CA2228730A1 - Styelins - Google Patents

Abstract

Novel microbial peptides called styelins are of the formula J1-X2-X3-B'4-B"5-J6-X'7-B8-J9-X10 J11-Z12-X13-J*14-B*15-B16-B18-O19-J*20 X21-B22-J23-J24-X'25-C26-X*27-J28-X29-Z30 and the pharmaceutically acceptable acetylated forms and salts amides and esters thereof wherein:
B represents a basic amino acid;
B' represents a basic or a small amino acid;
B" represents a basic amino acid or proline;
B* represents a basic amino acid or tyrosine, wherein said tyrosine optionally is alkylated;
X represents a hydrophobic amino acid;
X' represents a hydrophobic or a small amino acid;
Z represents a basic or a hydrophobic amino acid;
J represents a small amino acid;
J* represents a small amino acid or tyrosine which tyrosine is optionally methylated;
O represents an amino acid containing a hydroxyl group; and C represents any amino acid.

Description

STYELINS

Acknowledgment of Government Support This invention was made at least in part with funding from NIH grant numbers A1-37945 and A1-22839. The U.S. Government has certain rights in this invention.
Technical Field The invention relates to a class of peptide and peptide-like compounds with 1 0 antimicrobial activity. These peptides, designated "styelins" are characterized by patterns of basic amino acids which result in compounds with a spectrum of antimicrobial activities.

Background Art 1 5 Antimicrobial peptides have been isolated from a wide variety of animal sources. These sources include, prominently, leukocytes of humans (Lehrer, R.I. et al., Ann Rev Immunol (1992) 11: 105); pigs (Kokryakov, V.N. et al., FEBS Lett (1993) 231), I,ee, J.Y. et al. Proc Natl Acad Sci USA (1989) 86:9159-9162, PCT application W095/03325, published 2 February 1995); bovine sources (Selsted, M.E. et al., JBiol Chem (1993) 268:6641); rabbits (Patterson-Delafield, J. et al., InfectImmun (1980) 30: 180); and birds (Harwig, S.S.L. et al., FEBS Lett (1994) 342:281). Antimicrobial peptides have also been found in bovine tongue (Schonwetter, B.S. et al., Science (1995) 267:1645) respiratory tract epithelia (Diamond, G. et al., Proc Natl Acad Sci USA ( 1991) 88 :3952) and gastrointestinal and genital urinary tracts of hllm~n.~ and

2 5 animals (Jones, D.E. et al., JBiol Chem (1992) 267:23216; Bensch, K.W. et al., FEBS
Lett (1995) 368:331). In addition, antimicrobial peptides have been isolated from the hemocytes of the Horseshoe Crab as described by Nakamura, T. et al., J Biol Chem(1988) 263:16709-16713. These various antimicrobial peptides, for example the tachyplesins, polyphemusins, defensins, protegrins and g;~llin~cins, are typically

3 0 characterized by specific positions of cysteine residues which putatively control conformation of the molecule.

Antimicrobial peptides and proteins have also been found in plants as reviewed by Cornelissen, B.J.C. et al., Plant Physiol (1993) 101:709-712.
An additional class of antimicrobial peptides, found in the skin of the African clawed frog, Xenopus laevis, are a-helical (noncovalent-cyclic) peptides (Zasloff, M., Proc Natl Acad Sci USA (1987) 84:5449). This class of antimicrobial peptides, called the m~ inin~, in their mature form contain, 23 amino acids and are a-helical but not amidated. The m ~g~inin~ possess broad spectrum antimicrobial activity (Harwig, S.S.L. et al., FEBSLett (1994) 342:281; Zasloff, M. et al., Proc Natl Acad Sci USA
(1988) 85:910). The nature ofthe antimicrobial activity as related to the a-helical amphipathic structure of m ~inin~ has been studied (Duclohier, H. et al., Biophys J
(1989) 56:1017) as has that of another class of a-helical antimicrobial peptides, the cecropins (Christensen, B. et al., Proc Natl Acad Sci USA (1988) 85:5072. The m ~inin~ are synthesized from a large pl~lopeptide cont~ining a single copy of M A~inin-l and five copies of the closely related M a~inin-2 (Terry, A.S. et al., J
Biol Chem (1988) 263:5745).
Another class of antimicrobial peptides which is characterized by specific patterns of basic and hydrophobic amino acids is the class of clavanins, originally isolated from the hemocytes of the tunicate Styela clava and described in PCT
application P C T/U S97/19266 filed 24 October 1997 and incorporated herein by 2 0 reference. The characterizing features of these peptides distinguish them from the styelins disclosed herein, isolated from the same source. Antimicrobial peptideswhich seem most homologous to those disclosed herein are in the cecropin class.
Cecropins were originally found in insects but have also been isolated from pig intestine. See Lee, J.Y. et al. Proc Natl Acad Sci USA (1989) 86:9159-9162 (cited 2 5 above); Sipos, D. et al. Eur JBiochem (1992) 209:163-169; Moore, A.J. et al. J
Antimicrobial Chemotherapy (1996) 37:1077-1089; Gazit, E. et al. JMol Biol (1996) 258:860-870. The cecropins may even have antitumor activity (Moore, A.J Peptide Research (1994) 7:265-269). Some cecropins have been named for the insects from which they were isolated, such as Manduca B2, and Sarcophaga lA.
3 0 The present invention is directed to a class of peptides and peptide-like compounds several members of which may be isolated, as were the clavanins, from the hemocytes of the tunicate Styela clava. Tunicates are simple marine invertebrates whose larval forms contain a constellation of features establishing their kinship to early vertebrates. The body cavity of the mature tunicate provides an acceptablesource of mèsoderm-derived phagocytes (hemocytes) that are counterparts to the blood leukocytes of higher vertebrates. It is known that phagocytes of freshly harvested colonial tunicates are often filled with various bacteria and that theintroduction of bacteria beneath the tunic is capable of inducing phagocytic cells to traverse the underlying epithelium and surround these foreign objects.
A description of the isolation of styelins A and B and confirm~tion of their antimicrobial activity is set forth in Lee, H. et al. Comp Biochem Physiol (1997) 1 18B:515-521. Cloning of cDNA encoding styelins C, D and E is described by Zhao, C. et al. FEBSLetters (1997) 412:144-148. The contents ofthesepapers is incorporated herein by reference.

Disclosure of the Invention The invention is directed to a class of peptides and peptide-like compounds, the styelins, that are characterized by specific patterns of basic and hydrophobic amino acid side-chains and which show a broad spectrum of antimicrobial activity.
The styelins are therefore useful additions to the repertoire of agents useful in preserving materials otherwise susceptible to microbial degradation, in protecting 2 0 plants against bacterial infection, and in therapeutic and prophylactic protection of ~nim~l~ against bacteria, fungi and viruses. As used in the present application "antimicrobial" refers to the ability to inhibit the growth of, destroy, or otherwise impede the undesired destructive effects of such replicable forms.
Thus, in one aspect, the invention is directed to compounds of the formula:
2 5 Jl-X2-x3-B~4-B~s-J6-x~7-Bs-Js-xlo Jll-Zl2-XI3-J*l4-B*ls-Bl6-Bl8-~l9-J*20 (1) X2l-B22-J23-J24-X'2s-C26-X*27-J28-X29-Z30 and the pharmaceutically acceptable acetylated forms, salts and esters and amides thereof wherein:
3 0 B represents a basic amino acid;
B' represents a basic or a small amino acid;
B" represents a basic amino acid or proline;

B* represents a basic amino acid or tyrosine, wherein said tyrosine optionally is alkylated;
X represents a hydrophobic amino acid;
X' represents a hydrophobic or a small amino acid;
Z represents a basic or a hydrophobic amino acid;
J represents a small amino acid;
J* represents a small amino acid or tyrosine which tyrosine is optionally methylated;
O represents an amino acid containing a hydroxyl group; and C represents any amino acid.
Included in the invention are the compounds of formula (1) in the acylated and/or amidated form as well as their esters and salts.
In other aspects, the invention is directed to recombinant materials useful for the production of those peptides of the invention that contain gene-encoded amino acids, as well as plants or ~nim~l~ modified to contain expression systems for the production of these peptides. The invention also includes methods to prepare andmanipulate these recombinant materials.
In addition, the invention is directed to pharmaceutical compositions and compositions for application to plants and to materials whose preservation from 2 0 microbial growth is desired, which compositions contain the compounds of the invention as active ingredients and to compositions which contain expression systems for the production of the peptides for in situ expression of the nucleotide sequence encoding these peptides. The invention is also directed to methods to prepare the invention compounds synthetically, to antibodies specific for these compounds, and to 2 5 the use of the compounds as preservatives, therapeutics, and prophylactics. The invention is also directed to the use of the compounds of the invention as standards in antimicrobial assays and as affinity ligands for adsorption of counterpart structures in microbes, including viruses, as set forth above.

Brief Description of the Drawings Figure lA shows reverse-phase HPLC ofthe styelin-containing fraction derived from S. clava hemocytes recovered from acid-urea PAGE. Figure lB shows further separation of styelins A and B derived from an initial chromatographic run.
Figures 2A-2C show the antimicrobial activity of styelins A and B with respect to E. coli, S. typhimurium, and P. aeruginosa, respectively.
Figures 3A-3C show the antimicrobial activity of styelins A and B against S. aureus, VR-E. faecium, and ~. monocytogenes.
Figures 4A and 4B show the antimicrobial activity of styelins A and B against 0 Planococcus citreus and Psychrobacter immobilis.
Figures 5A and SB show the effect of pH on the antimicrobial activity of styelin A. Figure 5C shows the effect of enhanced salt concentration on antimicrobial activity of styelin A.
Figure 6 shows the nucleotide sequence and deduced amino acid sequence of cDNA encoding styelin E. As shown, the mature protein is preceded by a propiece and a signal sequence and followed by a "postpiece."
Figure 7 shows a comparison of the signal sequences, mature peptide sequences, and the C-terminal extension of the styelin precursors deduced from the cDNA encoding styelins C, D and E.
Modes of Carrying Out the Invention The compounds of the invention are generally described by the formula J~ -X2-X3-B'4-B''s-J6-X'7-B8-Jg-Xl 0 Jll-Zl2-xl3-J*l4-B*l5-Bl6-Bl8-Ol9-J*20 (1) 2 5 X2l-B22-J23-J24-X'2s-C26-X*27-J2s-X2~Z30 and the salts, esters, amides, and acyl forms thereof. Each position represented by a letter indicates a single amino acid residue although, as described below, one or more of the peptide linkages between such residues may be replaced by a peptide linkage mimic. The invention compounds include those represented by formula (1) as well as 3 0 homologous peptides which are isolable from the hemocytes of tunicates.
"Homologous" forms are those which retain the ability to form an a-helical configuration, are antimicrobial, have the same pattern of basic amino acids, and are linear rather than covalently linked cyclic in configuration/conformation.
The amino terminus of the peptide may be in the free amino form or may be acylated by a group of the formula RCO-, wherein R represents a hydrocarbyl group of 1-6C. The hydrocarbyl group is saturated or unsaturated and is typically, forexample, methyl, ethyl, i-propyl, t-butyl, n-pentyl, cyclohexyl, cyclohexene-2-yl, hexene-3-yl, hexyne-4-yl, and the like.
The C-terminus of the peptides of the invention may be in the form of the underivatized carboxyl group, either as the free acid or an acceptable salt, such as the potassium, sodium, calcium, magnesium, or other salt of an inorganic ion or of an organic ion such as caffeine. The carboxyl terminus may also be derivatized by formation of an ester with an alcohol of the formula ROH, or may be amidated by an amine of the formula NH3, or RNH2, or R2NH, wherein each R is independently hydrocarbyl of 1-6C as defined above. Amidated forms of the peptides wherein theC-terminus has the formula CONH2 are preferred.
As the peptides of the invention contain substantial numbers of basic amino acids, the peptides of the invention may be supplied in the form of the acid addition salts. Typical acid addition salts include those of inorganic ions such as chloride, bromide, iodide, fluoride or the like, sulfate, nitrate, or phosphate, or may be salts of 2 0 organic anions such as acetate, formate, benzoate and the like. The acceptability of each of such salts is dependent on the intended use, as is commonly understood.
The amino acids in the peptides of the invention may be those encoded by the gene or may be analogs thereof, may be posttranslational products of the gene-encoded amino acids, and may also be the D-isomers thereof. One preferred 2 5 embodiment of the peptides of the invention is that form wherein all of the residues are in the D-configuration thus conferring resistance to protease activity whileret~ining antimicrobial or antiviral properties. The resulting styelins are themselves enantiomers of the native L-amino acid-cont~ining forms.
The amino acid notations used ~herein are conventional and are as follows:

One-LetterThree-Letter Amino Acid Symbol Symbol Alanine A Ala Arginine R Arg Asparagine N Asn Aspartic acid D Asp Cysteine C Cys Glutamine Q Gln Glutamic acid E Glu Glycine G Gly Histidine H His Isoleucine I lle Leucine L Leu Lysine K Lys Methionine M Met Phenylalanine F Phe Proline P Pro Serine S Ser Threonine T Thr Tryptophan W Trp Tyrosine Y Tyr Valine V Val The amino acids not encoded genetically are abbreviated as indicated in the discussion below.
In the specific peptides shown in the present application, the L-form of any amino acid residue having an optical isomer at the a carbon is intended unless the D-form is expressly indicated by a dagger superscript (t).
The compounds of the invention are peptides or peptide-like compounds which are partially defined in terms of amino acid residues of designated classes.
Amino acid residues can be generally subclassified into major subclasses as follows:
Acidic: The residue has a negative charge due to loss of H ion at physiological pH and the residue is attracted by aqueous solution so as to seek the surface positions in the conformation of a peptide in which it is contained when the peptide is in aqueous medium at physiological pH.
Basic: The residue has a positive charge due to association with H ion at physiological pH or within one or two pH units thereof (e.g., histidine) and theresidue is attracted by aqueous solution so as to seek the surface positions in the conformation of a peptide in which it is contained when the peptide is in aqueous medium at physiological pH.
Hydrophobic: The residues are not charged at physiological pH and the residue is repelled by aqueous solution so as to seek the inner positions in theconformation of a peptide in which it is contained when the peptide is in aqueous medlum.
Neutral/polar: The residues are not charged at physiological pH, but the residue is not sufficiently repelled by aqueous solutions so that it would seek inner positions in the conformation of a peptide in which it is contained when the peptide is in aqueous medium.
This description also characterizes certain amino acids as "small" since their side chains are not sufficiently large, even if polar groups are lacking, to confer hydrophobicity. "Small" amino acids are those with four carbons or less when at least one polar group is on the side chain and three carbons or less when not.
It is understood, of course, that in a statistical collection of individual residue molecules some molecules will be charged, and some not, and there will be an attraction for or repulsion from an aqueous medium to a greater or lesser extent. To fit the definition of"charged," a signifcant percentage (at least approximately 25%) of the individual molecules are charged at the relevant pH. The degree of attraction or 2 0 repulsion required for classification as polar or nonpolar is arbitrary and, therefore, amino acids specifically contemplated by the invention have been classified as one or the other. Most amino acids not specifically named can be classified on the basis of known behavior.
Amino acid residues can be further subclassified as cyclic or noncyclic, and 2 5 aromatic or nonaromatic, self-explanatory classifications with respect to the side-chain substituent groups of the residues, and as small or large. The residue is considered small if it contains a total of four carbon atoms or less, inclusive of the carboxyl carbon, provided an additional polar substituent is present; three or less if not. Small residues are, of course, always nonaromatic.
3 0 For the naturally occurring protein amino acids, subclassification according to the foregoing scheme is as follows.

ill649 Acidic Aspartic acid and Glutamic acid Basic Noncyclic: Arginine, Lysine Cyclic: Histidine Small Glycine, Serine, Alanine, Threonine Polar/large Asparagine, Glutamine Hydrophobic Tyrosine, Valine, Isoleucine, Leucine, Methionine, Phenylalanine, Tryptophan The gene-encoded secondary arnino acid proline is a special case due to its known effects on the secondary conforrnation of peptide chains, and is not, therefore, included in a group. Cysteine residues are also not included in these classifications since their capacity to form disulfide bonds to provide secondary structure may override the general polarity/nonpolarity of the residue. In any event, the invention compounds isolable from tunicates do not contain cysteine.
In synthetic analogs, cysteine may be included, as a "small" amino acid, but the circumstances of its inclusion must be such that cyclic disulfides are not formed.
Further, the inclusion of cysteine residues in analogous peptides is disadvantageous because of the possibility of formation of intermolecular disulfides which may denature the antimicrobial activity of the compounds.
"Modified" amino acids may be included in the styelins are gene-encoded amino acids; these gene-encoded amino acids have been processed after translation of the gene, e.g., by the addition of methyl or hydroxyl groups or derivatization through covalent linkage to other substituents or oxidation or reduction or other covalent modification. The classification into which the resulting modified amino acid falls will be determined by the characteristics of the modified form. For example, if lysine were modified by acylating the ~-amino group, the modified form would not be 2 0 classed as basic but as polar/large.
However, the amino acids included in the peptides of the invention are not necessarily limited to gene-encoded amino acids per se or the posttranslational modified forms thereof. Other amino acids which can be classified according to the foregoing can also be included. Certain additional commonly encountered amino 2 5 acids, which may be found in the peptides of formula (1), include, for example, beta-alanine (beta-Ala), or other omega-amino acids, such as 3-aminopropionic, 2,3-diaminopropionic (2,3-diaP), 4-aminobutyric and so forth, alpha-aminisobutyric acid (Aib), sarcosine (Sar), ornithine (C)rn), citrulline (Cit), t-butylalanine (t-BuA), t-butylglycine (t-BuG), N-methylisoleucine (N-MeIle), phenylglycine (Phg), and cyclohexylalanine (Cha), norleucine (Nle), 2-naphthylalanine (2-Nal); 1,2,3,4-tetrahydroisoquinoline-3-carboxylic acid (Tic); 0-2-thienylalanine (Thi); methionine sulfoxide (MSO); and homoarginine (Har). These also fall conveniently into particular categories.
Based on the above definitions, Sar, beta-Ala and Aib are small;
t-BuA, t-BuG, N-MeIle, Nle, Mvl, Cha, Phg, Nal, Thi and Tic are hydrophobic;
1 0 2,3-diaP, Orn and Har are basic;
Cit, Acetyl Lys and MSO are neutral/polar/large.
The various omega-amino acids are classified according to size as small (beta-Ala and 3-aminopropionic) or as large and hydrophobic (all others).
Other amino acid substitutions for those encoded in the gene can also be 1 5 included in peptide compounds within the scope of the invention and can be classified within this general scheme according to their structure.
In all of the "peptides" of the invention, one or more amide linkages (-CO-NH-) may optionally be replaced with another linkage which is an isostere such as -CH2NH-, -CH2S-, -CH2CH2, -CH=CH- (cis and trans), -COCH2-, -CH(OH)CH2-2 0 and -CH2SO-. This replacement can be made by methods known in the art. The following references describe preparation of peptide analogs which include thesealternative-linking moieties: Spatola, A.F., Vega Data (March 1983), Vol. 1, Issue 3, "Peptide Backbone Modifications" (general review); Spatola, A.F., in "Chemistry and Biochemistry of Amino Acids Peptides and Proteins," B. Weinstein, eds., Marcel 2 5 Dekker, New York, p. 267 (1983) (general review); Morley, J.S., Trends Pharm Sci (1980) pp. 463-468 (general review); Hudson, D., et al., Int JPept Prot Res (1979) 14:177-185 (-CH2NH-, -CH2CH2-); Spatola, A.F., et al., Life Sci (1986) 38:1243-1249 (-CH2-S); Hann, M.M., J Chem Soc Perkin Trans I (1982) 307-314 (-CH-CH-, cis andtrans); Almquist, R.G., et al., JMed Chem (1980) 23:1392-1398 (-COCH2-);
3 0 Jennings-White, C., et al., Tetrahedron Lett (1982) 23:2533 (-COCH2-); Szelke, M., et al., European Application EP 45665 (1982) CA:97:39405 (1982) (-CH(OH)CH2-);

Holladay, M.W., et al., Tetrahedron Lett (1983) 24:4401-4404 (-C(OH)CH2-); and Hruby, V.J., Life Sci (1982) 3l:189-l99 (-CH2-S-).
The compounds of forrnula (1 ) are generally defined as set forth in the Disclosure of the Invention set forth above.
Preferred embodiments of the peptides of the invention are those wherein Jl is glycine; or X2 is tryptophan; or X3 is leucine or phenylalanine; or B'4 is glycine or arginine; or B"5 is proline, hydroxylysine, or glycine; or J6 is alanine; or X'7is alanine or phenylalanine; or B8 is histidine, arginine or lysine; or Jg is serine; or X10 is valine; or J" is serine or glycine; or Z~2 is lysine or asparagine; or X~3 is phenylalanine; or J*14 is alanine or tyrosine; or 2 0 B*l5 is lysine, hydroxylysine or tyrosine; or Bl6 is hydroxylysine or lysine; or Bl7 is histidine; or Bl8 is hydroxylysine or lysine; or O19is threonine or tyrosine; or 2 5 J*20 is alanine or tyrosine; or X2l is isoleucine; or B22 is lysine or histidine; or J23 is alanine; or J24 is alanine or glycine; or 3 0 X25 is tryptophan or leucine; or C26 is lysine or serine or glut~rnine; or X*27 is isoleucine or alanine; or J2~ is alanine or glycine; or X29 is arginine, lysine or histidine; or Z30is histidine or leucine.
Also especially preferred are the C-terminal amidated forms of the compounds of the invention where the carboxyl terminus is of the formula -CONH2.
As shown in the examples below, the naturally occurring styelins are encoded by a nucleotide sequence which provides not only the codons for the mature protein, but also the initially formed precursors thereof. As shown by the open reading frame in the cDNA, the mature protein is the cleavage product of a larger protein containing an N-terminal signal sequence and "propiece" and a C-terminal "postpiece." Styelins C, D and E, whose genes have been sequenced, have identical signal sequences andpropieces and homologous postpieces.
Especially preferred embodiments of the peptides of the invention include styelins A-E whose structures are desclibed in the examples.
As used herein, the terrn "precursor" of the peptide of the invention includes two categories: first, it includes the protein encoded by the cDNA or a portion thereof which contains extensions at the C- and/or N-terminus of the mature peptide; andsecond, it includes the initial translation product of the naturally occurring styelins prior to any posttranslational modification of the gene-encoded residues. It may also 2 0 be used to include the side-chain-protected form of the peptides obtained when the peptide is synthesized using standard solid-phase techniques.

Preparation of the Invention Compounds The invention compounds, often designated herein "styelins" are essentially 2 5 peptide backbones which may be modified at the N- or C-terminus and are linear peptides.
Standard methods of synthesis of peptides the size of styelins are known.
Most commonly used currently are solid phase synthesis techniques; indeed, automated equipment for systematically constructing peptide chains can be purchased.
3 0 Solution phase synthesis can also be used but is considerably less convenient. When synthesized using these standard techniques, amino acids not encoded by the gene and D-enantiomers can be employed in the synthesis. Thus, one very practical way to obtain the compounds of the invention is to employ these standard chemical synthesis techniques.
In addition to providing the peptide backbone, the N- and/or C-terminus can be derivatized, again using conventional chemical techniques. The compounds of the invention may optionally contain an acyl group, preferably an acetyl group at the amino terminus. Methods for acetylating or, more generally, acylating, the free amino group at the N-terminus are generally known in the art; in addition, the N-terminal amino acid may be supplied in the synthesis in acylated form.
At the carboxy terminus, the carboxyl group may, of course, be present in the form of a salt; in the case of pharmaceutical compositions this will be a pharmaceutically acceptable salt. Suitable salts include those formed with inorganic ions such as NH4+, Na+, K+, Mg++, Ca+t, and the like as well as salts formed with organic cations such as those of caffeine and other highly substituted amines. The carboxy terminus may also be esterified using alcohols of the formula ROH wherein R is hydrocarbyl (1-6C) as defined above. Similarly, the carboxy terminus may beamidated so as to have the formula -CONH2, -CONHR, or -CONR2, wherein each R
is independently hydrocarbyl ( l -6C) as herein defined. Techniques for esterification and amidation as well as neutralizing iIl the presence of base to form salts are all standard organic chemical techniques.
2 0 If the peptides of the invention are prepared under physiological conditions, the side-chain amino groups of the basic amino acids will be in the form of the relevant acid addition salts.
If the peptide backbone is comprised entirely of gene-encoded amino acids, or of posttranslational modified forms thereof or if some portion of it is so composed, 2 5 the peptide or the relevant portion may also be synthesized by a method that comprises recombinant DNA techniques. The DNA encoding the peptides of the invention or a precursor thereof may itself be synthesized using commercially available equipment; codon choice can be integrated into the synthesis depending on the nature of the host.
3 0 Recombinantly produced forms of the styelins may require subsequent derivatization to modify the N- and/or C-terminus or to modify the gene-encoded amino acids. Indeed, as styelins A and B, which were isolated forms of the peptide, contain hydroxylysine, it is evident that posttranslational processing of the gene-encoded amino acids is required or desirable.
For recombinant production, the DNA encoding the peptides or their precursors is included in an ~res~ion system which places these coding sequencesunder control of a suitable promoter and other control sequences compatible with an intended host cell. Types of host cells available span almost the entire range of the plant and animal kingdoms. Thus, the peptides of the invention could be produced in bacteria or yeast (to the extent that they can be produced in a nontoxic or refractile form or utilize resistant strains) as well as in animal cells, insect cells and plant cells.
Indeed, modified plant cells can be used to regenerate plants containing the relevant ~ples~ion systems so that the resulting transgenic plant is capable of self protection vis-à-vis these infective agents.
The peptides of the invention c~m be produced in a form that will result in their secretion from the host cell by fusing to the DNA encoding the peptide or its precursor, a DNA encoding a suitable signal peptide, or may be produced intracellularly. They may also be produced as fusion proteins with additional amino acid sequence which may or may not need to be subsequently removed prior to the use of these compounds as antimicrobials.
Thus, the peptides of the invention can be produced in a variety of modalities 2 0 including chemical synthesis and recombinant production or some combination of these techniques.
Any members of the styelins which occur naturally are supplied in purified and isolated form. By "purified and isolated" is meant free from the environment in which the peptide normally occurs (in l;he case of such naturally occurring peptides) 2 5 and in a form where it can be used practically. Thus, "purified and isolated" form means that the peptide is substantially pure, i.e., more than 90% pure, preferably more than 95% pure and more preferably more than 99% pure or is in a completely different context such as that of a pharrnaceutical preparation.

3 0 Antibodies Antibodies specifically immunoreactive with the styelins of the invention may also be produced using standard immunological techniques for production of polyclonal antisera and, if desired, immortalizing the antibody-producing cells of the immuni7;ed host for sources of monoclonal antibody production, as well as by recombinant techniques. By "specifically immunoreactive" with the styelins is meant that the antibodies or, as described below, fragments thereof, have a significantly higher affinity for the styelins than for peptides of the related antimicrobial peptides such as the cecropins or m~g~inin~. Thus, the antibodies must recognize epitopes that are unique to this class of peptides and not found in the related antimicrobial compounds.
Techniques for producing antibodies to any substance of interest are well known. It may be necessary to enhance the immunogenicity of the substance by coupling the hapten to a carrier. Suitable carriers for this purpose include substances which do not themselves produce an immune response in the m~mm~l to be a-lministered the hapten-carrier conjugate. Common carriers used include keyholelimpet hemocyanin (KLH), diphtheria l;oxoid, serum albumin, and the viral coat protein of rotavirus, VP6. Coupling of the hapten to the carrier is effected by standard techniques such as contacting the carrier with the peptide in the presence of a dehydrating agent such as dicyclohexylcarbodiimide or through the use of linkerssuch as those available through Pierce Chemical Company, Chicago, IL.
The styelins of the invention in immunogenic form are then injected into a 2 0 suitable m~mm~ n host and antibody titers in the serum are monitored.
Polyclonal antisera may be harvested when titers are sufficiently high.
Alternatively, antibody-producing cells of the host such as spleen cells or peripheral blood Iymphocytes may be harvested and immortalized. The immortalized cells are then cloned as individual colonies and screened for the production of the desired 2 5 monoclonal antibodies. The genes encoding monoclonal antibodies secreted byselected hybridomas or other cells may be recovered, manipulated if desired, forexarnple, to provide multiple epitope specificity or to encode a single-chain form and may be engineered for expression in alternative host cells, such as CHO cells.
Thus, as used herein, "antibodies" also includes any immunologically reactive 3 0 fragment of the immunoglobulins such as Fab, Fab' and F(ab')2 fragments as well as modified immunoreactive forms such as Fv regions, which are produced by manipulation of the relevant genes (isolable, for example, from the apl)Lopliatehybridoma).
The antibodies of the invention are, of course, useful in immunoassays for determining the amount or presence of the styelins. Such assays are essential inquality controlled production of compositions containing the styelins of the invention.
In addition, the antibodies can be used to assess the efficacy of recombinant production of the styelins, as well as for screening expression libraries for the presence of styelin encoding genes. They may also be used as affinity ligands for purifying and/or isolating the styelins.

Compositions Containing the Styelins and Methods of Use The styelins are effective in inactivating a wide range of microbial, including viral targets, including gram-positive and gram-negative bacteria, yeast, protozoa and certain strains of virus. Accordingly, they can be used in disinfectant compositions and as preservatives for materials such as foodstuffs, cosmetics, medicaments, or other materials containing nutrients for org~ni~m~. For use in such contexts, these peptides are supplied either as a single peptide, in admixture with several other styelins, or in admixture with additional antimicrobial agents, especially protegrins or cecropins. In general, as these are preservatives in this context, they are usually 2 0 present in relatively low amounts, of less than 5%, by weight of the total composition, more preferably less than 1%, still more preferably less than 0.1%.
The peptides of the invention are also useful as standards in antimicrobial assays and in assays for determination of capability of test compounds to bind to endotoxins such as lipopolysaccharides.
2 5 For use as antimicrobials or antivirals for treatment of animal subjects, the peptides of the invention can be formu]ated as ph~rm~ceutical or veterinary compositions. Depending on the subject to be treated, the mode of ~(1mini~tration, and the type of treatment desired -- e.g., prevention, prophylaxis, therapy; theclavanins are formulated in ways consonant with these parameters. A summary of 3 0 such techniques is found in Remington's Pharmaceutical Sciences, latest edition, Mack Publishing Co., Easton, PA.

In general, for use in treatment or prophylaxis, the peptides of the invention may be used alone or in combination with other antibiotics such as erythromycin,tetracycline, macrolides, for example azithromycin and the cephalosporins.
Especially preferred is combination with one or more protegrins or cecropins.
Depending on the mode of a~mini.~tration, the styelins will be formulated into suitable compositions to permit facile delivery l;o the affected areas. Use of the enantiomeric forms containing all D-amino acids may confer advantages such as resistance to those proteases, such as trypsin and chymotrypsin, to which the styelins containing L-amino acids are less resistant.
The peptides of the invention ccm be ~flmini~tered singly or as mixtures of several clavanins or in combination with other pharmaceutically active components, and in single or multiple a-1mini~trations. The formulations may be prepared in a manner suitable for systemic a(lmini~tration or topical or local a~lmini~tration.
Systemic formulations include those designed for injection (e.g., intramuscular,intravenous or subcutaneous injection) or may be prepared for transdermal, transmucosal, or oral a-lmini~tration. I'he formulation will generally include a diluent as well as, in some cases, adjuvants, buffers, preservatives and the like. The styelins can also be a~lmini~tered in liposomal compositions or as microemulsions.
If aAmini~tration is to be oral, the peptides of the invention must be protected2 0 from degradation in the stomach using a suitable enteric coating. This may be avoided to some extent by utili7ing amino acids in the D-configuration, thus providing resistance to protease. However, the peptide is still susceptible to hydrolysis due to the acidic conditions of the stomach; thus, some degree of enteric coating may still be required.
2 5 As the examples will show, by al)propl;ately choosing the member of the styelin genus, it is possible to adapt the antimicrobial activity to maximize its effectiveness with respect to a particular target microbe. As used herein, "microbe"
will be used to include not only yeast, bacteria, and other unicellular org~ni~m~ but also viruses. The particular styelin can also be chosen to be advantageous in a 3 0 particular context, such as low salt or physiological salt, the presence or human serum, or conditions that mimic the conditions found in blood and tissue fluids.

CA 02228730 l998-04-l4 The styelins may also be applied to plants or to their environment to prevent microbial-induced including viral diseases in these plants. Suitable compositions for this use will typically contain a diluent as well as a spreading agent or other ancillary agreements beneficial to the plant or to the environment.
Thus, the styelins may be used in any context wherein an antimicrobial action is required. This use may be an entirely in vitro use, or the peptides may be lministered to org~nisms.
In addition, the antimicrobial, including antiviral activity may be generated insitu by ~(lministering an expression system suitable for the production of the styelins.
Such expression systems can be supplied to plant and animal subjects using knowntechniques. For example, in ~nim~ls, pox-based ~xp~ession vectors can be used togenerate the peptides in situ. Similarly, plant cells can be transformed with expression vectors and then regenerated into whole plants which are capable of their own production of the peptides.
The following examples are intended to illustrate but not to limit the invention.

Example l 2 0 Preparation of Styelins from S. clava Tunicate hemocytes were obtained from live Styela clava (Marinus Biologicals, Long Beach CA) and processed as set forth in Lee, I.H., FEBS Lett (1997). Briefly, their stalks were transected and the hemolymph was collected dripwise into disodium ethylene~ minetetraacetic acid (EDTA). Approximately 2 x 2 5 108 hemocytes (l .96~0.62 x 108, mean + SEM, n=5) were obtained from 50 tunicates.
The collections were pooled, passed through a sterile 74 ~m mesh filter (CorningCostar, Cambridge, MA) and centrifuged at 260 x g for 5 min at 4~C. After the cells had been resuspended in 0.34 M sucrose and counted in a hemocytometer, they wererecentrifuged to remove the sucrose, resuspended in 40 ml of ice cold 5% acetic acid, 3 0 sonicated three times and stirred overnight at 4~C to extract them. The debris was removed by centrifugation at 27,000 x g for 30 min and the supernatant, which contained approximately 15 mg protein/50 tunicates (6.95 ~ 0.52 mg protein/108 hemocytes), was reserved for subsequent styelin purification.
After each step of the purification, 10% of each fraction was tested against Listeria monocytogenes by the two-stage radial diffusion assay of Lehrer, R.I. et al. J
Immunol Meth (1991) 137:167-173 to identify the fractions with antimicrobial activity. Briefly, ~2 x 105 CFU/ml midlogalillllllic phase bacteria were incorporated into a thin 1% agarose gel Co~ g 0.30 mg/ml of trypticase soy broth powder (BBL, Cockeysville, MD) and l O mM buffer (9 mM sodium phosphate + 1 mM
sodium citrate), pH6.5. A series of 3 mm diameter wells was punched into the agar to 1 0 permit the addition of the 5 111 peptide samples, which had been concentrated by vacuum centrifugation and dissolved in acidified water (0.01 % acetic acid). Three hours after the samples were added, a 10 ml nutrient-rich overlay gel (60 mg/ml trypticase soy broth powder, 10 mM buffer and 1% agarose) was poured to allow surviving org~ni~m~ to form visible microcolonies. After an overnight incubation, the diameters of the clear zones were measured to the nearest 0.1 mm and expressed in units (10 units = 1 mm).
The crude extracts of tunicate hemocytes were initially ultrafiltered through a 10 kDa exclusion size Amicon YM-10 membrane to remove larger molecules. When prepared from 2 x 108 hemocytes (50 ~nim~l~), such ultrafiltrates contained 2 0 approximately 3.5 mg of protein by BC'A analysis. After concentration to 2 ml by vacuum centrifugation (Speed Vac Concentrator, Savant Instruments, Hicksville, NY), the extract was subjected to acid-urea PAGE preparative electrophoresis. The eluates were collected in 2.5 ml fractions and concentrated by vacuum centrifugation.
Antibacterial fractions were pooled and purified by a reverse phase (RP)-2 5 HPLC 4.6 X 250 mm Vydac C 18 column (The Separations Group, Hesperia, CA), using a 1 %/min linear gradient of acetonitrile in 0.1 % trifluoroacetic acid. Active fractions were identified and further purified by applying shallower acetonitrile gradients in 0.13% heptafluorobutyric acid, as shown in Figures lA and lB. Sinceboth styelins A and B absorbed light at 280 nm, the elution could be followed using 3 0 this wavelength, as shown in the dotted line in Figure lB. The solid lines in Figures lA and lB represent absorbence at 220 nm.

The recovered styelins A and B were tested for antimicrobial activity against six bacterial pathogens which affect humans using rabbit alpha defensin NP- 1 as a control. The Lehrer highly sensitive two-stage radial diffusion assay was perforrned at pH6.5 with underlay gels that contain 0.1 M NaCl.
Styelins A and B killed three stains of Gram-negative bacteria, Escherichia coli, Salmonella typhimurium and Pseudomonas aeruginosa equally well, acting with a minim~l inhibitory concentration (MlC) of approximately 1-2 llg/ml, as indicated by the X-intercepts of the plots shown in Figures 2A-2C. Although NP-1 and styelinswere equally effective against P. aeruginosa (MIC = 2 mg/ml), NP-l was 1 0 considerably less active against E. coli ML-35 (MIC ~ 20 mg/ml) and it was inactive (MIC>200 llg/ml) against S. typhimurium 14028S. The generally adverse effects ofNaCl on the antimicrobial activity of NP-l and other defensins against Gram-negative bacteria has been described previously as was the resistance of S. typhimurium 14028S.
1 5 Figures 3A-3C show similar assays with Gram-positive bacteria. Styelins A
and B killed both Listeria monocytogenes and a vancomycin-resistant strain of Enterococcus faecium with an MIC of approximately 1 ~g/ml, and they killed S. aureus with an MIC of~ 3 ,ug/ml. Rabbit defensin NP-1 had comparable activityagainst L. monocytogenes (MIC<2 ~g/ml), but was less active against E. faecium 2 0 (MIC = 20 ,ug/ml) and inactive against S. aureus (MIC>200 ~g/ml) under these conditions. In contrast to their efficacy against bacteria, styelins A and B were less active against yeast-phase C. albicans (MIC ~ 36 ,ug/ml for both, data not shown).
Both styelins killed the Gram-negative bacillus Psychrobacter immobilis and the Gram-positive Planococcus citreus as shown in Figures 4A and 4B. These colony 2 5 counting assays were performed in medium that contained 0.3 M NaCl, 10 mM
sodium phosphate buffer (pH6.5) and 37 mg/ml of marine broth (Difco #2216, Detroit, MI).
The antibacterial activity of styelin A against L. monocytogenes and E. coli was not influenced by pH over the range of 5.5 to 7.4 (Figures 5A-5B) and its activity 3 0 against E. coli at pH7.4 was unaltered if the NaCl concentration of the underlay gels was varied from 0.0 to 0.4 M (Figure 5C). Similar results were obtained with styelin B (data not shown).

Example 2 Structures of Styelins A and B
Neither styelin A nor styelin B contains cysteine and both were especially rich 5in phenylalanine. Table 1 shows the amino acid composition of the peptides.

Table 1 Styelin A Styelin B
AminoAcid Moles (n) Moles (n) Cysteine n.f. (0) n.f. (0)-Aspartic Acid 3.7 (l ) 3.6 (1 ) Glutamic Acid 0.8 (0) 0.5 (0) Serine 10.4 (3/4)10.9 (3/4) Glycine 10.7 (3/4)10.9 (3/4) Histidine 6.5 (2) 6.5 (2) Arginine n.f. (0) Threonine 6.8 (2) 6.6 (2) Alanine 12.6 (4) 13.5 (4) Proline n.f. (0) n.f. (0)-Tyrosine n.f. (0) n.f. (0) Valine 3.6 (1 ) 3.9 (1 ) Methionine 0.6 (0) 1.3 (0) Isoleucine 3 3 (1 ) 3 4 (1 ) Leucine 9.8 (3) 10.5 (3) OH-Lysine 8.4 (3) 6.9 (2) Phenylalanine 22.3 (7) 21.1 (7) Tryptophan n.d. '0) n.d. (0) Lysine 0.4 ~) 04 (~) Unusual ormodified (2/3) (213) TOTAL 99.9 30/32100.0 23/31 In Table 1, the moles % data are based on recovery of known amino acids.
PTH-derivatized hydrolysates of styelins A and B also contained an unknown peak that emerged before PTH-histidine, plus 1 (styelin A) or 2 (styelin B) peaks that emerged before hydroxylysine. Consequently, styelins A and B also contain 2 or 3modified or unusual amino acid. The (n) column estimates the number of residues in each peptide. When two numbers are shown, either is possible: n.f., not found; n.d., not determined.

CA 02228730 l998-04-l4 Styelin A was shown to have a ~mass of 3,685.8 D and styelin B to have a mass of 3,700.6 D by MALDI-MS analysis.
Table 2 shows the results of sequence analysis of styelins A and B in comparison to certain other peptides. In Table 2, ~ represents hydroxylysine, and X
represents an unidentified residue. As shown, both peptides are compared to the sequence of m~g~inin 2; styelin A is also compared to Zinc Finger ZFl4 and styelin B
to the desiccation stress protein (DSP), a 25 kD precursor of an inducible protein in the hemolymph of the yellow mealworm.

Table 2 Peptide 5 10 15 20 Styelin A GXFG~ AFXSV SNFA~ ~H~TA
Magainin 2 G - IGK FLHSA KKFGK AFVGE
Styelin B GXFGP AFHSV SNFA~ ~H~TA
Styelin A GXFG~ AFX_V SNFA~ ~H~TA
Zinc Finger ZF14 - - - GK SFTNS SNLTK - HRT -Styelin B GXFGP AFHSV SNFA~ ~H~TA
Tenebrio"DSP" EQLDE CEEKV KNFAK KHKET
No unmodified tyrosines are shown in the amino acid analysis so that if tyrosines are present, they are likely to be methylated as in clavanins C and D or otherwise modified. Acid-labile tryptophan would not have been detected after acid hydrolysis in our analyses.
Example 3 Recovery of Styelin-Encoding cDNA
Total RNA from tunicate pharyngeal and hemocyte tissues was isolated and purified from freshly harvested Styela c lava using a total RNA separator kit 2 0 (Clontech, Palo Alto, CA). First strand cDNA synthesis and styelin 3' side cDNA
amplification were carried out with a 3'RACE kit (Gibco BRL, Gaithersburg, MD) using l ,ug of total pharyngeal RNA, and lO ,uM adapter primer to obtain the first strand of cDNA. A "guess primer" that corresponds to amino acids 3-7 of styelin A
(Phe-Gly-Lys-Ala-Phe) having the nucleotide sequence GTCGGAATTCTTTGGAAAAGCTTTT, was synthesized. The underline indicates its EcoRI restriction site.
PCR was performed in a total volume of 50 ~1 that contained: 1/10 vol. of first strand cDNA, 10 pmol each of guess primer and AUAP primer, and 5 U of pfu DNA polymerase. The reaction was run for 35 cycles in a GeneAmp PCR system 2400 (Perkin-Elmer, Palo Alto, CA), with 20 sec denaturation (94~C), 20 sec annealing (43~C), and 2 min extension (68~C) per cycle. PCR product about 320 bpin size was purified.
The 320 bp PCR product was used to screen a Styela clava pharyngeal cDNA
1 0 library constructed in ~ TripIExTM by Clontech Laboratories, using ~. coli strain XL 1 -Blue as a host. Phage DNA was transferred to nylon membrane filters (Dupont, Boston, MA), which was hybridized overnight at 48~C with the ~2P-labeled 320 bp PCR product in Rapid-hyb buffer (Amersham, Arlington Heights, IL). After severalwashes, finally at 60~C in O.lxSSC and 0.1% SDS, the filters were exposed to X-ray 1 5 films at -70~C with an intensifying screen. The positive clones were subjected to additional rounds of plaque screening at low density.
Positive phage plaques were picked to undergo PCR amplification, which was performed with LD-Insert Screening Amplimers (Clontech Lab, Palo Alto, CA) and Pfu DNA polymerase in a GeneAmp PCR system 2400. Amplified PCR products 2 0 were sequenced directly by the fluorescein-labeled dideoxynucleotide terminator method, and analyzed on an Applied Biosystem 373A DNA Sequencer (Perkin-Elmer, Palo Alto, CA) at the UCLA DNA Sequencing Facility.
Three clones were obtained that correspond to styelins C, D and E. The amino acid sequences deduced do not correspond exactly to either styelins A or B. All are 2 5 synthesized as pleplol)eptides. The signal sequences and pro pieces, which contain 22 residues, of styelins C, D and E are identical. The nucleotide sequences of styelins C, D and E are shown in Figure 6. Figure 7 shows a comparison of the signal sequences, mature peptide sequences, and the C-terminal extension of the styelin precursorsdeduced from the cDNA encoding styelins C, D and E.
3 0 As shown below, the amino acid sequences of styelins A, B, C and D arehighly homologous. As in Table 2, X signifies an unknown residue and ~ represents hydroxylysine. It is probable that the C-terminal glycine residue is removed to form an amide bond in the sequences shown for styelins C, D and E.

Table 3 Styelin A GXFG~ AFXSV SNFA~ ~H~TA .. (partial sequence) Styelin B GXFGP AFHSV SNFA~ ~H~TA .. (partial sequence) Styelin C GWLRK MKSV GKFW KHKYY IKMW KIGRH ALG
Styelin D GWFGK AFRSV SNFYK KHKTY IHAGL SMTL LG
Styelin E GWLRK MKSV GKFW KHKYY IKMW QIGKH ALG

For comparison, the sequences of styelins C, D and E are compared to those of insect cecropins set forth as Manduca B2, Sarcophaga IA, and Cecropin A in Table 4 and as compared to porcine cecropin designated Cecropin P1 in Table 4.

Table 4 Manduca B2 - W - - NPFKELERAGQ_VRDAVTSMPAVATVGQMMIAR
Sarcophaga IA GWL_KIGKKIE_VGQHT_DATIQGLGIAQQMNVMTARG
Cecropin A (Dr.v.) GWL_KIGKKIERIGQHT_DATIQGLGIAQQMNVMTARG
Styelin C (3b) GWL_KMKSVG_FYYK - KWIKMWKIGRH - - - - - - - ALG
Styelin D (6b) GWFGKAFRS_SNFYKK - KTYIHAGLS - - - - - - - - MTLLG
Styelin E (10b) GWLRKMKSVGKFWK~WIKMWQIGKH ------ -ALG
Cecropin P1 SWLSKTAKK_ENSAKKR ISEGIA - - - IAIQ - - - - - GGPR

It is further understood that the mature peptide contains a "postpiece" that is cleaved after translation. The postpiece portions of styelins C, D and E are shown in Table 5.

Table 5 Styelin C DMTDEEFQDFMKEVEQAREEELQSRQ

Styelin D DMTDEEFQEFMQDIEQAR~T~.T,T..~RQ

Styelin E DMTDEEFQDFMKEVEQAREEELQSRQ

. , . - .

- 24a -SEQUENCE LISTING

(1) GENERAL INFORMATION:
(i) APPLICANT: The Regents of the University of California (ii) TITLE OF INVENTION: STYELINS
(iii) NUMBER OF SEQUENCES: 20 (iv) CORRESPONDENCE ADDRESS:
(A) ADDRESSEE: Fetherstonhaugh & Co.
(B) STREET: Box 11560, Vancouver Centre 2200 - 650 West Georgia St.
(C) CITY: Vancouver (D) PROVINCE: B.C.
(E) COUNTRY: Canada (F) POSTAL CODE: V6B 4N8 (v) COMPUTER READABLE FORM:
(A) MEDIUM TYPE: Floppy disk (B) COMPUTER: IBM PC compatible (C) OPERATING SYSTEM: PC-DOS/MS-DOS
(D) SOFTWARE: PatentIn Release #1.0, Version #1.30 (vi) CURRENT APPLICATION DATA:
(A) APPLICATION NUMBER: CA 2,228,730 (B) FILING DATE: 14-APR-1998 (C) CLASSIFICATION:
(vii) PRIOR APPLICATION DATA:
(A) APPLICATION NUMBER: US 60/075,026 (B) FILING DATE: 18-FEB-1998 (vii) PRIOR APPLICATION DATA:
(A) APPLICATION NUMBER: US 60/072,855 (B) FILING DATE: 20-JAN-1998 (vii) PRIOR APPLICATION DATA:
(A) APPLICATION NUMBER: US 60/068,802 (B) FILING DATE: 24-DEC-1997 (viii) ATTORNEY/AGENT INFORMATION:
(A) NAME: Fetherstonhaugh & Co (C) REFERENCE/DOCKET NUMBER: 40478-99 CA 02228730 l999-03-24 - 24b -(ix) TELECOMMUNICATION INFORMATION:
(A) TELEPHONE: (604) 682-7295 (B) TELEFAX: (604) 682-0274 (2) INFORMATION FOR SEQ ID NO:1:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 20 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: peptide (ix) FEATURE:
(A) NAME/KEY: Modified-site (B) LOCATION: 5 (D) OTHER INFORMATION: /note= "Xaa = Hyl"
(ix) FEATURE:
(A) NAME/KEY: Modified-site (B) LOCATION: 15 (D) OTHER INFORMATION: /note= "Xaa = Hyl"
(ix) FEATURE:
(A) NAME/KEY: Modified-site (B) LOCATION: 16 (D) OTHER INFORMATION: /note= "Xaa = Hyl"
(ix) FEATURE:
(A) NAME/KEY: Modified-site (B) LOCATION: 18 (D) OTHER INFORMATION: /note= "Xaa = Hyl"
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:1:
Gly Xaa Phe Gly Xaa Ala Phe Xaa Ser Val Ser Asn Phe Ala Xaa Xaa His Xaa Thr Ala (2) INFORMATION FOR SEQ ID NO:2:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 19 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: single CA 02228730 l999-03-24 - 24c -(D) TOPOLOGY: linear (ii) MOLECULE TYPE: peptide (xi) SEQUENCE DESCRIPTION: SEQ ID NO:2:
Gly Ile Gly Lys Phe Leu His Ser Ala Lys Lys Phe Gly Lys Ala Phe Val Gly Glu (2) INFORMATION FOR SEQ ID NO:3:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 20 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: peptide (ix) FEATURE:
(A) NAME/KEY: Modified-site (B) LOCATION: 15 (D) OTHER INFORMATION: /note= "Xaa = Hyl"
(ix) FEATURE:
(A) NAME/KEY: Modified-site (B) LOCATION: 16 (D) OTHER INFORMATION: /note= "Xaa = Hyl"
(ix) FEATURE:
(A) NAME/KEY: Modified-site (B) LOCATION: 18 (D) OTHER INFORMATION: /note= "Xaa = Hyl"
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:3:
Gly Xaa Phe Gly Pro Ala Phe His Ser Val Ser Asn Phe Ala Xaa Xaa His Xaa Thr Ala (2) INFORMATION FOR SEQ ID NO:4:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 15 amino acids . . .. .... . ~ . .

CA 02228730 l999-03-24 - 24d -(B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: peptide (xi) SEQUENCE DESCRIPTION: SEQ ID NO:4:
Gly Lys Ser Phe Thr Asn Ser Ser Asn Leu Thr Lys His Arg Thr (2) INFORMATION FOR SEQ ID NO:5:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 20 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: peptide (xi) SEQUENCE DESCRIPTION: SEQ ID NO:5:
Glu Gln Leu Asp Glu Cys Glu Glu Lys Val Lys Asn Phe Ala Lys Lys His Lys Glu Thr (2) INFORMATION FOR SEQ ID NO:6:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 5 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: peptide (xi) SEQUENCE DESCRIPTION: SEQ ID NO:6:
Phe Gly Lys Ala Phe (2) INFORMATION FOR SEQ ID NO:7:
(i) SEQUENCE CHARACTERISTICS:

. .

CA 02228730 l999-03-24 - 24e -(A) LENGTH: 25 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:7:

(2) INFORMATION FOR SEQ ID NO:8:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 33 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: peptide (xi) SEQUENCE DESCRIPTION: SEQ ID NO:8:
Gly Trp Leu Arg Lys Ala Ala Lys Ser Val Gly Lys Phe Tyr Tyr Lys His Lys Tyr Tyr Ile Lys Ala Ala Trp Lys Ile Gly Arg His Ala Leu Gly (2) INFORMATION FOR SEQ ID NO:9:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 32 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: peptide (xi) SEQUENCE DESCRIPTION: SEQ ID NO:9:
Gly Trp Phe Gly Lys Ala Phe Arg Ser Val Ser Asn Phe Tyr Lys Lys His Lys Thr Tyr Ile His Ala Gly Leu Ser Ala Ala Thr Leu Leu Gly .. . . ,, . _ CA 02228730 l999-03-24 - 24f -(2) INFORMATION FOR SEQ ID NO:10:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 33 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: peptide (xi) SEQUENCE DESCRIPTION: SEQ ID NO:10:
Gly Trp Leu Arg Lys Ala Ala Lys Ser Val Gly Lys Phe Tyr Tyr Lys His Lys Tyr Tyr Ile Lys Ala Ala Trp Gln Ile Gly Lys His Ala Leu Gly (2) INFORMATION FOR SEQ ID NO:11:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 36 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: peptide (xi) SEQUENCE DESCRIPTION: SEQ ID NO:11:
Trp Asn Pro Phe Lys Glu Leu Glu Arg Ala Gly Gln Arg Val Arg Asp Ala Val Thr Ser Ala Ala Pro Ala Val Ala Thr Val Gly Gln Ala Ala Ala Ile Ala Arg (2) INFORMATION FOR SEQ ID NO:12:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 40 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: single CA 02228730 l999-03-24 - 24g -(D) TOPOLOGY: linear (ii) MOLECULE TYPE: peptide (xi) SEQUENCE DESCRIPTION: SEQ ID NO:12:
Gly Trp Leu Lys Lys Ile Gly Lys Lys Ile Glu Arg Val Gly Gln His l 5 10 15 Thr Arg Asp Ala Thr Ile Gln Gly Leu Gly Ile Ala Gln Gln Ala Ala Asn Val Ala Ala Thr Ala Arg Gly (2) INFORMATION FOR SEQ ID NO:13:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 40 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: peptide (xi) SEQUENCE DESCRIPTION: SEQ ID NO:13:
Gly Trp Leu Lys Lys Ile Gly Lys Lys Ile Glu Arg Ile Gly Gln His Thr Arg Asp Ala Thr Ile Gln Gly Leu Gly Ile Ala Gln Gln Ala Ala Asn Val Ala Ala Thr Ala Arg Gly (2) INFORMATION FOR SEQ ID NO:14:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 31 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: peptide (xi) SEQUENCE DESCRIPTION: SEQ ID NO:14:

CA 02228730 l999-03-24 - 24h -Ser Trp Leu Ser Lys Thr Ala Lys Lys Leu Glu Asn Ser Ala Lys Lys Arg Ile Ser Glu Gly Ile Ala Ile Ala Ile Gln Gly Gly Pro Arg (2) INFORMATION FOR SEQ ID NO:15:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 26 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: peptide (xi) SEQUENCE DESCRIPTION: SEQ ID NO:15:
Asp Met Thr Asp Glu Glu Phe Gln Asp Phe Met Lys Glu Val Glu Gln Ala Arg Glu Glu Glu Leu Gln Ser Arg Gln (2) INFORMATION FOR SEQ ID NO:16:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 26 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: peptide (xi) SEQUENCE DESCRIPTION: SEQ ID NO:16:
Asp Met Thr Asp Glu Glu Phe Gln Glu Phe Met Gln Asp Ile Glu Gln Ala Arg Glu Glu Glu Leu Leu Ser Arg Gln (2) INFORMATION FOR SEQ ID NO:17:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 397 base pairs (B) TYPE: nucleic acid CA 02228730 l999-03-24 - 24l -(C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: cDNA
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:17:

CAAACAACGA TCAAATGGAA TGGATATGAA ACGACATCGA TTAAAGAACA TTTT~lllll 360 (2) INFORMATION FOR SEQ ID NO:18:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 399 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: cDNA
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:18:

GACCAAACAA AGATCAAATG GACGGAAAAG GAAACGACAT CGATTTAAGA ATAT~ ll 360 TCATTGTAAA CGGAAATGCA TAAAATA~AA AGAGGCGCC 399 CA 02228730 l999-03-24 - 24j -(2) INFORMATION FOR SEQ ID NO:19:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 397 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: cDNA
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:19:

CAAACAACGA TCAAATGGAA TGGATATGAA ACGACATCGA TTAAAGAACA TTTT~lllll~ 360 (2) INFORMATION FOR SEQ ID NO:20:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 22 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: peptide (xi) SEQUENCE DESCRIPTION: SEQ ID NO:20:
Met Gln Met Lys Ala Thr Ile Leu Ile Val Leu Val Ala Leu Phe Met Ile Gln Gln Ser Glu Ala ~ ....~.

Claims (14)

Claims

1. An antimicrobial compound of the formula J1-X2-X3-B'4-B"5-J6-X'7-B8-J9-X10 J11-Z12-X13-J*14-B*15-B16-B18-O19-J*20 X21-B22-J23-J24-X'25-C26-X*27-J28-X29-Z30 and the pharmaceutically acceptable acetylated forms and salts amides and esters thereof wherein:
B represents a basic amino acid;
B' represents a basic or a small amino acid;
B" represents a basic amino acid or proline;
B* represents a basic amino acid or tyrosine, wherein said tyrosine optionally is alkylated;
X represents a hydrophobic amino acid;
X' represents a hydrophobic or a small amino acid;
Z represents a basic or a hydrophobic amino acid;
J represents a small amino acid;
J* represents a small amino acid or tyrosine which tyrosine is optionally methylated;
O represents an amino acid containing a hydroxyl group; and C represents any amino acid.

2. The compound of claim 1 wherein J1 is glycine; or X2 is tryptophan; or X3 is leucine or phenylalanine; or B'4 is glycine or arginine; or B"5 is proline, hydroxylysine, or glycine; or J6 is alanine; or X'7 is alanine or phenylalanine; or B8 is histidine, arginine or lysine; or J9 is serine; or X10 is valine; or J11 is serine or glycine; or Z12 is lysine or asparagine; or X13 is phenylalanine; or J*14 is alanine or tyrosine; or B*15 is lysine, hydroxylysine or tyrosine; or B16 is hydroxylysine or Iysine; or B17 is histidine; or B18 is hydroxylysine or lysine; or O19 is threonine or tyrosine; or J*20 is alanine or tyrosine; or X20 is isoleucine; or B22 is lysine or histidine; or J23 is alanine; or J24 is alanine or glycine; or X25 is tryptophan or leucine; or C26 is lysine or serine or glutamine; or X*27 is isoleucine or alanine; or J28 is alanine or glycine; or X29 is arginine, lysine or histidine; or Z30 is histidine or leucine.

3. The compound of claim 1 wherein J1 is glycine; and X2 is tryptophan; and X3 is leucine or phenylalanine; and B'4 is glycine or arginine; and B"5 is proline, hydroxylysine, or glycine; and J6 is alanine; and X'7 is alanine or phenylalanine; and B8 is histidine, arginine or lysine; and J9 is serine; and X10 is valine; and J11 is serine or glycine; and Z12 is lysine or asparagine; and X13 is phenylalanine; and J*14 is alanine or tyrosine; and B*15 is lysine, hydroxylysine or tyrosine; and B16 is hydroxylysine or lysine; and B17 is histidine; and B18 is hydroxylysine or lysine; and O19 is threonine or tyrosine; and J*20 is alanine or tyrosine; and X21 is isoleucine; and B22 is lysine or histidine; and J23 is alanine; and J24 is alanine or glycine; and X25 is tryptophan or leucine; and C26 is lysine or serine or glutamine; and X*27 is isoleucine or alanine; and J28 is alanine or glycine; and X29 is arginine, lysine or histidine; and Z30 is histidine or leucine.

4. The compound of claim 1 which further comprises the sequence ALG, LG, or ALG.

5. The compound of claim 1 which consists of gene-encoded amino acids or the posttranslational modified forms thereof.

6. A peptide in purified and isolated form, having antimicrobial activity, substantially homologous to the compound of formula (1), which is isolable from a tunicate.

7. A recombinant expression system for production of an antimicrobial peptide having the amino acid sequence of the compound of claim 5, or a precursor thereof, which expression system comprises a nucleotide sequence encoding said peptide or precursor operably linked to the control sequences for effecting expression.

8. The recombinant expression system of claim 7 wherein the nucleotide sequence encoding said peptide encodes a precursor peptide.

9. A recombinant host cell modified to contain the expression system of claim 7.

10. A method to produce an antimicrobial peptide which method comprises culturing the modified host cells of claim 9 under conditions wherein said peptide or a precursor of said peptide is produced.

11. A pharmaceutical composition for antimicrobial use which comprises the compound of claim 1 in admixture with at least one pharmaceutically acceptable excipient.

12. A composition for application to plants or plant environments for conferring resistance to fungal, bacterial or viral infection in plants which comprises the compound of claim 1 in admixture with at least one environmentally acceptable diluent.

13. A method to prevent the growth of a virus or bacterium or fungus which method comprises contacting a material which supports the growth of said virus or bacterium or fungus with an amount of the compound of claim 1 effective to prevent said growth, or with a composition containing the compound of claim 1 asactive ingredient.

14. Antibodies specifically immunoreactive with the compound of claim 1.