CA2222280A1 - Human chemokine beta-11 and human chemokine alpha-1 - Google Patents

Abstract

Human chemokine polypeptides and DNA (RNA) encoding such chemokine polypeptides and a procedure for producing such polypeptides by recombinant techniques is disclosed. Also disclosed are methods for utilizing such chemokine polypeptides for the treatment of leukemia, tumors, chronic infections, auto-immune disease, fibrotic disorders, wound healing and psoriasis. Antagonists against such chemokine polypeptides and their use as a therapeutic to treat rheumatoid arthritis, auto-immune and chronic and acute inflammatory and infective diseases, allergic reactions, prostaglandin-independent fever and bone marrow failure are also disclosed. Also disclosed are diagnostic assays for detecting diseases related to mutations in the nucleic acid sequences and altered concentrations of the polypeptides. Also disclosed are diagnostic assays for detecting mutations in the polynucleotides encoding the chemokine polypeptides and for detecting altered levels of the polypeptide in a host.

Description

W 0~16/39522 PCTnUS9C~

~uman Chemokine Beta-11 and ~uman Chemokine Alpha-1 This invention relates to newly identified polynucleotides, polypeptides encoded by such polynucleotides, the use of such polynucleotides and polypeptides, as well as the production of such polynucleotides and polypeptides. More particularly, the polypeptides of the present invention are human chemokine polypeptides, sometimes hereinafter referred to as human chemokine beta-11 (Ck~-11) and human chemokine alpha-1 (Ck~-1). The invention also relates to inhibiting the action of such polypeptides.
Chemokines, also referred to as intercrine cytokines, are a subfamily of structurally and functionally related cytokines. These molecules are 8-10 kd in size. In general, chPmnkines exhibit 20% to 75~ homology at the amino acid level and are characterized by four conserved cysteine residues that form two disulfide bonds. Based on the arrangement of the first t,wo cysteine residues, chemokines have been classified into two subfamilies, alpha and beta.
In the alpha subfamily, the first two cysteines are separated by one amino acid and hence are referred to as the "C-X-C"
subfamily. In the beta subfamily, the two cysteines are in an ad~acent position and are, therefore, referred to as the CA 02222280 1997-11-2~
W O 915/39522 PCT~US~6~'~5~/>

IIC-CII sub~amily. Thus far, at least eight dif~erent members of this family have been identified in hl~m~nR.
The intercrine cytokines exhibit a wide variety of functions. A hallmark feature is their ability to elicit chemotactic migration of distinct cell types, includiny monocytes, neutrophils, T lymphocytes, basophils and fibroblasts. Many ch~mnkines have proinflammatory activity and are involved in multiple steps during an inflammatory reaction. These activities include stimulation of histamine release, lysosomal enzyme and leukotriene release, increased adherence of target immune cells to endothelial cells, enhanced binding of complement proteins, induced expression of granulocyte adhesion molecules and complement receptors, and respiratory burst. In addition to their involvement in inflammation, certain chemokines have been shown to exhibit other activities. For example, macrophage inflammatory protein 1 (MIP-1) is able to suppress hematopoietic stem cell proliferation, platelet factor-4 (PF-4) is a potent inhibitor of endothelial cell growth, Interleukin-3 (IL-8) promotes proli~eration of keratinocytes, and GRO is an autocrine growth factor for melanoma cells.
In light of the diverse biological activities, it is not surprising that ch~mokines have been implicated in a number of physiological and disease conditions, including lymphocyte trafficking, wound healing, hematopoietic regulation and immunological disorders such as allergy, asthma and arthritis.
Members of the "C-C" branch exert their effects on the following cells: eosinophils which destroy parasites to lessen parasitic infection and cause chronic inflammation in the airways of the respiratory system; macrophages which suppress tumor formation in vertebrates; and basophils which release histamine which plays a role in allergic inflammation. However, members of one branch may exert an effect on cells which are- normally responsive to the other W 01~6~9522 PCT~US~

branch of rhPmokines and, therefore, no precise role can be attached to the members of the branches.
While members of the C-C branch act pre~om;n~ntly on mononllclear cells and members o$ the C-x-c branch act pre~o~in~ntly on neutrophils a distinct chemoattractant property cannot be assigned to a ~h~m~kine based on this guideline. Some chemokines from one family show characteristics of the other.
The polypeptides of the present invention have the conserved cysteine residues, namely Ck~-11 has "C-CII and Ck~-1 has "C-X-C" regions, and they have high amino acid sequence homology to known chemokines and have, therefore, been putatively characterized as human ch~mokines.
In accordance with one aspect of the present invention, there are provided novel polypeptides which are human Ck~-11 and Ck~-1 as well as biologically active and diagnostically or therapeutically useful fragments, analogs and derivatives thereof.
In accordance with another aspect of the present invention, there are provided isolated nucleic acid molecules encoding such polypeptides, including mRNAs, DNAs, cDNAs, genomic DNA as well as biologically active and diagnostically or therapeutically useful fragments, analogs and derivatives thereof.
In accordance with another aspect of the present invention there are provided nucleic acid probes comprising nucleic acid molecules of sufficient length to specifically hybridize to Ck~-11 and Ck~-1 sequences.
In accordance with yet a further aspect of the present invention, there is provided a process for producing such polypeptides by recombinant techniques which comprises culturing recombinant prokaryotic and/or eukaryotic host cells, containing a Ck~-11 or Ck~-1 nucleic acid sequence, under conditions promoting expression of said protein and subsequent recovery of said protein.

W 0~6~9522 PCTrUS9~ 3/~

In accordance with yet a further aspect of the present invention, there is provided a process for utilizing ~uch polypeptides, or polynucleotides encoding such polypeptides for therapeutic purposes, for example, to treat solid tumors, chronic infections, leukemia, T-cell mediated auto-immune di.seases, parasitic infections, psoriasis, asthma, allergy, to regulate hematopoiesis, to stimulate growth factor ac:tivity, to inhibit angiogenesis and to promote wound healing.
In accordance with yet a further aspect of the present invention, there are provided antibodies against such polypeptides.
In accordance with yet another aspect of the present invention, there are provided antagonists to such polypeptides, which may be used to inhibit the action of such polypeptides, for example, in the treatment of certain auto-immune diseases, atherosclerosis, chronic inflammatory and infectious diseases, histamine and IgE-mediated allergic reactions, prostagl~n~;n-independent fever, bone marrow failure, cancer~, silicosis, sarcoidosis, rheumatoid arthritis, shock, hyper-eosinophilic syndrome and fibrosis in the asthmatic lung.
In accordance with another aspect of the present invention there is provided a method of diagnosing a disease or a susceptibility to a disease related to a mutation in the Ck~-ll or Ck~-1 nucleic acid secluences and the protein encoded by such nucleic acid secluences.
In accordance with yet a further aspect of the present invention, there is provided a process for utilizing such polypeptides, or polynucleotides encoding such polypeptides, for in vitro purposes related to scientific research, synthesis of DNA and manufacture of DNA vectors.
These and other aspects of the present invention should be apparent to those skilled in the art from the teachings herein.

W 0'96/39522 PCTJU~ J~

The following drawings are illustrative of embo~;m~nts o~ the invention and are not meant to limit the ~cope o~ the i.nvention as enromp~ssed by the claims.
Figure 1 displays the cDNA sequence and corresponding deduced amino acid sequence of Ck~-11 The initial 17 amino acids represent the leader sequence such that the putative mature polypeptide comprises 81 amino acids. The st~n~d a,ne-letter abbreviations for amino acids are used.
Sequencing was performed using a 373 Automated DNA sequencer (Applied Biosystems, Inc.). Sequencing accuracy is predicted to be greater than 97% accurate.
Figure 2 displays the cDNA sequence and corresponding deduced amino acid sequence of Ck~-l. The initial 22 amino acids represent the leader sequence such that the putative mature polypeptide comprises 87 amino acids. The standard one-letter abbreviations for amino acids are used.
In accordance with an aspect of the present invention, there are provided isolated nucleic acids (polynucleotides) which encode for the mature polypeptides having the deduced almino acid sequences of Figures 1 (SEQ ID No. 2) and 2 (SEQ
ID No. 4) or for the mature polypeptides encoded by the cDNAs of the clones deposited as ATCC Deposit No. 75948 (Ck~
and 75947 (Ck~-1) on November 11, 1994.
Polynucleotides encoding Ck~-11 may be isolated ~rom mlmerous human adult and fetal cDNA libraries, for example, a human fetal spleen cDNA library. Ck~-11 is a member of the C-C branch of rhem~kines. It contains an open reading frame encoding a protein of 98 amino acid residues of which approximately the first 17 amino acids residues are the putative leader sequence such that the mature protein comprises 81 amino acids. The protein exhibits the highest degree of homology to the Rat, RANTES polypeptide with 31 identity and 47% similarity over a stretch of 89 amino acids.
It is also important that the four spatially conserved CA 02222280 1997-11-2~
W O 96~9522 PCT~US96/09572 cysteine residues in ~hPmnkines are founLd in the E~ Ypeptides.
Polynucleotides encoding Ck~-l may be isolated from numerous human adult and fetal cDNA libraries, for example, hLuman tonsils cDNA library. Ck~-1 is a member o~ the C-x-C
branch of chPmokines. It contains an open reading frame encoding a protein of 109 amino acid residues of which approximately the first 22 amino acids residues are the putative leader secruence such that the mature protein comprises 87 amino acids. The protein exhibits the highest degree of homology to interleukin-8 from Sheep (Ovis Aries) with 31% identity and 80% similarity over a stretch of 97 amino acids. It is also important that the four spatially conserved cysteine residues in rhPmokines are found in the polypeptides.
The polynucleotides of the present invention may be in the form of RNA or in the form of DNA, which DNA includes c~DNA, genomic DNA, and synthetic DNA. The DNA may be double-stranded or single-stranded, and if single stranded may be the coding strand or non-coding (anti-sense) strand. The coding sequence which encodes the mature polypeptides may be identical to the coding sequences shown in Figures 1 (SEQ ID
No. 1) and 2 (SEQ ID No. 3) or that of the deposited clones or may be a different coding sequence which coding sec~uence, as a result of the rP~lln~ncy or degeneracy of the genetic code, encodes the same mature polypeptides as the DNA of Figures 1 (SEQ ID No. 1) and 2 (SEQ ID No. 3) or the d~posited cDNAs.
The polynucleotides which encode for the mature polypeptides of Figures 1 (SEQ ID No. 2) and 2 (SEQ ID No. 4) OI' for the mLature polypeptides encoded by the deposited cDNAs maLy include: only the coding sequence for the mature polypeptide; the coding sec~uence for the mature polypeptide and additional coding ~equence such as a leader or secretory se!c~uence or a proprotein ~equence; the coding secluence for W O 96/39522 . PcTsu~GJ~53l~

t]~e mature polypeptide (and optionally additional codiny sequence) and non-coding sequence, such as introns or non-coding sequence 5' and/or 3' of the coding sequence for the ~ture polypeptides.
Thus, the term l~polynucleotide encoding a polypeptide~
encompasses a polynucleotide which includes only coding sequence ~or the polypeptide as well as a polynucleotide w]~ich includes additional coding and/or non-coding ~equence.
The present invention further relates to variants of the hereinabove described polynucleotides which encode for fragments, analogs and derivatives of the polypeptide having the deduced amino acid sequences of Figures 1 (SEQ ID No. 2) and 2 (SEQ ID No. 4) or the polypeptides encoded by the cDNAs o~ the deposited clones. The variant of the polynucleotides ~ly be a naturally occurring allelic variant of the polynucleotides or a non-naturally occurring variant of the polynucleotides.
Thus, the present invention includes polynucleotides encoding the same mature polypeptides as shown in Figures 1 (',EQ ID No. 2) and 2 (SEQ ID No. 4) or the same mature polypeptides encoded by the cDNA of the deposited clones as well as variants of such polynucleotides which variants encode for a fragment, derivative or analog of the polypeptides of Figures 1 (SEQ ID No. 2) and 2 (SEQ ID No. 4) or the polypeptides encoded by the cDNA of the deposited clones. Such nucleotide variants include deletion variants, substitution variants and addition or insertion variants.
As hereinabove indicated, the polynucleotides may have a coding sequence which is a naturally occurring allelic variant of the coding sequences shown in Figures 1 (SEQ ID
Nc~. 1) and 2 (SEQ ID No. 3) or of the coding se~uence of the deposited clones. As known in the art, an allelic variant is an alternate form of a polynucleotide sequence which may have a substitution, deletion or addition of one or more -CA 02222280 1997-11-2~
W 0~6~9522 PCT~US96/09572 nucleotides, which does not substantially alter the function of the e~coded polypeptide.
The present invention also includes polynucleotides, wherein the coding sequence for the mature polypeptides may be fused in the same reading frame to a polynucleotide sequence which aids in expression and secretion of a p~lypeptide from a host cell, for example, a leader sequence which functions as a secretory sequence for controlling transport of a polypeptide from the cell. The polypeptide having a leader sequence is a preprotein and may have the leader sequence cleaved by the host cell to form the mature form of the polypeptide. The polynucleotides may also encode for a proprotein which is the mature protein plus additional 5' amino acid residues. A mature protein having a p~osequence is a proprotein and is an inactive form of the p~otein. Once the prosequence is cleaved an active mature protein r~mA; n~ .
Thus, for example, the polynucleotides of the present invention may encode for a maLture protein, or for a protein having a prosequence or for a protein having both a prosequence and a presequence (leader sequence).
The polynucleotides of the present invention may also have the coding sequence fused in frame to a marker sequence which allows for purification of the polypeptides of the present invention. The marker sequence may be a hexa-histidine tag supplied by a pQE-9 vector to provide for purification of the mature polypeptides fused to the marker in the case of a bacterial host, or, for example, the marker sequence may be a hemagglutinin (HA) tag when a mAmmAlian hcst, e.g. COS-7 cells, is used. The HA tag corresponds to an epitope derived from the influenza hemagglutinin protein (Wilson, I., et al., Cell, 37:767 (1984)).
The term "gene" means the segment of DNA involved in producing a polypeptide chain; it includes regions preceding and following the coding r~gion (leader and trailer) as well CA 02222280 1997-11-2~
wos6~ss22 PCT~S96J09572 as intervening seguences (introns) between individual coding ~;egments (exons).
Fragments of the full length gene of the present invention may be used as a hybridization probe ~or a cDNA
library to isolate the full length cDNA and to isolate other cDNAs which have a high sequence s;mi 1 ~rity to the gene or ~imilar biological activity. Probes of this type pre~erably hlave at least 30 bases and may contain, for example, 50 or ore bases. The probe may also be used to identify a cDNA
clone corresponding to a full length transcript and a genomic clone or clones that contain the complete gene including regulatory and promotor regions, exons, and introns. An example of a screen comprises isolating the coding region of the gene by using the known DNA sequence to synthesize an oligonucleotide probe. Labeled oligonucleotides having a sequence complementary to that of the gene of the present invention are used to screen a library of human cDNA, genomic D~NA or mRNA to determine which members of the library the probe hybridizes to.
The present invention further relates to polynucleotides which hybridize to the hereinabove-described sequences if there is at least 70~, preferably at least 90%, and more preferably at least 95~ identity between the sequences. The present invention particularly relates to polynucleotides which hybridize under stringent conditions to the hereinabove-described polynucleotides. As herein used, the term "stringent conditions" means hybridization will occur only if there is at least 95~ and preferably at least 9,7~ identity between the sequences. The polynucleotides which hybridize to the her~;n~hove described polynucleotides in a preferred embodiment encode polypeptides which either retain substantially the same biological function or activity as the mature polypeptide encoded by the cDNAs of Figure 1 (SEQ ID NO:1) or the deposited cDNA(s).

W 0~6~9522 . PCTAUS~G~'u5~/~

Alternatively, the polynucleotide may have at least 20 h,ases, preferably at least 30 bases, and more preferably at least 50 bases which hybridize to a polynucleotide of the present invention and which has an identity thereto, as her~;n~hove described, and which may or may not retain activity. For example, such polynucleotides may be employed as probes for the polynucleotide of SEQ ID NO:1, for example, for recovery of the polynucleotide or as a diagnostic probe or as a PCR primer.
Thus, the present invention is directed to polynucleotides having at least a 70% identity, preferably at least 90~ and more preferably at least a 95~ identity to a polynucleotide which encodes the polypeptide of SEQ ID NO:2 as well as fragments thereof, which fragments have at least 3D bases and preferably at least 50 bases and to polypeptides encoded by such polynucleotides.The deposit(s) referred to herein will be maint~ne~ under the terms of the Budapest T:reaty on the International Recognition of the Deposit of M:icro-organisms for purposes of Patent Procedure. These deposits are provided merely as convenience to those of skill in the art and are not an admission that a deposit is required under 35 U.S.C. 112. The sequence of the polynucleotides contA;n~ in the deposited materials, as well as the amino acid sequence of the polypeptides encoded thereby, are incorporated herein by reference and are controlling in the event of any conflict with any description ol sequences herein. A license may be required to make, use or sell the deposited materials, and no such license is hereby granted.
The present invention further relates to polypeptides which have the deduced amino acid sequences of Figures 1 (SEQ
Ir) No. 2 ) and 2 (SEQ ID No. 4), or which have the amino acid sequence encoded by the deposited cDNA, as well as fragment~, a~lalogs and derivatives of such polypeptides.

-W O 96~9522 . PCTJU'~ f~33s~

The terms ~$ragment," "derivative" and ~analog~ when referring to the polypeptides of Figures 1 (SEQ ID No. 2) and 2 (S~Q ID No. 4) or that encoded by the deposited cDNA, means polypeptides which retain essentially the same biological function or activity as such polypeptides. Thus, an analog includes a proprotein which can be activated by cleavage of the proprotein portion to produce an active mature plolypeptide .
The polypeptides of the present invention may be recombinant polypeptides, natural polypepti~es or synthetic polypeptides, preferably reComh;n~nt polypeptides.
The fragment, derivative or analog of the polypep~ides of Figures 1 ( SBQ ID No. 2) and 2 (SEQ ID No. 4) or that encoded by the deposited cDNAs may be (i) one in which one or more of the amino acid residues are substituted with a conserved or non-conserved amino acid residue (preferably a conserved amino acid residue) and such substituted amino acid residue may or may not be one encoded by the genetic code, or (ii) one in which one or more of the amino acid residues includes a substituent group, or (iii) one in which the mature polypeptide is fused with another compound, such as a compound to increase the half-life of the polypeptide (for example, polyethylene glycol), or (iv) one in which the additional amino acids are fused to the mature polypeptide, such as a leader or secretory sequence or a sequence which is elmployed for purification of the mature polypeptide or a proprotein sequence. Such fragments, derivatives and analogs are deemed to be within the scope of those skilled in the art from the teachings herein.
The polypeptides and polynucleotides of the present illvention are preferably provided in an isolated form, and preferably are purified to ho~ yelleity.
The term "isolated" means that the material is removed from its original enviLol~..ellt (e.g., the natural environment ii-- it is naturally occurring). For example, a naturally-W 0 96~9522 CA 02222280 1997-11-2~ PCTrUSg~5~/~

occurring polynucleotide or polypeptide present in a living an:imal is not isolated, but the same polynucleotide or poLypeptide, separated from some or all of the coexisting mat:erials in the natural system, is isolated. Such polynucleotides could be part of a vector and/or such polynucleotides or polypeptides could be part of a composition, and still be isolated in that such vector or composition is not part of its natural environment.
The polypeptides of the present invention include the polypeptide of SEQ ID NO:2 ( in particular the mature polypeptide) as well as polypeptides which have at least 70~
similarity (preferably at least 70~ identity) to the polypeptide of SEQ ID NO:2 and more preferably at least 90 similarity (more preferably at least 90~ identity) to the polypeptide of SEQ ID NO:2 and still more preferably at least 95~ similarity (still more preferably at least 95~ identity) to the polypeptide of SEQ ID NO:2 and also include portions of such polypeptides with such portion of the polypeptide generally containing at least 30 amino acids and more preierably at least 50 amino acids.
As known in the art "similarity" between two polypeptides is determined by comparing the amino acid se~lence and its conserved amino acid substitutes of one polypeptide to the sequence of a second polypeptide.
Fragments or portions of the polypeptides of the present invention may be employed for producing the corresponding full-length polypeptide by peptide synthesis; therefore, the fragments may be employed as intermediates for producing the full-length polypeptides. Fragments or portions of the polynucleotides of the present invention may be used to synthesize full-length polynucleotides of the present invention.
The present invention also relates to vectors which include polynucleotides of the present invention, host cells which are genetically engineered with vectors of the CA 02222280 1997-11-2~
WOS~6~9S22 PCT~S96/095~2 invention and the production o~ polypeptide~ of the invention by recombinant techniques.
Host cells are genetically engineered (transduced or transformed or transfected) with the vectors of this invention which may be, for example, a cloning vector or an expression vector. The vector may be, for example, in the form of a plasmid, a viral particle, a phage, etc. The engineered host cells can be cultured in conventional nutrient media modified as appropriate for activating promoters, selecting transformants or amplifying the Ck~
or Ck~-1 genes. The culture conditions, such as temperature, pH and the like, are those previously used with the host cell selected for expression, and will be apparent to the ordinarily skilled artisan.
The polynucleotides of the present invention may be e~ployed for producing polypeptides by recombinant tlechniques. Thus, for example, the polynucleotide may be included in any one of a variety of expression vectors for expressing a polypeptide. Such vectors include chromosomal, nonchromosomal and synthetic DNA sequences, e.g., derivatives of SV40; bacterial plasmids; phage DNA;
baculovirus; yeast plasmids; vectors derived from combinations of plasmids and phage DNA, viral DNA such as vaccinia, adenovirus, fowl pox virus, and pseudorabies.
However, any other vector may be used as long as it is replicable and viable in the host.
The appropriate DNA sequence may be inserted into the v/_ctor by a variety of procedures. In general, the DNA
sequence is inserted into an appropriate restriction Pn~onllClease site(s) by procedures known in the art. Such procedures and others are deemed to be within the scope of those skilled in the art.
The DNA sequence in the expression vector is operatively l:inked to an appropriate expression control sequence(s) (promoter) to direct mR~A synthesis. As representative ~ CA 02222280 1997-11-2~
.~6~9522 PCT/U~G~ 72 examples of such promoters, there may be mentioned: LTR or SV40 promoter, the E. coli. lac or,trp, the phage lambda PL
promoter and other promoters known to control expression of genes in prokaryoti_ or eukaryotic cells or their viruses The expression vector also contains a ribosome binding site for translation initiation and a transcripticn terminator.
The vector may also include appropriate sequences for al~plifying expression. t In addition, the expression vectors preferably contain one or more selectable marker genes to provide a phenotypic t:rait for selection of transformed host cells such as d:ihydrofolate reductase or neomycin resistance for eukaryotic cell culture, or such as tetracycline or ampicillin resistance in E. coli.
The vector containing the appropriate DNA sequence as hereinabove described, as well as an appropriate promoter or control sequence, may be employed to transform an appropriate host to permit the host to express the protein.
As representative examples of appropriate hosts, there m~ly be mentioned: bacterial cells, such as E. coli, st.rePtomyces~ S~lm~n~lla tYPhimUriUm; fungal cells, such as yeast; insect cells such as Drosophila S2 and Spodoptera Sf9;
~mimAl cells such as CH0, COS or Bowes melanoma;
ad.enoviruses; plant cells, etc. The selection of an appropriate host is deemed to be within the scope of those skilled in the art from the teachings herein.
More particularly, the present invention also includes recomhinAnt constructs comprising one or more of the sequences as broadly described above. The constructs comprise a vector, such as a plasmid or viral vector, into which a sequence of the invention has been inserted, in a forward or reverse orientation. In a preferred aspect of this embodiment, the construct further comprises regulatory se,~uences, including, for example, a promoter, operably lilnked to the sequence. Large numbers of suitable vectors W 0 96/39522 PCT/U~3~a~5)~

and promoters are known to those of 5kill in the art, and are ,-ommercially available. The fo;lowing vectors are provided by way of example. Bacterial: pQE70, pQE60, pQE-9 (Qiagen), pBS, pD10, phagescript, psiX174, pBluescript SK, pBSKS, pNH8A, pNH16a, pNH18A, pNH46A (Stratagene); pTRC99a, pKK223-3, pKK233-3, pDR540, pRIT5 (Pharmacia). Eukaryotic: pWLNEO, pSV2CAT, pOG44, pXT1, pSG (Stratagene) pSVK3, pBP~, pMSG, pSVL (Pharmacia). However, any other plasmid or vector may be used as long as they are replicable and viable in the t.
Promoter regions can be selected from any desired gene using CAT (chlor~mrh~nicol transfera8e) vectors or other vectors with selectable markers. Two appropriate vectors are pKK232-8 and pCM7. Particular named bacterial promoters include lacI, lacZ, T3, T7, gpt, l~mh~l~ PR~ PL and trp.
Eukaryotic promoters include CMV imm~ te early, HSV
t:hymidine kinase, early and late SV40, LTRs from retrovirus, and mouse metallothionein-I. Selection of the appropriate vector and promoter is well within the level of ordinary skill in the art.
In a further embo~i m~nt, the present invention relates to host cells containing the above-described constructs. The host cell can be a higher eukaryotic cell, such as a m~ ian cell, or a lower eukaryotic cell, ~;uch as a yeast cell, or the host cell can be a prokaryotic cell, such as a bacterial cell. Introduction of the construct into the host cell can be effected by calcium phosphate transfection, DEAE-Dextran mediated transfection, or electroporation (Davis, L., Dibner, M., Battey, I., Basic Methods in Molecular Biology, (1986)).
The constructs in host cells can be used in a conventional m~nnP~ to produce the gene products encoded by the recombinant sequences. Alternatively, the polypeptides of the invention can be synthetically produced by conventional peptide synthesizers.

W 0~6~9522 PCT~US9~/05~/~

Mature proteins can be expressed in m~mm~lian cells, yeast, bacteria, or other cells under the control of aLppropriate promoters. Cell-free translation systems can also be employed to produce such proteins using RNAs derived from the DNA constructs of the present invention.
Appropriate cloning and expression vector8 for use with prokaryotic and eukaryotic hosts are described by Sambrook, et al., Molecular Cloning: A Laboratory ~nllAl, Second Edition, Cold Spring Harbor, N.Y., (1989), the disclosure of which is hereby incorporated by reference.
Transcription of the DNA encoding the polypeptides of the present invention by higher eukaryotes is increased by inserting an enhancer sequence into the vector. ~nhAn~erS
are cis-acting elP~Ants of DNA, usually about from 10 to 300 b]D that act on a promoter to increase its transcription.
Examples include the SV40 Pnh~ncer on the late side of the replication origin bp 100 to 270, a cytomegalovirus early promoter ~nh~ncer~ the polyoma Pnh~ncer on the late side of the replication origin, and adenovirus Pnh~ncers.
Generally, recomh;n~nt expression vectors will include origins of replication and selectable markers permitting tr.ansformation of the host cell, e.g., the ampicillin resistance gene of E. coli and S. cerevisiae TRP1 gene, and a promoter derived from a highly-expressed gene to direct transcription of a downstream structural sequence. Such promoters can be derived from operons encoding glycolytic enzymes such as 3-phosphoglycerate kinase (PGK), ~-factor, acid phosphatase, or heat shock proteins, among others. The he!terologous structural secluence is assembled in appropriate phase with translation initiation and termination sequences, and preferably, a leader sequence capable of directing secretion of translated protein,into the periplasmic space or extracellular medium. Optionally, the heterologous sequence can encode a fusion protein including an N-terminal identification peptide imparting desired characteristics, CA 02222280 1997-11-2~
WO 96/39522 PC~JUS96109572 e.g., stabilization or simpli~ied puri~ication o~ expressed recombinant product.
Useful expression vectors for bacterial use are c:onstructed by inserting a structural DNA se~;{uence encoding a desired protein together with ~uitable tran~lation initiation and termination ~ignal~ in operable reading pha~e with a ~unctional promoter. The vector will comprise one or more phenotypic selectable markers and an origin of replication to en~ure maintenance of the vector and to, if de~irable, provide ampli~ication within the host. Suitable prokaryotic ho~t~ for tran~formation include E. coli, ~acillus ~ubtilis, Salmonella tY~~;mllrium and various ~pecies within the genera Psell~m~n~, Streptomyces, and Staphylococcus, although others may also be employed a~ a atter of choice.
AS a representative but nonlimiting example, usef~ul expre~~ion vector~ for bacterial u~e can comprise a s;electable marker and bacterial origin of replication derived from commercially available plasmids comprising genetic elements of the well known cloning vector pBR322 (ATCC
37017). Such cs~Prcial vector~ include, for example, p~KK223-3 (Pharmacia Fine Chemicals, Upp~ala, Sweden) and pGEM1 (Promega Biotec, Madi~on, WI, USA). These pBR322 "backbone" section~ are combined with an a~ro~riate promoter and the structural sequence to be expres~ed.
Following transformation of a ~uitable ho~t ~train and growth of the host strain to an appropriate cell den~ity, the selected promoter is induced by appropriate means (e.g., temperature shift or chemical induction) and cells are cultured for an additional period.
Cells are typically harvested by centrifugation, disrupted by phy~ical or chemical mean~, and the resulting crude extract ret~;ne~ for further purification.
Microbial cell~ employed in expre~~ion of proteins can be disrupted by any convenaent method, including freeze-thaw WO '~6/39S22 PCr/lJS9~v3~1~

cycling, sonication, mechanical disruption, or use of cell lysing agents, such methods are well know to those skilled in the art.
Various ~ lian cell culture systems can also be elnployed to express recombinant protein. Examples of m:~mm~ n expression systems include the COS-7 lines of monkey kidney fibroblasts, described by Gluzman, Cell, 23:175 (:L981), and other cell lines capable of expressing a compatible vector, for example, the C127, 3T3, CH0, HeLa and BlIK cell lines. ~mm~l ian expression vectors will comprise an origin of replication, a suitable promoter and enhancer, and also any necessary ribosome binding sites, polyadenylation site, splice donor and acceptor sites, transcriptional termination sequences, and 5' flanking nontranscribed sequences. DNA sequences derived from the SV40 splice, and polyadenylation sites may be used to provide the required nontranscribed genetic elements.
The polypeptides can be recovered and purified from recombinant cell cultures by methods including ~mmo~; um sulfate or ethanol precipitation, acid extraction, anion or cation exchange chromatography, phosphocellulose chLromatography, hydrophobic interaction chromatography, affinity chromatography, hydroxylapatite chromatography and lectin chromatography. Protein refolding steps can be used, as necessary, in completing configuration of the mature protein. Finally, high performance liquid chromatography (HPLC) can be employed for final purification steps.
The polypeptides of the present invention may be a naturally purified product, or a product of chemical synthetic procedures, or produced by recombinant techniques from a prokaryotic or eukaryotic host (for example, by bacterial, yeast, higher plant" insect and m~ l ian cells in culture). Depending upon the host employed in a recombinant production procedure, the polypeptides of the present invention may be glycosylated or may be non-glycosylated.

CA 02222280 1997-11-2~
W O 96~9522 P ~ ~US96109572 Plolypeptides of the invention may also include an initial methionine amino acid residue.
The polynucleotides and polypeptides of the present invention may be employed as research reagents and materials for discovery of treatments and diagnostics to human disease.
The human ch~mokine polypeptides may be employed to ; nh; h; t bone marrow stem cell colony fonmation as adjunct protective treatment during cAnc~r chemotherapy and for leukemia.
The human chem~k;ne polypeptides may al80 be employed to ~nh;h;t epidermal keratinocyte proliferation for treatment of psoriasis, which is characterized by keratinocyte hyper-proliferation.
The human ~h~mokine polypeptides may also be employed to treat solid tumors by stimulating the invasion and activation of host defense cells, e.g., cytotoxic T cells and macrophages and by inhibiting the angiogenesis of tumors.
They may also be employed to ~nhAnce host defenses against resistant chronic and acute infections, for example, mycobacterial infections via the attraction and activation of microbicidal leukocytes.
The human ch~mokine polypeptides may also be employed to ;nh;h;t T cell proliferation by the inhibition of IL-2 biosynthesis for the treatment of T-cell mediated auto-;mmllne diseases and lymphocytic leuk~m; A~, Ck~-11 and Ck~-1 may also be employed to stimulate wound healing, both via the recruitment of debris clearing and connective tissue promoting inflammatory cells and also via its control of excessive TGF~-mediated fibrosis. In this s,ame m~nner~ Ck~-ll and Ck~-1 may also be employed to treat other fibrotic disorders, including liver cirrhosis, o;steoarthritis and pnlm~nAry fibrosis.
The human ch~mokine polypeptides also increase the presence of eosinophils which have the distinctive function WO 96/39522 CA 0 2 2 2 2 2 8 0 19 9 7 - 1 1 - 2 ~ PCT/US96/09572 of killing the larvae of parasites that invade tissues, as in ~;chistosomiasis, trichinosis and ascariasis.
They may also be employed to regulate hematopoiesis, by regulating the activation and differentiation of various hematopoietic progenitor cells, for example, to release mature leukocytes from the bone marrow following chemotherapy.
The polynucleotides and polypeptides encoded by such Elolynucleotides may also be utilized for in vitro purposes related to scientific research, synthesis of DNA and manufacture of DNA vectors and for designing therapeutics and diagnostics for the treatment of human disease.
Fragments of the full length Ck~-11 or Ck~-1 genes may be used as a hybridization probe for a cDNA library to isolate the full length gene and to isolate other genes which have a high sequence similarity to the gene or similar biological activity. Probes of this type generally have at l,east 20 base~. Preferably, however, the probes have at least bases and generally do not exceed 50 bases, although t]hey may have a greater number of bases. The probe may al80 be used to identify a cDNA clone corresponding to a full length transcript and a genomic clone or clones that contain t~le complete genes including regulatory and promotor regions, e~cons, and introns. An example of a screen comprises i~;olating the coding region of the genes by using the known D~A sequence to synthesize an oligonucleotide probe. Labeled o].igonucleotides having a sequence complementary to that of the genes of the present invention are used to screen a li.brary of human cDNA, genomic DNA or m~NA to determine which members of the library the probe hybridizes to.
This invention is al~o related to the use of the Ck~
or Ck~-1 gene as part of a diagnostic assay for detecting diseases or susceptibility to diseases related to the presence of mutations in the Ck~-11 or Ck~-1 nucleic acid sequences. Such diseases are related to under-expression of W0'~6~9522 PC~S9GI~5~l) the human ch~m~kine polypeptides, for example, tumors and cancers.
Individuals carrying mutations in the Ck~-11 or Ck~-l gene may be detected at the DNA level by a variety of techniques. Nucleic acids for diagnosis may be obtained from a patient's cells, such as from blood, urine, saliva, tissue biopsy and autopsy material. The genomic DNA may be used directly for detection or may be amplified enzymatically by using PCR (Saiki et al., Nature, 324:163-166 (1986)) prior to analysis. RNA or cDNA may also be used for the same purpose.
As an example, PCR primers complementary to the nucleic acid encoding Ck~-11 or Ck~-l can be used to identify and analyze Ck~-11 or Ck~-1 mutations. For example, deletions and insertions can be detected by a change in size of the al~plified product in comparison to the normal genotype.
Point mutations can be identified by hybridizing amplified D]NA to radiolabeled Ck~-11 or Ck~-1 RNA or alternatively, radiolabeled Ck~-ll or Ck~-1 antisense DNA sequences.
Perfectly matched sequences can be distinguished from mismatched duplexes by RNase A digestion or by differences in melting temperatures.
Genetic testing based on DNA sequence differences may be achieved by detection of alteration in electrophoretic mobility of DNA fragments in gels with or without denaturing agents. Small sequence deletions and insertions can be v:isualized by high resolution gel electrophoresis. DNA
fragments of different sequences may be distinguished on denaturing formamide gradient gels in which the mobilities of d:ifferent DNA fragments are retarded in the gel at different positions according to their specific melting or partial melting temperatures (see, e.g., Myers et al., Science, 2:30:1242 (1985)).
Sequence changes at specific locations may also be revealed by nuclease protection assays, such as RNase and Sl WO !~6/39S22 CA O 2 2 2 2 2 8 0 19 9 7 - 1 1 - 2 ~ PCT/U5!)6/~5 / ?

protection or the chemical cleavage method (e.g., Cotton et al., PNAS, USA, 85:4397-4401 (1985)~.
Thus, the detection of a specific DNA sequence may be achieved by methods such as hybridization, RNase protection, chemical cleavage, direct DNA secluencing or the use of restriction enzymes, (e.g., Restriction Fragment Length Polymorphisms (RFLP)) and Southern blotting of genomic DNA.
In addition to more conventional gel-electrophoresis and DNA sequencing, mutations can also be detected by in situ analysis.
The present invention also relates to a diagnostic assay for detecting altered levels of Ck~-ll or Cka-1 protein in various tissues since an over-expression of the proteins c~mpared to normal control tissue samples may detect the presence of a disease or susceptibility to a disease, for example, a tumor. Assays used to detect levels of Ck~-11 or Cka-1 protein in a sample derived from a host are well-known to those of skill in the art and include radioimml~noassays, competitive-binding assays, Western Blot analysis, ELISA
assays and "sandwich" assay. An ELISA assay (Coligan, et a:L., Current Protocols in Tmmllnology, 1(2), Chapter 6, (:L991)) initially comprises preparing an antibody specific to the Ck~-11 or Cka-l antigen, preferably a monoclonal antibody. In addition a reporter antibody is prepared against the monoclonal antibody. To the reporter antibody is at:tached a detectable reagent such as radioactivity, f].uorescence or, in this example, a horseradish peroxidase enzyme. A sample is removed from a host and incubated on a solid support, e.g. a polystyrene dish, that binds the proteins in the sample. Any free protein ~;n~ing sites on the dish are then covered by incubating with a non-specific protein like BSA. Next, the monoclonal antibody is incubated in the dish during which time the monoclonal antibodies attach to any Ck~-ll or Ck~-1 proteins attached to the polystyrene dish. All un~ound monoclonal antibody is washed W09,6/39522 PCT~S~6/09~7~

out with buffer. The reporter antibody linked to horseradish p~eroxidase is now placed in the dish resulting in binding of the reporter antibody to any monoclonal antibody bound to Ck~-11 or Ck~-1. Unattached reporter antibody is then washed out. Peroxidase substrates are then added to the dish and the amount o~ color developed in a given time period is a measurement of the amount of Ck~-11 or Ck~-l protein present v in a given volume of patient sample when comr~red against a st~n~A~d curve.
A competition assay may be employed wherein antibodies specific to Ck~-11 or Ck~-1 are attached to a solid support and labeled Ck~-11 or Ck~-1 and a sample derived from the host are passed over the solid support and the amount of l,abel detected, for example by liquid scintillation chromatography, can be correlated to a quantity of Ck~-ll or Ck~-1 in the sample.
A "sandwich" assay is similar to an ELISA assay. In a ~;andwich~ assay Ck~-11 or Ck~-l is passed over a solid sllpport and binds to antibody attached to a solid support.
A second antibody is then bound to the Ck~-11 or Ck~-1. A
third antibody which is labeled and specific to the second antibody is then passed over the solid support and binds to the second antibody and an amount can then be quantified.
This invention provides a method for identification of the receptors for the human ~h~mnkine polypeptides. The gene encoding the receptor can be identified by numerous methods known to those of skill in the art, for example, ligand p~nning and FACS sorting (Coligan, et al., Current Protocols in Immun., 1(2), Chapter 5, (1991)). Preferably, expression cloning i8 employed wherein polyadenylated RNA is prepared from a cell responsive to the polypeptides, and a cDNA
library created from this RNA is divided into pools and used to transfect COS cells or other cells that are not responsive to the polypeptides. Transfected cells which are grown on glass slides are exposed -to the labeled polypeptides. The WO 1~6/39S22 CA O 2 2 2 2 2 8 0 19 9 7 - 1 1 - 2 ~ PCT/US9~ 53 /~

polypeptides can be labeled by a variety of means including iodination or inclusion of a recognition site for a site-specific protein kinase. Following fixation and incubation, the slides are subjected to autoradiographic analysis.
Positive pools are identified and sub-pools are prepared and retransfected using an iterative sub-pooling and rescreening process, eventually yielding a single clones that encodes the putative receptor.
As an alternative approach for receptor identification, the labeled polypeptides can be photoaffinity linked with cell membrane or extract preparations that express the receptor molecule. Cross-linked material is resolved by PAGE
analysis and exposed to X-ray film. The labeled complex cont~in;ng the receptors of the polypeptides can be excised, resolved into peptide fragments, and subjected to protein m:icrosequencing. The amino acid sequence obtained from m:Lcrosec~uencing would be used to design a set of degenerate o]Ligonucleotide probes to screen a cDNA library to identify the genes encoding the putative receptors.
This invention provides a method of screening compounds to identify agonists and antagonists to the human ch~m~kine polypeptides of the present invention. An agonist is a compound which has similar biological functions of the polypeptides, while antagonists block such functions.
ChLemotaxis may be assayed by placing cells, which are chemoattracted by either of the polypeptides of the present invention, on top of a filter with pores of sufficient diameter to admit the cells (about 5 ~Lm). Solutions of potential agonists are placed in the bottom of the chamber with an appropriate control medium in the upper compartment, and thus a concentration gradient of the agonist is measured by counting cells that migrate into or through the porous membrane over time.
When assaying for antagonists, the human ~hemokine polypeptides of the present invention are placed in the W O ~6/39522 PCT/U~,GI'~53~

bottom chamber and the potential antagonist is added to determine i~ chemotaxis o~ the cells is prevented.
Alternatively, a mAmmAlian cell or membrane preparation expressing the receptors of the polypeptides would be incubated with a labeled human ch~mokine polypeptide, eg.
radioactivity, in the presence of the compound. The ability of the compound to block this interaction could then be measured. When assaying ~or agonists in this fashion, the human chpmnkines would be absent and the ability of the agonist itself to interact with the receptor could be measured.
~ xamples of potential Ck~-ll and Ck~-1 antagonists include antibodies, or in some cases, oligonucleotides, which bind to the polypeptides. Another example of a potential antagonist is a negative ~omin~nt mutant of the polypeptides.
Negative ~mln~nt mutants are polypeptides which bind to the receptor o~ the wild-type polypeptide, but fail to retain biological activity.
Antisense constructs prepared using antisense technology ~re also potential antagonists. Antisense technology can be used to control gene expression through triple-helix iormation or antisense DNA or RNA, both of which methods are based on binding of a polynucleotide to DNA or RNA. For example, the 5' coding portion of the polynucleotide sequence, which encodes for the mature polypeptides of the present invention, is used to design an antisense RNA
oligonucleotide of from about 10 to 40 base pairs in length.
A DNA oligonucleotide is designed to be complemPnt~y to a region of the gene involved in transcription (triple- helix, see Lee et al., Nucl. Acids Res., 6:3073 (1979); Cooney et al, Science, 241:456 (1988); and Dervan et al., Science, 251:
1360 (1991)), thereby preventing transcription and the p~roduction of the human che~k;ne polypeptides. The antisense RNA oligonucleotide hybridizes to the mRNA in vivo and blocks translation -of the mRNA molecule into the W 0!~6/39522 CA 02222280 1997-11-2~ PCT/U~3GI~33/' polypeptides (antisense - Okano, J. Neurochem , 56:560 (1991); OligodeoxynucleotideS as Antisense Inhibitors of Gene ]3xpression, CRC Press, Boca Raton, FL (1988)). The oligonucleotides described above can also be delivered to cells such that the antisense RNA or DNA may be expressed i~
~vivo to inhibit production of the human chPmokine polypeptides~
Another potential human ch~mnkine antagonist is a peptide derivative of the polypeptides which are naturally or synthetically modified analogs of the polypeptides that have lost biological function yet still recognize and bind to the receptors of the polypeptides to thereby effectively block t:he receptors. Examples of peptide derivatives include, but are not limited to, small peptides or peptide-like molecules.
The antagonists may be employed to inhibit the chemotaxis and activation of macrophages and their precursors, and of neutrophils, basophils, B lymphocytes and some T cell subsets, e.g., activated and CD8 cytotoxic T
cells and natural killer cells, in certain auto-~mmlln~ and chronic inflammatory and infective diseases. Examples of auto-immune diseases include multiple sclerosis, and insulin-dependent diabetes.
The antagonists may also be employed to treat infectious diseases including silicosis, sarcoidosis, idiopathic pnlmnnAry fibrosis by preventing the recruitment and aLctivation of ~nnonllclear phagocytes. They may also be employed to treat idiopathic hyper-eosinophilic syndrome by preventing eosinophil production and migration. Endotoxic shock may also be treated by the antagonists by preventing the migration of macrophages and their production of the human c~h~m~kine polypeptides of the present invention.
The antagonists may al~o be employed for treating atherosclerosis, by preventing monocyte infiltration in the artery wall.

W 0516~9522 . PCTnJS5~5~r~

The antagonists may also be employed to treat hist~mine-mediated allergic reactions and ;m~lln~logical disorders including late phase allergic reaction~ chronic urticaria and atopic dermatitis by inhibiting ~hA~okine-induced mast cell and basophil degranulation and release of histamine.
Ig~-mediated allergic reactions such as allergic asthma rhinitis and eczema may also be treated.
The antagonists may also be employed to treat chronic and acute inflammation by ~L~v~,lting the attraction of monocytes to a wound area. They may al~o be employed to r-egulate normal pnlmonAry macrophage populations since chronic and acute inflammatory plllmon~y disea~es are associated with sequestration of mo~onllclear phagocytes in the lung.
Antagonists may also be employed to treat rheumatoid arthritis by preventing the attraction of monocytes into synovial fluid in the joints of patients. Monocyte influx and activation plays a significant role in the pathogenesis of both degenerative and inflammatory arthropathies.
The antagonists may be employed to interfere with the d~leterious cascades attributed primarily to IL-l and TNF
which prevents the biosynthesis of other inflammatory cytokines. In this way the antagonists may be employed to prevent inflammation. The antagonists may also be employed to inhibit prostagl~n~; n -indepPn~nt fever induced by cl~Pm~lkines .
The antagonists may also be employed to treat cases of bone marrow failure for example aplastic ~n~mi~ and myelodysplastic syndrome.
The antagonists may also be employed to treat asthma and a]Llergy by preventing eosinophil accumulation in the lung.
The antagonists may also be employed to treat subepithelial basement .,.~..~ dne fibrosis which is a pro~n~nt feature of the asthmatic lung.

CA 02222280 1997-11-2~
W O916~9~22 PCTAUS96/09572 The antagonists may be employed in a composition with a pharmaceutically acceptable carrier, e.g., as hereinafter described.
The human chemokine polypeptides and agonists and antagonists may be employed in combination with a suitable pharmaceutical carrier. Such compositions comprise a t:herapeutically effective amount of the polypeptide, and a plharmaceutically acceptable carrier or excipient. Such a carrier includes but is not limited to saline, buffered saline, dextrose, water, glycerol, ethanol, and combinations tihereof. The formulation should suit the mode of ~m; nistration.
The invention also provides a pharmaceutical pack or kit comprising one or more containers filled with one or more of the ingredients of the pharmaceutical compositions of the invention. Associated with such cont~;nPr(s) can be a notice in the form prescribed by a governm~nt~l agency regulating the manufacture, use or sale of pharmaceuticals or biological products, which notice reflects approval by the agency of m~mufacture, use or sale for human A~ministration. In addition, the polypeptides and agonists and antagonists may be employed in conjunction with other therapeutic compounds.
The pharmaceutical compositions may be A~mi nistered in a convenient mAnner such as by the topical, intravenous, intraperitoneal, intramuscular, intratumor, subcutaneous, intranasal or intradermal routes. The pharmaceutical compositions are A~m;n;stered in an amount which is effective for treating and/or prophylaxis of the specific indication.
In general, the polypeptides will be ~m;nistered in an amount of at least about 10 ~g/kg body weight and in most caLses they will be ?~m;nistered in an amount not in excess of about 8 mg/Kg body weight per day. In most cases, the dosage is from about 10 ~g/kg to about 1 mg/kg body weight daily, ta.king into account the routes of ~ministration, symptoms, etc.

W096~9522 PCT~S961~5~

The human ch~mnkine polypeptides, and agonists or antagonists which are polypeptides, may be employed in accordance with the present invention by expression of such polypeptides in vivo, which is often referred to as "gene therapy."
Thus, for example, cells from a patient may be engineered with a polynucleotide (DNA or RNA) encoding a polypeptide ex vivo, with the engineered cells then being provided to a patient to be treated with the polypeptide.
Such methods are well-known in the art. For example, cells may be engineered by procedures known in the art by use of a retroviral particle contA;n;ng RNA encoding a polypeptide of the present invention.
Similarly, cells may be engineered in vivo for expression of a polypeptide in vivo by, for example, procedures known in the art. As known in the art, a producer cell for producing a retroviral particle cont~;n;ng RNA
encoding the polypeptide of the present invention may be ~m; ni stered to a patient for engineering cells in vivo and expression of the polypeptide in vivo. These and other nnethods for ;~Am; n;stering a polypeptide of the present invention by such method should be apparent to those skilled in the art from the teachings of the present invention. For example, the expression vehicle for engineering cells may be other than a retrovirus, for example, an adenovirus which may be used to engineer cells in vivo after combination with a suitable delivery vehicle.
Retroviruses from which the retroviral plasmid vectors hereinabove mentioned may be derived include, but are not l.imited to, Moloney Murine Leukemia Virus, spleen necrosis ~irus, retroviruses such as Rous Sarcoma Virus, Harvey Sarcoma Virus, avian leukosis virus, gibbon ape leukemia virus, human ;mmllnoAeficiency virus, adenovirus, ~yeloproliferative Sarcoma Virus, and m~mm~ry tumor virus.

CA 02222280 1997-11-2~
W 0~6/39522 PCT/U',C~5~72 In one embodiment, the retroviral plasmid vector is ~erived ~rom Moloney Murine Leukemia Virus.
The vector includes one or more promoters. Suitable promoters which may be employed include, but are not limited to, the retroviral LTR; the SV40 promoter; and the human cytomegalovirus (CMV) promoter described in Miller, et al., Biotechniques, Vol. 7, No. 9, 980-990 (1989), or any other promoter (e.g., cellular promoters such as eukaryotic clellular promoters including, but not limited to, the histone, pol III, and ~-actin promoters). Other viral p:romoters which may be employed include, but are not limited to, adenovirus promoters, thymidine kinase (TK) promoters, and B19 parvovirus promoters. The selection of a suitable promoter will be apparent to those skilled in the art from the teachings contained herein.
The nucleic acid seguence encoding the polypeptide of the present invention is under the control of a suitable promoter. Suitable promoters which may be employed include, b~lt are not limited to, adenoviral promoters, such as the aclenoviral major late promoter; or hetorologous promoters, such as the cytomegalovirus (CMV) promoter; the respiratory syncytial virus (RSV) promoter; inducible promoters, such as the MMT promoter, the metallothionein promoter; heat shock promoters; the albumin promoter; the ApoAI promoter; human globin promoters; viral thymidine kinase promoters, such as the Herpes Simplex thymidine kinase promoter; retroviral LTRs (including the modified retroviral LTRs hereinabove described); the ~-actin promoter; and human growth hormone promoters. The promoter also may be the native promoter which controls the gene encoding the polypeptide.
The retroviral plasmid vector is employed to transduce packaging cell lines to form p~oducer cell lines. Examples of packaging cells which may be transfected include, but are not limited to, the PE501, PA317, ~-2, ~-AM, PA12, T19-14X, VT-19-17-H2, ~CRE, ~CRIP,~GP+E-86, GP+envAml2, and DAN cell CA 02222280 1997-11-2~
Wo~6~9s22 PCT~S~6/09572 lines as described in Miller, Human Gene Therapv, Vol. 1, pgs. 5-14 (1990), which is incorporated herein by reference in its entirety. The vector may transduce the packaging cells through any means known in the art. Such means include, but are not limited to, electroporation, the use o~
liposomes, and CaP04 precipitation. In one alternative, the retroviral plasmid vector may be encapsulated into a liposome, or coupled to a lipid, and then ~m~n; ~tered to a host.
The producer cell line generates infectious retroviral vector particles which include the nucleic acid sequence(s) encoding the polypeptides. Such retroviral vector particles then may be employed, to transduce eukaryotic cells, either in vi tro or in vivo. The transduced eukaryotic cells will express the nucleic acid sequence(s) encoding the polypeptide. Fukaryotic cells which may be transduced include, but are not limited to, embryonic stem cells, embryonic carcinoma cells, as well as hematopoietic stem cells, hepatocytes, fibroblasts, myoblasts, keratinocytes, endothelial cells, and bronch~l epithelial cells.The sequences of the present invention are also valuable for chromosome identification. The sec~uence is specifically targeted to and can hybridize with a particular location on an individual human chromosome. Moreover, there i8 a current need for identifying particular sites on the chromosome. Few chromosome marking reagents based on actual secruence data ~repeat polymorphisms) are presently available for marking c:hromosomal location. The mapping of DNAs to chromosomes according to the present invention is an important first step in correlating those sequences with genes associated with clisease.
Briefly, sequences can be mapped to chromosomes by p~reparing PCR primers (preferably 15-25 bp) ~rom the cDNA.
Computer analysis of the 3' untranslated region is used to - rapidly select primers tha~ do not span more than one exon in W05~6/39522 CA 02222280 Iss7-ll-2~ PCT~S96/09572 the genomic DNA, thus complicating the amplification process.
1'hese primers are then used for PCR screening of somatic cell ~Lybrids cont~ning individual human chromosomes. Only those hybrids cont~in~ng the human gene corresponding to the primer will yield an amplified fragment.
PCR mapping o~ somatic cell hybrids is a rapid procedure for assigning a particular DNA to a particular chromosome.
Using the present invention with the same oligonucleotide primers, sublocalization can be achieved with panels of fragments from specific chromosomes or pools of large genomic clones in an analogous m~nn~r, Other mapping strategies that can similarly be used to map to its chromosome include in situ hybridization, prescreening with labeled flow-sorted c.hromosomes and preselection by hybridization to construct c~hromosome specific-cDNA libraries.
Fluorescence in situ hybridization (FISH) of a cDNA
c:Lones to a metaphase chromosomal spread can be used to provide a precise chromosomal location in one step. This technique can be used with cDNA as short as 50 or 60 bases.
For a review of this technique, see Verma et al., Human Chromosomes: a MAnU~ l of Basic Techniques, Pelydmoll Press, New York (1988).
Once a sequence has been mapped to a precise chromosomal location, the physical position of the sequence on the chromosome can be correlated with genetic map data. Such da.ta are found, for example, in V. McKusick, Mendelian Inheritance in Man (available on line through Johns Hopkins University Welch Medical Library). The relationship between genes and diseases that have been mapped to the same chromosomal region are then identified through linkage analysis (coinheritance of physically adjacent genes).
Next, it is necessary to determine the differences in the cDNA or genomic sequence between affected and unaf~ected individuals. If a mutation is observed in some or all of the affected individuals but not in any normal individuals, then .

W096~9522 PCT~S~6~

the mutation is likely to be the causative agent of the disease.
With current resolution of physical mapping and genetic mapping techniques, a cDNA precisely localized to a chromosomal region associated with the disea8e could be one of between 50 and 500 potential causative genes. (This assumes 1 megabase mapping resolution and one gene per 20 kb).
The polypeptides, their fragments or other derivatives, or analogs thereof, or cells expressing them can be used as an lmmllnogen to produce antibodies thereto. These antibodies can be, for example, polyclonal or monoclonal antibodies.
~The present invention also includes ch;m~ric, single chain, ,and hllm~n~zed antibodies, as well as Fab fragments, or the product of an Fab expression library. Various procedures ~nown in the art may be u~ed for the production of such antibodies and ~ragments.
Antibodies generated against the polypeptides corresponding to a sequence of the present invention can be obtained by direct injection of the polypeptides into an iln;m~l or by ~min;stering the polypeptides to an ~n;m~l, preferably a nonhl-m~n. The antibody so obtained will then bind the polypeptides itself. In this m~nn~r, even a ~;ecluence encoding only a fragment o~ the polypeptides can be used to generate antibodies binding the whole native polypeptides. Such antibodies can then be used to isolate the polypeptide from tissue expressing that polypeptide.
For preparation of monoclonal antibodies, any technique ~hich provides antibodies produced by continuous cell line cultures can be used. Examples include the hybridoma technique (Kohler and Milstein, 1975, Nature, 256:495-497), the trioma technique, the human B-cell hybridoma technique ~Kozbor et al., 1983, Tmmllnology Today 4:72), and the BBV-hybridoma technique to produce human monoclonal antibodies WO 96/39522 CA 0 2 2 2 2 2 8 0 19 9 7 - 1 1 - 2 ~ PCT/US9~ 3 /~

(Cole, et al., 1985, in Monoclonal Antibodies and ~ancer Therapy~ Alan R. Liss, Inc., pp. 77-96).
Techniques described for the production of single chain antibodies (U.S. Patent 4,946,778) can be adapted to produce single chain antibodies to ;mmllnogeniC polypeptide products of this invention. Also, transgenic mice may be used to c~xpress hllm~n;zed antibodies to ;mml~nogeniC polypeptide products of this invention.
The present invention will be further described with reference to the following examples; however, it is to be ~mderstood that the present invention is not limited to such examples. All parts or amounts, unless otherwise specified, are by weight.
In order to facilitate underst~n~;ng of the following e!xamples certain ~requently occurring methods and/or terms will be described.
"Plasmids" are designated by a lower case p preceded and/or followed by capital letters and/or numbers. The starting plasmids herein are either co~mercially available, publicly available on an unrestricted basis, or can be constructed from available plasmids in accord with published procedures. In addition, equivalent plasmids to those described are known in the art and will be apparent to the ordinarily skilled artisan.
"Digestion" of DNA refers to catalytic cleavage of the DNA with a restriction enzy~me that acts only at certain sequences in the DNA. The various restriction enzymes used herein are cQ~m~rcially available and their reaction conditions, cofactors and other requirements were used as would be known to the ordinarily skilled artisan. For analytical purposes, typically 1 ~g of plasmid or DNA
fragment is used with about 2 units of enzyme in about 20 ~1 of buffer solution. For the purpose of isolating DNA
fragments for plasmid construction, typically 5 to 50 ~g of D~rA are digested with 20 tlO 250 units of enzyme in a larger CA 02222280 1997-11-2~
W O 96/39522 PCT~US96109572 volume. Appropriate buffers and substrate amounts for paLrticular restriction enzymes are specified by the maLnufacturer. Incubation times o~ about 1 hour at 37 C are ordinarily used, but may vary in accordance with the supplier's instructions. After digestion the reaction is electrophoresed directly on a polyacrylamide gel to isolate tlle desired fragment.
Size separation of the cleaved fragments is performLed u~3ing 8 percent polyacrylamide gel described by Goeddel, D.
et al ., Nucleic Acids Res., 8:4057 (1980).
"Oligonucleotides" refers to either a single stranded polydeoxyDLucleotide or two complementary polydeoxynucleotide st:rands which may be chemically synthesized. Such synthetic oligonucleotides have no 5' phosphate and thus will not li.gate to another oligonucleotide without adding a phosphate with an ATP in the presence of a kinase. A synthetic oligonucleotide will ligate to a fragment that has not been d~phosphorylated.
~ higation" refers to the process of forming phLosphodiester bonds between two double stranded nucleic acid fragments (Maniatis, T., et al., Id., p. 146). Unless otherwise provided, ligation may be accomplished using known buffers and conditions with 10 units to T4 DNA ligase ("ligase") per O.5 ~g of approximately equimolar amounLts of the DNA fragments to be ligated.
Unless otherwise stated, transformation was performed as described in the method of Graham, F. and Van der Eb, A., Virology, 52:456-457 (1973).

Exam~le 1 Bacterial ~xpression and Purification of Ck~-11 The DNA sequence encoding,for Ck~-11, ATCC # 75948, is initially amplified using PCR oligonucleotide primers corresponding to the 5' and 3' end sequences of the processed Ck~-11 nucleic acid sequence (minus the putative signal CA 02222280 1997-11-2~
W 0!16~9522 PCT~US96/09572 peptide sequence). Additional nucleotides corresponding to the Ck~-11 gene are added to the 5~ and 3' end sequences respectively. The 5' oligonucleotide primer has the sequence 5' CCCGCATGCCAA~-l~-l~AGTGGCACCA 3' contains a SphI restriction enzyme site (bold) followed by 18 nucleotides of Ck~
coding sequence (underlined) starting from the second nucleotide of the secluences coding for the mature protein.
The ATG codon is included in the SphI site. In the next codon following the ATG, the first base is from the SphI site and the rPm~i ni ng two bases correspond to the second and third base of the first codon (residue 18) of the putative mature protein. The 3' sequence 5~
CCCGGATCCCAATGCTTGACTCGGACT 3' contains complementary sequences to a BamH1 site (bold) and is followed by 18 nucleotides of gene specific secluences preceding the termination codon. The restriction enzyme sites correspond to the restriction enzyme sites on the bacterial expression vector pQE-9 (Qiagen, Inc. Chatsworth, CA). pQE-9 encodes ,~ntibiotic resistance (Ampr), a bacterial origin of replication (ori), an IPTG-regulatable promoter operator (P/O), a ribosome binding site (RBS), a 6-His tag and :restriction enzyme sites. pQE-9 is then digested with SphI
and BamH1. The amplified secluences are ligated into pQE-9 ~nd are inserted in frame with the secluence encoding for the histidine tag and the RBS. The ligation mixture is then used lo transform the E. coli strain M15/rep 4 (Qiagen, Inc.) by t:he procedure described in Sambrook, J. et al., Molecular tloning: A Laboratory M~n~ , Cold Spring Laboratory Press, (1989). M15/rep4 contains multiple copies of the plasmid pREP4, which expresses the lacI repressor and also confers kanamycin resistance (Kanr). Transformants are identified by t:heir ability to grow on LB plates and ampicillin/kanamycin resistant colonies are selected. Plasmid DNA is isolated and c:onfirmed by restriction analysis. Clones cont~;ning the clesired constructs are grown overnight (O/N) in liquid CA 02222280 1997-11-2~
W O 9'6/39522 PCTnU5,G~5/J

culture in LB media supplemented with both Amp (100 ug/ml) aLnd Kan (25 ug/ml). The O/N culture is used to inoculate a large culture at a ratio of l:100 to 1:250. The cells are glrown to an optical density 600 (O.D.~) of between 0.4 and 0.6. IPTG ("Isopropyl-B-D-thiogalaCto pyrano~ide~) is then added to a final concentration o~ 1 mM. IPTG induces by inactivating the lacI repressor, clearing the P/O leading to increased gene expression. Cells are grown an extra 3 to 4 hours. Cells are then harvested by centrifugation. The cell pellet is solubilized in the chaotropic agent 6 Molar Guanidine HCl pH 5Ø A~ter clarification, solubilized Ck~-ll is purified ~rom this solution by chromatography on a Nickel-Chelate column under conditions that allow for tight binding by proteins cont~;n~ng the 6-His tag (Hochuli, E. et al., J. Chromatography 411:177-184 (1984)). Ck~-11 ( ~98~
pure) is eluted from the column in 6M guanidine HCl. Protein renaturation out o~ GnHCl can be accomplished by several protocols (Jaenicke, R. and Rudolph, R., Protein Structure -A Practical Approach, IRL Press, New York (1990)).
Initially, step dialysis is utilized to remove the GnHCL.
Alternatively, the purified protein isolated from the Ni-chelate column can be bound to a second column over which a decreasing linear GnHCL gradient is run. The protein is allowed to renature while bound to the column and is subsequently eluted with a buffer cont~;ning 250 mM
Imidazole, 150 mM NaCl, 25 mM Tris-HCl pH 7.5 and 10~
Glycerol. Finally, soluble protein is dialyzed against a s~torage buffer cont~;ning 5 mM ~mmonium Bicarbonate.

Example 2 Bacterial ExPression and Purification of Ck~-1 The DNA sequence encoding.for Ck~-1, ATCC # 75947, is i]litially amplified using PCR oligonucleotide primers corresponding to the 5' and 3' end sequences of the processed Ck~-1 nucleic acid sequence (minus the putative signal WO~K~9522 CA 02222280 Iss7-ll-2~ PCT~S96/ogs72 peptide sequence). Additional nucleotides corresponding to 1 are added to the 5' and 3' end sequences respectively.
~he 5' oligonucleotide primer has the sequence 5~
C'CCGCATGCCTTCTGGAGGTCTATTACACA 3' contains a SphI restriction e!nzyme site (bold) followed by 21 nucleotides of Ck~-1 coding ~equence starting from the 8econd nucleotide of the sequences coding for the mature protein. The ATG codon is included in the SphI site. In the next codon following the ATG, the first base is from the SphI site and the r~m~;n~ng two bases correspond to the second and third base of the first codon (residue 23) of the putative mature protein. ~s a consequence, the first base in this codon is changed from G
to C co~rAring with the original sequences, resulting in a Val to Leu substitution in the recombinant protein. The 3~
sequence 5' CCCGGATCCGGGAATCTTT~-l~-l-lA~AC 3~ contains complementary sequences to a BamH1 site (bold) and is followed by 19 nucleotides of gene specific sequences preceding the termination codon. The restriction enzyme si.tes correspond to the restriction enzyme sites on the bacterial expression vector pQE-9 (Qiagen, Inc. Chatsworth, C~,). pQE-9 encodes antibiotic resistance (Ampr), a bacterial origin of replication (ori), an IPTG-regulatable promoter operator (P/O), a ribosome binding site (RBS), a 6-His tag and restriction enzyme sites. pQE-9 is then digested with SphI and BamHl. The amplified sequences are ligated into pQE-9 and are inserted in frame with the sequence encoding for the histidine tag and the RBS. The ligation mixture is then used to trans~orm the E. coli M15/rep 4 (Qiagen, Inc.) by the procedure described in Sambrook, J. et al., Molecular Cloning: A Laboratory MAnllAl~ Cold Spring Laboratory Press, (1989). M15/rep4 contains multiple copies of the plasmid p~3P4, which expresses the lacI repressor and also confers ka~amycin resistance (Kanr). Transformants are identified by their ability to grow on LB plates and ampicillin/kanamycin resistant colonies are selected. Plasmid DNA is isolated and -CA 02222280 1997-11-2~
W 09~6/39522 PCTnUS~C,'~jJ7 ~onfinmed ~y restriction analysis. Clones cont~ning the desired constructs are grown overnight (0/N) in liquid c:ulture in LB media supplemented with both Amp (100 ug/ml) cmd Xan (25 ug/ml). The O/N culture is used to inoculate a ]arge culture at a ratio of 1:100 to 1:250. The cells are grown to an optical density 600 (O.D.~) of between 0.4 and 0.6. IPTG ("Isopropyl-B-D-thiogalacto pyranoside") is then added to a final concentration of 1 mM. IPTG induces by inactivating the lacI repressor, clearing the P/0 leading to i.ncreased gene expression. Cells are grown an extra 3 to 4 hours. Cells are then harvested by centrifugation. The cell pellet is solubilized in the chaotropic agent 6 Molar Guanidine HCl pH 5Ø A~ter clari~ication, solubilized Ck~-1 i.s purified from this solution by chromatography on a Nickel-C'helate column under conditions that allow for tight binding by proteins cont~;n~ng the 6-His tag (Hochuli, E. et al., J.
Chromatography 411:177-184 (1984)). Ck~-l ( ~98% pure) is eluted from the column in 6M guanidine HCl. Protein renaturation out of GnHCl can be accomplished by several plrotocols (Jaenicke, R. and Rudolph, R., Protein Structure -A. Practical Approach, IRL Press, New York (1990)).
Initially, step dialysis is utilized to remove the GnHCL.
A.lternatively, the puri~ied protein isolated from the Ni-chelate column can be bound to a second column over which a decreasing linear GnHCL gradient is run. The protein is allowed to renature while bound to the column and is subsequently eluted with a buffer contA;n;ng 250 mM
Imidazole, 150 mM NaCl, 2S mM Tris-HCl pH 7.5 and 10~
Glycerol. Finally, soluble protein is dialyzed against a storage buffer cont~;n;ng 5 mM ~m~n;um Bicarbonate.

Example 3 ~x~ression of Recombinant Ck~-ll in COS cells The expression of plasmid, Ck~-ll HA is derived from a vector pcDNAI/Amp (Invitr~gen) contA;n;ng: 1) SV40 origin of WO '~6/39522 CA 0 2 2 2 2 2 8 0 19 9 7 - 1 1 - 2 ~ PCT/US96/09S72 replication, 2) ampicillin resistance gene, 3) E coli replication origin, 4) CMV promoter followed by a polylinker region, a SV40 intron and polyadenylation site. A DNA
fragment encoding the entire Ck~-11 precursor and a HA tag ~used in frame to its 3' end is cloned into the polylinker region of the vector, therefore, the recom~inant protein expression is directed under the CMV promoter. The HA tag correspond to an epitope derived from the influenza hem,agglutinin protein as previously described (I. Wilson, H.
Niman, R. Heighten, A Cherenson, M. Connolly, and R. Lerner, 1984, Cell 37, 767). The infusion of HA tag to the target protein allows easy detection of the recombinant protein with a;n antibody that recognizes the HA epitope.
The plasmid construction strategy is described as f~llows:
The DNA sequence encoding for Ck~-11, ATCC # 75948, is constructed by PCR using two primers: the 5' primer 5' A~ AGCTTGCCATGGCCCTGCTACTG 3' contains a HindIII site followed by 18 nucleotides of Ck~-ll coding sequence starting from the minus 3 position relative to initiation codon; the 3' sequence 5'CGCTCTAGATTAAGCGTAGT~ ~AC~l~lATGGGTATAGGTTA
ACTGCTGCGAC 3' contains complementary sequences to an XbaI
site, translation stop codon, HA tag and the last 18 n~Lcleotides of the Ck~-11 coding sequence (not including the stop codon). Therefore, the PCR product contains a HindIII
site, Ck~-ll coding sequence followed by HA tag fused in ~rame, a translation termination stop codon next to the HA
tag, and an XbaI site. The PCR amplified DNA ~ragment and the vector, pcDNAI/Amp, are digested with HindIII and XbaI
restriction enzyme and ligated. The ligation mixture is transformed into E. coli strain SURE (Stratagene Cloning Systems, La ~olla, CA) the transformed culture is plated on ampicillin media plates and resistant colonies are selected.
Plasmid DNA is isolated from transformants and ex~m~ned by restriction analysis for the presence of the correct CA 02222280 1997-11-2~
W O 9~6/39522 PCT~US~ 5~L

fragment. For expression of the recombinant Ck~-11, COS
cells are transfected with the expression vector by DBAE-DEXTRAN method (J. Sambrook, E. Fritsch, T. Maniatis, Molecular Cloning: A Laboratory Manual, Cold Spring Laboratory Press, (1989)). The expression of the Ck~-11 HA
protein is detected by radiolabelling and ~mmllnoprecipitation method (E. Harlow, D. Lane, Antibodies: A Laboratory Manual, Cold Spring Harbor Laboratory Press, (1988)). Cells are labelled for 8 hours with 35S-cysteine two days post transfection. Culture media are then collected and cells are l~rsed with detergent (RIPA buffer (150 mM NaCl, 1~ NP-40, 0.1~ SDS, 1~ NP-40, 0.5% DOC, 50mM Tris, pH 7.5). (Wilson, I.
et: al., Id. 37:767 (1984)). Both cell lysate and culture media are precipitated with a HA specific monoclonal antibody. Proteins precipitated are analyzed by SDS-PAGE.

Exam~le 4 E~ression of Recombinant Ck~-l in COS cells The expression of plasmid, Ck~-l HA is derived from a vector pcDNAI/Amp (Invitrogen) cont~n;n~: 1) SV40 origin of replication, 2) ampicillin resistance yene, 3) ~.coli replication origin, 4) CMV promoter followed by a polylinker region, a SV40 intron and polyadenylation site. A DNA
fragment encoding the entire Ck~-1 precursor and a HA tag fused in frame to its 3' end is cloned into the polylinker region of the vector, therefore, the recombinant protein expression is directed under the CMV promoter. The HA tag correspond to an epitope derived from the influenza hemagglutinin protein as previously described (I. Wilson, H.
Niman, R. Heighten, A Cherenson, M. Connolly, and R. Lerner, 1984, Cell 37, 767). The infusion of HA tag to the target protein allows easy detection of the recombinant protein with an antibody that recognizes the HA epitope.
The plasmid construction strategy is described as follows:

WO 96/39522 CA O 2 2 2 2 2 8 0 19 9 7 - 1 1 - 2 ~ PCT/US~G/~5; ~2 The DNA sequence encoding for Ck~-1, ATCC # 75947, is constructed by PCR using two primers: the 5' primer 5' ~AAAAGCTTAGAATGAAGTTCATCTCG 3' contains a HindIII site followed by 18 nucleotides of Ck~-1 coding sequence starting from the minus 3 position relative to the initiation codon;
the 3' sequence 5' CGCTCTAGATTAAGCGTAGTCTGGGAC~l~lATGGGTAG
~GAA~ -l-l 3' contains complementary sequences to an XbaI
site, translation stop codon, HA tag and the last 18 nucleotides of the Ck~-1 coding sequence (not including the stop codon). Therefore, the PCR product contains a HindIII
site, Ck~-1 coding sequence followed by HA tag fused in frame, a translation termination stop codon next to the HA
tag, and an XbaI site. The PCR amplified DNA fragment and t:he vector, pcDNAI/Amp, are digested with HindIII and an XbaI
restriction enzyme and ligated. The ligation mixture is transformed into E. coli strain SURE (Stratagene Cloning Systems, La Jolla, CA) the transformed culture is plated on ampicillin media plates and resistant colonies are selected.
Plasmid DNA is isolated from transformants and ~mi n~d by restriction analysis for the presence of the correct fragment. For expression of the recombinant Ck~-1, COS cells are transfected with the expression vector by DEAE-DEXTRAN
method (J. Sambrook, E. Fritsch, T. Maniatis, Molecular Cloning: A Laboratory M~n~ , Cold Spring Laboratory Press, (L989)). The expression of the Ck~-1 HA protein is detected by radiolabelling and immunoprecipitation method (E. Harlow, D. Lane, Antibodies: A Laboratory ~nll~ l, Cold Spring Harbor Laboratory Press, (1988)). Cells are labelled for 8 hours w:Lth 35S-cysteine two days pOst transfection. Culture media are then collected and cells are lysed with detergent (RIPA
buffer (150 mM NaCl, 1~ NP-40, 0.1~ SDS, 1~ NP-40, 0.5~ DOC, 5CImM Tris, pH 7.5). (Wilson, I. et al., Id. 37:767 (1984)).
Both cell lysate and culture media are precipitated with a HA
specific monoclonal antibody. Proteins precipitated are analyzed by SDS-PAGE.

W o 96r39522 PCTrUS961~53 ExamDle 5 Clonin~ and ex~ression of Ck~-11 usinq the baculovirus e~ression SYstem The DNA sequence encoding the full length Ck~
protein, ATCC # 75948, is ampli~ied using PCR oligonucleotide primers corresro~; ng to the 5' and 3' sequences of the gene:
The 5' primer has the sequence 5' CGCGGGATCCGCCATCATG
GC'CCTGCTACTGGCCCT 3' and contA; nQ a BamHI restriction enzyme si.te (in bold) followed by 6 nucleotides resPmhli ng an efficient ~ignal for the initiation of translation in eu~aryotic cells (Kozak, M., J. Mol. Biol., 196:947-950 (1987) which is ju8t behind the first 20 nucleotides of the Ck:~-11 gene (the initiation codon for translation "ATG" is underlined).
The 3' primer has the sequence 5' CGGCGGTACCTGGCTGCACGGTCCATAGG 3' and contains the cleavage site ~or the restriction en~onl~clease Asp781 and 19 nucleotides complementary to the 3' non-translated 8equence of the Ck~-11 gene. The amplified sequences are isolated from a 1~ agarose gel using a c- -rcially available kit (nGeneclean," BI0 101 Inc., La Jolla, Ca ). The frag~ent is then dige8ted with the ~n~nnll~leases BamHI and Asp781 and then purified again on a 1~ agarose gel. This ~ragment is designated F2.
The vector pRG1 (modification of pVL941 vector, di~cussed below) is used for the expression of the Ck~-11 protein using the baculovirus expression system (for review se~e: Summers, M.D. and Smith, G.E. 1987, A mAnllAl of methods for baculovirus vectors and insect cell culture procedures, Te:Kas Agricultural Experimental Station Bulletin No. 1555).
This expre88ion vector rnnt~inQ the strong polyhedrin promoter of the Autographa californica nuclear polyhedrosis vi~us (AcMNPV) followed by the recognition sites for the restriction Pn~onllrleases BamHI and Asp781. The polyadenylation site of the simian virus (SV)40 is used for W O 96/39522 PCT~US9~ 53/~

efficient polyadenylation. For an easy selection of recombinant viruses the beta-galactosidase gene from E.coli i6 inserted in the same orientation as the polyhedrin promoter followed by the polyadenylation signal of the polyhedrin gene. The polyhedrin sequences are flanked at both sides by viral se~uences for the cell-mediated homologous recombination of cotransfected wild-type viral Dl~A. Many other baculovirus vectors could be used in place o:E pRGl such as pAc373, pVL941 and pAcIMl (Luckow, V.A. and Sllmmers, M.D., Virology, 170:31-39).
The plasmid is digested with the restriction enzymes BamHI and Asp781 and then dephosphorylated using calf intestinal phosphatase by procedures known in the art. The D~A is then isolated from a 1~ agarose gel using the commercially available kit ("Geneclean" BI0 101 Inc., La ~olla, Ca.). This vector DNA is designated V2.
Fragment F2 and the dephosphorylated plasmid V2 are ligated with T4 DNA ligase. E.coli B 101 cells are then transformed and bacteria identified that contained the p~.asmid (pBac-Ck~-ll) with the CK~-ll gene using the enzymes Ba~mHI and Asp781. The sequence of the cloned fragment is confirmed by DNA sequencing.
5 ~g of the plasmid pBac-CK~-ll is cotransfected with 1.O ~g of a commercially available linearized baculovirus (~BaculoGold~ baculovirus DNA", Pharmingen, San Diego, CA.) using the lipofection method (Felgner et al. Proc. Natl.
Acad. Sci. USA, 84:7413-7417 (1987)).
l~g of BaculoGold~ virus DNA and 5 ~g of the plasmid pBac-CK~-ll are mixed in a sterile well of a microtiter plate contA;ning 50 ~1 of serum free Grace's medium (Life Technologies Inc., Gaithersburg, MD). Afterwards 10 ~1 Lipofectin plus 90 ~1 Grace's medium are added, mixed and incubated for 15 minutes at room temperature. Then the transfection mixture is added dropwise to the Sf9 insect cells (ATCC CRL 1711) seeded in a 35 mm tissue culture plate W0~6~9522 PCT~S9'~

with lml Grace's medium without serum. The plate is rocked back and forth to mix the newly added solution. The plate i~
then incubated for 5 hours at 27OC. After 5 hours the transfection solution is removed from the plate and 1 ml o~
Grace's insect medium supplemented with 10~ fetal cal~ serum is added. The plate i8 put back into an incubator and cultivation continued at 27~C for four days.
After four days the supernatant is collected and a plaque assay perfonmed 8~mil~ as described by Summers and Smith (supra). As a modification an agarose gel with "Blue Gal" (Life Technologies Inc., Gaithersburg) is used which allows an easy isolation of blue st~ne~ plaques. (A
detailed description of a "plaque assay" can also be found in t]he user's guide for insect cell culture and baculovirology distributed by Life Technologies Inc., Gaithersburg, page 9-1~)) .
Four days after the serial dilution, the viruses areaclded to the cells and blue st~inPA plaques are picked with the tip of an Eppendorf pipette. The agar cont~;n'ng the recombinant viruses is then resuspended in an Eppendorf tube containing 200 ~1 of Grace's medium. The agar is removed by a brief centrifugation and the supernatant con~n;ng the recombinant baculovirus is used to infect Sf9 cells seeded in 35 mm dishes. Four days later the supernatants of these culture dishes are harvested and then stored at 4~C.
Sf9 cells are grown in Grace's medium supplemented with 10~ heat-inactivated FBS. The cells are infected with the recombinant baculovirus V-CK~-ll at a multiplicity of in~ection (MOI) of 2. Six hours later the medium is removed and replaced with SF900 II medium minus methionine and cysteine (Life Technologies Inc., Gaithersburg). 42 hours lalter 5 ~Ci of 35S-methionine and 5 ~Ci 3~S cysteine (Amersham) are added. The cells are further incubated for 16 hours before they are harvested by centrifugation and the labelled proteins visualized by SDS-PA OE and autoradiography.

W 0!~6~9522 PCT/U~ 5 ~xample 6 Cloninq and expression of Ck~-1 usinq the baculovirus expression system The DNA sequence encoding the full length Ck~-1 protein, ATCC # 75947, is ampli~ied using PCR oligonucleotide primers corresponding to the 5' and 3' sequences of the gene:
The 5' primer has the sequence 5' GCCGGATCCGCCATC
aTGAAGTTCATCTCGACATC 3' and contains a BamHI restriction enzyme site (in bold) followed by 6 nucleotides resembling an efficient signal for the initiation of translation in eukaryotic cells (Kozak, M., J. Mol. Biol., 196:947-950 (1987) which is just behind the first 20 nucleotides of the Ck~-1 gene (the initiation codon for translation "ATG" is underlined).
The 3' primer has the sequence 5' CGCGGGTACCGG
TGTTCTTAGTGGAAA 3' and contains the cleavage site for the restriction endonuclease A~p781 (in bold) and 17 nucleotides complementary to the 3' non-translated sequence of the Ck~-1 gene. The amplified sequences are isolated from a 1~ agarose gel using a commercially available kit ("Geneclean,~ BIO 101 Inc., La Jolla, Ca.). The fragment is then digested with the endonucleases BamHI and Asp781 and then purified again on a 1% agarose gel. This fragment is designated F2.
The vector pRG1 (modification of pVL941 vector, discussed below) is used for the expression of the Ck~-l protein using the baculovirus expression system (for review see: Summers, M.D. and Smith, G.E. 1987; A mAn~lAl of methods for baculovirus vectors and insect cell culture procedures, Texas Agricultural ~xperimental Station Bulletin No. 1555).
This expression vector contains the strong polyhedrin promoter of the Autographa californica nuclear polyhedrosis virus (AcMNPV) followed by t~e recognition sites for the restriction Pn~onllcleases BamHI and Asp781. The polyadenylation site of the simian virus (SV)40 is used for efficient polyadenylation. For an easy selection of CA 02222280 1997-11-2~
W 0 96~9522 PCT/U~/O~S72 recombinant viruses the beta-galactosidase gene from E.coli i s inserted in the same orienta~ion a~ the polyhedrin promoter followed by the polyadenylation ~ignal of the polyhedrin gene. The polyhedrin sec~uences are flanked at both sides by viral sequences ~or the cell-mediated homologous recombination of cotransfected wild-type viral DNA. Many other baculovirus vectors could be used in place o,f pRG1 such as pAc373, pVL941 and pAcIM1 (Luckow, V.A. and Summers, M.D., Virology, 170:31-39).
The plasmid is digested with the restriction enzymeE;
BamHI and Asp781 and then dephosphorylated usi~g calf intestinal phosphatase by procedures known in the art. The DNA is then isolated from a 1% agarose gel using the commercially available kit ("Geneclean" BIO 101 Inc., La Jolla, Ca.). This vector DNA is designated V2.
Fragment F2 and the dephosphorylated pla~;mid V2 are ligated with T4 DNA ligase. E.coli HB101 cells are then transformed and bacteria identified that contained the plasmid (pBac-CkcY-1) with the Ck~ gene using the enzymes Bi~nHI and Asp781. The sec~uence of the cloned fragment is confirmed by DNA secruencing.
5 ~g of the plasmid pBac-CkcY-1 is cotransfected with 1.0 ~g of a commercially available linearized baculovirus ("BaculoGoldn' baculovirus DNA", Pharmingen, San Diego, CA.) using the lipofection method (Felgner et al. Proc. Natl.
Acad. Sci USA, 84:7413-7417 (1987)).
l~g of BaculoGoldn' virus DNA and 5 ~g of the plasmid p~ac-Ck~-1 are mixed in a sterile well of a microtiter plate cont~;n;ng 50 ~l of serum free Grace's medium (Life Technologies Inc., Gaithersburg, MD). Afterwards 10 ~l Lipofectin plus 90 ~ul Grace's medium are added, mixed and incubated for 15 minutes at room temperature. Then the transfection mixture is added dropwise to the Sf9 insect cells (ATCC CRI 1711) seeded in a 35 mm tissue culture plate with lml Grace's medium without serum. The plate is rocked CA 02222280 1997-11-2~
WO 516/39522 PCT/US~6~'~53 / ?

back and forth to mix the newly added solution. The plate is t~en incubated for 5 hours at 27~C. After 5 hours the t:ransfection solution is removed from the plate and 1 ml of Grace's insect medium supplemented with 10% fetal calf serum is added. The plate is put back into an incubator and cultivation continued at 27~C for four days.
After four days the supernatant is collect~d and a p:Laque assay performed similar as described by Summers and Srnith (supra). As a modification an agarose gel with "Blue Gal" (Life TechnologieS Inc., Gaithersburg) is used which a]Llows an easy isolation of blue stained plaques. (A
detailed description of a l'plaque assay" can also be found in the user's guide for insect cell culture and baculovirology distributed by Life Technologies Inc., Gaithersburg, page 9-lt~).
Four days after the seri~l dilution, the viruses are aclded to the cells and blue stained plaques are picked with the tip of an Eppendorf pipette. The agar cont~;n;ng the recombinant viruses is then resuspended in an Eppendorf tube contA;n;ng 200 ~1 of Grace's medium. The agar is removed by a brief centrifugation and the supernatant cont~in~ng the recombinant baculovirus is used to infect Sf9 cells seeded in 35 mm dishes. Four days later the supernatants of these cu.lture dishes are harvested and then stored at 4~C.
Sf9 cells are grown in Grace's medium supplemented with 10~ heat-inactivated FBS. The cells are infected with the recombinant baculovirus V-Ck~-1 at a multiplicity of infection (MOI) of 2. Six hours later the medium is removed and replaced with SF900 II medium minus methionine and cysteine (hife Technologies Inc., Gaithersburg, MD). 42 hours later 5 ~Ci of 35S-methionine and 5 ~Ci 35S cysteine (Amersham) are added. The cells are further incubated for 16 hours before they are harvested by centrifugation and the labelled proteins visualized by SDS-PAGE and autoradiography.

wo96~9s22 PCT~S9G~

Example 7 ~x~ression via Gene Therapy Fibroblasts are obtained from a subject by skin biopsy.
The resulting tissue is placed in tissue-culture medium and separated into small pieces. Small chunks of the tissue are placed on a wet ~urface of a tissue culture flask, approximately ten pieces are placed in each flask. The flask is turned upside down, closed tight and le~t at room temperature over night. After 24 hours at room temperature, the flask is inverted and the chunks of tissue remain fixed to the bottom of the flask and fresh media (e.g., Ham's F12 media, with 10~ FBS, penicillin and streptomycin, is added.
This is then incubated at 37~C for approximately one week.
At this time, fresh media is added and subsequently changed ev~ry several days. After an additional two weeks in cu_~ure, a monolayer of fibroblasts emerge. The monolayer is trypsinized and scaled into larger flasks.
pMV-7 (Kirschmeier, P.T. et al, DNA, 7:219-25 (1988) flanked by the long tenminal repeats of the Moloney murine sarcoma virus, is digested with EcoRI and HindIII and subsequently treated with cal~ intestinal phosphatase. The linear vector is ~ractionated on agarose gel and purified, using glass beads.
The cDNA encoding a polypeptide of the present invention i5 amplified using PCR primers which correspond to the 5' and 3' end sequences respectively. The 5' primer contA; n; ng an EcoRI site and the 3' primer $further includes a HindIII
site. ~qual quantities o~ the Moloney murine sarcoma virus linear backbone and the amplified $EcoRI and HindIII ~ragment are added together, in the presence of T4 DNA ligase. The resulting mixture is maint~;n~ under conditions appropriate for ligation of the two fragments. The ligation mixture is used to transform bacteria HB101, which are then plated onto agar-cont~;n;ng kanamycin for the purpose of confirming that the vector had the gene o~ interest properly inserted.

W O 96~9S22 PCT~US96~3~/~

The amphotropic pA317 or GP+aml2 packaging cells are qrown in tissue culture to confluent density in Dulbecco~s ~odified Eagles Medium (DMEM) with 10~ calf serum (CS), penicillin and streptomycin. The MSV vector cont~nlng the gene is then added to the media and the packaging cells are t:ransduced with the vector. The packaging cells now produce infectious viral particles containing the gene (the packaging cells are now referred to as producer cells).
Fresh media is added to the transduced producer cells, cmd subsequently, the media is harvested from a 10 cm plate of confluent producer cells. The spent media, cont~;ning the infectious viral particles, is filtered through a millipore iilter to remove detached producer cells and this media is t:hen used to infect fibroblast cells. Media is removed from a sub-confluent plate of fibroblasts and quickly replaced with the media from the producer cells. This media is removed and replaced with fresh media. If the titer of virus :Ls high, then virtually all fibroblasts will be infected and IlO selection is required. If the titer is very low, then it :is necessary to use a retroviral vector that has a selectable marker, such as neo or his.
The engineered fibroblasts are then injected into the host, either alone or after having been grown to confluence on cytodex 3 microcarrier beads. The fibroblasts now produce lhe protein product.
Numerous modifications and variations of the present :invention are possible in light of the above teachings and, l:herefore, within the scope of the appended claims, the :invention may be practiced otherwise than as particularly described.

-W 0 96~95Z2 . PCTlUb,~J0~5~2 SEQUENCE LISTING
(1) GENERAL INFORMATION:
(i) APPLICANTS: H~ GENoME SCIENOES, I~C. AND HA~DCNG LI
(ii) TITLE O~ INVENTION: Human Chemokine Beta-1I and Human Chemokine Alpha-1 (iii) NUMBER OF SEQUENCES: 16 (iv) CORRESPONDENCE ADDRESS:
(A) ADDRESSEE: STERNE, KESSLER, GOLDSTEIN & FOX P.L.L.C.
~B) STREET: 1100 New York Avenue, N.W.
(C) CITY: ~.~h;n~bon (D) STATE: D.C.
(E) COUNTRY: USA
(F) ZIP: 20005-3934 (v) CURRBNT APPLICATION DATA:
(A) APPLICATION NUMBER: TO BE ADVI~D
(B) FIhING DATE: 05 ~~ 1996 (C) CLASSIFICATION:
(vi) PRIOR APPLICATION DATA
(A) APPLICATION NUMBER: 08/460,987 & 08/464,401 (B) FILING DATE: 05 June 1995 & 05 June 1995 (vii) ATTORNEY/AGENT INFORMATION:
(A) NAME:GOLDSTEIN, JORGE A.
(B) ~EGISTRATION NUMBER: 29,021 (C) RBFEREN OE /DOCKET NUMBER: 1488.038PC02 (viii; TBLECOMMUNICATION INFORMATION:
(A) TELEPHONE: (202) 371-2600 (B) TELEFAX: (202) 371-2540 (2) INFORMATION FOR SEQ ID NO:1:
(i) SEQUENCE CHARACTERISTICS' (A) LENGTH: 29~ BASE PAIRS
(B~ TYPE: NUCLEIC ACID
(C) STRANDEDNESS: SINGLE
(D) TOPOLO&Y: LINEAR

W 0'~6~9522 PCT~US96/09572 (ii) MOLECULE TYPE: CDNA
(xi) SE~u~NC~ DESCRIPTION: SEQ ID NO:1:
ATGGCCCTGC TACTGGCCCT CAGCCTGCTG Gll~ l~GA ~l-lLCCLAGC CCCAACTCTG 60 AGTGGCACCA ATGATGCTGA AGACTGCTGC ~-lrJl~-lr~lL;A CCCAGAAACC CA~CC~-lL;GG 120 TACATCGTGA GGAACTTCCA CTAC~-ll~-lC ATCAAGGATG GTTGCAGGGT GCCTGCTGTA 180 GTGTTCACCA CACTGAGGGG CCGCCAGCTC TGTGCACCCC CAGACCAGCC C-lr~G~lAGAA 240 (2) INFORMATION FOR SEQ ID NO:2:
(i) SEQ~NC~ CHARACTERISTICS
(A) LENGTH: 98 AMINO ACIDS
(B) TYPE: AMINO ACID
(C) STRAN~N~SS:
(D) TOPOLOGY: LINEAR
(ii) MOLECULE TYPE: PROTEIN
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:2:
M:et Ala Leu Leu heu Ala Leu Ser Leu Leu Val Leu Trp Thr Ser P~ro Ala Pro Thr Leu Ser Gly Thr Asn Asp Ala Glu Asp Cys Cys L,eu Ser Val Thr Gln Lys Pro Ile Pro Gly Tyr Ile Val Arg Asn E~he His Tyr Leu Leu Ile Lys ASp Gly Cys Arg Val Pro Ala Val ~al Phe Thr Thr Leu Arg Gly Arg Gln Leu Cy~ Ala Pro Pro Asp Gln Pro Trp Val Glu Arg Ile Ile Gln Arg Leu Gln Arg Thr Ser Ala Lys Met Lys Arg Arg Ser Ser ~2) INFORMATION FOR SEQ ID NO:3:
(i) SEQu~N~ CHARACTERISTICS
(A) LENGTH: 330 BASE PAIRS
(B) TYPE: NUCLEIC ACID
(C) STR~NDEDNESS: SINGLE
(D) TOPOLOGY: LINEAR
(ii) MOLECULE TYPE: cDNA
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:3:
ATGAAGTTCA TCTCGACATC TCTGCTTCTC ATG~TGCTGG TCAGCAGCCT ~ CL-AGTC 60 C'AA~l~l-lC TGGAGGTCTA TTACACAAGC TTGAGGTGTA GAl~l~lC~A AGAGAGCTCA 120 Gl~-l-l-lATcc CTAGACGCTT CATTGATCGA ATTCAAATCT TGCCCCLilLrG GAATGGTTGT 180 CCAAGAAAAG A~ATC'ATAGT CTGGAAGAAG AACAAGTCAA llrvl~l~l~l GGACCCTCAA 240 GCTGAATGGA TACAAAGAAT GATGGAAGTA TTGAGAAAAA GAALi~ lC AACTCTACCA 30O

W O 96~9522 . PCTnuS9~10 ~2) INFORMATION FOR SEQ ID NO:4:
(i) SEQUENCE CHARACTERISTICS
(A) LENGTH: 109 AMINO ACIDS
(B) TYPE: AMIN0 ACID
(C) STRANDEDNESS:
(D) TOPOLOGY: LINEAR
(ii) MOLECULE TYPE: PROTEIN
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:4:
Met Lys Phe Ile Ser Thr Ser Leu Leu Leu Met Leu Leu Val Ser S~er Leu Ser Pro Val Gln Gly Val Leu Glu Val Tyr Tyr Thr Ser Leu Arg Cys Arg Cys Val Gln Glu Ser Ser Val Phe Ile Pro Arg Arg Phe Ile Asp Arg Ile Gln Ile Leu Pro Arg Gly Asn Gly Cys Pro Arg Lys Glu Ile Ile Val Trp Lys Lys Asn Lys Ser Ile Val Cys Val Asp Pro Gln Ala Glu Trp Ile Gln Arg Met Met Glu Val Leu Arg Lys Arg Ser Ser Ser Thr Leu Pro Val Pro Val Phe Lys Arg Lys Ile Pro (2) INFORMATION FOR SEQ ID NO:5:
(i) ~ SEQu~ CHARACTERISTICS
(A) LENGTH: 27 BASE PAIRS
(B) TYPE: NUCLEIC ACID
(C) STRANDEDNESS: SINGLE
(D) TOPOLOGY: LINEAR
(ii) MOLECULE TYPE: 01igonucleotide (xi) SEQu~N~ DESCRIPTION: SEQ ID NO:5:
CCCGCATGCC AA~ AGT GGCACCA 27 (2~ INFORMATION FOR SEQ ID NO:6:
(i) SEQUENCE CHARACTERISTICS
(A) LENGTH: 27 BASE PAIRS
(B) TYPE: NUCLEIC ACID
(C) STRANDEDNESS: SINGLE
(D) TOPOLOGY: LINEAR
(ii) MOLECULE TYPE: Oligonucleotide (xi) SEQUENCE DESCRIPTION: SEQ ID NO:6:

CA 02222280 1997-11-2~
W O 96~9522 PCT~US96/09572 (2) INFORMATION FOR SEQ ID NO:7:
(i) SEQUENCE CHARACTERISTICS
(A) LENGTH: 30 BASE PAIRS
(B) TYPE: NUCLEIC ACID
(C) STRANDEDNESS: SINGLE
(D) TOPOLOGY: LINEAR
(ii) MOLECULE TYPE: Oligonucleotide (xi) SEQUENCE DESCRIPTION: SEQ ID NO:7:

(2) INFORMATION FOR SEQ ID NO:8:
(i) SEQUENCE CHARACTERISTICS
(A) LENGTH: 28 BASE PAIRS
(B) TYPE: NUCLEIC ACID
(C) STRANDEDNESS: SINGLE
(D) TOPOLOGY: LINEAR
(ii) MOLECULE TYPE: Oligonucleotide (xi) SEQUENCE DESCRIPTION: SEQ ID NO:8:

(2) INFORMATION FOR SEQ ID NO:9:
(i) SEQUENCE CHARACTERISTICS
(A) LENGTH: 27 BASE PAIRS
(B) TYPE: NUCLEIC ACID
(C) STRANDEDNESS: SINGLE
(D) TOPOLOGY: LINEAR
(ii) MOLECULE TYPE: Oligonucleotide (xi) SEQu~N~ DESCRIPTION: SEQ ID NO:9:
A~AAAGCTTG CCATGGCCCT GCTACTG 27 (2) INFORMATION FOR SEQ ID NO:10:
(i) SEQU~N~ CHARACTERISTICS
(A) LENGTH: 57 BASE PAIRS
(B) TYPE: NUCLEIC ACID
(C) STRANDEDNESS: SINGLE
(D) TOPOLOGY: LINEAR
(ii) MOLECULE TYPE: Oligonucleotide W O 96~9522 . PCTnUS96/09572 (xi~ SEQ~N~ DESCRIPTION: SEQ ID NO:10:

(2) lN~O~IATION FOR SEQ ID NO:11:
(i) SEQ~N~ CHARAC~ERISTICS
(A) LENGTH: 27 BASB PAIRS
(B) TYPE: NUCLEIC ACID
(C) STRANDEDNESS: SINGLE
(D) TOPOLOGY: LINEAR
(ii) MOLECULE TYPE: Oligonucleotide (xi) SEQUENCE DESCRIPTION: SEQ _D NO:11:
F~AAGCTTA GAATGAAGTT CATCTCG 27 (2) INFORMATION FOR SEQ ID NO:12:
(i) SEQ~N~ CHARACTERISTICS
(A) LENGTH: 54 BASE PAIRS
(B) TYPE: N~CLEIC ACID
(C) STRANDEDNESS: SINGLE
(D) TOPOLOGY: LINEAR
(ii) MOLECULE TYPE: Oligonucleotide (xi) SEQUENCE DESCRIPTION: SEQ ID NO:12:
CGCTCTAGAT TAAGCGTAGT CTGGGACGTC GTATGGGTAG GGAATCTTTC T~ l' 54 (2) INFORMATION FOR SEQ ID NO:13:
(i) SEQUENCE CHARACTERISTICS
(A) LENGTH: 36 BASE PAIRS
(B) TYPE: N~CLEIC ACID
(C) STRAN~N~SS: SINGLE
(D) TOPOLOGY: LINEAR
(ii) MOLECULE TYPE: Oligonucleotide (xi) SEQUENCE DESCRIPTION: SEQ ID NO:13:
CGC'GGGATCC GCCATCATGG CCCTGCTACT GGCCCT 36 (2) INFORMATION FOR SEQ ID NO:14:
(i) SBQUBNCE CHARACTERISTICS
(A) LBNGTH: 29 BASE PAIRS
(B) TYPE: NUCLEIC ACID
(C) STRANDEDNESS: SINGLE
(D) TOPOLOGY: LINBAR

W 0~6~9522 PCTAJ5~ 3 (ii) MOLECULE TYPE: Oligonucleotide (xi) SEQUENCE DESCRIPTION: SEQ ID NO:14:
C~,GCGGTACC TGGCTGCACG GTCCATAGG 29 (:2) INFORMATION FOR SEQ ID NO:15:
(i) SE~N~ CHARACTERISTICS
(A) LENGTH: 35 BASE PAIRS
(B) TYPE: NUCLEIC ACID
(C) STR~NDEDNESS: SINGLE
(D) TOPOLOGY: LINEAR
(ii) MOLECULE TYPE: Oligonucleotide (xi) SEQUENCE DESCRIPTION: SEQ ID NO:15:

(:2) INFORMATION FOR SEQ ID NO:16:
(i) SEQUEN OE CHARACTERISTICS
(A) LENGTH: 27 BASE PAIRS
(B) TYPE: NUCLEIC ACID
(C) STR~NDEDNESS: SINGLE
(D) TOPOLOGY: LINEAR
(ii) MOLECULE TYPE: Oligonucleotide (xi) SEQUENCE DESCRIPTION: SEQ ID NO:16:

CA 02222280 l997-ll-2;i W O 96~9522 PCT~US9CI~5iL

INDICATIONS RE ~ ~ING TO A DErOSITED MICRO ORGANISM
(PCT Rule 13L~is) A. ~he indications made belo v relate to the microorganism referred to in Ihe description on page 5 , line 23 lB. IDENTI~ICATION OF DEPOSIT Further deposits are identified on an a~ innql sheet Name of dcp~sit;lly institution AMERIC~N TYPE C~LTU~ Ct T~T~ TIoN
Address of d~po:.ild- ~ institution (including postal code and counJry) 12301 Parklawn Drive R~ckville, Maryland 20852 United States of America Date of depositAccession Number No~vember 11, 1994ATCC 75947 C. ADDITIONAL INDICATIONS (l~ave blank if not app&cablc) This information is r, nn-inued on an 3~ iti nnql sheet O
D~ Plasmid, 374~801 D. DESiC.NATED STATES FOR WHIC~ INDICATIONS ARE MADE (if tfie i ' - are~ notfot all dcsignated S~ates) E. SEPARATEF~NISHINGOFINDICATIONS (leavcblankifnot nrr!; ", Thein~tir~qti,nnclistedbelcwwillbesubmittedtotheInternationalBureaulater(speci~ egcn~ta/natureofthei~ n~i c.g.,"Acccssion Numb~r of Dcposit~) For receivinn Office use only For Intcrnational Bureau use only O lllis sheet was received with the international application O l~is shcct was received by the International Bureau on:

Authori;~cd officcr/~ulhoriacd olIicer form l'C~'/KO,~l 3 t (I uh, 199~) --56.1--W 0516~9S22 PCT~US96/09572 INDICATIONS RELATING TO A DEI'OSITED MICROORGANISM
(PCI' Rule 13bts) A. The indications made below relate to the microorganism referred to in lhe description on page 5 , line 22 1~. IDENTIEICATION OF DEPOSIT Furlher deposits are identified on an aAA~ n~l sbeet O
Name of depositary hl .liluliu"
AMER~C~N TYPE CULTU~ Ct~T ,T F~CI IC~
Address of del~osild,~ ~ _lil..(;.... (includ;ng postal codcand country) 12301 Parklawn Drive Rockville, Maryland 20852 United States of Arnerica Date of àeposit Acoession Number Nove~r~ber 11, 1994 ATCC 75948 C. ADDITIONAL INDICATIONS (/eave blank if not applicablc) This inforrnation is ~r ~; ~ed on an aA~A ~ n~l sheet ~NA l?lasmid, 374~797 D. DESIGNATED STATES FOR WHICH INDICATIONS ARE MADE (if the indicafions arenotforall lcsignafed Sfafes) E. SEPARATEFURNISHINGOFINDICATIONS (/eaveblankifnot nrr~
TheindicationslistedbelowwillbesubmittedtotheInternalionalBureaulater (specifythegeneralnatureoftheindicationsGg., ~Accession Number of Depositn) For receivin~ OfGce use oniy For International Bureau use only This shect was received with the internalional application C~ This sheet was received by the International Bureau on:

Aulhorizcd oh lcer ~.ulhorized of Gcer Form PCI'/RO/13~ (July 1992) --56.2--

Claims (20)

WHAT IS CLAIMED IS:

1. An isolated polynucleotide comprising a member selected from the group consisting of:
(a) a polynucleotide encoding the polypeptide as set forth in SEQ ID NO: 2;
(b) a polynucleotide encoding the polypeptide as set forth in SEQ ID NO:4;
(b) a polynucleotide capable of hybridizing to and which is at least 70% identical to the polynucleotide of (a) or (b); and (c) a polynucleotide fragment of the polynucleotide of (a), (b) or (c).

2. The polynucleotide of Claim 1 wherein the polynucleotide is DNA.

3. The polynucleotide of Claim 2 which encodes the polypeptide comprising amino acid 1 to 81 of SEQ ID NO:2.

4. The polynucleotide of Claim 2 which encodes the polypeptide comprising amino acid 1 to 87 of SEQ ID NO:4.

5. The polynucleotide of Claim 2 comprising a nucleotide sequence selected from the group consisting of SEQ ID NO:1 or SEQ ID NO:2.

6. An isolated polynucleotide comprising a member selected from the group consisting of:
(a) a polynucleotide which encodes a mature polypeptide encoded by the DNA contained in ATCC Deposit No. 75948;
(b) a polynucleotide which encodes a mature polypeptide encoded by the DNA contained in ATCC Deposit No. 75947;

(c) a polynucleotide capable of hybridizing to and which is at least 70% identical to the polynucleotide of (a) or (b); and (d) a polynucleotide fragment of the polynucleotide of (a), (b) or (c).

7. A vector containing the DNA of Claim 2.

8. A host cell genetically engineered with the vector of Claim 7.

9. A process for producing a polypeptide comprising:
expressing from the host cell of Claim 8 the polypeptide encoded by said DNA.

10. A process for producing cells capable of expressing a polypeptide comprising transforming or transfecting the cells with the vector of Claim 7.

11. A polypeptide selected from the group consisting of (i) a polypeptide having the deduced amino acid sequence of SEQ ID NO:2 and fragments, analogs and derivatives thereof; (ii) a polypeptide having the deduced amino acid sequence of SEQ ID NO:4 and fragments, analogs and derivatives thereof; (iii) a polypeptide encoded by the cDNA of ATCC Deposit No. 75948 and fragments, analogs and derivatives of said polypeptide; and (iv) a polypeptide encoded by the cDNA of ATCC Deposit No. 75947 and fragments, analogs and derivatives of said polypeptide.

12. A compound effective as an agonist for the polypeptide of claim 11.

13. A compound effective as an antagonist against the polypeptide of claim 11.

14. A method for the treatment of a patient having need of Ck.beta.-11 comprising: administering to the patient a therapeutically effective amount of the polypeptide of claim 11.

15. The method of Claim 14 wherein said therapeutically effective amount of the polypeptide is administered by providing to the patient DNA encoding said polypeptide and expressing said polypeptide in vivo.

16, A method for the treatment of a patient having need of Ck.alpha.-1 comprising: administering to the patient a therapeutically effective amount of the compound of claim 12.

17. A method for the treatment of a patient having need to inhibit a chemokine polypeptide comprising:
administering to the patient a therapeutically effective amount of the antagonist of Claim 13,

18, A process for diagnosing a disease or a susceptibility to a disease related to expression of the polypeptide of claim 11 comprising:
determining a mutation in the nucleic acid sequence encoding said polypeptide.

19, A diagnostic process comprising:
analyzing for the presence of the polypeptide of claim 11 in a sample derived from a host,

20, A method for identifying compounds which bind to and activate or inhibit a receptor for the polypeptide of claim 11 comprising:
contacting a cell expressing on the surface thereof a receptor for the polypeptide, said receptor being associated with a second component capable of providing a detectable signal in response to the binding of a compound to said receptor, with a compound to be screened under conditions to permit binding to the receptor; and determining whether the compound binds to and activates or inhibits the receptor by detecting the presence or absence of a signal generated from the interaction of the compound with the receptor.