequences o~ the present invention.
~ n accordance with yet a ~urther aspect o~ the present invention, there are provided antibodies against such polypeptides.

Sl~ JTE SHEET (RULE 26) - In accordance with yet a ~urther aspect o~ the present invention, there are provided agonists to the polypeptide o~ the present invention.
In accordance with yet another aspect o~ the present invention, there are provided antagonists to such polypeptides, which may be used to ~ nh~ ht t the action o~
such polypeptides, for example, in the treatment of corneal in~lAmm~tion, neoplasia, ~or example, tumors and cancers and ~or psoriasis.
In accordance with still another aspect o~ the present invention, there are provided diagnostic assays ~or detecting diseases related to overexpression o~ the polypeptide o~ the present invention and mutations in the nucleic acid sequences encoding such polypeptide.
In accordance with yet a ~urther aspect of the present invention, there is provided a process ~or utilizing such polypeptides, or polynucleotides encoding such polypeptides, ~or in vitro purposes related to scienti~ic research, synthesis o~ DNA and manu~acture o~ DNA vectors.

These and other aspects o~ the present invention rhould be apparent to those skilled in the art ~rom the teachings herein.
The ~ollowing drawings are illustrative of embodiments o~ the invention and are not meant to limit the scope of the invention as encompassed by the claims.
Figure 1 depicts the cDNA sequence and corresponding deduced amino acid sequence o~ TGF~-HIII. The st~n~d one letter abbreviations ~or amino acids are used. The putative signal sequence has been underlined.
Figure 2 is an illustration o~ comparative amino acid sequence homology between TGF~-HIII (top line) and hllm~n TGF~-HI. Dar~ened amino acids denote the conserved EGF
moti~ ~m~ ~ n which is shown to be conserved in the polypeptide o~ the present invention.
In accordance with an aspect o~ the present invention, there is provided an isolated nucleic acid (polynucleotide) - which encodes ~or the mature polypeptide having the deduced amino acid sequence o$ Figure 1 (SEQ ID N0:2).
The polynucleotide o~ this invention was discovered in a hllm~n testes cDNA library. It is structurally related to the TGF~ gene $amily. It contains an open reading $rame encoding a polypeptide of 229 amino acid~, which exhibits signi~icant homology to a number o~ members o$ the TGF~
gene ~amily; these members include TGF~ itsel~ as well as other members such as amphiregulin and cripto.
Furthermore, the six cysteine residues occurring in all members in a characteristic motif are conserved in TGF~-HIII.
The full-length polypeptide of the present invention as set ~orth in Figure 1 (SEQ ID N0:2) has a putative signal sequence which comprise~ amino acid 1 through amino acid 25 o$ Figure 1 (SEQ ID N0:2) which aids in secretion o$ the polypeptide ~rom the cell. Amino acid 126 through amino acid 177 o~ SEQ ID N0:2 represent the active site o~
the protein o~ the present invention. Further, amino acid 178 through amino acid 204 represents a putative tr~n~m~mh~ane portion which is thought to be necessary to direct the polypeptide to particular target locations for the carrying out o$ biological ~unctions a~ hereina~ter described. The transme,-~rdlle portion may also be cleaved ~rom the polypeptide such that the putative soluble portion o~ the polypeptide of the present invention comprises amino acid 1 through amino acid 177 o$ SEQ ID N0:2. The protein exhibits the highest degree o~ homology to TGF~.
In accordance with another aspect o~ the present invention there are provided isolated polynucleotides encoding a mature polypeptide expressed by the DNA
contained in ATCC Deposit No. 97342, deposited with the American Type Culture Collection, 12301 Park Lawn Drive, Rockville, Maryland 20852, USA, on November 20, 1995. The deposited material is a pBluescript plasmid (Stratagene, La Jolla, CA) that contains the ~ull-length TGF~-HIII cDNA.
The deposit has been made under the tenms of the Budapest Treaty on the International Recognition o$ the Depo~it o~

CA 02242633 l998-07-03 W O 97/25349 PCTrUS96/~0149 Micro-org~n;~:m~q ~or purposes of Patent Procedure. The strain will be irrevocably and without restriction or condition released to the public upon the issuance of a patent. These deposits are provided merely as convenience to those of skill in the art and are not an admission that a deposit is required under 35 U.S.C. 112. The sequence o~ the polynucleotides contained in the deposited materials, as well as the amino acid sequence of the polypeptides encoded thereby, are controlling in the event o~ any conflict with any description o~ sequences herein.
A license may be required to make, use or sell the deposited materials, and no such license is hereby granted. References to 'Ipolynucleotides 1I throughout this speci~ication includes the DNA of the deposit re~erred to above.
The polynucleotide of the present invention may be in the form of RNA or in the form of DNA, which DNA includes cDNA, genomic DNA, and synthetic DNA. The DNA may be double-stranded or single-stranded, and if single str~n~
may be the coding strand or non-coding (anti-sense) strand.
The coding sequence which encodes the mature polypeptide may be identical to the coding sequence shown in Figure 1 (SEQ ID NO:1) or may be a different coding sequence which coding sequence, as a result of the re~lln~ncy or degeneracy of the genetic code, encodes the same mature polypeptide as the DNA of Figure 1 (SEQ ID NO:1).
The polynucleotide which encodes for the mature polypeptide of Figure 1 (SEQ ID NO:2) may include, but is not limited to: only the coding sequence for the mature polypeptide; the coding sequence for the mature polypeptide and additional coding sequence such as a leader or secretory sequence or a proprotein sequence; the coding sequence for the mature polypeptide (and optionally additional coding sequence) and non-coding sequence, such as introns or non-coding sequence 5' and/or 3' o~ the coding sequence for the mature polypeptide.
Thus, the term "polynucleotide encoding a polypeptide"
encompasses a polynucleotide which include~ only coding WO 97/25349 PCT~US96/00149 sequence ~or the polypeptide as well as a polynucleotide which includes additional coding and/or non-coding sequence.
The present invention $urther relates to variants o$
the hereinabove described polynucleotides which encode for $ragments, analogs and derivatives o$ the polypeptide having the deduced amino acid sequence o$ Figure 1 (SEQ ID
NO:2). The variant o~ the polynucleotide may be a naturally occurring allelic variant of the polynucleotide or a non-naturally occurring variant of the polynucleotide.
Thus, the present invention includes polynucleotides encoding the same mature polypeptide as shown in Figure 1 (SEQ ID NO:2) as well as variants o~ such polynucleotides which variants encode for a ~ragment, derivative or analog of the polypeptide of Figure 1 (SEQ ID NO:2). Such nucleotide variants include deletion variants, substitution variants and addition or insertion variants.
As her~;nAhove indicated, the polynucleotide may have a coding sequence which is a naturally occurring allelic variant of the coding sequence shown in Figure 1 (SEQ ID
NO:1). As known in the art, an allelic variant is an alternate form o~ a polynucleotide sequence which may have a ~ubstitution, deletion or addition of one or more nucleotides, which does not subst~nt;~lly alter the $unction o$ the encoded polypeptide.
The present invention also includes polynucleotides, wherein the coding sequence ~or the mature polypeptide may ~e $used in the same r~; ng $rame to a polynucleotide sequence which aids in expression and secretion o$ a polypeptide from a host cell, for example, a leader sequence which $unctions as a secretory sequence for controlling transport of a polypeptide from the cell. The polypeptide having a leader sequence is a preprotein and may have the leader sequence cleaved by the host cell to ~orm the mature form of the polypeptide. The polynucleotides may also encode $or a proprotein which is the mature protein plus additional 5' amino acid residues.
A mature protein having a prosequence is a proprotein and W O 97/25349 PCT~US96/00149 ~ is an inactive fonm o~ the protein. Once the prosequence is cleaved an active mature protein r~m~i n~ . Ih~, _3r example, the polynucleotide o~ the present invention may encode ~or a mature protein, or ~or a protein having a prosequence or for a protein having both a prosequence and a presequence (leader se~uence).
The polynucleotides of the present invention may also have the coding sequence ~used in frame to a marker sequence which allows ~or puri~ication o~ the polypeptide o~ the present invention. The marker sequence may be a hexa-histidine tag supplied by a pQE-9 vector to provide ~or puri~ication o~ the mature polypeptide ~used to the marker in the case of a bacterial host, or, ~or example, the marker sequence may be a hemagglutinin (HA) tag when a m~mm~ n host, e.g. COS-7 cells, is used. The HA tag corresponds to an epitope derived from the in~luenza hemagglutinin protein (Wilson, I., et al., Cell, 37:767 (1984)).
The term "gene" means the segment of DNA involved in producing a polypeptide chain; it includes regions preceding and ~ollowing the coding region (leader and trailer) as well as intervening sequences (introns) between individual coding segments (exons).
Fragments o~ the ~ull length TGF~-HIII gene may be used as a hybridization probe ~or a cDNA library to isolate the ~ull length gene and to isolate other genes which have a high sequence similarity to the gene or similar biological activity. Probes o~ this type pre~erably have at least 30 bases and may cont~;n, ~or example, at least 5~
or more bases. The probe may also be used to identi~y a cDNA clone corresponding to a ~ull length transcript and a genomic clone or clones that co~t~i n the complete TGF~-HIII
gene including regulatory and promotor regions, exons, and introns. An example o~ a screen comprises isolating the coding region o~ the gene by using the ~nown DNA sequence to synthesize an oligonucleotide probe. Labeled oligonucleotides having a sequence compl~m~nt~y to that o~
the gene o~ the present invention are used to screen a W O 97/25349 PCT~US96/00149 - library of h~ n cDNA, genomic DNA or mRNA to determine which members of the library the probe hybridizes to.
The present invention further relates to polynucleotides which hybridize to the hereinabove-described sequences i~ there is at least 70%, preferably at least 90%, and more prefera~ly at least 95~ identity between the ~equences. The present invention particularly relates to polynucleotides which hybridize under stringent conditions to the hereinabove-described polynucleotides.
As herein used, the term "stringent conditions" means hybridization will occur only if there is at least 95~ and preferably at least 97~ identity between the sequences.
The polynucleotides which hybridiz~ to the hereina~ove described polynucleotides in a pre~erred embo~m~nt encode polypeptides which either retain substantially the same biological function or activity as the mature polypeptide encoded by the cDNAs of Figure 1 (SEQ ID NO:1).
Alternatively, the polynucleotide may have at least 20 bases, preferably at lea~t 30 bases, and more preferably at least 50 bases which hybridize to a polynucleotide of the present invention and which has an identity thereto, as hereinabove described, and which may or may not retain activity. For example, such polynucleotides may be employed as probes for the polynucleotide of SEQ ID NO:1, for example, for recovery of the polynucleotide or as a diagnostic probe or as a PCR primer.
Thus, the present invention is directed to polynucleotides having at least a 70~ identity, preferably at least 90~ and more preferably at least a 95~ identity to a polynucleotide which encodes the polypeptide of SEQ ID
NO:2 and polynucleotides compl~m~nt~ry thereto as well as portions thereof, which portions have at least 30 consecutive bases and preferably at least 50 consecutive bases and to polypeptides encoded by such polynucleotides.
The present invention further relates to a polypeptide which has the deduced amino acid ~equence o~ Figure 1 ~SEQ
ID NO:2), as well as ~ragments, analogs and derivatives of such polypeptide.

W O 97/25349 PCT~US96/00149 - The te~ms "~ragment," ~derivative~ and "analogl' when re~erring to the polypeptide o~ Figure 1 (SEQ ID NO:2), means a polypeptide which retains essentially the same biological ~unction or activity as such polypeptide. Thus, an analog includes a proprotein which can be activated by cleavage o~ the proprotein portion to produce an active J mature polypeptide.
The polypeptide o~ the present invention may be a rec~;n~nt polypeptide, a natural polypeptide or a synthetic polypeptide, pre~erably a recombinant polypeptide.
The ~ragment, derivative or analog o~ the polypeptide o~ Figure 1 (SEQ ID NO:2) may be (i) one in which one or more o~ the amino acid residue~ are substituted with a conserved or non-conserved amino acid residue (pre~erably a conserved amino acid residue) and such substituted amino acid residue may or may not be one encoded by the genetic code, or (ii) one in which one or more o~ the amino acid residues includes a substituent group, or (iii) one in which the mature polypeptide is ~used with another compound, such as a compound to increase the hal~ e o~
the polypeptide (~or example, polyethylene glycol), or (iv) one in which the additional amino acids are ~used to the mature polypeptide, such as a leader or secretory sequence or a sequence which is employed ~or puri~ication o~ the mature polypeptide or a proprotein sequence. Such ~ragments, derivatives and analogs are deemed to be within the scope of those skilled in the art ~rom the t~ch;ngs herein.
The polypeptides and polynucleotides o~ the present invention are pre~erably provided in an isolated ~orm, and pre~erably are puri~ied to homogeneity.
The term "isolated" means that the material is removed ~rom its original envilo~l,-,ellt (e.g., the natural environm~nt i~ it is naturally occurring). For example, a naturally-occurring polynucleotide or polypeptide present in a living ~n~ m~ 1 is not isolated, but the same polynucleotide or polypeptide, separated ~rom some or all W O 97~5349 PCT~US96/00149 - o~ the coe~isting materials in the natural system, is isolated. Such polynucleotides could be part of a vector and/or such polynucleotides or polypeptides could be part of a composition, and still be isolated in that such vector or composition is not part of its natural environm~nt.
The polypeptides of the present invention include the polypeptide of SEQ ID NO:2 (in particular the mature polypeptide) as well as polypeptides which have at least 70% ~;;m;l ~7~ity (preferably at least 70~ identity) to the polypeptide of SEQ ID NO:2 and more pre~erably at least 9096 similarity (more preferably at least 90~ identity) to the polypeptide of SEQ ID NO:2 and still more preferably at least 95~ similarity (still more pre~erably at least 95~
identity) to the polypeptide of SEQ ID NO:2 and also include portions of such polypeptides with such portion of the polypeptide generally cont~;n;ng at least 30 amino acids and more pre~erably at least ~Q amino acids.
As known in the art "similarity" between two polypeptides is determined by comparing the amino acid sequence and its conserved amino acid substitutes of one polypeptide to the sequence of a second polypeptide.
Fragments or portions o~ the polypeptides of the present invention may be employed for pro~l~cin~ the corresponding full-lengthpolypeptide by peptide synthesis;
therefore, the fragments may ~e employed as intermediates for producing the full-length polypeptides. Fragments or portions o~ the polynucleotide~ of the present invention may be used to synthesize full-length polynucleotides of the present invention.
The present invention also relates to vectors which include polynucleotides o~ the present invention, host cells which are genetically engineered with vectors of the invention and the production of polypeptides of the invention by recombinant techni~ues.
Host cells are genetically engineered (transduced or transformed or trans~ected) with the vectors of this invention which may be, for example, a cloning vector or an expression vector. The ~ector may be, ~or example, in the W O 97/2~349 PCT~US96/00149 - form of a p~asmid, a viral particle, a phage, etc. The engineered host cells can be cultured in conventional nutrient media modi~ied as appropriate for activating promoters, selecting transformants or amplifying the genes o~ the present invention. The culture conditions, such as temperature, pH and the like, are those previously used with the host cell selected for expression, and will be apparent to the ordinarily skilled artisan.
The polynucleotides of the present invention may be employed for producing polypeptides by recombinant techniques. Thus, ~or example, the polynucleotide may be included in any one o~ a variety o~ expression vectors for expressing a polypeptide. Such vectors include chromosomal, nonchromosomal and synthetic DNA sequences, e.g., derivatives of SV40; bacterial plasmids; phage DNA;
baculovirus; yeast plasmids; vectors derived ~rom C~mh~n~tiOnS Oi~ plasmids and phage DNA, viral DNA such as vaccinia, adenovirus, fowl pox virus, and pseudorabies.
However, any other vector may be used as long as it is replicable and viable in the host.
The appropriate DNA sequence may be inserted into the vector by a variety of procedures. In general, the DNA
sequence is inserted into an a~.~riate restriction ~n~nll~lease site(s) by procedures known in the art. Such procedures and others are deemed to be within the scope of those skilled in the art The DNA sequence in the expression vector is operatively l~ nk~ to an d~riate expression control sequence(s) (promoter) to direct mRNA synthesis. As representative examples of such promoters, there may be mentioned: LTR or SV40 promoter, the E. coli. ac or trp, the phage lambda PL promoter and other promoters known to control expression of genes in prokaryotic or eukaryotic cells or their viruses. The expression vector also contains a ribosome binding site for translation initiation and a transcription terminator. The vector may also include appropriate sequences for ampli~ying expression.

.

WO 97/25349 PCT~US96/00149 - ~n addi~ion, the expression vectors pre~erably contain one or more selectable marker genes to provide a phenotypic trait ~or selection of transformed host cells such as dihydro~olate reductase or neomycin resistance ~or eukaryotic cell culture, or such as tetracycline or ampi-~; 1 1 i n resistance in E coli.
The vector cont~; n~ ng the appropriate DNA sequence as hereinabove described, as well as an appropriate promoter or control seguence, may be employed to trans~orm an appropriate host to permit the host to express the protein.

As representative examples o~ appropriate hosts, there may be mentioned: bacterial cells, such as E. coli, Streptomyces, S?lmonella typhimurium; ~ungal cells, such as yeast; insect cells such as Drosophila S2 and S~odo~tera S~9; ~n~m~l cells such as CHO, COS or Bowes mel~n~m~;
adenoviruses; plant cells, etc. The selection Of an appropriate host is deemed to be within the scope of those skilled in the art ~rom the teachings herein.
More particularly, the present invention also includes recombinant constructs comprising one or more o~ the ~eguence~ as broadly described above. The constructs comprise a vector, such as a plasmid or viral vector, into which a sequence o~ the in~ention has been inserted, in a ~orward or reverse orientation. In a pre~erred a~pect of this embodiment, the construct ~urther comprises regulatory sequences, including, ~or example, a promoter, operably linked to the sequence. Large numbers of suitable vectors and promoters are known to those of ~kill in the art, and are c~m~cially available. The ~ollowing vectors are provided by way o~ example; Bacterial: pQE70, pQE60, pQE-9 ~Qiagen), pBS, pD10, phagescript, psiX174, pbluescript SK, pbsks, pNH8A, pNH16a, pNH18A, pNH46A (Stratagene); ptrc99a, pKK223-3, pKR233-3, pDR540, pRIT5 (Pharmacia~; Eukaryotic:
pWLNEO, pSV2CAT, pOG44, pXT1, pSG (Stratagene) pSVK3, pBPV, pMSG, pSVL (Phanmacia). ~owever, any other plasmid or vector may be used as long as they are replicable and viable in the ho~t.

W O 97/25349 PCT~US96/0~149 - Promoter regions can be selected ~rom any desired gene using CAT (chlor~mph~n~col trans~erase) vectors or other vectors with selectable markers. Two appropriate vectors are pKK232-8 and pCM7. Particular named bacterial promoters include lacI, lacZ, T3, T7, gpt, lambda PR~ PL and trp. Eukaryotic promoters include CMV immediate early, HSV
thymidine kinase, early and late SV40, LTRs ~rom retrovirus, and mouse metallothionein-I. Selection of the appropriate vector and promoter is well within the level of ordinary skill in the art.
In a ~urther embodiment, the present invention relates to host cells cont~;n~ng the above-described constructs.
The host cell can be a higher eukaryotic cell, such as a m~mm~ n cell, or a lower eukaryotic cell, such as a yeast cell, or the host cell can be a prokaryotic cell, such as a bacterial cell. Introduction of the construct into the host cell can be e~ected by calcium phosphate transfection, DEAE-Dextran mediated trans~ection, or electroporation (Davis, L., Dibner, M., ~attey, I., Basic Methods in Molecular Biology, (1986)).
The constructs in host cells can be used in a conventional m~nn~ to produce the gene product encoded by the recomh;n~nt sequence. Alternatively, the polypeptides o~ the invention can be synthetically produced by conventional peptide synthesizers.
Mature proteins can be expressed in m~mm~l ian cells, yeast, bacteria, or other cells under the control of appropriate promoters. ~ell-~ree translation systems can also be employed to produce such proteins using RNAs derived ~rom the DNA constructs o~ the present invention.
Appropriate cloning and expression vectors ~or use with prokaryotic and eukaryotic hosts are described by Sambrook, et al., Molecular Cloning: A Laboratory ~nll~l, Second Edition, Cold Spring Earbor, N.Y., (1989), the disclosure o~ which is hereby incorporated by re~erence.
Transcription o~ the DNA encoding the polypeptides o~
the present invention by higher eukaryotes is increased by inserting an ~nh~ncer sequence into the vector. Rnh~ncers W O 97~5349 PCT~US96/00149 - are cis-act~ng elements of DNA, usually about ~rom lO to 300 bp that act on a promoter to increase its transcription. Examples including the SV40 enhancer on the late side o~ the replication origin bp 100 to 270, a cytomegalovirus early promoter enhancer, the polyoma enhancer on the late side of the replication origin, and adenovirus enhancers.
Generally, recombinant expression vectors will include origins of replication and selectable markers permitting transformation of the host cell, e.g., the ampicillin resistance gene o~ ~. coli and S. cerevisiae TRP1 gene, and a promoter derived ~rom a highly-expressed gene to direct transcription o~ a downstream structural sequence. Such promoters can be derived from operons encoding glycolytic enzymes such as 3-phosphoglycerate kinase (PGK), ~-factor, acid phosphatase, or heat shock proteins, among others.
The heterologous structural sequence is assembled in a~l~riate phase with translation initiation and tenmination sequences, and preferably, a leader seguence capable of directing secretion o~ translated protein into the periplasmic space or extracellular medium. Optionally, the heterologous sequence can encode a ~usion protein including an N-terminal identification peptide imparting desired characteristics, e.g., ~tabilization or simpli~ied puri~ication of expressed recomhin~nt product.
Useful expression vectors for bacterial use are constructed by inserting a structural DNA sequence encoding a desired protein together with suitable translation initiation and termination signals in operable reading phase with a functional promoter. The vector will comprise one or more phenotypic selectable markers and an origin of replication to ensure maintenance of the vector and to, if desirable, provide amplification within the host. Suitable prokaryotic hosts ~or transformation include E. coli, ~acillus subtilis, S~l~n~lla tv~h;mll~ium and various species within the genera Psell~mon~, Streptomyces, and Staphylococcus, although others may also be employed as a matter of choice.

W O 97/25349 PCTrUS96/00149 - As a r~?resentative but nonl;m; ting example, useEul expression vectors ~or bacterial use can comprise a selectable marker and bacterial origin o~ replication derived ~rom commercially available plasmids comprising genetic elements of the well known cloning vector pBR322 (ATCC 37017). Such commercial vectors include, ~or exa~ple, pKK223-3 (Pharmacia Fine Chemicals, Uppsala, Sweden) and GEM1 (Promega Biotec, Madison, WI, USA). These pBR322 "backbone" sections are combined with an appropriate promoter and the structural sequence to be expressed.
Following transformation of a suitable host strain and growth o~ the host strain to an appropriate cell density, the selected promoter is induced by appropriate means (e.g., temperature shi~t or chemical induction) and cells are cultured for an additional period.
Cells are typically harvested by centri~ugation, disrupted by physical or chemical means, and the resulting crude extract retained ~or ~urther puri~ication.
Microbial cells employed in expression o~ proteins can be disrupted by any convenient method, including ~reeze-thaw cycling, sonication, mechanical disruption, or use o~
cell lysing agents, such methods are well known to those skilled in the art.
Various m~mm~ n cell culture systems can also be employed to express recombinant protein. Examples o~
m~mm~l ian expression systems include the COS-7 lines o~
monkey kidney ~ibroblasts, described by Gluzman, Cell, 23:175 (1981), and other cell lines capable of expressing a compatible vector, ~or example, the C127, 3T3, CH0, HeLa and BHK cell lines. ~mm~ n expression vectors will comprise an origin o~ replication, a suitable promoter and enhancer, and also any necessary ribosome h~n~;ng sites, polyadenylation site, splice donor and acceptor sites, transcriptional termination sequences, and 5' ~lanking nontranscribed sequences. DNA se~uences derived ~rom the SV40 splice, and polyadenylation sites may be used to provide the required nontranscribed genetic elements.

-W O 97/25349 PCT~US96/00149 The po~ypeptides can be recovered and puri~ied ~rom recombinant cell cultures by methods including ~mmnn; U~
sul~ate or ethanol precipitation, acid extraction, anion or cation ~ch~nge chromatography, phosphocellulose chromatography, hydrophobic interaction chromatography, a~inity chromatography, hydroxylapatitechromatography and lectin chromatography. Protein refolding steps can be used, as necessary, in completing con~iguration o~ the mature protein. Finally, high per~ormance liquid chromatography (HPLC) can be employed ~or ~inal puri~ication steps.
The polypeptides o~ the present invention may be a naturally puri~ied product, or a product o~ chemical synthetic procedures, or produced by recombinant techniques ~rom a prokaryotic or eukaryotic host (~or example, by bacterial, yeast, higher plant, insect and mA~lian cells in culture). Depending upon the host employed in a recombinant production procedure, the polypeptides o~ the present invention may be glycosylated or may be non-glycosylated. Polypeptides o~ the invention may also include an initial methionine amino acid residue.
The polynucleotides and polypeptides o~ the present invention may be employed as research reagents and materials ~or discovery o~ treatments and diagnostics ~or hllm~n disease.
The polypeptide of the present invention may also be employed ~or characterization o~ receptors. The EGF ~amily receptors currently includes ~our EGF receptors, denoted as EGFRl, BGFR2, EGFR3 and EGFR4. The EGFR2 receptor may also be re~erred to as Erb-2 and this molecule is use~ or a variety o~ diagnostic and therapeutic indications (Prigent, S.A., and Lemoine, N.R., Proq. Growth Factor Re~., 4:1-24 (1992~). The TGF~-HIII polypeptide is likely a ligand ~or one or more of these receptors as well as ~or a new EGF-type receptor. Use o~ the TGF~-HIII can assist with the identi~ication, characterization and cloning o~ such receptors. For example, the EGF receptor gene represents the cellular homolog o~ the v-erb-B oncogene o~ avian .

W O 97/25349 PCT~US96/00149 erythroblastQsis virus. Over expression of the EGF-receptor or deletion o~ kinase regulatory segments of the protein can bring about tumorigenic transformation of cells (Manjusri, D. et al., ~llm~n Cytokines, 364 and 381 ~1991)).
The polypeptides o~ the present invention ,m,~y also be employed for restoration or enhancement of neurological r functions ~m~n~ ~he~ as a result of trauma or other damaging pathologies (such as AIDS dementia, senile dementia, etc). TGF~ and its homologs have been found to be the most abundant ligand for the EGF/TGF~ receptor in most parts of the brain (Kaser, et al., Mol. Brain Res., 16:316-322, (1992)). There appears to be a widespread distribution of TGF~ in various regions of the brain in contrast to EGF which is only present in smaller, more discrete areas, suggesting that TGF-alpha might play a physioloyical role in brain tissues. These numerous receptor sites for TGF~ in the brain suggest that TGF has an important utility in promoting normal brain cell di~ferentiation and function. Accordingly, in instances where neurological functioning is ~tm;n;.ch~, an ~m; n~ stration of the polypeptide of the present invention may stimulate the brain and ~nh~n~e proper physiological functions.
TGF~-HIII or soluble form thereof may also be employed to treat ocular disorders, for example, corneal inflammation. A variety of experiments have implicated members of the TGF~ gene family in such pathologies. A
recent paper summarizes some of the data related to the role these growth factors play in eye disease ~Mann, et al ~ell 73:249-261 (1993)). Recent experiments have shown that a number of mice lacking the TGF~ gene displayed corneal inflammation due to an infiltration of leukocytes and other cells to the substantia propria of the eyes.
In addition, the specificity of the TGF~ growth factors for their target cells can be exploited as a mech~n~ sm to destroy the target cell. For example, TGF~-HIII or soluble forms thereof can be coupled (by a wide variety of methods) to toxic molecules: for example, a - _ ~ 9_ -W O 97/2~349 PCT~US96/00149 - radiopharmacçutical which inactivate target cells. These growth ~actor-toxin fusions kill the target cell (and in certain cases neighboring cells by a variety of ~bys~n~
e~ects). A recent example o~ such toxin-~usion genes is published by Mesri, et al., ~. Biol. Chem. 268:4853-62 (1993). TGF~-HIII and related molecules may also be encapsulated in liposomes and may be conjugated to antibodies which recognize and bind to tumor or cell specific antigens, thereby provided a means for "targeting"
cells.
In this same m~nne~, TGF~-HIII can be employed as an anti-neoplastic compound, since mem~ers o~ the EGF ~amily show anti-proliferative e~fects on transformed cells. For in vivo u~e, the subject polypeptide may be ~m;n;stered in a variety of ways, including but not limited to, injection, in~usion, topically, parenterally, etc. ~m~n;stration may be in any physiologically acceptable carrier, including phosphate bu~ered saline, saline, sterilized water, etc.
The TGF~-HIII polypeptide fragment may also be employed to treat certain kidney disorders, since it has been found that there has been expression o~ these growth ~actors in the kidney. Thus, these ~actor~ may be necessary for the proper physiological maintenance o~ this organ.
Treatments may also be related to liver regeneration or liver dys~unction, since TGF~ and its homologs and hepatocyte growth ~actor trigger hepatocyte regeneration a~ter partial hepatectomy and after acute liver cell ~ecrosis (Masuhara, M. et al, Hepatology 16:1241-1249 ~1992)).
A significant treatment involving TGF~-HIII relates to wound h~l; ng The compositions o~ the present invention may be employed ~or treating a wide variety of wounds including substantially all cutaneous wounds, corneal wounds, and injuries to the epithelial-lined hollow organs of the body. Wound~ suitable for treatment include those resulting from trauma such as burns, abrasions and cuts, as well as ~rom surgical procedures such as surgical incisions W O 97/25349 PCT~US96/00149 - and skin graf~ing. Other conditions suitable ~or treatment with the polypeptide of the present invention include chronic conditions, such as chronic ulcers, diabetic ulcers, and other non-healing (trophic) conditions.
TGF~-HIII or soluble fragment thereof may be incorporated in physiologically-acceptable carriers for application to the affected area. The nature of the carriers may vary widely and will depend on the intended location of application. For application to the skin, a cream or ointment base is usually preferred; suitable bases include lanolin, Silvadene ~Marion) (particularly ~or the treatment of burns), Aquaphor ~Duke Laboratories, South Norwalk, Conn.), and the like. If desired, it will be possible to incorporate TGF~-HIII cont~; n~ ng compositions in h~n~ges and other wound dressings to provide ~or continuous exposure of the wound to the peptide. Aerosol applications may also find use.
The concentration of TGF~-HIII in the treatment composition is not critical but should be enough to induce epithelial cell proliferation. The compositions may be applied topically to the affected area, typically as eye drops to the eye or as creams, ointments or lotions to the skin. In the case of the eyes, frequent treatment is desirable, usually being applied at intervals of 4 hours or less. On the skin, it is desirable to r~nt;nn~lly maintain the treatment composition on the affected area during the healing, with applications of the treatment composition from two to ~our times a day or more ~requently.
The amount employed o~ the subject polypeptide will vary with the manner of ~m~n; stration, the employment of other active compounds, and the like, generally being in the range o~ about 1 ~g to 100 ~g. The subject polypeptide may be employed with a physiologically acceptable carrier, such as saline, phosphate-buffered saline, or the like.
The amount of compound employed will be determ; n~
empirically, based on the response of cells in vitro and response of exper;m~nt~l ~n;m~l s to the subject 97/25349 PCT~US96/00149 polypeptides_ or ~orm~ t~ons cont~n;ng the subject polypeptides.
The TGF~-HIII or soluble fragment thereof may be employed in the modulation of angiogenesis, bone resorption, immune response, and synaptic and neuronal effector ~unctions. TGF~-HIII may also be used in the modulation of the arachidonic acid cascade.
TGF~-HIII or soluble ~ragment thereof may also be employed for applications related to terminal differentiation. Many TGF~ factors, and their homologs, induce terminal differentiation in their target cells.
This property can be exploited in vivo by ~m~n;stering the factor and inducing target cell ~ th. This regimen is under consideration for disorders related to the hyper-proliferation of medically undesirable cell types such as cancers and other proliferative disorders (eg inflammation, psoriasis, etc). In addition to in vivo ~m; n; ~tration, there are a variety of situations where in vitro ;n;stration may be warranted. For example, bone marrow can be purged of undesirable cell populations in vitro by treating the cells with growth factors and/or derivatives thereof.
Applications are also related to alopecia, hair loss and to other skin conditions which af~ect hair follicular develop~ent. Several lines of evidence implicate the involvement TGF~! growth factors in such conditions. As described above, I'knockout" mice engineered to contain a null mutation in the TGFCY gene display abnormalities related to quantitative and ~ualitative hair synthesis. In addition, mapping studies in mice have shown that some mutations af~ecting hair growth map to the TGF~ gene locus (Mann et al, Cell 73:249-261(1993)). Topical or systemic applications of TGF~-HIII or derivatives thereof may be employed to treat some ~orms of alopecia and hair ~oss and these cl~ fall within the scope of this invention.
Certain disease pathologies may be partially or completely ameliorated by the systemic clinical ~lm; n~ gtration oi~ the TGFa!-EIII growth i~actor. This W O 97/25349 PCT~US96/00149 lm;n; stration can be in the form of gene therapy (see below); or through the ~m;n;stration of peptides or proteins synthesized ~rom recombinant constructs of TGF~-HIII DNA or from peptide chemical synthesis (Woo, et al., Protein Engineering 3:29-37 (1989).
This invention provides a method o~ screening compounds to identify agonist or antagonist compounds to the polypeptide of the present invention. As an example, a m~mm~lian cell or membrane preparation expressing a TGF~-HIII receptor is incubated with a potential compound and the ability of the compound to generate a second signal from the receptor is measured to determine if it is an effective agonist. Such second messenger systems include but are not limited to, cAMP guanylate cyclase, ion channels or phosphoinositide hydrolysis. Effective antagonists are determined by the method above wherein an antagonist compound is detected which ~inds to the receptor but does not elicit a second messenger response to thereby block the receptor from TGF~-HIII.
Another assay for i~ nt; fying potential antagonists specific to the receptors to the polypeptide of the present invention is a competition assay which comprises isolating plasma membranes which over-express a receptor to the polypeptide of the present invention, for example, hllm~n A431 carctnom~ cells. Serially diluted test sample in a medium (volume is approximately 10 microliters) con~in;ng 10 nM I~I-TGF~-HIII is added to five micrograms of the plasma mc..~ ane in the presence of the potential antagonist compound and incubated for 4 hours at 4~C. The reaction mixtures are diluted and ;mm~ tely passed through a millipore filter. The filters are then rapidly washed and the bound radioactivity is measured in a gamma counter.
The amount of bound TGFa!-HIII is then measured. A control assay is also performed in the absence of the compound to determine if the antagonists reduce the amount o~ bound TGF~-HIII.

Potential antagonist compounds include an antibody, or in some cases, an oligopeptide, which binds to the polypeptide. Alternatively, a potential antagonist may be a closely related protein which binds to the receptor whcih is an inactive forms of the polypeptide and thereby prevent the action of the polypeptide of the present invention.
Another antagonist compound is an antisense construct prepared using antisense technology. Antisense technology can be used to control gene expression through triple-helix formation or antisense DNA or RNA, both of which methods are based on binding of a polynucleotide to DNA or RNA.
For example, the 5' coding portion of the polynucleotide sequence, which encodes for the mature polypeptides of the present invention, is used to design an antisense RNA
oligonucleotide of from about 10 t0 40 base pairs in length. A DNA oligonucleotide is designed to be complementary to a region of the gene involved in transcription (triple helix see Lee et al., Nucl. Acids Res., 6:3073 (1979); Cooney et al, Science, 241:456 (1988);
and Dervan et al., Science, 251: 1360 (1991)), thereby preventing transcription and the production of the polypeptide of the present invention. The antisense RNA
oligonucleotide hydridizes to the mRNA in vivo and blocks translation of the mRNA molecule into the polypeptide of the present invention (Antisense - Okano, J. Neurochem., 56:560 (1991); Oligodeoxynucleotides as Antisense Inhibitors of Gene Expression, CRC Press, Boca Raton, FL
(1988)). The oligonucleotides described above can also be delivered to cells such that the antisense RNA or DNA may be expressed in vivo to inhibit production of the polypeptide of the present invention.
Antagonist compounds include a small molecule which binds to the polypeptde of the present invention and blocks its action at the receptor such that normal biological activity is prevented. The small molecules may also bind the receptor to the polypeptide to prevent binding. Examples of small molecules include but are not limited to small peptides or peptide-like molecules.
The antagonists may be employed to treat neoplasia, for example, cancers and tumors. It is know that W O 97/25349 PCT~US96/00149 - inhibition Qf secretion or production o~ members o~ the EGF
~amily by tumor cells in mice causes regression o~ tumors.

The antagonists to the polypeptides o~ the present invention may also be used therapeutically ~or the treatment o~ certain skin disorders, ~or example, psoriasis. Elevated levels o~ expres~ion o~ members o~
this ~amily o~ growth ~actors in skin biopsies taken ~rom diseases such as psoriatic lesions have been ~ound to be elevated (Cook, et al., ~ancer Research, 52:3224-3227 (1992)). The antagonists may be employed in a composition with a pharmaceutically acceptable carrier, e.g., as hereina~ter described.
The polypeptides o~ the present invention or agonist or antagonist compounds may be employed in combination with a suitable pharmaceutical carrier. Such compositions comprise a therapeutically ef~ective amount o~ the polypeptide or compound, and a pharmaceutically acceptable carrier or excipient. Such a carrier includes but is not limited to saline, buffered saline, dextrose, water, glycerol, ethanol, and combinations thereo~. The ~ormulation should suit the mode o~ A~m;n;stration.
The invention also provides a pharmaceutical pack or kit comprising one or more cont~ners ~illed with one or more o~ the ingredients o~ the pharmaceutical compositions o~ the invention. Associated with such cont~iner(s) can be a notice in the ~orm prescribed by a governm~ntal agency regulating the manu~acture, use or sale o~ pharmaceuticals or biological products, which notice re~lects approval by the agency o~ manu~acture, use or sale ~or human ~m;n;stration. In addition, the polypeptides or compounds o~ the present invention may be employed in conjunction with other therapeutic compounds.
The pharmaceutical compositions may be~A~m;n;stered in a convenient m~nner such as by the oral, topical, intravenous, intraperitoneal, intramuscular, subcutaneous, intr~n~AAl or intradermal routes. The pharmaceutical compositions are A~m;n;stered in an amount which is W O 97/25349 PCT~US96/00149 - effective for treating and/or prophylaxis of the speci~ic indication. In general, they are ~m~n~stered in an amount of at least about 10 ~g/kg body weight and in most cases they will be ~m; n; stered in an amount not in excess o~
about 8 mg/Kg body weight per day. In most cases, the dosage is from about 10 ~g/kg to about 1 mg/kg body weight daily, taking into account the routes of ~m; n; stration, symptoms, etc.
The polypeptides, and agonists and antagonists which are polypeptides, may also be employed in accordance with the present invention by expression o~ such polypeptide~ in vivo, which is o~ten re~erred to as "gene therapy."
Thus, ~or example, cells ~rom a patient may be engineered with a polynucleotide (DNA or RNA~ encoding a polypeptide ex vivo, with the engineered cells then being provided to a patient to be treated with the polypeptide.
Such methods are well-known in the art and are apparent ~rom the teachings herein. For example, cells may be engineered by the use of a retroviral plasmid vector cont~;n;ng RNA encoding a polypeptide of the present invention.
S;m; 1 ~ly, cells may be engineered in vivo for expression of a polypeptide in vivo by, for example, procedures known in the art. For example, a packaging cell is transduced with a retroviral plasmid vector cont~in~ng RNA encoding a polypeptide of the present invention such that the packaging cell now produces infectious viral particles cont~ n; ng the gene of interest. These producer cells may be ~m; n;stered to a patient ~or engineering cells in vivo and expression of the polypeptide in vivo.
These and other methods for ~m~ n; stering a polypeptide of the present invention by such method should be apparent to those skilled in the art from the teachings of the present invention.
Retroviruses ~rom which the retroviral plasmid vectors her~n~hove mentioned may be derived include, but are not limited to, Moloney Murine Leukemia Virus, spleen necrosis virus, retroviruses ~uch as Rous Sarcoma Virus, Harvey -CA 02242633 l998-07-03 WO 97/25349 PCTrUS96/0~149 - Sarcoma Virus, avian leukosis virus, gibbon ape leukemia virus, human ;mmllnodë~iciency virus, adenovirus, Myeloproliferative Sarcoma Virus, and m~mm~ry tumor virus.
In one embodiment, the retroviral plasmid vector is derived ~rom Moloney Murine Leukemia Virus.
The vector includes one or more promoter~. Suitable promoters which may be employed include, but are not limited to, the retroviral LTR; the SV40 promoter; and the hllm~n cytomegalovirus ~CMV) promoter described in Miller, et al., Biotech~iques, Vol. 7, No. 9, 980-990 (1989), or any other promoter ~e.g., cellular promoters such as eukaryotic cellular promoters including, but not limited to, the histone, pol III, and ~-actin promoters). Other viral promoters which may be employed include, but are not limited to, adenovirus promoters, thymidine kinase (TK) promoters, and B19 parvovirus promoters. The selection of a suitable promoter will be apparent to those skilled in the art from the teachings cont~n~d herein.
The nucleic acid sequence encoding the polypeptide o~
the present invention is under the control of a suitable promoter. Suitable promoters which may be employed include, but are not limited to, adenoviral promoters, such as the adenoviral major late promoter; or heterologous promoters, such as the cytomegalovirus (CMV~ promoter; the respiratory syncytial virus (RSV) promoter; ~n~ll~lhle promoters, such as the MMT promoter, the metallothionein promoter; heat shock promoters; the albumin promoter; the ApoAI promoter; human globin promoters; ~iral thymidine kinase promoters, such as the Herpes Simplex thymidine kinase promoteri retroviral LTRs (including the modified retroviral ~TRs hereinabove described); the ~-actin promoter; and hllm~n growth hormone promoters. The promoter also may be the native promoter which controls the gene encoding the polypeptide.
The retroviral pla~mid vector is employed to transduce packaging cell lines to form producer cell lines. Examples of packaging cells which may be transfected include, but are not limited to, the PE501, PA317, ~-2, ~-AM, PA12, T19-W O 97/2~349 PCTrUS96/00149 - 14X, VT-19-1~-H2, ~CRE, ~CRIP, GP+E-86, GP+envAml2, and DAN
cell lines as described in Miller, ~llm~n Gene Thera~, Vol.
1, pgs. 5-14 (199~), which is incorporated herein by reference in its entirety. The vector may transduce the packaging cells through any means known in the art. Such means include, but are not limited to, electroporation, the use o~ liposomes, and CaPO4 precipitation. In one alternative, the retroviral plasmid vector may be encapsulated into a liposome, or coupled to a lipid, and then ~mi n; stered to a host.
The producer cell line generates in~ectious retroviral vector particles which include the nucleic acid sequence~s) encoding the polypeptides. Such retroviral vector particles then may be employed, to transduce eukaryotic cells, either in vitro or in vivo. The transduced eukaryotic cells will express the nucleic acid se~uence(s) encoding the polypeptide. Bukaryotic cells which may be transduced include, but are not limited to, embryonic stem cells, embryonic carc;nom~ cells, as well as hematopoietic stem cells, hepatocytes, fibroblasts, myoblasts, keratinocytes, endothelial cells, and bronch;~l epithelial cells.
This invention is also related to the use of the gene o~ the present invention as a diagnostic. Detection o~ a mutated form of the gene o~ the present invention will allow a diagnosis o~ a disease or a susceptibility to a disease which results ~rom underexpression of the polypeptide o~ the pre~ent invention, for example, improper wound h~Al;ng, i".~er neurological ~unctioning, ocular disorders, kidney and liver disorders, hair follicular development, angiogenesis and embryogenesis.
Individuals carrying mutations in the human gene o~
the present invention may be detected at the DNA level by a variety of techniques. Nucleic acids for diagnosis may be obt~n~ ~rom a patient's cells, such as from blood, urine, saliva, tissue biopsy and autopsy material. The genomic DNA may be used direct~y for detection or may be amplified enzymatically by using PCR (Saiki et al., Nature, W O 97125349 PCT~US96/00149 324:163-166 ~1986)) prior to analysis. RNA or cDNA may also be used for the same purpose. As an example, PCR
primers complem~nt~y to the nucleic acid encoding a polypeptide o~ the present invention can be used to identi~y and analyze mutations thereo~. For example, deletions and insertions can be detected by a change in size o~ the ampli~ied product in comparison to the normal genotype. Point mutations can be identified by hybridizing ampli~ied DNA to radiolabeled RNA or alternatively, radiolabeled antisense DNA sequences. Per~ectly matched sequences can be distinguished ~rom mismatched duplexes by RNase A digestion or by differences in melting temperatures.
Sequence di~erences between the re~erence gene and genes having mutations may be revealed by the direct DNA
se~lPnc;ng method. In addition, cloned DNA segments may be employed as probes to detect speci~ic DNA segments. The sensitivity o~ this method is greatly enhanced when combined with PC~. For example, a sequencing primer is used with double-str~n~e~ PCR product or a single-stranded template molecule generated by a modi~ied PCR. The sequence determination is per~ormed by conventional procedures with radiolabeled nucleotide or by automatic se~l~nc~ng procedures with ~luorescent-tags.
Genetic testing based on DNA sequence dif~erences may be achieved by detection o~ alteration in electrophoretic mobility o~ DNA ~ragments in gels with or without denaturing agents. Small sequence deletions and insertions can be ~isualized by high resolution gel electrophoresis.
DNA ~ragments o~ di~erent sequences may be distinguished on denaturing ~ormamide gradient gels in which the mobilities o~ di~erent DNA ~ragments are retarded in the gel at di~erent positions according to their speci~ic melting or partial melting temperatures (see, e.g., Myers et al ., Science, 230:1242 (1985)).
Sequence changes at speci~ic locations may also be revealed by nuclease protection assays, such as RNase and .

W O g7/2S349 PCT~US96/00149 - S1 protection or the chemical cleavage method (e.g., Cotton et al., PNAS, USA, 85:4397-4401 (1985)).
Thus, the detection of a speci~ic DNA sequence may be achieved by methods such as hybridization, RNase protection, chemical cleavage, direct DNA seguencing or the use o~ restriction enzymes, ~e.g , Restriction Fragment Length Polymorphisms (RFLP)) and Southern blotting of genomic DNA.
In addition to more conventional gel-electrophoresis and DNA sequencing, mutations can also be detected by in situ analysis.
The present invention al~o relates to diagnostic assays ~or detecting altered levels o~ the polypeptide o~
the present invention in various tis~ues since an over-expression of the proteins co~r~red to normal control tissue samples can detect the presence o~ certain disease conditions such as neoplasia, skin disorders, ocular disorders and in~lammation. Assays used to detect levels o~ the polypeptide o~ the present invention in a sample derived ~rom a host are well-known to those o~ skill in the art and include radio;mmllnQassays, competitive-binding assays, Western Blot analysi~ and preferably an ELISA
assay. An ELISA assay initially comprises preparing an antibody specific to an antigen o~ the polypeptide o~ the present invention, pre~erably a monoclonal antibody. In addition a reporter antibody is prepared ayainst the monoclonal antibody. To the reporter antibody is attached a detectable reagent such as radioactivity, ~luorescence or in this example a horseradish peroxidase enzyme. A sample is now ~ ~ved ~rom a host and incubated on a solid support, e.g. a polystyrene dish, that binds the proteins in the sample. Any free protein hi n~i ng sites on the dish are then covered by incubating with a non-speci~ic protein such as bovine serum albumin. Next, the monoclonal antibody is incubated in the dish during which time the monoclonal antibodies attach to any polypeptides o~ the present invention attA~h~ to the polystyrene dish. All unbound monoclonal antibody is washed out with bu~er. The W O 97/25349 PCTrUS96/00149 - reporter antibody linked to horseradish peroxidase i8 now placed in the dish resulting in binding of the reporter antibody to any monoclonal antibody bound to polypeptides o~ the present invention. Unattached reporter antibody is then washed out. Peroxidase substrates are then added to the dish and the amount o~ color developed in a given time period is a measurement o~ the amount o~ protein present in a given volume of patient sample when compared against a st~n~d curve.
A competition assay may also be employed to determine levels of the polypeptide of the present invention in a sample derived ~rom the hosts. Such an assay comprises isolating plasma membranes which over-express the receptor for the polypeptide o~ the present invention. A test sample contA~n~ng the polypeptides of the present invention which have been labeled, are then added to the plasma membranes and then incubated for a set period of time.
Also added to the reaction mixture is a sample derived from a host which is suspected of cont~n;ng the polypeptide of the present invention. The reaction mixtures are then passed through a filter which is rapidly washed and the bound radioactivity is then measured to determine the amount o$ competition ~or the receptors and there~ore the amount o~ the polypeptides of the present invention in the sample.
Antibodies specific to TGF~-HIII may be used for cancer diagnosis and therapy, since many types of cancer cells up-regulate various members of the TGF~ ~amily during the process o~ neoplasia or hyperplasia. These antibodies bind to and inactivate TGF~-HIII. Monoclonal antibodies against TGF~-HIII (and/or its family members) are in clinical use for both the diagnosis and therapy o~ certain disorders including (but not limited to) hyperplastic and neoplastic growth abnormalities. Upregulation o~ growth ~actor expression by neoplastic tissues ~orms the basis $or a variety o~ serum assays which detect increases in growth factor in the blood of affected patients. These assays are typically applied not only in diagnostic settings, but are WO 97~5349 PCT~US96/00149 - applied in ~rognostic settings as well (to detect the presence o~ occult tumor cells following surgery, chemotherapy, etc).
In addition, malignant cells expressing the TGF~-HIII
receptor may be detected by using labeled TGF~-HIII in a receptor binding assay, or by the use o~ antibodies to the TGF~-HIII receptor itsel~. Cells may be distinguished in accordance with the presence and density of receptors ~or TGF~-HIII, thereby providing a means ~or predicting the susceptibility o~ such cells to the biological activities o~ TGF~-HIII.
The sequences o~ the present invention are also valuable ~or chromosome identification. The sequence is speci~ically targeted to and can hybridize with a particular location on an individual hnm~n chromosome.
Moreover, there is a current need ~or identifying particular sites on the chromosome. Few chromosome marking reagents based on actual se~uence data (repeat polymorphisms) are presently available for marking chromosomal location. The mapping o~ DNAs to chromosomes according to the present invention is an important ~irst step in correlating those sequences with genes associated with di~ease.
Briefly, sequences can be mapped to chromosomes by preparing PCR primers (preferably 15-25 bp~ ~rom the cDNA.
Computer analysis o~ the 3' untranslated region o~ the gene is used to rapidly select primers that do not span more than one exon in the genomic DNA, thus complicating the ampli~ication process. These primers are then used ~or PCR
screening o~ somatic cell hybrids contA;n;ng individual hllm~n chromosomes. Only those hybrids contA;n;ng the human gene corresponding to the primer will yield an ~mpli~ied ~ragment.
PCR mapping o~ somatic cell hybrids is a rapid procedure ~or assigning a particular DNA to a particular chromosome. Using the present invention with the same oligonucleotide primers, sublocalization can be achieved with panels o~ ~ragments ~rom speci~ic chromosomes or pools W O 97/25349 PCT~US96/00149 - of large ge~omic clones in an analogous manner. Other mapping strategies that can similarly be used to map to its chromosome include in situ hybridization, prescreening with labeled ~low-sorted chromosomes and preselection by ~ hybridization to construct chromosome specific-cDNA
libraries.
Fluorescence in 57 tu hybridization (FISH) of a cDNA
clone to a metA~h~e chromosomal spread can be used to provide a precise chromosomal location in one step. This technique can be used with cDNA as short as 50 or 60 bases.
For a review of this technique, see Verma et al., ~llmAn Chromosomes: a ~nll~l of ~asic Techniques, Pe~ydlllollpre New ~ork (1988).
Once a sequence has been mapped to a precise chromosomal location, the physical position o~ the sequence on the chromosome can be correlated with genetic map data.
Such data are found, for example, in V. McKusick, Mendelian Inheritance in Man (available on line through Johns Hopkins University Welch Medical ~ibrary). The relation~h;p between genes and diseases that have been mapped to the same chromosomal region are then identified through linkage analysis (coinheritance of physically adjacent genes).
Next, it is necessary to determine the dif~erences in the cDNA or genomic sequence between affected and unaf~ected individuals. If a mutation is observed in some or all o~ the affected individuals but not in any normal individuals, then the mutation is likely to be the causative agent o~ the disease.
With current resolution of physical mapping and genetic mapping techniques, a cDNA precisely localized to a chromosomal region associated with the disease could be one of between 50 and 500 potential causative genes. (This assumes 1 megabase mapping resolution and one gene per 20 kb).
The polypeptides, their ~ragments or other derivatives, or analogs thereof, or cells expressing them can be used as an ;mmllnogen to produce antibodies thereto.
These antibodies can be, for example, polyclonal or 97~5349 PCT~US96/00149 monoclonal a~tibodies. The present invention also includes c~;m~ric, single chain, and hl7m~nized antibodies, as well as Fab fragments, or the product of an Fab expression library. Various procedures known in the art may be used ~or the production o~ such antibodies and ~ragments.
Antibodies generated against the polypeptides corresponding to a sequence of the present invention can be obtained by direct injection of the polypeptides into an ~n~m~l or by ~m;n; stering the polypeptides to an ~n;m~l, pre~erably a nonhl7m~n . The antibody so obt~; n~ will then bind the polypeptides itsel~. In this m~nn~, even a sequence encoding only a ~ragment o~ the polypeptides can be used to generate antibodies binding the whole native polypeptides. Such antibodies can then be used to isolate the polypeptide ~rom tissue expressing that polypeptide.
For preparation of monoclonal antibodies, any techni~ue which provides antibodies produced by continuous cell line cultures can be used. Examples include the hybridoma technique (Kohler and Milstein, 1975, Nature, 256:495-497), the trioma technique, the hllm~n B-cell hybridoma technique (Kozbor et al., 1983, Tmmllnology Today 4:72), and the BBV-hybridoma technique to produce human mono~lon~l antibodies (Cole, et al., 1985, in Monoclonal Antibodies and Cancer Therapy, Alan R. Liss, Inc., pp. 77-96).
Techniques described for the production o~ single ch~; n antibodies (U.S. Patent 4,946,778) can be adapted to produce single chain antibodies to ;mmllnogenic polypeptide products o~ this invention. Also, transgenic mice may be used to express hllm~nlzed antibodies to ;mm~nogenic polypeptide products o~ this invention.
The present invention will be ~urther described with re~erence to the ~ollowing examples; however, it is to be understood that the present invention is not limited to such examples. All parts or amounts, unless otherwise specified, are by weight.

W O 97/25349 PCT~US96/00149 - In orde~ to ~acilitate underst~n~;ng of the ~ollowing examples certain ~requently occurring methods and/or terms will be described.
"Plasmids" are designated by a lower case p preceded and/or ~ollowed by capital letters and/or numbers. The starting plasmids herein are either commercially available, publicly available on an unrestricted basis, or can be constructed ~rom available plasmids in accord with published procedures. In addition, equivalent plasmids to those described are known in the art and will be apparent to the ordinarily skilled artisan.
"Digestion" o~ DNA refers to catalytic cleavage o~ the DNA with a restriction enzyme that acts only at certain sequences in the DNA The various restriction enzymes used herein are commercially available and their reaction conditions, co~actors and other requirements were used as would be known to the ordinarily skilled artisan. For analytical purposes, typically 1 ~g o~ plasmid or DNA
~ragment is used with about 2 units o~ enzyme in about 20 ~1 o~ bu~er solution. For the purpose o~ isolating DNA
~ragments ~or plasmid construction, typically 5 to 50 ~g o~
DNA are digested with 20 to 250 units o~ enzyme in a larger volume. Appropriate bu~ers and substrate amounts ~or particular reetriction enzymes are specified by the manu~acturer. Incubation times o~ about 1 hour at 37 C are ordinarily ueed, but may vary in accordance with the supplier's instructions. A~ter digestion the reaction is electrophoresed directly on a polyacrylamide gel to ieolate the desired ~ragment.
Size separation o~ the cleaved ~ragments is per~ormed u~ g 8 percent poly~-rvla~mide ael described by Goeddel D
et al., Nucleic Acids Res., 8:4057 (1980).
"Oligonucleotides" re~ers to either a single str~n~e~
polydeoxynucleotide or two complementary polydeoxynucleotide strands which may be chemically syntheeized. Such synthetic oligonucleotides have no 5' phosphate and thus will not ligate to another oligonucleotide without adding a phosphate with an ATP in W O 97/25349 PCT~U$96/00149 - the presence of a kinase. A synthetic oligonucleotide will ligate to a ~ragment that has not been dephosphorylated.
"Ligation" refers to the process of ~orming phosphodiester bonds between two double str~n~ nucleic acid ~ragments (Maniatis, T., et al., Id., p. 146). Unless otherwise provided, ligation may be accomplished using ~nown buffers and conditions with 10 units of T4 DNA ligase (~ligase~) per 0.5 ~g o~ approximately equimolar amounts o~
the DNA fragments to be ligated.
Unless otherwi~e stated, transformation was performed as described in the method of Graham, F. and Van der Eb, A., Virology, 52:456-457 (1973).

Example 1 Bacterial Expression and Purification of the soluble ~orm of TGF~-HIII
The DNA se~uence encoding TGF~-HIII, ATCC # 97342, was initially amplified using PCR oligonucleotide primers corresponding to the 5' sequences of the processed TGF~-HIII protein (minus the signal peptide sequence) and the vector seguences 3' to the TGF~-HIII gene. Additional nucleotides corresponding to TGF~-HIII were ~e~ to the 5' and 3~ seguences respectively. The 5~ oligonucleotide primer has the sequence 5' CGCGGATCCGGGCAAAAGAACCTTTGC 3' ~SEQ ID NO:3) cont;~;n~ a BamHI restriction enzyme site (in bold) ~ollowed by 18 nucleotides o~ TGF~-HIII coding sequence starting from the presumed t~r~;n~l amino acid of the processed protein. The 3' sequence 5 G~ ~r-~CTA~AGCAGTGAGAACGAGCC 3' (SEQ ID NO:4) contA;n~
complementary sequences to a XbaI site and is followed by 21 nucleotides o~ TGF~-HIII. The restriction enzyme sites correspond to the restriction enzyme sites on the bacterial expression vector pQE-9 (Qiagen, Inc. Chatsworth, CA, 91311). pQE-9 encodes antibiotic resista~ce (Ampr), a bacterial origin of replication (ori), an IPTG-regulatable promoter operator (P/O), a ribosome binding site (RBS), a 6-His tag and restriction enzyme sites. pQE-9 was then digested with BamHI and XbaI. The ampli~ied sequences were -WO 97/Z5349 PCT~US96/00149 - ligated into_ pQE-9 and were inserted in ~rame with the sequence encoding ~or the histidine tag and the RBS. The ligation mixture wa~ then used to trans~orm ~. coli strain M1~/rep 4 (Qiagen, Inc.) by the procedure described in Sambrook, J. et al., Molecular Cloning: A Laboratory nll~l, Cold Spring Laboratory Press, ~1989). M15/rep4 cont~;~C multiple copies of the plasmid pREP4, which expresses the lacI repressor and also con~ers kanamycin resistance (Kanr). Trans~ormants were i~nt; fied by their ability to grow on LB plates and ampicillin/k~n~mycin resistant colonies were selected. Plasmid DNA was isolated and con~irmed by restriction analysis. Clones containing the desired constructs were grown overnight (O/N) in liquid culture in ~B media supplemented with both Amp (100 ug/ml) and Kan (25 ug/ml). The O/N culture was used to inoculate a large culture at a ratio o~ 1:100 to 1:250. The cells were grown to an optical density 600 (O.D.~) o~ between 0.4 and 0.6. IPTG ("Isopropyl-B-D-thiogalacto pyranoside") was then ~ to a ~inal concentration o~ 1 mM. IPTG
induces by inactivating the lacI repressor, clearing the P/O leading to increased gene expression. Cells were grown an extra 3 to 4 hours. Cells were then harvested by centri~ugation. The cell pellet was solubilized in the chaotropic agent 6 Molar Guanidine HCl. A~ter clari~ication, solubilized TGF~-HlII was puri~ied ~rom this solution by chromatography on a Nickel-Chelate column under conditions that allow for tight binding by proteins COntA~n;ng the 6-His tag (Hochuli, E. et al., J.
Chromatography 411:177-184 (1984)). TGF~-HIII (85 % pure) was eluted ~rom the column in 6 molar guanidine HCl pH 5.0 and ~or the purpose o~ renaturation adjusted to 3 molar guanidine HCl, lOOmM sodium phosphate, 10 molar glutathione (reduced) and 2 molar glutathione (oxidized). A~ter incubation in this solution ~or 12 hours the protein was dialyzed to 10 molar sodium phosphate.

Example 2 97~5349 PCT~US96/00149 Cloninq and expression of TGF~-HIII usinq the baculovirus exPression system The DNA sequence encoding the TGF~-HIII protein, ATCC
# 97342, was ampliEied using PCR oligonucleotide primers corresponA;ng to the 5' and 3' sequences o~ the gene.
The first set of primers listed below correspond to the extracellular ~n~i n and the second set correspond the putative active ~nm~; n:
The ~irst set of primers are, ~ ' CGCGGATCCGTCCATCATGGCGCCTCACGGCCCG 3' (SEQ ID N0:5) and 5' G~-LAGACTACATAAGCAGTGAGAACGAGCC 3' (SEQ ID N0:6);
The second set o~ primers are:
5' C~:CGGATCCCGGGC~AAPZ~~Z~r~TTGC 3' (SEQ ID N0:7) 5 ' G~AGACTACATAAGCAGTGAGAACGAGCC 3~( SEQ ID N0:8).
All 5' primers have a BamHI restriction enzyme site (in bold). The 3' primer se~uences contain the cleavage site for the restriction ~n~onllclease XbaI and have nucleotides complementary to the 3' extracellular and active domain, respectively of the TGF~-HIII gene. The amplified se~uences were isolated ~rom a 1~ agarose gel using a commercially available kit ("Geneclean," BI0 101 Inc., La ~olla, Ca.). The fragment was then digested with the ~n~onllrleases BamHI and XbaI and then purified again on a 1~ agarose gel. This fragment was designated F2.
The vectors pA2 and pA2GP were used (modi~ication of pV~941 vec~or, discussed below) for the expression o~ the TGF~-HIII protein using the baculovirus expression system (for review see: Summers, M.D. and Smith, G.E. 1987, A
m~nllAl o~ methods ~or baculovirus vectors and insect cell culture procedures, Texas Agricultural Experimental Station Bulletin No, 1555). This expression vector r.ontA; n!:: the strong polyhedrin promoter of the Autographa cali~ornica nuclear polyhedrosis virus (AcMNPV) ~ollowed by the recognition sites for the restriction ~n~Qnllclea~es. The polyadenylation site Of the simian virus SV40 was used ~or e~ficient polyadenylation. For an easy selection of rec~mh~ n~nt virus the beta-galactosidase gene ~rom E.coli was inserted in the same orientation as the polyhedrin _ W O 97125349 PCT~US96/00149 - promoter ~ollowed by the polyadenylation signal of the polyhedrin gene. The polyhedrin sequences were flanked at both sides by viral ~e~uences for the cell-mediated homologous recombination of co-transfected wild-type viral DNA. Many other baculovirus vectors could be used such as pAc373, pRG1, pVL941 and pAcIM1 (Luckow, V.A. and ~ummers, M.D., Virology, 170:31-39~.
The plasmid was digested with the restriction enzymes BamHI and XbaI and then dephosphorylated using calf intestinal phosphatase by procedures known in the art. The DNA was then isolated from a 1~ agarose gel using the commercially av~ hle kit ("Geneclean" BIO 101 Inc., La Jolla, Ca.~. This vector DNA was designated V2.
Fragment F2 and the ~pho~phorylated plasmid V2 were ligated with T4 DNA ligase. E.coli HB101 cells were then trans~ormed and bacteria identified that con~nP~ the plasmid (pBacTGF~-HIII) with the TGF~-HIII gene using the restriction enzymes BamHI and XbaI. The sequence of the cloned ~ragment was con~irmed by DNA se~uencing.
5 ~g of the plasmid pBacTGF~-HIII was co-trans~ected with 1.0 ~g o~ a commercially av~ ble linearized baculovirus ("BaculoGold~ baculovirus DNA", Pharmingen, San Diego, CA.) using the lipo~ection method (Felgner et al.
~roc. Natl. Acad. Sci. USA, 84:7413-7417 (1987)).
l~g o~ BaculoGold~ virus DNA and 5 ~g o~ the plasmid pBacTGFc~-HIII were m;~A in a sterile well of a microtiter plate cont~in~ng 50 ~l o~ serum ~ree Grace's medium (Life Technologies Inc., Gaithersburg, MD). A~terwards 10 ~l ~ipofectin plus 90 ~1 Grace's medium were ~ , m~xe~ and incubated for 15 minutes at room temperature. Then the trans~ection mixture was added drop-wise to the S~9 insect cells (ATCC CRL 1711) seeded in a 35 mm tissue culture plate with 1 ml Grace's medium without serum. The plate was rocked back and forth to mix the newly added solution.
The plate was then incubated for 5 hours at 27~C. A~ter 5 hours the transfection solution was removed from the plate and 1 ml of Grace's insect medium supplemented with 10 97/25349 PCT~US96/00149 ~etal cal~ serum was added. The plate was put back into an incubator and cultivation continued at 27~C ~or four days.
After ~our days the supernatant was collected and a plaque assay perfonmed similar as described by Summers and Smith (supra). As a modification an agarose gel with '~Blue Gal" (Life Technologies Inc., Gaithersburg) was used which allows an easy isolation of blue sta~n~ pla~ues. (A
detailed description o~ a "pla~ue assay" can also be ~ound in the user's guide for insect cell culture and baculovirology distributed by Life Technologies Inc., Gaithersburg, page 9-10).
Four days after the serial dilution, the virus was added to the cells and blue stained pla~ues were picked with the tip o~ an Eppendorf pipette. The agar cont~;n~ng the recombinant viruses was then resuspended in an Eppendor~ tube cont~;n;ng 200 ~1 of Grace's medium. The agar was removed by a brief centrifugation and the supernatant cont~;n;ng the recombinant baculovirus was used to in~ect S~9 cells seeded in 35 mm dishes. Four days later the s~pernatants o~ the~e culture dishes we~e harvested and then stored at 4~C.
S~9 cells were grown in Grace's medium supplemented with 10% heat-inactivated FBS. The cells were in~ected with the recomh;n~nt baculovirus V-TGF~-HIII at a multiplicity o~ infection (MOI) o~ 2. Six hours later the medium was .e",o~ed and replaced with SF900 II medium minus methionine and cysteine (Li$e Technologies Inc., Gaithersburg) 42 hours later 5 ~Ci of 35S-methionine and 5 ~Ci 3~S cysteine (Amersham) were added. The cells were ~urther ;nc~ ted for 16 hours be~ore they were harvested by centrifugation and the labelled proteins visualized by SDS-PAGE and autoradiography.

Example 3 Expression o~ Recombinant TGFa-HIII in COS cells The expression of plasmid, TGF~-HIII HA is derived from a vector pcDNA3/Amp (Invitrogen) cont~;n;ng: 1) SV40 origin of replication, 2~ ampicillin resistance gene, 3) W O ~7/25349 PCTrUS96/00149 - E.coli replication origin, 4) CMV promoter ~ollowed by a polylinker region, an SV40'intron and~polyadenylation site.
A DNA ~ragment encoding the entire TGF~-HIII precursor and a HA tag ~used in ~rame to its 3' end is cloned into the polylinker region o~ the vector, there~ore, the recombinant protein expression is directed under the CMV promoter. The EA tag ~orresponds to an epitope derived from the in~luenza hemagglutinin protein as previously described (I. Wilson, H. Niman, R. Heighten, A Cherenson, M. Connolly, and R.
Lerner, 1984, Cell 37:767, ~1984)). The in~usion o~ HA tag to the target protein allows easy detection of the recombinant protein with an antibody that recognizes the HA
epitope.
The plasmid construction strategy is described as ~ollows:
The DNA sequence encoding TGF~-HIII, ATCC # 97342, is constructed by PCR using two primers: the 5' primer 5' CGCGGA~ ~lCCATC~TGGCGCCTCACGGCCCG 3' (SEQ ID NO:5) contains a BamHI site (in bold) followed by 18 nucleotides o~ TGF~-HIII coding sequence starting ~rom the initiation codon; the 3' sequence 5' GCGCT~ T~AGCAGTGAGAACGAGCC 3' (SEQ ID NO:9) contains compl~mf~nt;-l-y sequences to an XhoI
site, the last 21 nucleotides oE the TGFC~!-HIII tl~ ;n and an XhoI site. pcDNA3/Amp vector cont;~inS B am-xI/xhoI
clonin~ sites which bring the PCR insert in ~rame with the 3' HA tag ~ollowed by a stop codon. There~ore, the PCR
product contains a BamHI site, 606 base pair coding sequence and an XhoI site. The PCR ampli~ied DNA ~ragment and the vector, pcDNA3/Amp, are dige~ted with BamHI and XhoI restriction enzyme and ligated. The ligation mixture is transformed into E. coli strain SURE (available ~rom Strata~ene Cloning Systems, ~a ~olla, CA 92037) the trans~ormed culture is plated on ampicillin media plates and resi~tant colonies are selected. Pla~mid DNA is isolated ~rom transformants and ~m~ n~ by restriction analysis ~or the presence o~ the correct ~ragment. For expression o~ the recombinant ~GF~-HIII, COS cells are transfected with the expression vector by DEAE-DEXTRAN

W O 97/25349 PCT~US96/00149 method (~. ~ambrook, E. Fritsch, T. Maniatis, Molecular Cloning: A Laboratory M~nll~l, Cold Spring Laboratory Press, (1989)). The expression o~ the TGF~-HIII HA protein is detected by radiolabelling and ;mmllnoprecipitation method ~E. Harlow, D. Lane, Antibodies: A Laboratory ~nl~l, Cold Spring Harbor Laboratory Press, (1988)). Cells are labelled ~or 8 hours with 3~S-cysteine two day~ post trans~ection. Culture media is then collected and cells are lysed with detergent (RIPA bu~er (150 mM NaCl, 1~ NP-40, 0.1% SDS, 1% NP-40, 0.5% DOC, 50mM Tris, pH 7.5) (Wilson, I. et al., Id. 37:767 (1984)). Both cell lysate and culture media are precipitated with an HA speci~ic monoclonal antibody. Proteins precipitated are analyzed on 15% SDS-PAGE gels.

~xample 4 Ex~ression via Gene TherapY
- Fibrobla8ts are obtained from a subject by skin biopsy. The resulting tissue is placed in tissue-culture medium and separated into small pieces. Small chunks o~
the tissue are placed on a wet sur~ace of a tissue culture ~lask, approximately ten pieces are placed in each ~lask.
The ~lask is turned upside down, closed tight and left at room temperature over night. A~ter 24 hours at room temperature, the ~lask is inverted and the chunks o~ tissue r~m~ n fixed to the bottom o$ the ~lask and ~resh media ~e.g., Ham's F12 media, with 10~ FBS, penic;ll ;n and streptomycin, is added. This is then incubated at 37~C ~or approximately one week. At this time, ~resh media is ~fl~
and ~ubse~uently changed every reveral days. A~ter an additional two weeks in culture, a monolayer of ~ibroblasts emerge. The monolayer is trypsinized and scaled into larger ~la~ks.
pMV-7 (Kirschmeier, P.T. et al, DNA, 7:219-25 (1988) f~lanked by the long terminal repeats of the Moloney murine sarcoTna virus, is digested with EcoRI and T~; nflTII and subsequently treated with cal~ intes~inal phosphatase. The .

-W O 97/25349 PCT~US96/00149 - l;ne~ vector is ~ractionated on agarose gel and purified, using glass beads.
The cDNA encoding a polypeptide of the present invention is amplified using PCR primers which correspond to the 5' and 3' end sequences respectively. The 5' primer cont~n~ng an EcoRI site and the 3' primer further includes a HindIII site. Equal quantities o~ the Moloney murine sarcoma virus linear backbone and the amplified EcoRI and HindIII fragment are added together, in the presence of T4 DNA ligase. The resulting mixture is maint~;ne~ under conditions appropriate ~or ligation of the two ~ragments.
The ligation mixture is used to transform bacteria HB101, which are then plated onto agar-cont~;n;ng kanamycin for the purpose of confirming that the vector had the gene of interest properly inserted.
The amphotropic pA317 or GP+aml2 packaging cells are grown in tissue culture to confluent density in Dulbecco's Modi~ied Eagles Medium (DMEM) with 10~ calf serum ~CS), penicillin and streptom~cin. The MSV vector cont~;n~ng the gene is then added to the media and the packaging cells are transduced with the vector. The packaging cells now produce infectious viral particles cont~n;ng the gene (the packaging cells are now referred to as producer cells).
Fresh media is added to the transduced producer cells, and subsequently, the media is harvested from a 10 cm plate of con~luent producer cells. The spent media, contAtn;ng the infectious viral particles, is ~iltered through a millipore ~ilter to remove detached producer cells and this media is then used to infect fibroblast cells. Media is removed ~rom a sub-confluent plate of fibroblasts and qnlickly replaced with the media Erom the producer cells.
This media is removed and replaced with fresh media. If the titer o~ virus is high, then virtually all ~ibroblasts will be in~ected and no selection is required. If the titer is very low, then it is necessary to u~e a retroviral vector that has a selectable marker, such as neo or his.
The engineered fibroblasts are then injected into the host, either alone or a~ter having been grown to confluence WO 97/25349 PCT~US96/~0149 - on cytodex 3 microcarrier beads. The ~ibroblasts now produce the protein product.
Numerous modifications and variations o~ the present invention are possible in light o~ the above teachings and, there~ore, within the scope o~ the appended claims, the invention may be practiced otherwise than as particularly described.

-CA 02242633 l998-07-03 W 0 97/25349 PCT~US96/00149 _- SEQUENCE LISTING

(1) GENERAL INFORMATION:
(i) APPLICANT: Wei, Ying-Fei (ii) TITLE OF l~V~Nl'ION: Trans~orming Growth Factor Alpha HIII
(iii) NUMBER OF SEQUENCES: 10 (iv) CORRESPONDENCE ADDRESS:
(A) ADDRESSEE: Carella, Byrne, Bain, Gilfillan, Cecchi, Stewart & Olstein (B STREET: 6 Becker Farm Road (C CITY: Roseland (D STATE: NJ
(E COUN'1'KY: USA
(F ZIP: 07068-1739 (v) COMPUTER READABLE FORM:
~'A) MEDIUM TYPE: Floppy disk ~B) COMPUTER: IBM PC compatible ~C) OPERATING SYSTEM: PC-DOS/MS-DOS
~,D) SOFTWARE: PatentIn Release #1.0, Version #1.30 (vi) CURRENT APPLICATION DATA:
(A) APPLICATION NUMBER:
(B) FILING DATE:
(C) CLASSIFICATION:
(viii) ATTORNEY/AGENT INFORMATION:
(A) NAME: Ferraro, Gregory D
(B) REGISTRATION NUMBER: 36,134 (C) REFERENCE/DOCKET NUMBER: 325800-484 (ix) TELECOMMUNICATION INFORMATION:
(A) TEL~: 201-994-1700 (B) TELEFAX: 201-994-1744 (2) INFORMATION FOR SEQ ID NO:1:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 923 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) (ix) FEATURE:
(A) NAME/KEY: CDS
(B) LOCATION: 5..691 (xi) SEQUENCE DESCRIPTION: SEQ ID NO:1:

Met Ala Pro His Gly Pro Gly Ser Leu Thr Thr Leu Val Pro Trp Ala Ala Ala Leu Leu Leu Ala Leu Gly Val Glu Arg Ala Leu Ala Leu CA 02242633 l998-07-03 W O 97/25349 PCTnUS96/00l49 Pro Glu Ile Cys Thr-Gln Cys Pro Gly Ser Val Gln Asn Leu Ser Lys Val Ala Phe Tyr Cys Lys Thr Thr Arg Glu Leu Met Leu His Ala Arg Cys Cys Leu Asn Gln Lys Gly Thr Ile Leu Gly Leu Asp Leu Gln Asn Cys Ser Leu Glu Asp Pro Gly Pro Asn Phe His Gln Ala His Thr Thr Val Ile Ile Asp Leu Gln Ala Asn Pro Leu Lys Gly Asp Leu Ala Asn Thr Phe Arg Gly Phe Thr Gln Leu Gln Thr Leu Ile Leu Pro Gln His Val Asn Cys Pro Gly Gly Ile Asn Ala Trp Asn Thr Ile Thr Ser Tyr Ile Asp Asn Gln Ile Cys Gln Gly Gln Lys Asn Leu Cys Asn Asn Thr Gly Asp Pro Glu Met Cys Pro Glu Asn Gly Ser Cys Val Pro Asp Gly 160 165 170 ~ 175 Pro Gly Leu Leu Gln Cys Val Cys Ala Asp Gly Phe His Gly Tyr Lys Cys Met Arg Gln Gly Ser Phe Ser Leu Leu Met Phe Phe Gly Ile Leu Gly Ala Thr Thr Leu Ser Val Ser Ile Leu Leu Trp Ala Thr Gln Arg CGA AAA GCC AAG ACT TCA TGAACTACAT AG~~ ACC ATTGACCTAA 721 Arg Lys Ala Lys Thr Ser GGTGTAGACA AATACCAGTT CCCA~ G~l~G TTGTTGCCTA TAATAAACAC ~l"l"l"L"l"l'~'l"l"l' TTTAAAAAAA A~AAAAAAAA AA 923 ~2) l~K~ATION FOR SEQ ID NO:2:
(i) ~u~ CHARACTERISTICS:
A) LENGTH: 229 amino acids B) TYPE: amino acid ~D) TOPOLOGY: linear (ii) MOLECULE TYPE: protein -W O 97/2~349 PCT~US96/00149 ~Xi ) ~i :VU~;NC~ DESCRIPTION: SEQ ID NO: 2:
~et Ala Pro His Gly Pro Gly Ser Leu Thr Thr Leu Val Pro Trp Ala ~la Ala Leu Leu Leu Ala Leu Gly Val Glu Arg Ala Leu Ala Leu Pro ~lu Ile Cys Thr Gln Cys Pro Gly Ser Val Gln Asn Leu Ser Lys Val Ala Phe Tyr Cys Lys Thr Thr Arg Glu Leu Met Leu His Ala Ary Cys Cys Leu Asn Gln Lys Gly Thr Ile Leu Gly Leu Asp Leu Gln Asn Cys ~er Leu Glu Asp Pro Gly Pro Asn Phe His Gln Ala His Thr Thr Val ~le Ile Asp Leu Gln Ala Asn Pro Leu Lys Gly Asp Leu Ala Asn Thr Phe Arg Gly Phe Thr Gln Leu Gln Thr Leu Ile Leu Pro Gln His Val Asn Cys Pro Gly Gly Ile Asn Ala Trp Asn Thr Ile Thr Ser Tyr Ile Asp Asn Gln Ile Cys Gln Gly Gln Lys Asn Leu Cys Asn Asn Thr Gly ~sp Pro Glu Met Cys Pro Glu Asn Gly Ser Cys Val Pro Asp Gly Pro ~ly Leu Leu Gln Cys Val Cys Ala Asp Gly Phe His Gly Tyr Lys Cys Met Arg Gln 61y Ser Phe Ser Leu Leu Met Phe Phe Gly Ile Leu Gly Ala Thr Thr Leu Ser Val Ser Ile Leu Leu Trp Ala Thr Gln Arg Arg Lys Ala Lys Thr Ser (2) INFORMATION FOR SEQ ID NO: 3:
( i ) SEQUENCE CHARACTERISTICS:
(A'l LENGTH: 27 base pairs (B, TYPE: nucleic acid (C I STRA~L~ ;SS: single ( D TOPOLOGY: linear (ii) ~OLECULE TYPE: DNA (genomic) (xi ) SEQUENCE DESCRIPTION : SEQ ID NO : 3:
CGCGGATCCG GG~AAAAr~Az~ CCTTTGC 27 (2) INFORMATION FOR SEQ ID NO: 4:
( i ) ~i~iyu~ ; CHARACTERISTICS:
(A) LENGTH: 30 base pairs W O 97n~349 PCTAJS96/00149 (B) TYPE~ nucleic acid (C) STRA~n~DM~.~S: single~ ~
(D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) (xi) SEQUENCE DESCRIPTION: SEQ ID NO:4:
GCGTCTAGAC TAAAGCAGTG AGAACGAGCC , 30 (2) INFORMATION FOR SEQ ID NO:5:
(i) SEQUENCE C~ARACTERISTICS:
'A'~ LENGTH: 34 base pairs B TYPE: nucleic acid Cl STRAN~N~SS: single ;D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) (xi) SEQUENCE DESCRIPTION: SEQ ID NO:5:

(2) INFORMATION FOR SEQ ID NO:6:
( i ) S~U~N~'~ CHARACTERISTICS:
'A' LENGTH: 33 base pairs BJ TYPE: nucleic acid .CI STRANDEDNESS: single ~,DJ TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) (Xi ) S~yU~NC~ DESCRIPTION: SEQ ID NO:6:
GCGTCTAGAC T~r~TAAGCA GTr-~.A~rr-~ GCC 33 (2) INFORMATION FOR SEQ ID NO:7:
(i) SEQUENCE CHARACTERISTICS:
(A' LENGTH: 28 base pairs (B TYPE: nucleic acid (C STRAN~N~:SS: single (D, TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) (xi) s~Qu~ DESCRIPTION: SEQ ID NO:7:

(2) INFORMATION FOR SEQ ID NO:8:
( i ) ~QU~N~ CHARACTERISTICS:
(A) LENGTH: 33 base pairs W 097/25349 PCTrUS96/00l49 (i) SEQUENCE C~RACTERISTICS:
(A)-LENGTH: 33 base pairs- -(B) TYPE: nucleic acid (C) STRAWDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) (xi) SEQUENCE DESCRIPTION: SEQ ID NO:8:

(2) INFORMATION FOR SEQ ID NO:9:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 30 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) (xi) SEQUENCE DESCRIPTION: SEQ ID NO:9:

(2) INFORMATION FOR SEQ ID NO:lO:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 52 amino acids (B) TYPE: amino acid (C) STR~M~S: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID NO:l0:
Gly Gln Lys Asn Leu Cys Asn Asn Thr Gly Asp Pro Glu Met Cys Pro l 5 l0 15 Glu Asn Gly Ser Cys Val Pro Asp Gly Pro Gly Leu Leu Gln Cys Val Cys Ala Asp Gly Phe His Gly Tyr Lys Cys Met Arg Gln Gly Ser Phe Ser Leu Leu Met

Claims (26)

WHAT IS CLAIMED IS:

1. An isolated polynucleotide comprising a polynucleotide having at least a 70% identity to a member selected from the group consisting of:
(a) a polynucleotide encoding a polypeptide set forth in SEQ ID NO:2;
(b) a polynucleotide encoding a polypeptide comprising amino acids 1 to 177 of SEQ ID NO:2;
(c) a polynucleotide encoding a polypeptide comprising amino acids 1 to 204 of SEQ ID NO:2; and (d) a polynucleotide encoding a polypeptide comprising amino acids 126 to 177 of SEQ ID NO:2;
(e) a polynucleotide encoding a polypeptide comprising amino acids 26 to 177 of SEQ ID NO:2;
(f) a polynucleotide encoding a polypeptide comprising amino acids 26 to 204 of SEQ ID NO:2;
(g) a polynucleotide which is complementary to the polynucleotide of (a), (b), (c), (d), (e) or (f); and (h) a polynucleotide comprising at least 30 bases of the polynucleotide of (a), (b), (c), (d), (e), (f) or (g).

2. The polynucleotide of Claim 1 wherein the polynucleotide is DNA.

3. The polynucleotide of Claim 1 wherein the polynucleotide is RNA.

4. The polynucleotide of Claim 2 encoding a polypeptide comprising amino acids 126 to 177 set forth in SEQ ID NO:2.

5. The polynucleotide of Claim 2 comprising nucleotide 380 to 533 set forth in SEQ ID NO:1.

6. The polynucleotide of Claim 2 encoding a polypeptide comprising amino acids 26 to 177 set forth in SEQ ID NO:2.

7. The polynucleotide of Claim 2 comprising nucleotide 80 to 533 set forth in SEQ ID NO:1.

8. The polynucleotide of Claim 2 encoding a polypeptide comprising amino acids 26 to 204 set forth in SEQ ID NO:2.

9. The polynucleotide of Claim 2 encoding a polypeptide comprising amino acids 1 to 177 set forth in SEQ ID NO:2.

10. An isolated polynucleotide having at least a 70 identity to a member selected from the group consisting of:

(a) a polynucleotide encoding the same mature polypeptide expressed by the human cDNA contained in ATCC
Deposit No. 97342;
(b) a polynucleotide complementary to the polynucleotide of (a); and (c) a polynucleotide comprising at least 30 based of the polynucleotide of (a) or (b).

11. A vector comprising the DNA of Claim 2.

12. A host cell comprising the vector of Claim 11.

13. A process for producing a polypeptide comprising:
expressing from the host cell of Claim 12 the polypeptide encoded by said DNA.

14. A process for producing a cell which expresses a polypeptide comprising genetically engineering the cell with the vector of Claim 11.

15. A polypeptide comprising a member selected from the group consisting of:
(a) a polypeptide comprising an amino acid sequence as set forth in SEQ ID NO:2;

(b) a polypeptide comprising amino acids 1 to 204 set forth in SEQ ID NO:2;
(c) a polypeptide comprising amino acids 1 to 177 set forth in SEQ ID NO:2;
(d) a polypeptide comprising amino acids 126 to 177 set forth in SEQ ID NO:2;
(e) a polypeptide comprising amino acids 26 to 177 set forth in SEQ ID NO:2;
(f) a polypeptide comprising amino acids 26 to 204 set forth in SEQ ID NO:2;
(g) a polypeptide which is at least 70% identical to the polypeptide of (a), (b), (c), (d), (e) or (f); and (h) a polypeptide comprising at least 30 amino acids of the polypeptide of (a), (b), (c), (d), (e), (f) or (g).

16. The polypeptide of claim 15 comprising amino acid 126 to amino acid 177 of SEQ ID NO:2.

17. An antibody against the polypeptide of claim 15.

18. An agonist to the polypeptide of claim 15.

19. An antagonist to the polypeptide of claim 15.

20. A method for the treatment of a patient having need of TGF.alpha.-HIII comprising: administering to the patient a therapeutically effective amount of the polypeptide of claim 15.

21. A method for the treatment of a patient having need to inhibit TGF.alpha.-HIII comprising: administering to the patient a therapeutically effective amount of the compound of Claim 19.

22. The method of Claim 20 wherein said therapeutically effective amount of the polypeptide is administered by providing to the patient DNA encoding said polypeptide and expressing said polypeptide in vivo.

23. A process for identifying compounds active as agonists to the polypeptide of Claim 15 comprising:
contacting a reaction mixture containing a cell type which expresses a TGF.alpha.-HIII receptor and a compound to be screened; and determining if the compound generates a signal from said receptor to identify if the compound is an effective agonist.

24. A process for identifying compounds active as antagonists to the polypeptide of Claim 15 comprising:
contacting a reaction mixture containing a cell which expresses the TGF.alpha.-HIII receptor and a compound to be screened; and detecting the absence of a signal generated from said receptor after binding of said compound to identify if the compound is an effective antagonist.

25. A process for diagnosing a disease or a susceptibility to a disease comprising:
determining a mutation in the polynucleotide of claim 1.

26. A diagnostic process comprising:
analyzing for the presence of the polypeptide of Claim 15 in a sample derived from host.