CA2238696A1 - Electronically-solid-phase assay biomolecules - Google Patents

Abstract

Disclosed are materials and methods for detecting biomolecules in samples employing transponders associated with the bead(s) used as the solid phase in the assay, and information pertinent to the assay is encoded on the transponders memory elements. A dedicated read/write device is used remotely to encode or remotely to read the information. The invention can be used in direct or competitive ELISA-type assays, or in multiplex assays for the simultaneous assay of several analytes, including nucleic acids and protein.

Description

CA 02238696 1998-0~-26 W O 97/20074 PCT~US96/18939 F.T.~.cllRO~CA~LLY-SO~
PHASE ASSAY BIOMOLECULES
BACKGROIJND OF T~ INV13NIION
This invention relates to materials and methods for detecting biomolecules in samples, and more particularly to a particulate solid phase having ~or encoding in~ormation concerning the assay, and to assays employing such a solid phase.
Solid phase assays have been used to determine the presence and/or the concentration o~
biomolecules, such as proteins, peptides, nucleic acids, including deoxyribonucleic acids (DNA), ribonucleic acids (RNA) and their modi~ied ~orms, as well as carbohydrates and lipids. Solid-phase assays can be per~ormed in a variety o~ ~luids, e.g., simple bu~ers, biological ~luids, such as blood, serum, plasma, saliva, urine, tissue homogenates, and many others.
In solid phase assays, small beads, or microparticles, are typically used as the solid phase to capture the analyte. Solid phase microparticles can be made of a variety o~ materials, such as glass, plastic or latex, depending on the particular application. Some solid phase particles are made o~
~erromagnetic materials to ~acilitate their separation ~rom complex suspensions or mixtures.
In conventional solid-phase assays, the solid phase mainly aids in separating biomolecules that bind to the solid phase ~rom molecules that do not bind to the solid phase. Separation can be ~acilitated by gravity, centri~ugation, filtration, magnetism, immobilization o~ molecules onto the surface o~ the vessel, etc. The separation may be per~ormed either in a single step in the assay or, more o~ten, in multiple steps.
O~ten, it is desirable to per~orm two or more di~erent assays on the same sample, in a single vessel CA 02238696 l998-0~-26 W O 97/20074 PCT~US96/18939 and at about the same time. Such assays are known in the art as multiplex assays. Multiplex assays are per~ormed to det~rm;n~ simultaneously the presence or concentration of more than one molecule in the sample being analyzed, or alternatively, to evaluate several characteristics of a single molecule, such as, the presence o~ several epitopes on a single protein molecule.
One problem with conventional multiplex assays is that they typically cannot detect more than about ~ive analytes simultaneously, because o~
di~iculties with simultaneous detection and di~erentiation o~ more than about ~ive analytes. In other wordsl the number o~ di~erent analytes that may be assayed simultaneously is limited by the solid phase.

SUMMARY OF THE INVENTION
This invention overcomes many o~ these problems by the use o~ transponders associated with the solid phase beads to index the particles constituting the solid phase. Thus, each individual transponder~
con~ n; ng solid phase particle can be assigned a unique index number, electronically encoded inside the particle, that can be retrieved ~y the sc~nne~ device at any time, e.g., at one time during the assay, at multiple times during the assay, or continuously during the assay. The index number may relate to the time and date on which the assay was per~ormed, the patientls name, a code identi~ying the type o~ the assay, catalog numbers o~ reagents used in the assay, or data describiny the progress o~ the assay, such as temperature during di~erent steps o~ the assay. The index number may de~ine the nucleotide sequence o~ the oligonucleotide deposited on the sur$ace o~ the particle, the catalog number o~ a DNA ~ragment deposited on the particle, index numbers o~ chemical steps which were involved in the chemical synthesis o~

CA 02238696 1998-0~-26 W O 97/20074 PCT~US96/18939 an oligonucleotide bound to the particle, or some other relevant characteristics of the deposited molecules.
In an electronically-indexed multiplex assay of this invention, two or more transponders, each encoded with a different index number and constructed to bind a different analyte, are incubated with the sample in a single vessel. After necessary additions, incubations and washes are per~ormed, which are similar to incubations and washes in existing assays, the solid phase is analyzed to detect a label indicative of binding of the analyte to the solid phase, such as fluorescence, color, radioactivity or the like. Solid phase analysis is either preceded or ~ollowed by the decoding of the index number on the transponder.
~et~rm;n~tion of the label and decoding of the memory of the transponder can be done m~nn~lly on two di~ferent instruments, such as a fluorometer and a dedicated scanner, although a single automated instrument that would perform both ~unctions may be used. Such an instrument can be a modified fluorometer in which the scanner is mounted in the proximity of the fluorometer readout window, and reading the sample fluorescence and decoding the transponder are coordinated by a central computer. In addition, such an instrument can be equipped with an automated transport system for transponders.
In one aspect, the present invention provides an electronically-;n~ed solid phase particle for use in solid phase assays for biomolecules, including proteins and nucleic acids, comprising a transponder and a member o~ a biomolecular binding pair attached to the transponder.
In another aspect, the present invention provides a method of detecting biomolecules, including proteins and nucleic acids, in a sample using solid phase particles having transponders.
In another aspect, the present invention includes a ~it for detecting biomolecules in a sample CA 02238696 1998-0~-26 W O 97~0074 PCTA~S96/18939 using transponders, comprising assay vessels, a probe reagent, and a labeled conjugate reagent.
In another aspect, the present invention provides kits for detecting nucleic acids in samples, comprising assay vessels, at least one transponder having a nucleic acid probe bound to the transponder, and a labeled reagent to detect binding of sample nucleic acids to the probe.

BRIEF DESCRIPTION OF THE DRAWINGS
FIG. 1 is a schematic representation of a simple as~ay of this invention, involving proteins.
FIG. 2 is a schematic representation of a simple assay of this invention, involving nucleic 1~ acids.
FIG. 3 is a schematic representation of a simple nucleic acid-based assay of this invention utilizing an alternative labeling technique.
FIG. 4 is a schematic representation of a multiplex assay of this invention, involving proteins.
FIG. 5 is a schematic representation o~ a multiplex nucleic acid-based assay of this invention.
FIG. 6 is a schematic representation of a multiplex nucleic acid-based assay of this invention utilizing an alternative labeling technique.
FIG. 7 is a cross-sectional view of a solid phase particle with a transponder and a primary layer of biomolecules bound to a surface thereof.
FIG. ~ is a diagram of a solid phase particle with a transponder, and a primary layer o~ a nucleic acid sequence attached to the surface thereof.
FIG. 9 is a schematic diagram of the signal pathway ~or encoding and decoding data on the transponders.
33 FIG. lQ is a schematic representation of a miniature transponder.
FIG. 11 is a plan view o~ a m; ni ~ture transponder.

CA 02238696 1998-0~-26 FIG. 12 is a plan view of a transport system/analytical instrument ~or implementing the present invention.
FIG. 13 is a plan view o~ a modi~ied ~low cytometer ~or high speed analysis o~ solid phase particles o~ the present invention.

DETAILED DESCRIPTION OF THE lNvhNllON
Figure 1 depicts a simple assay o~ the invention, as implemented ~or an antigen and an antibody. A solid phase particle 10, with a transponder 12 i8 derivatized by attaching an antibody 11 to the outer sur~ace 16 o~ the particle 10.
In~ormation concerning the assay, e.g., the assay lot number, is encoded on the transponder, either by the manufacturer o~ the transponder, or by the user with a remote read/write sc~nne~ device (not shown). The derivatized particle 10 is incubated with a sample.
Antigen 13 present in the sample is bound by the antibody 11 attached to the particle 10. A second, fluorescent-labeled antibody 15 that binds to the antigen 13 is added to the sample mixture, and the particle 10 is thoroughly washed to remove unbound components. The labeled antibody 15 is detected with a ~luorometer to identi~y those transponders 12 that have antigen 13 bound thereto, and the transponder 12 is decoded using the sc~nne~ device (not shown) to retrieve the in~ormation encoded thereon.
Figure 2 depicts a simple assay o~ the invention as implemented ~or nucleic acids. A solid phase particle 10, with a transponder 12 is derivatized by attaching an oligonucleotide probe 17 to the outer sur~ace 16 o~ the particle 10. In~ormation concerning the assay, e.g., an index number identi~ying the patient, is encoded on the transponder, either by the manufacturer o~ transponder, or by the user with a remote read/write scanner device (not shown). Samp~e cont~n~ng target nucleic acid 19 is treated to label CA 02238696 1998-0~-26 W 097~0074 PCT~US96/18939 all of the nucleic acid therein. The derivatized particle 10 is placed in a sample, and the sample is heated to cause nucleic acids to dissociate The sample is then cooled under controlled conditions to cause the nucleic acids to ~nn~Al Target nucleic acids 19 complementary to the oligonucleotide probe 17 ~nn~ 1 to the probe 17. The particle 10 is thoroughly washed to remove unbound components. The labeled target nucleic acid 19 bound to the probe 17 is detected with a ~luorometer to identi~y those transponders 12 that have target nucleic acid 19 bound thereto, and the transponder 12 i8 decoded using the scanner device (not shown) to retrieve the in~ormation encoded thereon.
The detection and decoding steps when assaying ~or both proteins, as well as nucleic acids, may be done separately or may be done simultaneously.
Alternatively, the particles of many samples may be pooled into a vessel in no particular order with m; ~; ng allowed, and passed through a reader (not shown) that det~rm;n~ and records the ~luorescence and, at the same time, decodes the index number recorded in the transponder 12. It is important to note that when encoding or reading data on a transponder, other 2~ transponders must be shielded by a metal barrier or other means to prevent the electromagnetic radiation ~rom reaching such ~Inon-target~ transponders.
In an alternative labeling technique, depicted in Fig. 3, a second ~luorescent-labeled oligonucleotide probe 15 complementary to a second sequence o~ the target nucleic acid 13 is added to the sample mixture, to speci~ically label transponders 12 to which target nucleic acids 13 have bound.
A multiplex assay ~or protein analytes is depicted in Fig. 4. According to this invention, the assay is conducted in a similar m~nn~r to that o~ Fig.
1 , with two or more transponders 12 in each assay vessel ~not shown) to detect more than one analyte CA 02238696 1998-0~-26 W O 97/20074 PCTnUS96/18939 simultaneously. The transponders 12 are divided into two or more classes 12 and 12', each class having a distinct index number identifying the class, and each class having different antibody 11 and 11' bound to the surface 16 of the particle 10 and 10'. Each class of transponder 12, 12' is separately encoded, either by - the manu~acturer or by the user with a read/write s~Ann~ device (not shown), with an index number to identify, e.g., the antibody 11 bound to the surface 16 ~0 of the particle 10. Again, it is necessary to shield other, non-target transponders during the encoding process. The transponders 12, 12' are incubated in the sample vessel and antigen 13, 13' binds to the respective antibody 11, 11'. Second ~luorescent-labeled antibodies 15, 15' that bind to the antigens13, 13' are added to the sample vessel to bind to the antigens 13, 13'. The transponders 12, 12' are then washed thoroughly to remove unbound sample components and reagents. The labeled antibody 15, 15' is detected with a fluorometer to identify those transponders 12, 12' that have antigen 13, 13' bound thereto, and the transponders 12, 12' are decoded using the sc~nn~
device (not shown) to retrieve the information encoded thereon. The detection and decoding steps may be done separately or may be done simultaneously.
Alternatively, the particles 10, 10' may be pooled into a vessel in no particular order with m; ~; ng allowed, and passed through a reader ~not shown) that det~rm;nes and records the fluorescence and, at the same time, decodes the index number recorded in the transponder 12, 12'.
A multiplex assay for nucleic acids according to this invention is conducted in a similar manner, as depicted in Fig. 5, with two or more transponders 12 in each assay vessel (not shown) to detect more than one labeled target nucleic acid 19 simultaneously. The transponders 12 are divided into two or more classes 12 and 12', each class having a distinct index number CA 02238696 1998-0~-26 W O 97/~0074 PCT~US96/18939 identi~ying the class, and each class having a di~erent oligonucleotide probe 17 and 17' bound to the sur~ace 16 o~ the particle 10 and 10'. Using each class o~ transponder 12, 12' is separately encoded, either by the manu~acturer or by the user with a read/write scanner device (not shown), with an index number to identi~y, e.g., the sequence o~ the probe 17 bound to the sur~ace 16 o~ the particle 10. Again, it is necessary to shield other, non-target transponders during the encoding process. The transponders 12, 12' are added to a sample, and the sample is heated to cause nucleic acids to dissociate. The sample is then cooled under controlled conditions to cause the nucleic acids to re-~nn~1 . Target nucleic acid 19, 19' complementary to the respective probes 17, 17' anneals to the probes 17, 17'. The transponders 12, 12' are then washed thoroughly to remove unbound sample components and reagents. The labeled target nucleic acids 19, 19' are detected with a ~luorometer to identi~y those transponders 12, 12' that have target nucleic acids 19, 19' bound thereto, and the transponder 12, 12' is decoded using the sC~nn~r device (not shown) to retrieve the in~ormation encoded thereon. The detection and decoding steps may be done separately or may be done simultaneously.
Alternatively, the particles 10, 10' may be pooled into a vessel in no particular order with m;~;ng allowed, and passed through a reader (not shown) that determines and records the ~luorescence and, at the same time, decodes the index number recorded in the transponder 12, 12'.
In an alternative labeling technique, depicted in Fig. 6, second ~luorescent-labeled oligonucleotide probes 15, 15' that bind to second sequences o~ the target nucleic acids 19, 19' are to the sample vessel to bind to the target nucleic acids 19, 19'. Alternatively, the label may be a radioisotope, such as 32P,35S, 125I, and the like.

CA 02238696 1998-0~-26 W O 97/20074 PCT~US96/18939 The label may also be a chemill~m;nescent label, such as a luminol derivative or an acridinium ester, that emits light upon oxidation o~ a substrate. The label may be an enzyme, such as alkaline phosphatase, catalyzing a reaction employing a precipitating ~luorogenic substrate, e.g., attophos (JBL Scienti~ic, San Luis Obispo, CA), a precipitating chromogenic substrate, e.g., 5-bromo-4-chloro-3-indolyl phosphate), or a ch~m;luminescent substrate, e.g., ~l;3m;~ntyl 1,2-dioxetane phosphate (Tropix, New Bed~ord, MA).Finally, the label may be a bioluminescent enzyme such as luci~erin.
The assays o~ the present invention may be used with a variety o~ analytes, including covalently modi~ied proteins and peptides, protein or peptide conjugates, small molecules, deoxyribonucleic acid (DNA), ribonucleic acid (RNA), modi~ied nucleic acids and analogs o~ nucleic acids (in particular protein-nucleic acids, PNAs). The analyte may be a complex o~
biomolecules, such as a virus particle, a protein-nucleic acid complex, or a protein-hapten complex. The analyte may be a cell, and in such case the relevant molecules that participate in the binding process during the assay are typically cell sur~ace receptors or other elements o~ the cell wall or membrane.
Likewise, the sample may be presented in a variety o~
~orms, such as a solution in a simple bu~er, or a complex biological ~luid, such as blood, serum, urine, saliva, and many others, or it can be m; ~ with many other analytes which are simultaneously being assayed ~or in the multiplex ~ormat. The target nucleic acid can be mixed with many other analytes. The purity o~
the nucleic acid deposited as a primary layer on the ~ sur~ace of the transponder can vary as well, ~rom unpuri~ied, partially puri~ied to pure compounds.
The biomolecules deposited as a primary layer on the sur~ace o~ the transponder may take a variety o~
~orms, as well, such as covalently modi~ied proteins CA 02238696 1998-0~-26 W O 97~0~74 PCTAUS96/18939 and peptides, protein or peptide coniugates, small molecules (haptens), ribonucleic acid (RNA), modi~ied nucleic acids and analogs o~ nucleic acids (in particular protein-nucleic acids, PNAs). The biomolecules can be made in vivo, or in an enzymatic reaction in vitro, or chemically synthesized, either directly or through combinatorial synthesis, or may be a ~ragment o~ any o~ the above products. A pre~erred example o~ a product o~ an enzymatic reaction in vitro is the nucleic acid obtained ~rom the polymerase chain reaction (PCR). The purity o~ the biomolecules deposited as a primary layer on the sur~ace o~ the transponder can vary as well, ~rom unpuri~ied, partially puri~ied to pure compounds. The biomolecules, their complexes and aggreyates, including subcellular structures or cells, can be deposited as a primary layer on the sur~ace o~ the transponder by a variety o~ means including, ~or example, chemical conjugation to an active group on the support, direct chemical synthesis, adhesion or non-specific binding through hydrophobic interactions.
Figure 7 depicts a solid phase particle 10 ~or use in the present inventive methods, as applied to protein antigens. The solid phase particle 10 comprises a glass bead with a transponder 12 associated with it, and a member o~ a biomolecular binding pair (e.g., an antibody or an antigen) attached to the sur~ace 16 of the particle 10 as a primary layer 14.
The glass sur~ace 16 of the beads is derivatized through aminoalkylsilane treatment and addition o~ a cross-linker, to provide primary amine groups on a solid support ~or ~urther derivatization. The transponder 12 is equipped with a memory element.
Fig. 8 depicts a solid phase particle 10 o~
the present invention as applied to nucleic acids, having a transponder 12, and a primary layer 14 o~ an oligonucleotide probe attached to the outer sur~ace 16 o~ the particle 10.

CA 02238696 1998-0~-26 W O 97~0074 PCT~US96/18939 Il A transponder is a radio transmitter-receiver activated ~or tr~n~m;ssion o~ data by reception o~ a predetermined signal and may also be re~erred to as a microtransponder, a radio transponder, a radio tag, S etc. The signal comes ~rom a dedicated sc~nn~r that also receives and processes the data sent by the transponder in response to the signal. The scanner ~unction can be combined with the write ~unction, i.e., the process o~ encoding the data on the transponder.
Such a combination instrument is re~erred to as a scanner read/write device. An advantage o~ the transponder-scanner system is that the two units are not electrically connected by wire, but are coupled inductively, i.e., by the use of electromagnetic radiation, typically in the range ~rom 5-1,000 kHz, but also up to 1 GHz and higher.
Figure 9 is a ~low chart illustrating the cnmmnn~cation between the transponder 12 and a remote scanner read/write device 18. The transponder 12 is encoded with data sent by electromagnetic waves ~rom a remote scanner read/write device 18, unless the transponder 12 was pre-encoded by the manufacturer.
A~ter the assay steps are completed, the beads 10 are analyzed to detect the presence o~ a label indicative of binding o~ analyte and the transponders 12 are decoded. The scanner 18 sends a signal to the transponder 12. In response to the signal, the transponder 12 transmits the encoded data to the scanner 18.
Some transponders similar to the type employed in the present invention are available commercially. For example, BioMedic Data Systems Inc.
(BMDS, 255 West Spring Valley Ave., Maywood, New ~ersey~ manu~actures a programmable transponder ~or use in laboratory ~n;m~l identi~ication. The transponder is implanted in the body o~ an ~n;m~l, such as a mouse.
The transponder is glass-encapsulated to protect the electronics inside the transponder ~rom the CA 02238696 1998-0~-26 w o 97/aoo74 PCTAUS96/18939 environment. One o~ the types o~ transponders manu~actured by this corporation, model IPTT-100, has ~;mensionS o~ 14 x 2.2 x 2.2 mm and weighs 120 mg. The transponder is user-programmable with up to 16 alphAntlm~ric characters, the 16th letter programmable independently o~ the other 15 letters. It has a built-in temperature sensor as well. The electronic ~n;m~l monitoring system (ELAMS) includes also a scanner read/write system, such as the DAS-5001 console system, to encode or read data on/from the tran~ponder. The construction o~ the transponder and 8c~nn~r iS
described in U.S. Patent Nos. 5,250,944, 5,252,962, and 5,262,772, the disclosures o~ which are incorporated herein by re~erence. Other similar transponder-scanner systems include multi-memory electronic identi~ication tag (U.S. Patent 5,257,011) by AVID Corporation (Norco, C~) and a system made by TEMIC-Tele~unken (Eching, Germany). AVID's transponder has ~;m~n~ions o~ 1 mm x 1 mm x 11 mm, and can encode 96 bits o~ in~ormation.
The present invention can be practiced with dif~erent transponders, which might be o~ di~erent ~;m~n~ions and have dif~erent electronic memory capacity.
The commercially-available transponders are relatively large in size. The speed at which the transponders may be decoded is limited by the carrier ~requency and the method o~ transmitting the data. In typical signal tr~n~m~sion schemes, the data are encoded by modulating either the amplitude, ~requency or phase o~ the carrier. Depending on the modulation method chosen, compression schemes, transmission environment, noise and other ~actors, the rate o~ the signal tr~n~m;~sion is within two orders o~ magnitude o~ the carrier ~requency. For example, a carrier ~requency o~ 1,000 Hz corresponds to rates o~ 10 to 100,000 bits per second (bps). At the rate o~ 10,000 bps the transmission of 100 bits will take 0.01 sec.
The carrier ~requency can be several orders o~

CA 02238696 1998-0~-26 .
W097~0074 PCT~S96/18939 magnitude higher than 1,000 Hz, so the transmission rates can be proportionally higher as well.
There~ore, the limiting ~actor in the screening process is the speed at which the transport mech~n;~m carries the transponders through the read window o~ the ~luorometer/scanner device. In state-o~-- the-art ~low cytometers, the rate o~ movement o~ small particles or cells is 104-105 per second. A ~low cytometer may be used to practice the present invention, i~ two conditions are met: (1) the transponders are small enough to pass through the flow chamber, and (2) the design o~ the ~low chamber o~ the ~low cytometer is modi~ied to include an antenna and ~canner ~or collecting the electromagnetic radiation emitted by transponders.
A miniature transponder is depicted in Figs.
10 and 11. The source o~ the electrical power ~or the transponder 12a is at least one photovoltaic cell 40 within the transponder 12a, illuminated by light, pre~erably ~rom a laser (not shown). The same light beam induces the ~luorescence o~ ~luorogenic molecules immobilized on the sur~ace o~ the transponder 12a. The transponder 12a includes a memory element 42 that may be o~ the EEPROM type. The contents of the memory is converted f rom the digital ~orm to the analog ~orm by a Digital-to-Analog converter 44 mounted on the transponder 12a. The signal i8 amplii~ied by an ampli~ier 45, mixed with the carrier signal produced by an oscillator 48, and conducted to the outside o~ the transponder 12a by an antenna 50.
The contents o~ memory o~ the m;n;~ture transponder can be perm~n~ntly encoded, e.g., as ROM
memory, during the manu~acturing process o~ the transponder, di~erent batches o~ transponders being di~erently encoded. Pre~erably, the memory o~ the transponder is user-programmable, and is encoded by the user just be~ore, during, or just a~ter the biological material is deposited on the sur~ace o~ the CA 02238696 1998-0~-26 WO 97/20074 PCT~US96/18939 transponder. A user-programmable transponder 12a must have the "write" ~eature enabled by the antenna 50, ampli~ier 44 and the Analog-to-Digital converter 46 manu~actured on the transponder 12a, as well as the dedicated scanner/write device 27.
In a pre~erred embodiment, the signal ~rom the scanner is transmitted by modulating the intensity o~ the light illuminating the transponder 12a, which also actuates the photovoltaic cell power source 40.
The advantages o~ the miniature transponder o~ Figs. 10 and 11 are several-fold. First, the transponder ~;m~n~ions are reduced relative to a conventional transponder, because most o~ the volume o~
a conventional transponder is occupied by the solenoid.
The current design will enable the production o~ cubic transponders on the order o~ 0.01 to 1.0 mm, as measured along a side o~ the cube, and pre~erably 0.05 to 0.2 mm.
Second, a large number o~ transponders can be manu~actured on a gingle silicon wa~er. As depicted schematically in Fig. 11, a silicon wa~er 60 is simply cut to yield active transponders 12a. Third, the transponder, according the new design, will not need the glass capsule as an enclosure, ~urther reducing the size o~ the transponder. Silicone dioxide (SiO2) would constitute a signi~icant portion o~ the sur~ace o~ the transponder, and SiO2 has chemical properties like glass that allow derivatization or immobilization of . biomolecules. Alternatively, microtransponders may be 3~ coated with a variety o~ materials, including plastic, latex, and the like.
Finally, most importantly, the narrow ~ocus o~ the beam o~ the laser light would enable only one transponder to be active at a time during decoding, signi~icantly reducing noise level. Advanced user-programmability ig desirable a~ well and, pre~erably, various memory registers are addressable independently, .
CA 02238696 1998-0~-26 W O 97/20074 PCT~US96/18939 i.e., writing in one register does not erase the contents o~ other registers.
Figure 12 shows the analytical instrumentation and transport system used in an S embo~;m~nt o~ the present invention. A quartz tube 20 is mounted in the readout window 22 o~ a ~luorometer 24. The quartz tube 20 is connected to a metal ~unnel 26. The length o~ the quartz tube 20 is similar to the ~;m~n~ions o~ the transponder 12. Transponders 12 are ~ed into the metal ~unnel 26, and pass ~rom the ~unnel 26 into the quartz tube 20, where the ~luorescence is read by the ~luorometer 24 and the transponder 12 is decoded by the sCAnn~r 27, and then exit through a metal tube 28 and are conducted to a collection vessel (not shown). The metal ~unnel 26 and metal tube 28 are made o~ metal shield transponders 12 outside o~ the read window 22 by shielding ~rom the electromagnetic signal ~rom the sc~nn~r 27. This shielding prevents the srAnner signal ~rom reaching more than one transponder 12, causing multiple transponders 12 to be decoded.
~ ;n;mAl modi~ication o~ the ~luorometer 24 would be needed in the vicinity o~ the location that the tube occupies at the readout mom~nt to allow ~or positioning o~ the transponder reading device. To assure compatibility with existing assays, the glass surrounding the transponder could be coated or replaced with the type o~ plastic currently used to manu~acture beads.
In a pre~erred design, depicted in Fig. 13, a modi~ied ~low cytometer is used with the m; n; Ature transponder o~ the present invention. A metal coil antenna 30 is wrapped around the ~low cell 32 o~ a ~low cytometer 29. The transponders 12a pass through the ~low cell 32, and are decoded by the scanner device 27.
The signal carrying the data sent ~rom the transponders 12 is amplified by an ampli~ier 34 and processed by the scAnn;ng device 27. As the transponders 12a are CA 02238696 1998-0~-26 W O 97~0074 PCT~US96/18939 decoded, fluorescence ~rom the transponders 12a is detected and analyzed by the ~low cytometer 29.
The examples below illustrate various aspects o~ this invention.

PREPARATION OF DERIVATIZED GLASS
BEADS HAVING TRANSPOND~RS
The outside glass sur~ace of transponders (e.g., manu~actured by BMDS) is derivatized in the ~ollowing process.
1. Aminoalkylsilane treatment First, the transponders are cleaned by washing with xylene, ~ollowed by a 70~ ethanol rinse and air drying. Then, the transponders are submerged ~or about 30 seconds in a 2~ solution o~
aminopropyltriethoxysilane (Cat.# A3648, Sigma, St.
Louis, MO) in dry acetone. The glass beads are then sequentially rinsed with dry acetone and distilled water, and then air dried. This procedure is described in Pierce catalog (pp. T314-T315 o~ the 1994 catalog, Pierce, Rock~ord, IL).

2. Attachment O~ A Linker To Am; no~lkylsilane-Treated Glass The aminoalkylsilane-treated transponders are immersed in a 10 mM solution o~ a homobi~unctional NHS-ester cross-linker, BS3, bis(sul~osucc;n;m;dyl)suberate (Pierce Cat.# 21579, described on p. T159 o~ the 1994 30 Pierce catalog) in 100 mM phosphate bui~er (pH 7.0-7.4) ~or 5 to 60 minutes at room temperature. The exact incubation time is optimized ~or each treatment. The transponders are then rinsed with water, submerged in a 10-100 rnM protein solution in 100 mM phosphate bui~Eer 35 (pH 7.4-8.0), and incubated at room temperature f~or 2-3 hours. The transponders are rinsed three times with 100 mM phosphate bu~er (pH 7.4-8.0). The unreacted sites on the glass are blocked by incubating in Blocker CA 02238696 1998-0~-26 W O 97/20~74 PCTAJS96/18939 BLOTTO in phosphate-bu~ered saline ~PBS, Pierce, Cat.
37526) ~or 2 hrs. The transponders are rinsed three times with 100 mM phosphate bu~er (pH 7.4-8.0), and stored in this buf~er at 40C.
The described procedure, ~ound in Enzyme Tmmllnodiagnostics, E. Kurstak, ACA~ m;C Press, New - York, 1986, pp. 13-22, works with many proteins.
However, since properties o~ proteins can di~er widely, ~or some proteins alternative immobilization sch~m~ may have to be used.

SINGLE ASSAY FOR A PROTEIN ANALYTE
The purpose o~ this assay is to obtain a ~ualitative indication o~ the presence o~ hllm~n chorionic gonadotropin (hCG)in the sample, which in this example is a solution o~ hCG labeled with ~luorescein in PBS bu~er. Another purpose is to be able to retrieve during the course o~ the assay the identi~ication of the source o~ hCG used to prepare the sample.
The sur~ace o~ the transponder (model IPTT-100, manu~actured by BMDS) is derivatized as in Example 1 by aminoalkylsilane treatment, and the BS3 linker is attached to the aminoalkylsilane treated glass. A
monoclonal antibody raised against hCG is then conjugated to the linker to ~orm an embodiment o~ the solid phase particle o~ the present invention.
A transponder derivatized with the anti-hCG
antibody is immersed in 1 ml o~ PBS in a test tube. A
fluorescein-labeled hCG preparation is added to the test tube. The ~inal concentration is between 50 pg/ml and 50 mg/ml. The transponder is incubated at room temperature ~or 30 minutes. During that time, six alph~nllm~ric characters constituting the sample lot-number identifying the source o~ hCG is encoded into the memory o~ the transponder using a dedicated read/write sc~nn~r. Additional in~ormation such as the CA 02238696 1998-0~-26 W O 97~0074 PCT~US96/18939 lot number o~ the antibody preparation used, or the name of the patient who donated the gerum con~; n; ng hCG may also be encoded on the transponder. After a series o~ extensive washes over a period of 5 minutes, the transponder is placed in l ml o~ ~resh PBS bu~fer.
The transponder is then placed in a ~luorometer, and the ~luorescence intensity (FI) is measured and recorded. The FI readout is normalized with respect to positive control transponders which were exposed to ~luoresceinated bovine serum albumin instead o~
fluoresceinated hCG. The electronic memory of the transponder is decoded using a dedicated sc~nn~ to obtain the lot num~er o~ the hCG preparation.
The advantage of using the transponder in this example instead o~ a prior art solid phase particle is that there is no need to maintain an association between the test tube and the solid phase at all times during the assay Instead, a~ter electronically recording the lot number, the ~0 transponder can be separated ~rom the original cont~; ner without losing track of the lot number o~ the sample to which it was exposed. The transponder can be mixed with other transponders exposed to analytes having di~ferent lot numbers without losing in~ormation 2~ about the presence o~ hCG in the analyte.

ELECTRONICALLY INDEXED SO~ID PHASE
ASSAY FOR HUMAN IgAl AND IgGl A total o~ eight transponders ~e.g., BMDS
model IPTT-l00) are derivatized according to the procedure o~ Example l, with two antibodies, hllm~n IgAl (Cat.# I2636) and IgGl (Cat.# I4014) obtained ~rom Sigma (St. Louis, MO). Thus, two groups o~ transponders carrying these two antibodies are obtained. Four transponders o~ each of the two groups of transponders are encoded with the index nu-m-bers Al, A2, A3 and A4, and Gl, &2, G3 and G4, respectively, by the read/write CA 02238696 1998-0~-26 W O 97/20074 PCTnUS9~/18939 scanner device (BMDS). The letter corresponds to the type of ;mmllnoglobulin used to derivatize the transponder, and the digit gives the tube number.
Transponders are distributed into assay tubes, each - 5 tube cont~;n;ng one transponder o~ each type. Thus, tube 1 contains transponders encoded Al and Gl, tube 2 - A2 and G2, etc.
The ~ollowing set o~ analytes is prepared at a concentration between 50 pg/ml and 50 mg/ml in PBS:
Analyte 1: Mixture o~ monoclonal antibody to hllm~n IgAl labeled with FITC (Cat.#F6016), and monoclonal antibody to hllm~n IgGl labeled with FITC
(Cat.#F5016).
Analyte 2: Monoclonal antibody to hllm~n IgAl labeled with FITC.
Analyte 3: Monoclonal antibody to human IgGl labeled with FITC.
Analyte 4: No antibody present.
2 mls o~ analyte 1 is added to tube 1, cont~;n;ng two transponders, one o~ each group as described above. Similarly, 2 mls o~ analyte 2, 3 and 4 are added to tubes 2, 3 and 4, respectively, also cont~;n;ng two transponders each. The tubes are kept at room temperature ~or 30 minutes, a~ter which the transponders are washed three times with 5 ml PBS
bu~er. The fluorescence o~ each o~ the transponders is quantitated by using a FluorImager (Molecular Dynamics), and the encoding o~ each transponder is det~rm;ne~ by using the read/write device (BMDS).
The assay described is direct, since the concentration o~ FITC-derivatized antibody is measured.
Alternatively, the assay can be con~igured in a competitive ~ormat to measure the concentration o~
underivatized antibodies, such as those present in sera. Moreover, the number o~ analytes that can be te~ted in one tube i8 limited only by the requirement that the total volume o~ the transponders needed in the CA 02238696 1998-0~-26 W O 97/20074 PCT~US96/18939 single tube should not be much larger than the sample volume.

S MULTIP~EX ASSAY FOR ANTIBODIES EMPLOYING
PEPTIDES IMMOBILIZED ON TRANSPONDERS
Peptides can be immobilized on the surface o~
the transponders' glass envelope by either chemical synthesis or con]ugation. The glass surface o~ the transponder (e.g , AVID) is first derivatized with aminopropyltriethoxysilane, creating a suitable solid support for chemical peptide synthesis. The amino groups o~ the alkyl Ch~3; n~ attached to the support are appropriate for initiating peptide synthesis by ~orming the amide bond with the C-t~rmi n~ 1 residue o~ the peptide when st~n~d Fmoc or Boc chemistries are used.
The resulting peptide can be deprotected according to st~n~d protocols without cleaving the peptide ~rom the support.
Alternatively, peptides previously synthesized or isolated can be attached to the treated glass sur~ace using the cross-linker and protocol o~
Example 1. The requirement will be the presence of a primary amine group in the peptide (such as N-term;n~l amine), or a secondary amine group. The assay con~iguration is identical to Example 1, except that the proteins (i.e. monoclonal antibodies) of Example 1 are replaced with peptides in this Example.

A DIAGNOSTIC KIT FOR PERFORMING AN E~ECTRONICALLY
INDEXED MULTIPLEX ASSAY FOR THE HEPATITIS C VIRUS
The kit is used to simultaneously determine the presence of antibodies to four Hepatitis C Virus (HCV) antigens in human serum or plasma, or in mixtures o~ puri~ied anti-HCV antibodies prepared in the laboratory. The HCV antigens are as follows: (1) core, CA 02238696 1998-0~-26 W O 97/20074 PCT~US96/18939 (2) NS3, (3) NS4, N-t~m;n~l part, (4) NS4, C-term;n~l part.
The constituents of the HCV reagent kit are as ~ollows:

- 5 1. Reagent A, Specimen Diluent, 10 Mm Tris-HCL, pH 7.5.
Preservative: 0.1% sodium azide.
2. Reagent B, Probe. Goat antibody to hllm~n IgG
(H+L), conjugated to biotin. M;n;mllm concentration;
0.1 pg/ml. Preservative: 0.1% sodium azide.
3. Reagent C, Conjugate. Rabbit antibody to - biotin, conjugated to alkaline phosphatase. ~;n~mllm concentration: 0.1 pg/ml. Preservative: 0.1~ sodium azide.
4. Reagent D, Chromogen. 5-bromo-4-chloro-3 indolyl phosphate ~0.1~). Preservative: 0.1~ sodium azide.
5. 20 Test Vessels. Each vessel is a 2 ml test tube and contains 4 tran~ponders con~ugated to ~our HCV
antigens. The antigens are applied at a m;n;mllm o~ 1 ng per transponder. The transponders are electronically encoded with numbers 1,2,3 and 4, corresponding to antigens (1),(2),(3) and (4) respectively.

6. 1 Vial (0.1 ml) Accessory Positive Control.
It is an inactivated human plasma cont~;n;ng antibody to HCV, non-reactive ~or HBsAg and antibody to HIV-I/HIV-2. ~;n;mllm titer: 1:2. Preservative: 0.1%
sodium azide.

7. 1 Vial (0.1 ml) Accessory Negative Control.
It is hllm~n plasma nonreactive by FDA licensed tests ~or antibody to HCV, and non-reactive ~or HBsAg and antibody to HIV-l/HIV-2. Preservative: 0.1~ sodium azide.

8. Wash bu~er. 10 mM Tris-HCl, pH 7.5.

9. Enzyme Reaction Bu~er, 100 mM Tris-HCl, pH
8Ø

10. Bar coded calibration data sheet.

CA 02238696 1998-0~-26 W O 97/20074 PCTrUS96/18939 In an alternative con~iguration of the kit, the chromogen, reagent 4 above, is replaced with a ~luorogen, item 4a and Reagent 4a, namely:
4a. Reagent 4-a, Fluorogen, precipitating substrate ~or alkaline phosphatase (0.1~). The substrate is attophos reagent, manu~actured by JBL
Scientific, San Luis Obispo, CA. Preservative: 0.1 sodium azide.
The procedure for per~orming the assay on a single sample of unknown composition with regard to HCV
antibodies is as ~ollows. Three test vessels, X, Y and Z are placed in a rack. Sample is added to vessel X, Accessory Positive Control added to vessel Y, Accessory ~egative Control added to vessel Z. Appropriate amounts are det~rm;ned ~or each lot of reagents, but approximate volumes are 10-100 ml sample or controls diluted with the Wash Bu~er to the ~inal volume o~ 2 ml. The sample and bu~er are thoroughly mixed, and incubated for 30 minutes at room temperature, a~ter which the transponders in the vessel are washed extensively ~or 5 minutes with the Wash Bu~fer.
Reagent B is then added, and the vessel is incubated ~or 30 minutes, a~ter which the transponders are washed. Reagent C is then added, and the vessel is incubated ~or 30 minutes, a~ter which the transponders are washed. One ml o~ the enzyme reaction bu~er is then added to the vessels, ~ollowed by 1 ml o~ the substrate (item 4 or 4a~. The contents o~ the vessels is mixed thoroughly. The vessels are incubated at room temperature ~or 2 to 30 minutes, depending on the desired sensitivity o~ the assay, a~ter which the transponders are rinsed with the Wash Buf~er to remove excess substrate and that ~raction o~ the product o~
the reaction which did not precipitate. The color o~
the transponders is then det~rm;n~d in a photodiode spectrophotometer con~igured to measure the re~lected light, or the ~luorescence o~ the transponders is measured in a ~luorometer, depending on the label used.

CA 02238696 1998-0~-26 W O 97/20074 PCT~US96/18939 Each optical measurement is i~ollowed by the decoding o~
the electronic memory of the transponder and associated with the optical measurement.
.

MULTIP~EX DNA-BASED ASSAY ON TRANSPONDERS
EMPLOYING DNA ~iYNl~;SIZED ON THE SOLID SUPPORT
The glass outer surf~ace Of the transponders is i~irst derivatized by an ;lm; no~lkylsilane treatment.
The transponders (e.g., IPTT-100, B~S) are cleaned by washing with xylene, f~ollowed by a 70~ ethanol rinse and air drying. The transponders are then submerged i~or about 30 seconds in a 2~ solution of aminopropyltriethoxysilane (Cat.# A3648, Sigma, St.
Louis, MO) in dry acetone. The transponders are then sequentially rinsed with dry acetone and distilled water, and then air dried. This procedure is described in the Pierce catalog (pp. T314-T315 oE the 1994 catalog, Pierce, Rocki~ord, IL).
Nucleic acid probes are then covalently linked to the Amtno;3lkylsilane-treated glass by direct chemical synthesis on the glass support. A thymidine-derivatized support conti~;n;ng a stable nucleoside-urethane linkage is prepared, in which 5'-dimethoxytrityl thymidine is reacted with one equivalent oE tolylene-2,6-diisocyanate in the presence o~ one equivalent o~ N-ethyldiisopropylamine as a catalyst in pyridine/1,2-dichloroethane to generate the monoisocyanate. The monoisocyanate is not isolated, but is reacted directly with the aminopropyltriethoxysilane-derivatized glass sur~ace oE
the transponders. The procedure is described in detail in B.S. Sproat and D.M. Brown, A new linkage ~or solid phase synthesis oE oligodeoxyribonucleotides, Nucleic Acids Res. 13, 2979-2987, 1985.
The thymidine-derivatized support cont~n;ng a stable nucleoside-urethane linkage is used directly ~or the chemical synthesis oi~ oligodeoxynucleotides by CA 02238696 1998-0~-26 W O 97/20074 PCT~US96/18939 24 m~nl]~l synthesis on sintered ~unnels using st~n~d phosphoramidite-based DNA synthesis reagents, as described in Caruthers, M.H. et al., Deoxyoligonucleotide Synthesis Via The Phosphoramidite Method, Gene Ampli~ication and Analysis, Vol. III (T.S.
Papas et al., Eds., Elsevier/North Holland, Amsterdam).
The thymidine-urethane linker is resistant to cleavage with base during deprotection, and the resulting product is the deprotected oligonucleotide attached to the glass sur~ace o~ the transponder through the urethane-thymidilate linker.
The ~ollowing oligodeoxynucleotide reagents are prepared. Sequence 1 and se~uence 2 do not exhibit sel~-complementarity, are 15 nt long, and are linked to the transponders through a spacer, which is an oligonucleotide having the (dT)10 sequence.
Oligonucleotides C and D are derivatized at the 5'-end with ~luorescein. The seguences are as ~ollows:
transponder-oligonucleotide A: 5'-spacer-seguencel tran~ponder-oligonucleotide B: 5'-spacer-seguence2 oligonucleotide C: 5'-~luorescein-sequencelcomplement oligonucleotide D: 5'-~luorescein-seguence2complement Four assay tubes are prepared and labeled 1, 2, 3 and 4, each assay tube to accommodate two transponders, one transponder carrying oligonucleotide A and the second transponder carrying oligonucleotide B. The transponders are electronically encoded with two alph~nllme~ic characters, namely Al,A2,A3,A4 and Bl,B2,B3,B4, where the letter corresponded to the oligonucleotide used to derivatize the transponder, and the digit gave the test tube number into which the given transponder is placed. Thus tube 1 contains transponders A1 and B1; tube 2 - A2 and B2; tube 3, A3 and B3; and tube 4, A4 and B4, all immersed in 50 mM
Tris-HC1 bu~er (pH 7.5). Four analytes, X,Y,Z and W, are prepared, as ~ollows. Analyte X contains CA 02238696 1998-0~-26 W O 97~0074 PCT~US96/1~939 oligonucleotide C and oligonucleotide D; Y contains oligonucleotide C only, Z contained oligonucleotide D
only, and analyte W does not contain any oligonucleotides. The analyte solutions are prepared S in 50 mM Tris-HCl (pH 7.5~. The concentration o~ each given oligonucleotide in the analytes X, Y and Z is lO
nM to lO mM. After the ~our tubes are emptied o~
bu~er, but retain the transponders, 2 mls o~ X,Y,Z and W analyte are added to tubes l, 2, 3 and 4, respectively. The tubes are heated to 90oC, and slowly cooled to room temperature. Then the transponders are rinsed three times with the bu~er. The ~luorescence o~ each transponder is measured on a FluorImager instrument (Molecular Dynamics~.

MULTIPLEX DNA-BASED ASSAY ON TRANSPONDERS
EMPLOYING CONJUGATION OF OLIGONUCLEOTIDES TO SOLID
SUPPORT
Precleaned transponders (IPTT-lOO, BMDS~ are immersed in a l~ 3-aminopropyltrimethoxysilane solution (Aldrich Chemical, Milwau~ee, WI~ in g5~ acetone/water ~or 2 minutes, washed extensively with acetone (lO
washes, 5 minutes each) and dried (llOoC ~or 45 minutes~. The transponders are then treated ~or 2 hours with 1,4-phenylene diisothiocyanate (Aldrich~
(PDC, 0.2~ solution in lO~ pyridine/dimethyl ~ormamide~. The transponders are washed with methanol and acetone and stored at 40C in an anhydrous environment. The 5'-amino-modi~ied oligonucleotides to be immobilized on the glass support are dissolved in 100 mM sodium carbonate/bicarbonate bu~er (pH 9.O) at a concentration o~ 2 mM, and a 2 ml aliquot is applied directly to the PDC-derivatized transponders and incubated at 370C in a closed vessel ~or 2 hours. The transponders are then washed with NH40H, three times with water and air dried at room temperature. This derivatization procedure is based on a protocol CA 02238696 1998-0~-26 W O 97/20074 PCT~US96/18939 described in Guo et al. (Direct Fluorescence Analysis Of Genetic Polymorphism By Hybridization With Oligonucleotide Arrays On Glass Support. Nucleic Acids ~es. 22, 5456-5465, 1994).
The ~ollowing oligodeoxynucleotide reagents are prepared. Sequencel and sequence2 are 15 nt long, and are linked to the transponders through an oligonucleotide spacer having the (dT)10 sequence.
Oligonucleotides C and D are derivatized at the 5'-end with fluore~cein. The sequences are as ~ollows:
transponder-oligonucleotide A: 5'-spacer-sequencel transponder-oligonucleotide B: 5'-spacer-sequence2 oligonucleotide C: 5'-~luorescein-sequencelcomplement oligonucleotide D: 5'-~luorescein-sequence2complement Four assay tubes are prepared and labeled 1, 2, 3 and 4, each tube to accommodate two transponders, one transponder carrying oligonucleotide A and the second transponder carrying oligonucleotide B. The transponders are electronically encoded with two alph~nllmeric characters, namely Al,A2,A3,A4 and Bl,B2,B3,B4, where the letter corresponded to the oligonucleotide used to derivatize the transponder, and the digit gave the test tube number into which the given transponder is placed. Thus tube 1 contains transponders A1 and B1; tube 2 - A2 and B2; tube 3, A3 and B3; and tube 4, A4 and B4, all immersed in 50 mM
Tris-HCl bu~er (pH 7.5). Four analytes, X,Y,Z and W, 3~ are prepared, as ~ollows. Analyte X contains oligonucleotide C and oligonucleotide D; Y contains oligonucleotide C only, Z contained oligonucleotide D
only, and analyte W does not contain any oligonucleotides. The buffer is 50 mM Tris-HCl (pH
3~ 7.5). The concentration o~ each given oligonucleotide in the analytes X, Y and Z is 10 mM. After the four tubes are emptied o~ bu~er, but retain the transponders, 2 ml~ o~ X,Y,Z and W analyte are added to CA 02238696 1998-0~-26 W O 97/20074 PCT~US96/18939 27 tube 1,2,3 and 4, respectively. The tubes are heated to 90oC, and slowly cooled to room temperature. Then the transponders are rinsed three times with the buffer. The fluorescence o~ each transponder is measured on a Fluorimager (Molecular Dynamics).

CONJUGATION OF STREPTAVIDIN TO THE
GLASS SURFACE OF TRANSPONDERS
The outside glass surface of transponders (IPTT-100, BMDS) is derivatized through the aminoalkylsilane treatment outlined above, and a linker is attached to the aminoalkylsilane-treated glass. A
variety of methods can be used, as reviewed in Enzyme Immunodiagnostics, E. Kurstak, Academic Press, New York, 1986, pp. 13-22. This procedure a homobifunctional NHS-ester cross-linker, BS3, bis(sul~osuccinimidyl)suberate (Pierce Cat.# 21579, described on p. T159 of the 1994 Pierce catalog).
The transponders are immersed in the 10 rr~q solution of BS3 in 100 mM phosphate buffer (pH 7.0-7.4) for 5 to 60 minutes at room temperature, and the transponders are rinsed with water. A 10-100 mM
streptavidin solution in 100 mM phosphate bu~fer (pH
7.4 - 8.0) is prepared. The transponders are submerged in the streptavidin solution and incubated at room temperature for 2-3 hours. The transponders are rinsed three times with 100 mM phosphate buffer (pH 7.4-8.0).
The unreacted sites on the glass are blocked by incubating in Blocker BLOTTO in PBS (phosphate-buffered saline) (Pierce, Cat.# 37526) for 2 hrs. The transponders are rinsed three times with 100 mM
phosphate buffer (pH 7.4-8.0), and stored in this buffer at 40C.

CA 02238696 1998-0~-26 W O 97/20074 PCT~US96/18939 E~MPLE 9 DETECTION OF A POINT MUTATION IN THE N-RAS GENE
Point mutations in the N-ras gene are Erequently observed in various hematological and solid S tumors. A well-characterized mutation is a G -~ C
mutation in the first position of the 12th codon oi~ the N-ras gene. The present example provides a method to detect this mutation implementing transponders.
The sequence oE the first exon oE the N-ras 10 gene is given in Table 1. The glass surface of transponders (IPTT-100, Bl!~S) used in this example i8 derivatized with streptavidin using the conjugation method described in Example 3. The following oligodeoxynucleotides are chemically synthesized:
15 (1) GACTGAGTACAaACTGGTGG, corresponding to residues 3-22 of exon 1;
(2) CTCTATGGTGGC~ATCATATT-biotin, corresponding to residues 111 91;
(3) AACTGGTGGTGGTTGGAGCA, corresponding to residues 20 14-33, Oligonucleotide (2) is biotinylated at the 5' end.
These se~uences were previously used to perform mini-se~uencing using scintillating microplates by Th~ 1~; nen et al. (BioTechniques, 16, 938-943, 1994). Cellular 25 DNA from patient samples is purified using the standard Blin and Safford procedure (Sambrook et al., 1989/
Molecular Cloning: A Laboratory ~r~nll~l, 2nd Edition, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY). PCR amplification of DNA using primers 30 (1) and (2) i5 done on the Perkin-Elmer Cycler 9600, employing 50 cycles of ampli~ication. Each cycle involved a 1 minute denaturation at 94OC, 1 minute annealing at 55OC and 1 minute chain extension at 720C
in a final volume oE 100 ml. The single DNA strand 35 carrying biotin is captured on two transponders conjugated to streptavidin by incubating the product of the PCR reaction with the transponders in a buffer containing 150 rr~5 NaC1, 20 ~q sodium phosphate (pH 7.4) CA 02238696 l99X-0~-26 -W097/20074 PCT~S96/18939 and 0.1~ Tween-20 at 37OC with gentle shaking for 90 minutes. The bound PCR product was denatured with 50 mM NaOH for 5 minutes at room temperature. The transponders are then washed extensively 3-5 times with S a buffer (40 mM Tris-HCl, pH 8.8, 1 mM EDTA, 50 mM
NaC1, 0.1~ Tween-20). The patient name, consisting of six alph~nllm~ic characters, i8 encoded on the two transponders using a dedicated read-write scanner.
The diagnostic chain extension reaction is configured for one transponder as follows. The primer, oligonucleotide (3) is at a final concentration of 0.4 M, 3H dCTP or 3H dGTP (Amersham) at 0.2 mM, and 4 units of Ta~ polymerase, in a final volume of 1 ml of a buffer cont~;n;ng 50 mM KCl, 10 mM Tris-HCl (pH 9.O at 15 25OC), 0.1~ Triton X-100, 4 mM MgCl. The final volume and the test tube type are adjusted depending on the number of transponders so that the whole surface of the transponders is covered with buffer. The reaction i9 incubated at 550C for 10 minutes with gentle shaking.
To determine whether the mutation is present, transponders are used in two DNA chain extension reactions. The first reaction contains 3H dCTP and no other dNTPs, the second one contains 3H dGTP and no other dNTPs. Since the transponders are individually encoded with the patient's name, several transponders can be placed in the vessel where the reaction takes place.
After the reactions are completed, the transponders are washed 3 times as described above, and dried for 60 minutes at room temperature. The transponders are subjected to the electronic decoding, which is followed by counting of the radioactivity associated with the transponders in a scintillation counter, with or without scintillation ~luid.
3~ Radioactivity associated with the reac~ion employing 3H
dCTP indicates the presence of the mutation in the sample DNA.

W O 97/20074 PCT~US96/18939 Table 1 *

ATGACTGAGTACAAACTGGTGGTGGTTGGAGCAGGTG~ l~GGAAAAG 50 S TACTGACTCA~ ACCACCACCAACCTCGTCCACCACAACCCTTTTC
MetThrGluTyrLysLeuValValValGlyAlaGlyGlyValGlyLysSe CGcAcTGAcAATccAGcTAATccAGAAccA~lll~l~AGATGAATATGATc 100 GCGTGA~ AGGTCGATTAG~1Cl~ ;GTGA~ACATCTACTTATACTAG
rAlaLeuThrIleGlnLeuIleGl n~n~; sPheValAspGluTyrAspP

ccAcc~T~r~r~gtgaggccc 120 GGTGGTATCTCcactccggg roThrIleGlu Legend to Table 1:
Bold: Oligonucleotides (1) and (2);
Underlined: oligonucleotide primer (3);
Asterisk - indicates the posi~ion o~ the mutation G-~C
at codon 12. The sequence is ~rom G~nR~nk 86, entry HNSRAS1.

Claims (34)

I Claim:

1. An particle for use in solid phase assays for biomolecules, comprising:
(a) a transponder associated with a solid phase particle;
(b) a member of a biomolecular binding pair attached to a surface of the particle.

2. The particle of claim 1, wherein the surface of the particle is glass, latex or plastic.

3. The particle of claim 1, wherein the biomolecular binding pair is an antigen-antibody pair.

4. The particle of claim 1, wherein the biomolecular binding pair is an nucleic acid - nucleic acid pair.

5. The particle of claim 1, wherein at least one member of the biomolecular binding pair is single-stranded nucleic acid.

6. A particle for use in solid phase assays for nucleic acids, comprising a transponder associated with a solid phase particle and a primary layer of streptavidin conjugated to an outer surface of the particle.

7. The particle of claim 6, wherein a biotinylated nucleic acid probe is bound to the primary layer.

8. A method of detecting a member of a biomolecular bindig pair in a sample, comprising the steps of:
(a) providing a solid phase comprising particles having transponders, the transponders having memory elements and an index number encoded on the memory elements creating at least one class of transponders, each class having a different index number;
(b) the particles having a first member of a biomolecular binding pair attached to a surface of the solid phase particles;
(c) contacting the solid phase with a sample to cause a second member of the biomolecular binding pair to bind to the first member attached to the solid phase;
(d) analyzing the solid phase to detect the presence of a label indicative of binding of the second member; and (e) decoding the data encoded on transponders using a scanner device to identify the class of transponders to which analytes are bound.

9. A method of claim 8, wherein:
(a) the first member of the biomolecular binding pair is a nucleic acid probe, and the second member of the biomolecular binding pair is a nucleic acid target, an both the probe and the target having mutually complementary sequences, and (b) contacting the solid phase with a sample involves:
(bb) denaturing nucleic acids in the sample mixture; and (bbb) hybridizing nucleic acids in the sample mixture whereby target nucleic acid sequences hybridize to the probe

10. The method of claim 8, wherein the index number is encoded on the transponder memory element by the transponder manufacturer.

11. The method of claim 8, wherein the index number is encoded on the transponder memory element by the user with a scanner device.

12. The method of claim 8 wherein the label is bound to the target nucleic acid.

13. The method of claim 8 wherein the label is bound to a second oligonucleotide probe, the second probe having a sequence complementary to a second target sequence.

14. The method of claim 8, wherein the label comprises a fluorophore, a chromophore, a radiolabel, a chemiluminescent agent or a bioluminescent agent.

15. The method of claim 8, wherein an outer surface of the transponders is glass, plastic or latex.

16. The method of claim 8 wherein the data comprises physical or chemical characteristics or sequences of the biomolecule or biomolecules deposited on solid phase.

17. The method of claim 9 wherein the data comprises characteristics of the sample.

18. A method of detecting biomolecules in a sample, comprising the steps of:
(a) introducing into the sample at least two populations of solid phase particles, each particle having a transponder and having a member of a biomolecular binding pair attached to its surface, a first population having a different biomolecular binding pair member than a second population and the transponders in the first population being encoded with a different identification than the transponders of the second population;
(b) analyzing the particles to detect a label indicating the binding of a the sample biomolecule; and (c) decoding the transponders to determine the population of the transponder.

19. The solid phase of claim 18, wherein the solid phase comprises at least three populations of solid phase particles, each particle having a transponder and having an oligonucleotide probe attached to its surface, each of the three populations having a different oligonucleotide probe sequence and each of the populations being encoded with a different identification than the transponders of the second population.

20. A method of performing a multiplex solid phase assay for biomolecules, comprising the steps of:
(a) providing a particulate solid phase, the particles of the solid phase having transponders, the transponders having memory elements encoded with index number creating two or more classes of transponders, each class having a different index number;
(b) contacting the solid phase with a sample and performing a standard assay procedure to cause two or more different analytes to bind to the solid phase;
(c) washing the solid phase to remove unbound sample components;
(d) analyzing the solid phase to detect a label indicative of the presence of bound analytes; and (e) decoding the data encoded on the transponders to identify the class of transponder to which an analyte is bound.

21. A method of performing a multiplex solid phase assay for target nucleic acids in a sample, comprising the steps of:
(a) providing a particulate solid phase, the particles of the solid phase having transponders, the transponders having memory elements, and an oligonucleotide probe attached to a surface of the particle, the oligonucleotide probe complementary to a target sequence;
(b) the transponders comprising two or more classes of encoded transponders, each class having a different oligonucleotide bound to the surface of the particle, and each class having a different index number encoded on the transponders memory elements;
(c) contacting the solid phase with a sample to form a sample mixture, the sample mixture containing two more transponders of different classes;
(e) denaturing nucleic acids in the sample mixture;
(f) hybridizing nucleic acids in the sample mixture whereby target nucleic acids hybridize to the nucleic acid probe;
(g) removing unbound sample components from the sample mixture;
(h) analyzing the solid phase to detect a label indicative of the presence of bound analytes; and (i) decoding the data encoded on the transponders to identify the class of transponder to which an analyte is bound.

22. A method of detecting target nucleic acids in a sample, comprising the steps of:
(a) introducing into the sample at least two populations of solid phase particles, each particle having a transponder and having an oligonucleotide probe attached to its surface, a first population having an oligonucleotide probe that hybridizes to a different target nucleic acid than a second population and the transponders in the first population being encoded with a different identification than the transponders of the second population;
(b) denaturing the nucleic acids in the sample;
(c) hybridizing the target nucleic acids to the oligonucleotide probes;
(d) analyzing the particles to detect a label indicating that target nucleic acid has bound to the probe; and (e) decoding the transponder to identify the probe.

23. The solid phase of claim 22, wherein the solid phase comprises at least three populations of solid phase particles, each particle having a transponder and having an oligonucleotide probe attached to its surface, each of the three populations having a different oligonucleotide probe sequence and each of the populations being encoded with a different identification than the transponders of the second population.

24. A kit for detecting the presence of a member of a biomolecular binding pair in a sample, comprising:
(a) at least one assay vessel, containing at least one solid phase particle, a transponder associated with the particle, the transponder having a memory element, and a primary layer of biomolecules bound to a surface of the particle;
(b) at least one probe reagent, comprising a member of a biomolecular binding pair;

(c) at least one labeled conjugate reagent that binds selectively to the probe reagent.

25. The kit of claim 24, further comprising:
(a) at least one positive control, comprising a solution of a member the biomolecular binding pair; and (b) at least one negative control, comprising a solution free of the biomolecular binding pair member;

26. The kit of claim 25, further comprising:
(a) a sample diluent buffer solution; and (b) an enzyme reaction buffer solution.

27. The kit of claim 24, wherein the primary layer comprises protein antigens.

28. The kit of claim 24, wherein the primary layer of biomolecules comprise viral antigens.

29. The kit of claim 24, wherein the biomolecular binding pair member to be detected comprises a cell.

30. A kit for detecting the presence of a nucleic acid in a sample, comprising:
(a) at least one assay vessel, containing at least one solid phase particle having a transponder, and an oligonucleotide probe bound to a surface of the particle; and (b) at least one label reagent.

31. The kit of claim 30, wherein the label reagent comprises a reagent that labels the target nucleic acid.

32. The kit of claim 30, wherein the label reagent comprises a second labeled oligonucleotide probe complementary to a second target sequence.

33. The kit of claim 30, further comprising:
(a) at least one positive control, comprising a solution of solution of nucleic acid complementary to the oligonucleotide probe bound to the particle; and (b) at least one negative control, comprising a solution free of nucleic acids;

34. The kit of claim 27, further comprising:
(a) a sample diluent buffer solution; and (b) an enzyme reaction buffer solution.