CA2220670A1 - Human inhibitor of apoptosis gene 1 - Google Patents

Abstract

A human inhibitor of apoptosis polypeptide and DNA (RNA) encoding such polypeptide and a procedure for producing such polypeptide by recombinant techniques is disclosed. Also disclosed are methods for utilizing such polypeptide for the treatment of degenerative diseases, rheumatoid arthritis, septic shock, as an antiviral defense mechanism and to prevent the death of cells during trauma and strokes. Antagonists against such polypeptides and their use as a therapeutic to promote cell development, kill viral infections, promote tissue differentiation and development and maintain tissue homeostasis are also disclosed (tumors). Diagnostic methods for detecting mutations in the nucleic acid sequence encoding hIAP-1 protein are also disclosed.

Description

W 096135703 PCTnUS95/05922 H~ N I~nHIBITOR OF APOPTOSIS GENE 1 Thi invention relates to newly identified polynucleotides, polypeptides encoded by such polynucleotides, the use of such polynucleotides and polypeptides, as well as the production of such polynucleotides and polypeptides. More particularly, the polypeptide of the present invention is human inhibitor of apoptosis gene 1, sometimes hereinafter referred to as "hIAP-l". The invention also relates to inhibiting the action of such polypeptides.
PrOYL~ cell death (apoptosis) is a process through .which organisms get rid of unwanted cells. Proyr~r ~ cell death can be considered as a specific type of terminal cell differentiation. During apoptosis, the cells of an organism round up and they have active blebbing at the cell surface, forming apoptotic bodies, the nuclear membranes and some internal structures break down, the nuclear DNA is fragmented by enzymes, and finally the cell breaks into pieces.
The early studies of apoptosis provided that drugs that block protein synthesis prevent apoptosis, suggesting that progr~mm~ cell death requires specific proteins. A key aid in finding the gene encoding the protein which is responsible for apoptosis was the emergence in the 1980's of the tiny, transparent round worm Caenorhabditis elegans as a valuable W 096/35703 PCTrUS95/05922 resource for identifying genes active in embryonic development. This microscopic worm has only 1,090 cells, and development biologists, therefore, were able to trace the lineage of each cell as the worm matures, and found that 131 of the embryonic cells undergo programmed cell death. Among the genes identified in C.elegans where the death genes ced-3 and ced-4, as well as ced-9, an "anti-death" gene which protects cells from apoptosis.
The search for m~mm~l ian analogs to these genes had a breakthrough with the discovery that the gene bc1-2, which had been identified as a cancer-causing oncogene, protects ;mm--ne cells call lymphocytes from suicide and protects neurons as well. The worm protection gene, ced-9, was found to be 23~ homologous to bc1-2, and the bc1-2 gene could substitute for ced-9 in C. elegans, rescuing ced-9 mutants from cell death.
Further, a match was found between the ced-3 and a new m~mm-lian gene which coded for interleukin- ~-converting enzyme (ICE). The two proteins share 28~ identity at the amino acid level, and ced-3 is identical to ICE protein in a five amino acid stretch thought to be the active site responsible for ICE's protease activity.
Apoptosis may be induced by a variety of different extracellular and intracellular stimuli, some of which are still unknown, which can differ dep~n~; ng on cell type.
However, the numerous receptors and associated signal transduction pathways that respond to each different induction stimulus may converge on one or more of a limited number of pathways that actually "trigger" the p-o~ d~ll for apoptotic cell death. Among the stimuli which can induce apoptosis, there is extracellular ATP, actinomycin and oxygen radicals. Actinomycin inhibits the synthesis of RNA and induces apoptosis in some m~mm~lian cell types, including human primary uterine epithelial cells and HL60 leukemic cells (Gerschenson, L.~. and Rotello, R.J., Cold Spring W 096/35703 PCTnUS95/05922 Harbor, Laboratory Press, Cold Spring Harbor, New York, page 175, (1991) and Martin, S.J., et al., Immunol., 145:1859 ( 1990 ) ) .
The baculovirus, Cydia pomonella granulosis virus o (CpGV), was able to inhibit apoptosis in SF-21 cells (derived from the fall army worm Spodoptera frugiperda) from a mutated baculovirus AcMNPV which causes apoptosis in SF-21 cells in the absence of CpGV. The CpGV gene was sequenced (Crook, N.E. et al., J. Virol., 67:2168 (1993)) and found to have a characteristic zinc finger-like moti~. The gene was named iap for inhibitor of apoptosis, and the CpGV gene was called the Cp- IAP.
The zinc finger-like motif ~ound in the Cp-IAP
polypeptide belongs to a specific class of zinc finger-like motifs (Freemont, P.S. et al., Cell, 64:483 (1991)) usually ~ound at the amino terminus of polypeptides, but it can occur elsewhere, as in the case of the IAP polypeptide, where it is found at the carboxyl terminus. The IAP motif also contains an additional CX2C repeat in the amino-terminal portion of the motif, as well as an extra amino acid residue in the central region (CXHX3C instead of CXHX2C). There are approximately 27 known proteins co~t~;n;ng this type of zinc finger-like motif, four are found in baculoviruses. The zinc finger-like motif in also present in several proteins encoded by vertebrate viruses. The presence of the motif in several regulatory proteins supports the hypothesis that many of the proteins cont~;n;ng this motif may be transcriptional regulatory factors, although DNA b; n~; ng has been ~mon~trated thus far for only one particular member of this group (Tagawa, et al., J. Biol. Chem., 265:20021 (1990)).
The zinc finger-like motif found in Cp-IAP is also present in a number of cellular polypeptides that may have a role in regulating apoptosis. Several of these are encoded by hllm~n proto-oncogenes such as PM~, bmi-l, c-cbl, rfp and mel -18 .

W 096/3S703 PCTrUS95/05922 These proteins are involved in either positive or negative apoptotic control. Thus, Cp-IAP may belong to a class of cellular proteins which control apoptosis and contain this distinctive zinc finger-like motif. The polypeptide of the present invention contains the conserved zinc finger-like motifs and has been putatively identified as a member of this class of proteins.
Apoptosis has been shown to play a significant role in cell development, antiviral responses, tissue differentiation, development, tissue homeostasis, Al~h~; m~' S
disease, rheumatoid arthritis, septic shock, Parkinson's disease and may be a mech~n;sm by which cells die during strokes, trauma and degenerative diseases. Improper apoptosis, i.e., when cells fail to die when they should, may result in tumors, oncogenesis and viral infection.
In accordance with one aspect of the present invention, there is provided a novel mature polypeptide as well as biologically active and diagnostically or therapeutically useful fragments, analogs and derivatives thereof. The polypeptide of the present invention is of human origin.
In accordance with another aspect of the present invention, there are provided isolated nucleic acid molecules encoding a polypeptide of the present invention including mRNAs, DNAs, cDNAs, genomic DNAs as well as analogs and biologically active and dia~nostically or therapeutically useful fragments and derivatives thereof.
In accordance with yet a further aspect of the present invention, there is provided a process for producing such polypeptide by recombinant techniques comprising culturing recombinant prokaryotic and/or eukaryotic host cells, cont~;n;ng a nucleic acid sequence, under conditions promoting expression of said protein and subsequent recovery of said protein.
In accordance with yet a further aspect of the present invention, there is provided a process for utilizing such W 096/35703 PCTrUS95105922 polypeptide, or polynucleotide encoding such polypeptide ~or therapeutic purposes, for example, for preventing oncogenesis, to treat Al7he;m~'s disease, Parkinson's disease, rheumatoid arthritis, septic shock and to prevent the death of cells during strokes, trauma and degenerative diseases.
In accordance with yet a further aspect of the present invention, there is also provided nucleic acid probes comprising nucleic acid molecules of sufficient length to specifically hybridize to nucleic acid sequences of the present invention.
In accordance with yet a further aspect of the present invention, there are provided antibodies against such polypeptide8.
In accordance with yet another aspect of the present invention, there are provided compounds which bind to and inhibit such polypeptides, which may be used, for example, as an anti-viral defense mech~n;~, to allow cell development, tissue differentiation, tissue homeostasis and normal devel~,l,e"L .
In accordance with still another aspect of the present invention, there are provided processes for employing the disclosed polynucleotides and polypeptides for research purposes.
These and other aspects of the present invention should be apparent to those skilled in the art from the teachings herein.
The following drawings are illustrative of embo~;m~ntR
of the invention and are not meant to limit the scope of the invention as encompassed by the claims.
Figure 1 illustrates the cDNA sequence and correspo~;ng deduced amino acid sequence of the polypeptide of the present invention. The s~n~d abbreviations for nucleotides and amino acids are used. Sequencing was performed using a 373 automated DNA sequencer (Applied Biosystems, Inc.). .

WO 96/35703 PCTrUS95/05922 Figure 2 is an amino acid sequence alignm~nt of hIAP-1 with Cp-IAP (Cydia po-mnnella granulosis virus inhibitor of apoptosis) and Op-IAP (Orgyia pseudotsugata nuclear polyhedrosis virus inhibitor of apoptosis).
In accordance with an aspect of the present invention, there is provided an isolated nucleic acid (polynucleotide) which ~nco~c for the mature polypeptide having the deduced amino acid sequence of Figure 1 (SEQ ID NO:2) or for the mature polypeptide encoded by the cDNA of the clone deposited as ATCC Deposit No. - on May 11, 1995.
A polynucleotide encoding a polypeptide of the present invention may be obt~in~ from human jurket cell lines and human osteoclastoma stromal cells. It is structurally related to the ;nh; h; tor of apoptosis gene family. It cont~;n~ an open reading frame encoding a protein of 438 amino acid residues. The protein ~h;h;ts the highest degree of homology to Op-IAP with 44 ~ identity and 64 % simil~rity over the entire amino acid stretch. As stated previously, the conserved motifs found in genes of this type are preserved in the gene of the present invention.
The polynucleotide of the present invention may be in the form of RNA or in the form of DNA, which DNA includes cDNA, genomic DNA, and synthetic DNA. The DNA may be double-stranded or single-stranded, and if single stranded may be the coding strand or non-coding (anti-sense) strand. The coding sequence which encodes the mature polypeptide may be identical to the coding sequence shown in Figure 1 (SEQ ID
NO:1) or that of the deposited clone or may be a different coding sequence which coding sequence, as a result of the r~nn~ncy or degeneracy of the genetic code, ~nco~s the same mature polypeptide as the DNA of Figure 1 (SEQ ID NO:1) or the deposited cDNA.
The polynucleotide which Pnco~c for the mature pol~eptide of Figure 1 (SEQ ID NO:2) or for the mature polypeptide encoded by the deposited cDNA may include, but is W 096/35703 PCTrUS95/05922 not limited to: only the coding ~equence for the mature polypeptide; the coding sequence for the mature polypeptide and additional coding sequence; the coding sequence for the mature polypeptide (and optionally additional coding ~ sequence) and non-coding sequence, such as introns or non-coding sequence 5' and/or 3' of the coding sequence for the mature polypeptide.
Thus, the term "polynucleotide encoding a polypeptide"
encompasses a polynucleotide which includes only coding sequence for the polypeptide as well as a polynucleotide which includes additional coding and/or non-coding sequence.
The present invention further relates to variants of the hereinabove described polynucleotides which encode for fragments, analogs and derivatives of the polypeptide having the deduced amino acid sequence of Figure 1 ( SEQ ID NO:2) or the polypeptide encoded by the cDNA of the deposited clone.
The variant of the polynucleotide may be a naturally occurring allelic variant of the polynucleotide or a non-naturally occurring variant of the polynucleotide.
Thus, the present invention includes polynucleotides encoding the same mature polypeptide as shown in Figure 1 (SEQ ID NO:2) or the same mature polypeptide ~ncnA~A by the cDNA of the deposited clone as well as variants of such polynucleotides which variants ~.ncgA~ for a fragment, derivative or analog of the polypeptide of Figure 1 (SEQ ID
NO:2) or the polypeptide encoded by the cDNA of the deposited clone. Such nucleotide variants include deletion variants, substitution variants and addition or insertion variants.
As hereinabove indicated, the polynucleotide may have a c~;ng sequence which is a naturally occurring allelic variant of the coding sequence shown in Figure 1 (SEQ ID
NO:l) or of the coding sequence of the deposited clone. As known in the art, an allelic variant is an alternate form of a polynucleotide sequence which may have a substitution, deletion or addition of one or more nucleotides, which does W 096/35703 PCTrUS95/05922 not substantially alter the ~unction of the encoded polypeptide.
The polynucleotides of the present invention may also have the coding sequence fused in ~rame to a marker sequence which allows for purification of the polypeptide of the present invention. The marker sequence may be a hexa-histidine tag supplied by a pQE-9 vector to provide for purification of the mature polypeptide fused to the marker in the case of a bacterial host, or, for example, the marker sequence may be a hem~gglutinin (HA) tag when a ~-mm~ n host, e.g. COS-7 cell~, is used. The HA tag corresponds to an epitope derived from the influenza hemagglutinin protein (Wilson, I., et al., Cell, 37:767 (1984)).
The present invention further relates to polynucleotides which hybridize to the her~;n~hove-described se~lencPs if there is at least 70~, preferably at least 90~, and more preferably at least 95~ identity between the sequences. The present invention particularly relates to polynucleotides which hybridize under stringent conditions to the hereinabove-described polynucleotides. As herein used, the term "stringent conditions" means hybridization will occur only if there is at least 95% and preferably at least 97% identity between the se~-ences. The polynucleotides which hybridi~e to the herein~hove described polynucleotides in a preferred ~mho~m~nt ~nco~P polypeptides which either retain subst~nt~Ally the same biological function or activity as the mature polypeptide encoded by the cDNAs o~ Figure 1 (SEQ ID NO:l) or the deposited cDNA(s).
Alternatively, the polynucleotides may have at least 20 bases, preferably 30 bases and more preferably at least 50 bases which hybridize to a polynucleotide of the present invention and which have an identity thereto, as her~n~h~ve described, which may or may not retain activity. Such polynucleotides may be employed as probes for the polynucleotide of SEQ ID NO: 1, or for variants thereof, for W 096135703 PCTrUS95/05922 example, for recovery of the polynucleotide or as a diagnostic probe or as a PCR primer.
Thus, the present invention is directed to polynucleotides having at least a 70~ identity, preferably at least 90% and more preferably at least a 95% identity to a polynucleotide which ~ncoA~s the polypeptide of SEQ ID NO:2 as well as fragments thereo~, which ~ragments have at least 30 bases and preferably at least 50 bases and to polypeptides encoded by such polynucleotides.
The deposit(s) referred to herein will be ~-,ntA,nPA
under the terms of the Budapest Treaty on the International Recognition of the Deposit of Micro-org~n~ cmc for purposes of Patent Procedure. These deposits are provided merely as convenience to those of skill in the art and are not an admission that a deposit is required under 35 U.S.C. 112.
The sequence of the polynucleotides cont~ n~A in the deposited materials, as well as the amino acid sequence of the polypeptides encoded thereby, are incorporated herein by reference and are controlling in the event of any conflict with any description of se~l~nc~s herein. A license may be required to make, use or sell the deposited materials, and no such license is hereby granted.
The present invention further relates to a polypeptide which has the deduced amino acid sequence of Figure 1 (SEQ ID
NO:2) or which has the amino acid seguence ~ncoA~A by the deposited cDNA, as well as fragments, analogs and derivatives of such polypeptide.
The terms ~Ifragment,~ derivative~ and ~analog" when referring to the polypeptide of Figure 1 (SEQ ID NO:2) or that encoded by the deposited cDNA, means a polypeptide which retains esspnt~lly the same biological function or activity as such polypeptide. Thus, an analog includes a ~L~rotein which can be activated by cleavage of the proprotein portion to produce an active mature polypeptide.

W O 96/35703 PCTrUS95/05922 The polypeptide of the present invention may be a recomh;n~nt polypeptide, a natural polypeptide or a synthetic polypeptide, preferably a recombinant polypeptide.
The fragment, derivative or analog of the polypeptide of Figure 1 (SEQ ID NO:2) nor that encoded by the deposited cDNA may be ~i) one in which one or more of the amino acid residues are substituted with a conserved or non-conserved amino acid residue (preferably a conserved amino acid residue) and such substituted amino acid residue may or may not be one encoded by the genetic code, or (ii) one in which one or more of the amino acid residues includes a substituent group, or (iii) one in which the mature polypeptide is fused with another compound, such as a compound to increase the half-life of the polypeptide (for example, polyethylene glycol), or (iv) one in which the additional amino acids are fused to the mature polypeptide which are employed for purification of the mature polypeptide or a ~l~rotein sequence. Such fragments, derivatives and analogs are deemed to be within the scope of those skilled in the art from the teachings herein.
The polypeptides and polynucleotides of the present invention are preferably provided in an isolated form, and preferably are purified to homogeneity.
The polypeptides of the present invention include the polypeptide of SEQ ID NO.2 (in particular the mature polypeptide) as well as polypeptides which have at least 70%
s~m; l~rity (preferably a 7096 identity) to the polypeptide of SEQ ID NO:2 and more preferably a 90% sim~l~rity (more preferably a 90~ identity) to the polypeptide of SEQ ID NO:2 and still more preferably a 95% s~m~l~rity (still more preferably a 95~ identity) to the polypeptide of SEQ ID NO:2 and to portions of such polypeptide with such portion of the polypeptide generally cont~ n~ at least 30 amino acids and more preferably at least 50 amino acids.

As known in the art l~si m;l~rityll between two polypeptides is determined by co~r~ing the amino acid sequence and conserved amino acid substitutes thereto of the polypeptide to the sequence of a ~econd polypeptide.
Fragments or portions of the polypeptides of the present invention may be employed for producing the correspo~; n~
full-length polypeptide by peptide synthesis, therefore, the ~ragments may be employed as intenmediates for pro~nc~ ng the full-length polypeptides. Fra~ments or portions of the polynucleotides of the present invention may be used to synthesize ~ull-length polynucleotides of the present invention.
The term "isolated" means that the material is ~ ~ved from its original envil~ -nt (e.g., the natural envilu~ t if it is naturally occurring). For example, a naturally-occurring polynucleotide or polypeptide present in a living ~n;~-l iS not isolated, but the same polynucleotide or polypeptide, separated from some or all of the coexisting materials in the natural system, is isolated. Such polynucleotides could be part of a vector and/or such polynucleotides or polypeptides could be part of a composition, and still be isolated in that such vector or r~ro~ition is not part o~ its natural envi~
The term "gene" means the segment o$ DNA involved in pro~llr;ng a polypeptide chain; it includes regions pr~r~ing and ~ollowing the coding region "leader and trailer~ as well as intervening sequences (introns) between individual ro~;ng se_ nt~ (exons).
The present invention also relates to vectors which include polynucleotides of the present invention, host cells which are genetically engineered with vectors of the invention and the production of polypeptides of the invention by recombinant techniques.
Host cells are genetically engineered (transduced or transformed or transfected) with the vectors of this W 096/35703 PCTrUS95/05922 invention which may be, for example, a cloning vector or an expression vector. The vector may be, for example, in the form of a plasmid, a viral particle, a phage, etc. The engineered host cells can be cultured in conventional nutrient media modified as appropriate for activating promoters, selecting transformants or amplifying the hIAP-l genes. The culture conditions, such as temperature, pH and the like, are those previously used with the host cell selected for expression, and will be apparent to the ordinarily skilled artisan.
The polynucleotides of the present invention may be employed ~or pro~llr, n~ polypeptides by recomh~n~nt techniques. Thus, for example, the polynucleotide may be included in any one of a variety of expression vectors for expressing a polypeptide. Such vectors include chromosomal, nonchromosomal and synthetic DNA sequences, e.g., derivatives of SV40; bacterial plasmids; phage DNA; baculovirus; yeast plasmids; vectors derived from ccmh; n~tions of plasmids and phage DNA, viral DNA such as vaccinia, adenovirus, fowl pox virus, and pseudorabies. However, any other vector may be used as long as it is replicable and viable in the host.
The d~lo~.iate DNA sequence may be inserted into the vector by a variety of procedures. In general, the DNA
sequence is inserted into an d~lv~Liate restriction Pn~nnll~lease site(s) by procedures known in the art. Such procedures and others are deemed to be within the scope of those skilled in the art.
The DNA sequence in the expression vector is operatively linked to an d~v~liate expression control sequence(s) (promoter) to direct mRNA synthesis. As representative examples of such promoters, there may be mentioned: LTR or SV40 promoter, the E. coli. lac or trp, the phage 1~h~ PL
promoter and other promoters known to control expression of genes in prokaryotic or eukaryotic cells or their viruses.
The expression vector also cnnt~n~ a ribosome bin~;ng site W O 96/35703 PCTrUS95/05922 for translation initiation and a transcription terminator.
The vector m~y also include appropriate sequences ~or amplifying expression.
In addition, the expression vectors preferably contain one or more selectable m~rke~ genes to provide a phenotypic trait ~or selection of transformed host cells such as dihydrofolate reductase or neomycin resistance for eukaryotic cell culture, or such as tetracycline or ampic;ll; n resistance in E. coli.
The vector c~nt~;n;ng the appropriate DNA sequence as herP~n~hove described, as well as an appropriate promoter or control sequence, may be employed to transform an d~ro~iate host to permit the host to express the protein.
As representative examples of a~Lu~Liate hosts, there may be mentioned: bacterial cells, such as E. coli, strePtom~ces~ Salmonella tY~h~mll~ium; fungal cells, such as yeast; insect cells such as DrosoPhila S2 and SPodoptera S~9;
~n i m~ 1 cells such as CHO, COS or Bowes mel ~nom~;
adenoviruses; plant cells, etc. The selection of an appropriate host is deemed to be within the scope of those skilled in the art from the teachings herein.
More particularly, the present invention also includes re~srh;n~nt constructs comprising one or more of the sequences as broadly described above. The constructs comprise a vector, such as a plasmid or viral vector, into which a sequence of the invention has been inserted, in a forward or reverse orientation. In a preferred aspect o~ this Pmbo~;mPnt~ the construct further comprises regulatory sequences, including, for example, a ~Lc..l~Ler, operably linked to the sequence. Large numbers of suitable vectors and promoters are known to those of skill in the art, and are ro~m~cially available. The following vectors are provided by way of example; Bacterial: pQE70, pQE60, pQE-9 (Qiagen), pBS, pD10, phagescript, psiX17g, pbluescript SK, pbsks, pNH8A, pNH16a, pNH18A, pNH46A (Stratagene); ptrc99a, pKK223-W096/35703 PCTrUS95tOS922 3, pKK233-3, pDR540, pRIT5 (Pharmacia); Eukaryotic: pWLNEO, pSV2CAT, pOG44, pXT1, pSG (Stratagene) pSVK3, pBPV, pMSG, pSVL (Pharmacia). However, any other plasmid or vector may be used as long as they are replicable and viable in the host.
Promoter regions can be selected from any desired gene using CAT (chloramphenicol transferase) vectors or other vectors with selectable markers. Two appropriate vectors are pKK232-8 and pCM7. Particular named bacterial promoters include lacI, lacZ, T3, T7, gpt, l~mhr~ PR~ PL and trp.
Eukaryotic promoters include CMV ;mm~ te early, HSV
thymidine kinase, early and late SV40, LTRs from retrovirus, and mouse metallothionein-I. Selection of the appropriate vector and promoter is well within the level of ordinary skill in the art.
In a ~urther embo~m~nt, the present invention relates to host cells contA~n;ng the above-described constructs. The host cell can be a higher eukaryotic cell, such as a m~ lian cell, or a lower eukaryotic cell, such as a yeast cell, or the host cell can be a prokaryotic cell, such as a bacterial cell. Introduction of the construct into the host cell can be effected by calcium phosphate transfection, DEA~-Dextran mediated transfection, or electroporation (Davis, L., Dibner, M., Battey, I., Basic Methods in Molecular Biology, (1986)).
The constructs in host cells can be used in a conventional m-nne~ to produce the gene product ~nco~ by the recombinant sequence. Alternatively, the polypeptides of the invention can be synthetically produced by conventional peptide synthesizers.
Mature proteins can be expressed in m~mm~ n cells, yeast, bacteria, or other cells under the control of appropriate promoters. Cell-free translation systems can also be employed to produce such proteins using RNAs derived from the DNA constructs of the present invention.

W 096/35703 PCTrUS9~105~2Z
Appropriate cloning and expression vectors ~or use with prokaryotic and eukaryotic hosts are described by Sambrook, et al., Molecular Cloning: A Laboratory ~nll~l, Second Edition, Cold Spring ~hor, N.Y., (1989), the disclosure o~
which is hereby incorporated by reference.
Transcription o~ the DNA encoding the polypeptides of - the present invention by higher eukaryotes is increased by inserting an Pnh~ncer sequence into the vector. Rnh~n~erS
are cis-acting elPm~nts of DNA, usually about from 10 to 300 bp that act on a promoter to increase its transcription.
~xamples including the SV40 Pnh~n~r on the late side of the replication origin bp 100 to 270, a cyt~ ovirus early promoter Pnh~ncer~ the polyoma enh~cer on the late side o~
the replication origin, and adenovirus ~nh~ncers.
Generally, rero~b~n~nt expression vectors will include origins of replication and selectable m~rke~s permitting transformation of the host cell, e.g., the ampi~ ; n resistance gene of E. coli and S. cerevisiae TRP1 gene, and a promoter derived from a highly-expressed gene to direct transcription of a downstream structural sequence. Such promoters can be derived ~rom operons encoding glycolytic enzymes such as 3-phosphoglycerate kinase ~PGK), ~-~actor, acid phosphatase, or heat shock proteins, among others. The heterologous structural sequence is assem~led in d~' ~' iate phase with translation initiation and termination sequences.
Optionally, the heterologous sequence can Pn~o~P a fusion protein including an N-terminal i~Pnt;fication peptide imparting desired characteristics, e.g., st~h;l~zation or simplified puri~ication of expressed re~omh;n~nt product.
U~eful expression vectors for bacterial use are constructed by inserting a structural DNA sequence encoding a desired protein together with suitable translation initiation and termination signals in operable r~; ng phase with a functional promoter. The vector will comprise one or more phenotypic selectable markers and an origin of CA 02220670 l997~ll~lO
W 096/35703 PCTrUS95/05922 replication to ensure maintenance of the vector and to, if desirable, provide amplification within the host. Suitable prokaryotic hosts for transformation include E. coli, Bacillus subtilis, S~lmnn~lla tYn~;ml-rium and various species within the genera Psel-A~On~, Streptomyces, and Staphylococcus, although others may also be employed as a matter of choice.
As a representative but nonlimiting example, useful expression vectors for bacterial use can comprise a selectable marker and bacterial origin of replication derived from commPrcially available pl ~c,m;Ac comprising genetic elements of the well known cloning vector pBR322 (ATCC
37017). Such commercial vectors include, for example, pKK223-3 (Pharmacia Fine Chemicals, Uppsala, Sweden) and GEM1 (Promega Biotec, Madison, WI, USA). These pBR322 "backh~n~'l sections are com.bined with an a~lu~riate promoter and the structural sequence to be expressed.
Following transformation of a suitable host strain and growth of the host strain to an ~lu~Liate cell density, the selected promoter is induced by a~u~Liate means (e.g., temperature shift or chemical induction) and cells are cultured for an additional period.
Cells are typically harvested by centrifugation, disrupted by physical or chemical means, and the resulting crude extract re~inPA for further purification.
Microbial cells employed in expression of proteins can be disrupted by any convenient method, including freeze-thaw cycling, sonication, mechanical disruption, or use of cell lysing agents, such methods are well know to those skilled in the art.
Various m~r~l;An cell culture systems can also be employed to express recom.~inant protein. Examples of m:~mm~l ian expression systems include the COS-7 lines of monkey kidney fibroblasts, described by Gluzman, Cell, 23:175 (1g81), and other cell lines c~p~hle of expressing a compatible vector, for example, the C127, 3T3, CHO, HeLa and BHK cell lines. ~mm~ n expression vectors will comprise an origin of replication, a suitable promoter and ~nh~ncer, and also any necessary ribosome h; n~; ng sites, ~ polyadenylation site, splice donor and acceptor sites, transcriptional termination sequences, and 5~ ~lanking nontranscribed se~l~n~. DNA sequences derived from the Sv40 splice, and polyadenylation sites may be used to provide the required nontranscribed genetic el~m~nts.
The polypeptide can be recovered and purified from recombinant cell cultures by methods including Amm~;um sulfate or ethanol precipitation, acid extraction, anion or cation exchange chromatography, phosphocellulose chromatography, hydrophobic interaction chromatography, affinity chromatography, hydroxylapatite chromatography and lectin chrom tography. Protein refolding steps can be used, as necessary, in com.pleting configuration of the mature protein. Finally, high perfon~ance liquid chromatography (HPLC) can be employed for final purification steps.
The polypeptides of the present invention may be a naturally purified product, or a product of chemical synthetic procedures, or produced by recnmh; n~nt techniques from a prokaryotic or eukaryotic host (for example, by bacterial, yeast, higher plant, insect and m~mm~ n cells in culture). Depending upon thç host employed in a recn~h;n~nt production procedure, the polypeptides of the present invention may be glycosylated or may be non-glycosylated.
Polypeptides o~ the invention may also include an initial methionine amino acid residue.
The hIAP-1 polypeptides and ;nh; h; tory compounds, described below, which are polypeptides may also be employed in accordance with the present invention by expression of such polypeptides in vivo, which is referred to as "gene therapy.ll W 096/35703 PCTnUS95/05922 Thus, for example, cells from a patient may be engineered with a polynucleotide (DNA or RNA) encoding a polypeptide ex vivo, with the engineered cells then being provided to a patient to be treated with the polypeptide.
Such methods are well-known in the art and are apparent ~rom the teachings herein. For example, cells may be engineered by the use of a retroviral plasmid vector cont~n;ng RNA
encoding a polypeptide of the present invention.
S;m; 1 ~rly, cells may be engineered in vivo for expression of a polypeptide in vivo by, for example, procedures known in the art. For example, a packaginy cell is transduced with a retroviral plasmid vector cont~;ning RNA
encoding a polypeptide of the present invention such that the packaging cell now produces in~ectious viral particles cont~;n~ng the gene of interest. These producer cells may be ~m;n; stered to a patient ~or engineering cells in vi~o and expression of the polypeptide in vivo. These and other methods for ~m; n; stering a polypeptide of the present invention by such method should be apparent to those skilled in the art from the teachings of the pre~ent invention.
Retroviruses from which the retroviral plasmid vectors her~;n~hove mentioned may be derived include, but are not limited to, Moloney Murine Leukemia Virus, spleen necrosis virus, retroviruses such as Rous Sarcoma Virus, Harvey Sarcoma Virus, avian leukosis virus, gibbon ape leukemia virus, human ;mmllnodeficiency virus, adenovirus, Myeloproli~erative Sarcoma Virus, and mammary tumor virus.
In one ~mhoA; m~nt, the retroviral plasmid vector is derived from Moloney Murine Leukemia Virus.
The vector includes one or more promoters. Suitable promoters which may be employed include, but are not limited to, the retroviral LTR; the SV40 promoter; and the human cytomegalovirus (CMV) promoter described in Miller, et al., Biotechni~ues, Vol. 7, N0:9, 980-990 (1989), or any other promoter (e.g., cellular promoters such as eukaryotic WO 9613571~3 PCT/US95~05922 cellular promoters including, but not limited to, the histone, pol III, and ~-actin promoters). Other viral promoters which may be employed include, but are not limited to, adenovirus promoters, thymidine kinase (TK) promoters, and B19 parvovirus promoters. The selection of a suitable promoter will be apparent to those skilled in the art from ~ the teachings contained herein.
The nucleic acid sequence encodiny the polypeptide of the present invention is under the control of a suitable promoter. Suitable promoters which may be employed include, but are not limited to, adenoviral ~LG-I,oLers, such as the adenoviral major late promoter; or heterologous promoters, such as the cytomegalovirus (CMV) promoter; the respiratory syncytial virus (RSV) promoter; ~ n~llr; hle promoters, such as the MMT promoter, the metallothionein promoter; heat shock promoters; the ~lhllm~ n promoter; the ApoAI promoter; human globin promoters; viral thymidine kinase promoters, such as the Herpes Simplex thymidine kinase ~l~.,.oLer; retroviral LTRs (including the modified retroviral LTRs her~in~hnve described); the ~-actin promoter; and human growth hormone promoters. The promoter also may be the native promoter which controls the gene ~ncoA; ng the polypeptide.
The retroviral plasmid vector is employed to transduce packaging cell lines to form pro~llc~ cell lines. Examples of packaging cells which may be transfected include, but are not limited to, the PE501, PA317, ~-2, ~-AM, PA12, T19-14X, VT-19-17-H2, ~CRE, ~CRIP, GP+E-86, GP+envAml2, and DAN cell lines as described in Miller, Human Gene Thera~y, Vol. 1, pgs. 5-14 (1990), which is incorporated herein by reference in its entirety. The vector may transduce the packaging cells through any means known in the art. Such means include, but are not limited to, elect~ol~tion, the use of liposomes, and CaPO4 precipitation. In one alternative, the retroviral plasmid vector may be encapsulated into a W 096/35703 PCTrUS95/05922 liposome, or coupled to a lipid, and then A~m~n~stered to a host.
The producer cell line generates infectious retroviral vector particles which include the nucleic acid sequence(s) encoding the polypeptides. Such retroviral vector particles then may be employed, to transduce eukaryotic cells, either in vi tro or in vivo . The transduced eukaryotic cells will express the nucleic acid sequence(s) encoding the polypeptide. Eukaryotic cells which may be transduced include, but are not limited to, embryonic stem cells, embryonic carc; n~ cells, as well as hematopoietic stem cells, hepatocytes, fibroblasts, myoblasts, keratinocytes, endothel~Al cells, and bronrh;Al epithPl;Al cells.
Once the hIAP-1 polypeptide is being expressed intra-cellularly via gene therapy, it may be employed to treat neurodegenerative diseases caused by abnormal apoptosis of neurons, for example, Al~hP~mP~'s disease and Parkinson's disease.
hIAP-1 may also be employed to prevent cells from dying during trauma such as head injury and strokes.
The hIAP-1 protein of the present invention may also be employed to prevent abnormal apoptosis which leads to rheumatoid arthritis.
hIAP-1 polypeptide may also be employed to prevent oncogenesis which results frDm abnormal apoptosis.
In accordance with yet a further aspect of the present invention, there is provided a process for utilizing such polypeptides, or polynucleotides encoding such polypeptides, for in vitro purposes related to scientific research, synthesis of DNA and manufacture of DNA vectors. For example, the gene and gene product may be employed as a research tool for discovering diagnostic and therapeutic treatments for human disease and to shed light on the process of apoptosis in hnm~n~

W O 96/3~703 PcTnuS95/05922 Fragments o~ the ~ull length hIAP-1 gene may be used as a hybridization probe $or a cDNA library to isolate the ~ull length hIAP-1 gene and to isolate other yenes which have a high sequence s~m;l~3nity to the hIAP-1 gene or similar biological activity. The probes are at least 20 bases in length, preferably at least 30 and most preferably at least 50. The probe may also be used to identify a cDNA clone corresponding to a full length transcript and a genomic clone or clones that cont~; n the complete hIAP-1 gene including regulatory and promotor regions, exons, and introns. An example of a screen comprises isolating the coding region of the hIAP-1 gene ~y using the known DNA sequence to synthesize an oligonucleotide probe. Labeled oligonucleotides having a sequence complementary to that of the gene of the present invention are used to screen a library of human cDNA, genomic DNA or mRNA to determine which me~bPrs of the library the probe hybridizes to.
This invention is also related to the use of the hIAP-1 gene as a ~ nostic. Detection of a mutated ~orm o~ hIAP-1 will allow a diagnosis of a disea~e or a susceptibility to a disease which results from underexpression of hIAP-1.
Individuals carrying mutations in the human hIAP-1 gene may be detected at the DNA level by a variety of techniques.
Nucleic acids for diagnosis may be obt~;n~ from a patient's cells, such as from blood, urine, sali~a, tissue biopsy and autopsy material. The genomic DNA may be used directly for detection or may be ampli~ied enzymatically by using PCR
(Saiki et al., Nature, 324:163-166 (1986)) prior to analy~is.
RNA or cDNA may also be used for the same purpose. As an example, PCR primers complementary to the nucleic acid encoding hIAP-l can be used to i-lPnt;fy and analyze hIAP-1 mutations. For example, deletions and insertions can be detected by a change in size of the amplified product in comparison to the normal genotype. Point mutations can be identified by hybridizing amplified DNA to radiolabeled hIAP-W 096/35703 PCTrUS95/05922 1 RNA or alternatively, radiolabeled hIAP-1 antisense DNA
se~l~nc~s. Perfectly matched sequences can be distinguished from mismatched duplexes by RNase A digestion or by differences in melting temperatures.
Sequence differences between the re~erence gene and genes having mutations may be revealed by the direct DNA
se~l~nc;ng method. In addition, cloned DNA segments may be employed as probes to detect specific DNA segments. The sensitivity of this method is greatly ~nh~nc~d when co~h;n~
with PCR. For example, a se~l~nc;ng primer is used with double-stranded PCR product or a single-stranded template molecule generated by a modified PCR. The sequence determination is performed by conventional procedures with radiolabeled nucleotide or by automatic se~l~nc;ng procedures with fluorescent-tags.
Genetic testing based on DNA sequence differences may be achieved by detection of alteration in electrophoretic mobility of DNA fragments in gels with or without denaturing agents. Small sequence deletions and insertions can be visualized by high resolution gel electrophoresis. DNA
fragments of different sequences may be disting~ h~f~ on denaturing foL,.~,~,ide gradient gels in which the mobilities of different DNA fragments are retarded in the gel at different positions according to their specific melting or partial melting temperatures (see, e.g., Myers et al ., Science, 230:1242 (1985)).
Sequence changes at specific locations may also be revealed by nuclease protection assays, such as RNase and S1 protection or the chemical cleavage method (e.g., Cotton et al., PNAS, USA, 85:4397-4401 (1985)).
Thus, the detection of a specific DNA sequence may be achieved by methods such as hybridization, RNase protection, chemical cleavage, direct DNA se~l~n~;ng or the use of restriction enzymes, (e.g., Restriction Fragment Length Polymorph;~ (RFLP)) and Sollth~r~ blotting of genomic DNA.

W 096135703 PCTrUS9510592Z
In addition to more conventional gel-electrophoresis and DNA se~uencing, mutations can also be detected by in situ analysis.
The present in~ention also relates to a diagnostic assay ~or detecting altered levels of hIAP-1 protein in various tissues since an over-expression of the proteins compared to normal control tissue samples can detect the presence of conditions related to abnormally high apoptosis. Assays used to detect levels of hIAP-1 protein in a sample derived from a host are well-known to those of skill in the art and include radio; ~lno~says, competitive -h; n~;ng assays, Western Blot analysis and preferably an ELISA assay. An ELISA assay initially comprises preparing an antibody speci~ic to the hIAP-1 antigen, preferably a monoclonal ~nt, hody. In addition a reporter ~nt; ho~y is prepared against the monoclonal antibody. To the reporter antibody is attached a detectable reagent such as radioactivity, fluorescence or in this example a horseradish peroxidase enzyme. A sample is now lt,..o~ed from a host and incubated on a solid support, e.g. a polystyrene dish, that binds the proteins in the sample. Any free protein h; n~; ng sites on the dish are then covered by incubating~with a non-specific protein like BSA. Next, the monoclonal antibody is incubated in the dish during which time the monoclonal antibodies attach to any hIAP-1 proteins att~ ch~ tO the polystyrene dish. All unbound monoclonal ~nt; hody iS ~ h~ out with buffer. The ~e~olLer antibody linked to horser~i ch peroxidase is now placed in the dish resulting in h; n~; ng of the reporter antibody to any monoclonal antibody bound to hIAP-1. Unattached reporter antibody is then w~ch~ out.
Peroxidase substrates-are then added to the dish and the amount o~ color developed in a given time period is a measurement of the amount of hIAP-1 protein present in a given volume of patient sample when ~compared against a stAn~rd curve.

W 096/35703 PCT/U~J'~5922 A competition assay may be employed wherein antibodies specific to hIAP-1 is attached to a solid support and labeled hIAP-1 and a sample derived from the host are passed over the solid support and the amount of label detected attached to the solid support can be correlated to a quantity of hIAP-l in the sample.
This invention provides a method of screening compounds to identify those which block the ;nh; h; tion of apoptosis by hIAP-1. For example, SF-21 cells are trans~ected with a known gene which causes apoptosis, for example, ~nn;h;l~tor mutant DNA from vAcAnh or vP35Z. The compound to be tested and hIAP are then r~nt~cted with the cell, either intracellularly or extracellularly. A survey is then done of the cells under a light microscope three to four days after co-transfection, and the usual characteristics of an apoptotic cell is checked and the ability of the compound to prevent the action of hIAP is analyzed.
~ l1m~n IAP-1 is produced and functions intra-cellularly, therefore, any ;nh; h; tory compounds must function intra-cellularly. These c~"l~o~ds include antibodies which are produced intracellularly. For example, an antibody identified as ;nh; h; ting hIAP-l may be produced intracellularly as a single chain antibody by procedures known in the art, such as transforming the d~ u~liate cells with DNA ~nco~;ng the single chain ~nt;hoAy to ~LeveL~t the function of hIAP-l.
Another example is an antisense construct prepared using antisense technology used to control gene expression through triple-h~ formation or antisense DNA or RNA, both of which methods are based on h; nrl;ng of a polynucleotide to DNA or RNA. For example, the 5~ coding portion of the polynucleotide sequence, which ~nco~s for the mature polypeptides of the present invention, is used to design an antisense RNA oligonucleotide of from about 10 to 40 base pairs in length. A DNA oligonucleotide is designed to be W O ~6/35703 PCTAUS~5~'~5922 Complem-~nt~ry to a region o~ the gene involved in transcription (triple helix -see hee et al., NUCl. Acids Res., 6:3073 (1979); Cooney et al, Science, 241:456 (1988);
and Dervan et al., Science, 251: 1360 (1991)), thereby preventing transcription and the production o~ hIAP-1. The antisense RNA oligonucleotide hybridizes to the mRNA in ~ivo ~ and blocks translation of the mRNA molecule into hIAP-1 polypeptide (Antisense - Okano, J. Neurochem., 56:560 (1991);
Oligodeoxynucleotides as Antisense Tnh; h~ tors of Gene Expression, CRC Press, Boca Raton, FL (1988)). The oligonucleotides described above can also be delivered to cells such that the antisense RNA or DNA may be expressed in vivo to i nhi hi t production of hIAP-1.
Another example includes a mutated fonm, or mutein, of hIAP-1 which recognizes hIAP-1 substrates but has ;mrA; red function so as not to prevent apoptosis.
Another example i~ a small molecule which is able to pass through the cell membrane and bind to hIAP-1 and prevent its bioloyical activity. Examples of small molecules include but are not limited to small peptides or peptide-like molecules.
These compounds may be employed to inh;h;t the action of hIAP-1 and prevent tumors since oncogenesis results when cells ~ail to undergo apoptosis at the d~' ~liate time.
The action of hIAP-1 may also be ; nh; h;ted by these c~...~o~lds for the promotion of cell development to allow apoptosis to kill viral infected cells, and to stim~llAte tissue differentiation and development. The compounds may also be employed to ~-int~;n tissue homeostasis.
The cc...~o~lds may be employed in cQmh;n~tion with a suitable pharmaceutical carrier. Such compositions comprise a therapeutically effective amount of the co-l-~o~d, and a pharmaceutically acceptable carrier or excipient. Such a carrier includes but is not limited to ~Al ;ne, buffered saline, dextrose, water, glycerol, ethanol, and ro~h;nAtions W 096/3S703 PCTrUS95/05922 thereo~. The $onmulation should suit the mode of A~m;n;StratiOn.
The invention also provides a pharmaceutical pack or kit comprising one or more cont~;ners filled with one or more of the ingredients of the pharmaceutical compositions of the invention. Associated with such contA;n~r(s) can be a notice in the form prescribed by a gover~m~nt~l agency regulating the manufacture, use or sale of pharmaceuticals or biological products, which notice reflects d~' ~val by the agency of manufacture, use or sale for human A~m;n; ~tration. In addition, the compounds may be employed in conjunction with other therapeutic compounds.
The pharmaceutical composition~ may be A~; n;stered in a convenient mAnn~r such as by the oral, topical, intravenous, intraperitoneal, intramuscular, subclltAneous, intrAnA~Al or intradermal routes. The pharmaceutical compositions are A~m;n;stered in an amount which is effective for treating and/or prophylaxis of the specific indication.
In general, they are A~; n;stered in an amount of at least about 10 ~g/kg body weight and in most cases they will be A~m;n;~tered in an amount not in excess of about 8 mg/Kg body weight per day. In most cases, the dosage is from about 10 ~g/kg to about 1 mg/kg body weight daily, taking into account the routes of ~m;n;stration, symptoms, etc.
The se~lenc~fi of the present invention are also valuable for chromosome identification. The sequence is specifically targeted to and can hybridize with a particular location on an individual human chromosome. Moreover, there is a current need for i~nt;fying particular sites on the chromosome. Few chromosome marking reagents based on actual se~uence data (repeat polymorph;smc) are presently avA;l~hle for mArk;ng chromosomal location. The mapping of DNAs to chromosomes according to the present invention is an important first step in correlating those sequences with genes associated with disease.

W 096135703 PCTlUbgS~'v~922 Brie~ly, sequences can be mapped to chromosomes by preparing PCR primers (preferably 15-25 bp) from the cDNA.
Computer analysis of the 3' untranslated region o~ the gene is used to rapidly select primers that do not span more than one exon in the genomic DNA, thus complicating the àmplification process. These primers are then used $or PCR
screening of somatic cell hybrids con~n~n~ individual human chromosomes. Only those hybrids cont~;n~ng the human gene corresponding to the primer will yield an amplified fragment.
PCR mapping of somatic cell hybrids is a rapid procedure for assigning a particular DNA to a particular chromosome.
Using the present invention with the same oligonucleotide primers, sublor~l~7~tion can be achieved with r~n~ls of fra~ent~ ~rom speci~ic chromosomes or pools of large genomic clones in an analogous ~nn~r Other mapping strategies that can s~m~l~ly be used to map to its chromosome include in situ hybridization, prescreening with labeled flow-sorted chromosomes and preselection by hybridization to construct chromosome specific-cDNA libraries.
Fluorescence in situ hybridization (FISH) of a cDNA
clone to a met~ph~se chromosomal spread can be used to provide a precise chromosomal location in one step. This technique can be used with cDNA as short as 50 or 60 bases.
For a review of this technique, see Verma et al., ~n~-n a~o..~osomes: a M~nll~l of Basic Techniques, Pe~y~ l Press, New York ~1988).
Once a sequence has been mapped to a precise chromosomal location, the physical position of the sequence on the chromosome can be correlated with genetic map data. Such data are ~ound, for example, in V. McKusick, M~n~eli~n Inheritance in Man (available on line tl~ouyll Johns Hopkins University Welch Medical Library). The relatio~ch~r between genes and diseases that have been mapped to the same chromosomal region are then identified through linkage analysis (coinheritance of physically adjacent genes).

W 096/35703 PCTrUS95/05922 Next, it is necessary to determine the differences in the cDNA or genomic sequence between a~ected and una~fected individuals. If a mutation is observed in some,or all of the affected individuals but not in any normal individuals, then the mutation is likely to be the causative agent of the disease.
With current resolution of physical mapping and genetic mapping techniques, a cDNA precisely localized to a chromosomal region associated with the disease could be one of between 50 and 500 pot~nt;;7l causative genes. (This assumes 1 megabase mapping resolution and one gene per 20 kb).
The polypeptides, their frar3mpnt~ or other derivatives, or analogs thereof, or cells expressing them can be used as an ;mmnnogen to produce ;7nt;ho~7;es thereto. These antibodies can be, for example, polyclonal or monoclonal antibodies.
The present invention also includes çh;m-ric, single chain, and hllm-7n;zed ;7n~;ho~7;es, as well as Fab frA~r~nt.c, or the product of an Fab expression library. Various procedures known in the art m.ay be used for the production of such ;7nt;hodies and fragments.
~ nt;ho~;es generated against the polypeptides corresponding to a sequence o~ the present invention can be obtA; n~7 by direct injection of the polypeptides into an ~7n;m~-l or by r7r7m~n~tering ,the polypeptides to an ,7n;m-7l, preferably a n9nhllm7n. The Ant;ho~7y so obt;7;n~7 will then bind the polypeptides itself. In this m;7nn~r, even a sequence encoding only a fragment of the polypeptides can,be used to generate ~nt;hodies h; n~7.;ng the whole native polypeptides. Such antibodies can then be used to isolate the polypeptide from tissue expressing that polypeptide.
For preparation of monoclonal ~nt;ho~7;es, any technique which provides ;7nt;hodies produced by cont~nl70us cell line cultures can be used. Examples include the hybridoma technique (~ohler and Milstein, 1975, Nature, 256:495-497), the trioma technique, the human B-cell hybridoma technique (Kozbor et al., 1983, Tmmllnology Today 4:72), and the EBV-hybridoma technique to produce human monoclonal antibodies (Cole, et al., 1985, in Monoclonal Antibodies and ~Anc~r Therapy, Alan R. Liss, Inc., pp. 77-96).
Techniques described for the production of single chain t antibodies (U.S. Patent 4,946,778) can be adapted to produce single chain antibodies to ;~m~ln~enic polypeptide products o~ this invention. Also, transgenic An;mAls may be used to express hllm~n~zed Ant;hodies to ;mmllnogenic polypeptide products of this invention.
The present invention will be further de8cribed with reference to the following examples; however, it is to be understood that the present invention is not limited to such examples. All parts or amounts, unless otherwise specified, are by weight.
In order to facilitate understAn~i ng of the following examples certain frequently occurring methods and/or terms will be described.
"Plasmids" are designated by a lower case p preceded and/or followed by capital letters and/or n~lmh~rs The starting plasmids herein are either c~ e~cially av~;l Ahl e, publicly aVAilAhle on an unrestricted basis, or can be constructed $rom avA;lAhle plasmids in accord with pllhl;~h~
procedures. In addition, equivalent pl~s; ~ to those described are known in the art and will be apparent to the ordinarily skilled artisan.
"Digestion" of DNA refers to catalytic cleavage of the DNA with a restriction enzyme that acts only at certain sequences in the DNA. The various restriction enzymes used herein are c~Qrcially aVA;lAhle and their reaction conditions, cofactors and other requirements were used as would be known to the ordinarily skilled artisan. For the purpose of isolating DNA $ragments for plasmid construction, typically S to 50 ~g of DNA are digested with 20 to 250 units WO 96/35703 PCTrUS95/05922 of enzyme in a larger volume. A~o~iate buffers and substrate amounts for particular restriction enzymes are specified by the manufacturer. Incubation times of about 1 hour at 37 C are ordinarily used, but may vary in accordance with the supplier~s instructions. A~ter digestion the reaction is electrophoresed directly on a polyacrylamide gel to isolate the desired fragment.
Size separation of the cleaved fra~m~nt~ is per~ormed using 8 percent polyacrylamide gel described by Goeddel, D.
et al ., Nucleic Acids Res., 8:4057 (1980).
"Oligonucleotides" refers to either a single stranded polydeoxynucleotide or two complPm~nt~ry polydeoxynucleotide strands which may be chemically synthesized. Such synthetic oligonucleotides have no 5' phosphate and thus will not ligate to another oligonucleotide without ~ ng a phosphate with an ATP in the presence of a kinase. A synthetic oligonucleotide will ligate to a fragment that has not been dephosphorylated.
"Ligationn refer~ to the process of forming phosphodiester bonds between two double stranded nucleic acid fragments (Maniatis, T., et al., Id., p. 146). Unless otherwise provided, ligation may be accompl~shl~ u~ing known buffers and conditions with 10 units of T4 DNA ligase ("ligase") per 0.5 ~g of approximately equimolar amounts of the DNA fra_ - ts to be ligated.
Unless otherwise stated, transformation was performed as described in the method of Graham, F. and Van der Eb, A., Virology, 52:456-457 (1973).
ExamPle 1 Bacterial Ex~ression and Purification of hIAP-1 The DNA sequence encoding hIAP-1, ATCC # , is initially amplified using PCR oligonucleotide primers correspon~ng to the 5' and 3' end ~equences of the processed hIAP-1 gene (minus the signal peptide sequence) and the vector sequences 3' to the hIAP-1 gene. Additional W 096135703 PCT~US95/05922 nucleotides corresponding to hIAP-1 are added to the 5~ and 3' sequences respectively. The 5' oligonucleotide primer has the sequence 5~ GATCGGATCCATGAGTACTGA~GAAGCC~G 3~ (SEQ ID
NO:3) co~t~;n~ a BamHI restriction enzyme site ~ollowed by 20 nucleotides of hIAP-1 ro~; ng sequence starting from the presumed terminal amino acid o~ the processed protein. The 3~ sequence 5~ GACTGGAl~-l~-l-l-lA~G~G~ATGTACG 3~ (SEQ ID
NO:4) contains complen-nt~ry sequences to a BamHI site. The restriction enzyme sites correspond to the restriction enzyme sites on the bacterial expression vector pQE-9 (Qiagen, Inc.
Chatsworth, CA). pQE-9 Pnco~Pc ~nt;h~otic resistance ~Ampr), a bacterial origin of replication (ori), an IPTG-regulatable promoter operator (P/O), a ribosome h;n~;ng site (R8S), a 6-His tag and restriction enzyme sites. pQE-9 is then digested with BamHI and dephosphorylated. The ampli~ied se~l~n~s are ligated into pQE-9 and are inserted in frame with the sequence ~nro~ng for the hist~ne tag and the RBS. The ligation mixture is then used to transform E. coli strain M15/rep 4 (Qiagen, Inc.) by the procedure described in Sambrook, J. et al., Molecular Cloning: A Laboratory ~n Cold Spring Laboratory Press, (1989). M15/rep4 cont~;n~
multiple copies of the plasmid pREP4, which expresses the lacI repressor and also con~ers kanamycin resistance (Kan').
Transformants are identified by their ability to grow on L8 plates and ampicillin/kanamycin resistant colonies are selected. Plasmid DNA is isolated and confirmed by restriction analysis. Clones con~;n;ng the desired constructs are grown overnight (O/N) in liquid culture in LB
media supplemented with both Amp (100 ug/ml) and Xan (25 ug/ml). The O/N culture is used to inoculate a large culture at a ratio of 1:100 to 1:250. The cells are grown to an optical density 600 (O.D.~) o~ between 0.4 and 0.6. IPTG
(''Is~lo~yl-B-D-thiogalacto pyranoside") is th~n ~ to a final conc~ntration of 1 mM. IPTG induces by inactivating the lacI repressor, clearing the P/O l~;ng to increased W 096135703 PCTrUS95/05922 gene e~pression. Cells are grown an extra 3 to 4 hours.
Cells are then harvested by centrifugation. The cell pellet is solubilized in the chaotropic agent 6 Molar Guanidine HCl.
A$ter clari~ication, solubilized hIAP-1 protein is purified from this solution by chromatography on a Nickel-Chelate column under conditions that allow for tight h; ncl;ng by proteins cont~n;ng the 6-His tag (Hochuli, E. et al., J.
Chromatography 411:177-184 (1984)). hIAP-1 (50~ pure) is eluted from the column in 6 molar guanidine HCl pH 5.0 and for the purpose of renaturation adjusted to 3 molar guanidine HCl, lOOmM sodium phosphate, 10 mmolar glutathione (reduced) and 2 mmolar glutathione (oxidized). After incubation in this solution $or 12 hours the protein i~ dialyzed to 10 mmolar sodium phosphate.
Example 2 Cloninq and exPression of hIAP-1 usinq the baculovirus exPression system The DNA sequence encoding the full length hIAP-1 protein, ATCC # , is amplified using PCR oligonucleotide primers correspon~ng to the 5' and 3' end se~l~nc~C of the gene:
The 5' primer has the sequence 5' GCA6A~ AGATCTGG
TCACCATGAGTACTG 3' (SEQ ID NO:5) and cont~inc a BglII
restriction enzyme site (in bold) followed by 25 nucleotides res~mhl~ng an efficient signal for the initiation of translation in eukaryotic cells (Kozak, M., J. Mol. Biol., 196:947-950 (1987) which is just behind the hIAP-1 gene (the initiation codon for translation "ATG" is underlined).
The 3~ primer has the sequence 5' GCAGA~ l-lAAGAGAGAAA
TGTACG 3' (SEQ ID NO:6) and contains the cleavage site for the restriction ~n~nnl~clease BglII and 19 nucleotides complem~nt~y to the 3' non-translated sequence of the hIAP-1 gene. The amplified sequence~ are isolated from a 1~ agarose gel using a commercially available kit ("Geneclean," BIO 101 Inc., La Jolla, Ca.). The ~ragment is then digested with the W 096/35703 PCTnUS95/05922 ~n~nnrlease BglII and then puri~ied again on a 1~ agaro~e gel. This ~ragment is designated F2.
The vector pRG1 (modi~ication o~ pVL941 vector, discussed below) is used for the expression o~ the hIAP-1 - protein using the baculovirus expression system (for review see: Summers, M.D. and Smith, G.E. 1987, A ~-n~ l o~ methods for baculovirus vectors and insect cell culture procedures, Texas Agricultural Exper;~n~l Station Bulletin NO:1555).
This expression vector cont~;nc the strong polyhedrin promoter of the Autographa californica nuclear polyhedrosis virus ~AcMNPV) ~ollowed by the recognition sites for the restriction ~n~nnllclea~e BamHI. The polyadenylation site of the simian virus (SV)40 is used for efficient polyadenylation. For an easy selection of reromh;n~nt virus the beta-galactosidase gene from E.coli is inserted in the same orientation as the polyhedrin promoter followed by the polyadenylation signal o$ the polyhedrin gene. The polyhedrin sequences are flanked at both sides by viral se~l~nce for the cell-mediated homologous reC~mh;n~tion of cotransfected wild-type viral DNA. Many other baculovirus vectors could be used in place of pRG1 such as pAc373, pVL941 and pAcIM1 ~Luckow, V.A. and Summers, M.D., Virology, 170:31-39)-The pl~cm;~ is digested with the restriction enzyme BamHI and dephosphorylated using calf intestinal phosphatase by procedures known in the art. The DNA is then isolated from a 1% agarose gel using the co~cially available kit (~Geneclean" BIO 101 Inc., La Jolla, Ca.). This vector DNA
is designated V2.
Fragment F2 and the dephosphorylated plasmid V2 are ligated with T4 DNA ligase. E.coli B 101 cells are then transformed and bacteria identified that cont~;ne~ the plasmid (pBac hIAP-1) with the hIAP-l gene in the correct orientation using PCR. The se~uence of the cloned fragment is confirmed by DNA se~l~nC~ n~ .

W 096/35703 PCTrUS9~/05922 5 ~g of the plasmid pBac hIAP-1 is cotransfected with 1.0 ~g of a commercially av~ hl e l~np~rized baculovirus ("BaculoGold~ baculovirus DNA", Pharmingen, San Diego, CA.) using the lipofection method (Felgner et al. Proc. Natl.
Acad. Sci. USA, 84:7413-7417 (1987)).
l~g o~ BaculoGold~ virus DNA and 5 ~g of the plasmid pBac hIAP-1 are m~eA in a sterile well of a microtiter plate ~ont~n~ng 50 ~l of serum free Grace~s medium (Life Technologies Inc., Gaithersburg, MD). Afterwards 10 ~l Lipofectin plus 90 ~l Grace's medium are added, mixed and incubated ~or 15 minutes at room temperature. Then the transfection mixture is added drop-wise to the Sf9 insect cells (ATCC CRL 1711) seeded in a 35 mm tissue culture plate with 1 ml Grace's medium without serum. The plate is rocked back and forth to mix the newly added solution. The plate is then incubated for 5 hours at 27~C. After 5 hours the transfection solution is removed from the plate and 1 ml of Grace's insect medium supplemented with 10% fetal calf serum iS A AA~A, The plate is put back into an incubator and cultivation cont~nlleA at 27~C for four days.
After four days the supernatant is collected and a plaque assay performed s~m;l~r as described by Summers and Smith (supra). AS a modification an agarose gel with ~Blue Gal" (Life Technologies Inc., Gaithersburg) is used which allows an easy isolation of blue st~n~A plaques. (A
detailed de~cription of a "plaque assay" can also be ~ound in the user's guide for insect cell culture and baculovirology distributed by Life Technologies Inc., Gaithersburg, page 9-10) .
Four days after the serial dilution, the virus is ~AAeA
to the cells and blue st~n~ plaques are picked with the tip of an Eppendorf pipette. The agar cont~;n~ng the recomh;n~nt viruses is then resuspended in an Eppendorf tube c~nt~t n~ ng 200 ~l of Grace's medium. The agar is removed by a brief centrifugation and the supernatant cont~n~ng the recorhtn~nt W 096/35703 PCT/U~gS~5922 baculovirus is used to in~ect S~9 cells seeded in 35 mm dishes. Four days later the supernatant~ of these culture dishes are harvested and then stored at 4~C.
S~9 cells are grown in Grace's medium supplemented with 10~ heat-inactivated FBS. The cells are infected with the recomh;n~nt baculovirus V-hIAP-1 at a multiplicity of infection (MOI) of 2. Six hours later the medium is removed and replaced with SF900 II medium minus methionine and cysteine (Life Technologies Inc., Gaithersburg, MD). 42 hours later 5 ~Ci of 35S-methionine and 5 ~Ci 35S cysteine (Amersham) are added. The cells are further incubated for 16 hours be~ore they are harvested by centrifugation and the labelled proteins visualized by SDS-PAGE and autoradiography.
ExamPle 3 ExPression of Recomh;n~nt hIAP-1 in COS cells The expression of plasmid, hIAP-1 HA is derived from a vector pcDNAI/Amp (Invitrogen) cont~;n;ng: 1) SV40 origin of replication, 2) ampic;ll ;n resistance gene, 3) E.coli replication origin, 4) CMV promoter followed by a polyl;nk~
region, an SV40 intron and polyadenylation site. A DNA
fragment encoding the entire hIAP-1 precursor and a HA tag fused in frame to its 3' end is cloned into the polyl; nker region of the vector, therefore, the recombinant protein expression is directed under the CMV promoter. The HA tag corresponds to an epitope derived from the influenza hemagglllt~n;n protein as previously described (I. Wilson, H.
Niman, R. Heighten, A Cherenson, M. Connolly, and R. Tern~, 1984, Cell 37:767, (1984)). The infusion of HA tag to the target protein allows easy detection of the recomh;n~nt protein with an antibody that recognizes the HA epitope.
The plasmid construction strategy is described as ~ollows:
The DNA sequence encoding hIAP-1, ATCC # , is constructed by PCR using two primers: the 5' primer 5' GCAGATCTGCAATGAGTACTGAAGAAGCC 3~ (SEQ ID NO:7) ~ont~;n~ a W 096/35703 PCTrUS95/05922 BglII site followed by 21 nucleotides o~ hIAP-1 coding seguence starting from the initiation codon; the 3' sequence 5~ GCAGAl~-l-l~AAGCGTA~l~-l~GGA~l~lATGGGTAAGAGAGA~ATGT
ACGAACAGT 3' (SEQ ID NO:8) cont~;ns compl~ment~ry se~l~nce~
to a BglII site, translation stop codon, HA tag and the last 21 nucleotides of the hIAP-1 coding sequence (not including the stop codon). Therefore, the PCR product cont~;n~ a BglII
site, hIAP-1 co~;ng sequence followed by HA tag fused in frame, a translation termination stop codon next to the HA
tag, and a BglII site. The PCR amplified DNA fragment is digested with BglII and the vector, pcDNA1/Amp digested with BamHI restriction enzyme are ligated. The ligation mixture is transformed into E. coli strain XL-1-Blue (Stratagene Cloning Systems, La Jolla, CA) the transformed culture is plated on ampi~ n media plates and resistant colonies are selected.
Plasmid DNA is isolated from transformants and ~min~d by restriction analysis for the presence of the correct fragment. For expression of the reco~h;n~n~ hIAP-1, COS
cells are transfected with the expression vector by DEAE-DEXTRAN method (J. Sa~ ook, E. Fritsch, T. Maniatis, Molecular Cloning: A Laboratory ~nll~l, Cold Spring Lahoratory Press, (1989)). The expression of the hIAP-1 HA
protein is detected by radiolah~ll;ng and ~ noprecipitation method (E. Harlow, D. Lane, Antibodies: A Laboratory ~nn~l, Cold Spring ~rhor Laboratory Press, (1988)). Cells are l~helled for 8 hours with 35S-cysteine two days post trans~ection. Culture media is then collected and cells are lysed with detergent (RIPA buffer (150 mM NaCl, 1% NP-40, 0.1~ SDS, 1% NP-40, 0.5% DOC, 50mM Tris, pH 7.5) (Wilson, I.
et al., Id. 37:767 (1984)). Both cell lysate and culture media are precipitated with an HA specific monoclonal ~n~;ho~y. Proteins precipitated are analyzed on 15% SDS-PAGE
gels.
Exa~ le 6 Ex~ression o~ hIAP-1 ~ia Gene Therapy Fibroblasts are obtA~nP~ ~rom a subject by skin biopsy. The resulting tissue is placed in tissue-culture medium and separated into small pieces. Small chunks of the tissue are placed on a wet surface of a tis~ue culture flask, approximately ten pieces are placed in each flask. The flask is turned upside down, closed tight and left at room ~ temperature over night. After 24 hours at room temperature, the flask is inverted and the chunks of tissue rem.ain fixed to the bottom of the flask and fresh media (e.g., Ham~s F12 me~; ~A, with 10% FBS, penic;ll; n and streptomycin, is a~e~.
This is then incubated at 37~C for a~roximately one week.
At this time, ~resh ~ is added and subsequently changed every several days. After an additional two weeks in culture, a monolayer of fibroblasts emerge. The monolayer is trypsinized and scaled into laryer flasks.
pMV-7 (Kirschmeier, P.T. et al, DNA, 7:219-25 (1988) flanked by the long terminal repeats of the Moloney murine sarcoma virus, is digested with EcoRI and HindIII and subsequently treated with calf intestinal phosphatase. The l;nPA~ vector is fractionated on agarose gel and purified, using glass beads.
The cDNA Pnro~;ng a polypeptide of the present invPnt;on is amplified using PCR primers which correspond to the 5' and 3' end se~lpnrp~c respectively. The 5~ primer contA;n;ng an EcoRI site and the 3' primer having ront~A;nC a HindIII site.
Equal quantities of the Moloney murine sarcoma virus l; neA~
hAckhonP and the EcoRI and HindIII ~ragment are A~P~
together, in the presence of T4 DNA ligase. The resulting mixture is m~;ntA;ne~ under conditions a~Liate for ligation of the two fra~mPntc. The ligation mixture is used to transform bacteria B 101, which are then plated onto agar-c~ntA;n;ng kanamycin for the purpose of confirming that the vector had the gene of interest properly inserted.
The amphotropic pA317 or GP+am.12 packaging cells are yLo~ n in tissue culture to confluent density in Dulbecco's W 096/35703 PCTrUS95/05922 Modi~ied Eagles Medium (DMEM) with 1096 cal~ ~;erum (CS), penicillin and streptomycin. The MSV vector cont~;ning the gene is then added to the media and the packaging cells are transduced with the vector. The packaging cells now produce infectious viral particles cont~;n~ng the gene (the packaging cells are now referred to as producer cells).
Fresh media is added to the transduced producer cells, and subsequently, the media is harvested from a 10 cm plate o~ confluent producer cells. The spent media, cont~;n~ng the infectious viral particles, is fil~ered through a millipore ~ilter to remove detached producer cells and this media is then used to infect fibroblast cells. Media is removed from a sub-confluent plate of fibroblasts and quickly replaced with the media from the producer cells. This media is ,oved and replaced with ~resh media. If the titer of virus is high, then virtually all fibroblasts will be infected and no selection is required. If the titer is very low, then it is necessary to use a retroviral vector that has a selectable marker, such as neo or his.
The engineered fibroblasts are then injected into the host, either alone or a~ter having been grown to confluence on cytodex 3 microcarrier beads. The fibroblasts now produce the protein product.
Numerous modifications and variations of the present invention are possible in light of the above teachings and, therefore, within the scope of the appended claims, the invention may be practiced otherwise than as particularly described.

W 096135703 PCT~US95/05922 ~U~N~ LISTING
(1) ~N~R ~L INFORMATION:
(i) APPLICANT: HE, ET AL.
(ii) TITLE OF lNv~NllON: Human Inhibitor of Apoptosi~
Gene 1 (iii) N ~3ER OF SEQU~S: 8 (iv) CORRESPONDBNCE ~nn~ s:
(A) ~nnR~SEE: CARELLA, BYRNE, BAIN, GILFILLAN, CECCHI, STEWART ~ OLSTEIN
(B) STREET: 6 BECKER FARM ROAD
(C) CITY: ROSELAND
(D) STATE: NEW JERSEY
(E) ~O~ : USA
(F) ZIP: 07068 (v) CO~U1~K READABLE FORM:
(A) MEDIUM TYPE: 3.5 INCH DIS
(B) COM~ul~K: IBM PS/2 (C) OPERATING ~;y~ : MS-DOS
(D) SOFTWARE: WORD PERFECT 5.1 (vi) CURR~NT APPLICATION DATA:
(A) APPLICATION NUMBER:
(B) FILING DATE: Concurrently (C) CLASSIFICATION:
~vii) PRIOR APPLICATION DATA
(A) APPLICATION N~MBER:
(B) FILING DATE:

(viii) AllO~N~:Y/AGENT INFORMATION:
(A) NAME: FERRARO, GREGORY D.
(B) REGISTRATION NUMBER: 36,134 (C) REFERENCE/DOCKET N~MBER: 325800-292 (ix) TELECOMMUNICATION INFORMATION:
(A) TELEPHONE: 201-994-1700 (B) TELEFAX: 201-994-1744 (2) INFORMATION FOR SEQ ID NO:1:
(i) SEQU~N~ CHARACTERISTICS
(A) LENGTH: 1435 BASE PAIRS
(B) TYPE: NUCLEIC ACID
(C) STR~NDEDNESS: SINGLE
(D) TOPOLOGY: LINEAR

W 096/35703 PCTrUS95/05922 (ii) MOLECULE TYPE: cDNA
(xi) SEQu~N~ DESCRIPTION: SEQ ID NO:1:
AGTTATGCAA TGAGTACTGA AGAAGCCAGA ~Ll l~l 1ACCT ACCATATGTG GCCATTAACC 60 'llLll~l~AC CATCAGAATT GGr~Ar.~r.CT ~lll-L-lATT AT~T~r~rArC TGGAGATAGG 120 GTAGCCTGCT TTGCCTGTGG TGGGAAGCTC AGTAACTGGG AArrAA~GGA TGATGCTATG 180 TrAr-AArArC GGAGGCATTT TCCCAACTGT CCA11111GG AAAATTCTCT ArAA~rTCTG 240 TA~1GGC~AT CTAGTGTTCC AGTTCAGCCT GAGCAGCTTG CAA~1G~1GG TTTTTATTAT 360 ~1GG~1CG~A ATGATGATGT CAAATGCTTT 1 ~L ~ ~ ~ ~ATG GTGGCTTGAG ~1~11GG~AA 420 TCTGGAGATG ATCCATGGGT Ar.~Ar~TGCC AA~1~111C CAAG~l~l~A ~l~ll~ATA 480 CGAATGA~AG GCCAAGAGTT TGTTGATGAG ATTCAAGGTA GATATCCTCA L~ . l'~L-l~AA 540 QG~1~11~1 CAACTTCAGA TACCACTGGA rAAr.AA~ATG CTr.ArCrArC AATTATTCAT 600 TTTGGACCTG r~ArAAAr~TTC TTrAr-AArAT G~ ATGA TrAATArArC l~lG~;llA~A 660 TCTGCCTTGG AAATGGGCTT T~ATAr.Ar.Ar ~1G~1~AAAC A~ACAGTTCA AAGTA~AATC 720 CTGACAACTG GAGAGAACTA TAAA~rAr.TT AATGATATTG TGTCAGCACT TCTTAATGCT 780 GAAGATGAAA AAAr.Ar~rA Gr.ArA~r.AA AAArAArCTG AAGAAATGGC ATCAGATGAT 840 TTGTCATTAA TTCGr.~ArA~ CAGAATGGCT ~1~111~AAC AATTGACATG ~L~1~1~C~1 900 A1C~ ATA A1~L111A~A GGCCAATGTA ATTAATAA~r Arr.AArATGA TATTATTAAA 960 CAAAAAACAC AGATACCTTT ACAAGCGAGA GAACTGATTG AT~CrATTTT GGTTAAArrA 1020 AATGCTGCGG CCAACATCTT r~AAAArTGT CTAAAArAAA TTGACTCTAC ATTGTATAAG 1080 AACTTATTTG Tr,r~ATA~rAA TATGAAGTAT ATTCCAACAG AAGATGTTTC AG~1~1~1~A 1140 CTGGAAGAAC AATTGAGGAG GTTGCAAGAA rAACr~AArTT GTA~AGTGTG TATGr-ArAA~ 1200 GAA~111~1G TTGTATTTAT lC~ll~l~l CAl~lG~lAG TATGCCAGGA A1~1GCCC~1 1260 TCTCTAAGAA AATGCCCTAT TTGCAGGGGT ATAATCAAGG GTA~L~11CG TACATTTCTC 1320 TCTTAAAGAA AAATAGTCTA TATTTTAACC Tr,rATAAAA~ llA~A ATA11~11~A 1380 ACACTTGAAG CCATCTAAAG TA~AAGGr.A ATTATGAGTT TTTCAATTAG TAACA 1435 (2) INFORMATION FOR SEQ ID NO:2:
(i) SE~u~N~ CHARACTERISTICS
(A) LENGTH: 438 AMINO ACIDS(B) TYPE: AMINO ACID
(C) STRAND~n~.~.~
(D) TOPOLOGY: LINEAR
(ii) MOLECULE TYPE: PROTEIN
(xi) ~QU~l~ DESCRIPTION: SEQ ID NO:2:
Met Ser Thr Glu Glu Ala Arg Phe Leu Thr Tyr His Met Trp Pro Leu Thr Phe Leu Ser Pro Ser Glu Leu Ala Arg Ala Gly Phe Tyr Tyr Ile Gly Pro Gly Asp Arg Val Ala Cys Phe Ala Cys Gly Gly Lys Leu Ser Asn Trp Glu Pro Lys Asp Asp Ala Met Ser Glu His Arg Arg His Phe Pro Asn Cys Pro Phe Leu Glu Asn Ser Leu Glu Thr Leu Arg Phe Ser Ile Ser Asn Leu Ser Met Gln Thr His Ala Ala Arg Met Arg Thr Phe Met Tyr Trp Pro Ser Ser Val Pro Val Gln Pro Glu Gln Leu Ala Ser Ala Gly Phe Tyr Tyr Val Gly Arg-Asn Asp Asp Val Lys Cys Phe Cys Cys Asp Gly Gly Leu Arg Cys W 096135703 PCT~US95/~59ZZ
Trp Glu Ser Gly Asp Asp Pro Trp Val Glu His Ala Lys Trp Phe Pro Arg Cys Glu Phe Leu Ile Arg Met Lys Gly Gln Glu Phe Val Asp Glu Ile Gln Gly Arg Tyr Pro His Leu Leu Glu Gln Leu Leu -Ser Thr Ser Asp Thr Thr Gly Glu Glu Asn Ala Asp Pro Pro Ile Ile His Phe Gly Pro Gly Glu Ser Ser Ser Glu Asp Ala Val Met ~200 205 210 Met Asn Thr Pro Val Val Lys Ser Ala Leu Glu Met Gly Phe Asn Arg Asp Leu Val Lys Gln Thr Val Gln Ser Lys Ile Leu Thr Thr Gly Glu Asn Tyr Lys Thr Val Asn Asp Ile Val Ser Ala Leu Leu A~n Ala Glu Asp Glu Lys Arg Glu Glu Glu Lys Glu Lys Gln Ala Glu Glu Met Ala Ser Asp Asp Leu Ser Leu Ile Arg Lys Asn Arg Met Ala Leu Phe Gln Gln Leu Thr CYB Val ~eu Pro Ile Leu Asp Asn Leu Leu Lys Ala A~n Val Ile Asn Lys Gln Glu His Asp Ile Ile Lys Gln Lys Thr Gln Ile Pro Leu Gln Ala Arg Glu Leu Ile Asp Thr Ile Leu Val Lys Gly Asn Ala Ala Ala Asn Ile Phe Lys Asn Cys Leu Lys Glu Ile Asp Ser Thr Leu Tyr Lys Asn Leu Phe Val Asp Lys Asn Met Lys Tyr Ile Pro Thr Glu Asp Val Ser Gly Leu Ser Leu Glu Glu Gln Leu Arg Arg Leu Gln Glu Glu Arg Thr Cys Lys Val Cys Met Asp Lys Glu Val Ser Val Val Phe Ile Pro Cys Gly His Leu Val Val Cys Gln Glu Cys Ala Pro Ser Leu Arg Lys Cys Pro Ile Cys Arg Gly Ile Ile Lys Gly Thr Val Arg Thr Phe Leu Ser (2) INFORMATION FOR SEQ ID NO:3:
(i) S~:QU~N~ CH~RACTERISTICS
(A) L~l~: 30 BASE PAIRS
(B) TYPE: NUCLEIC ACID
(C) sTRAND~n~s SINGLE
(D) TOPOLOGY: LINEAR
(ii) MOLECULE TYPE: Oligonucleotide (xi) SE~u~N~ DESCRIPTION: SEQ ID NO:3:

W 096135703 PCTrUS95/05922 (2) INFORMATION FOR SEQ ID NO:4:
(i) SEQu~N~ CHARACTERISTICS
(A) LENGTH: 31 BASE PAIRS
(B) TYPE: NUCLEIC ACID
(C) STRAND~n~: SINGLE
(D) TOPOLOGY: LINEAR
(ii) MOLECULE TYPE: Oligonucleotide (xi) SEQu~N~ DESCRIPTION: SEQ ID NO:4:
GACTGGATCC TCTTTA~GAG AGAAATGTAC G 31 (2) INFORMATION FOR SEQ ID NO:5:
(i) SEQ~N~ CHARACTERISTICS
(A) LENGTH: 32 BASE PAIRS
(B) TYPE: NUCLEIC ACID
(C) STRAND~n~!~: SINGLE
(D) TOPOLOGY: LINEAR
(ii) MOLECULE TYPE: Oligonucleotide (xi) S~Q~N~ DESCRIPTION: SEQ ID NO:5:
GCAGATCTGT AGAT~Lw L~A CCATGAGTAC TG 32 (2) INFORMATION FOR SEQ ID NO:6:
(i) ~Qu~N-CE CHARACTERISTICS
(A) LENGTH: 26 BASE PAIRS
(B) TYPE: NUCLEIC ACID
(C) STRAND~n~-~S: SINGLE
(D) TOPOLOGY: LINEAR
(ii) MOLECULE TYPE: Oligonucleotide (xi) SEQu~N~ DESCRIPTION: SEQ ID NO:6:

(2) INFORMATION FOR SEQ ID NO:7:
(i) SEQUENCE CHARACTERISTICS
(A) LENGTH: 29 BASE PAIRS
(B) TYPE: NUCLEIC ACID
(C) STRANDEDNESS: SINGLE
(D) TOPOLOGY: LINEAR
(ii) MOLECULE TYPE: Oligonucleotide (xi) ~Qu~N~ DESCRIPTION: SEQ ID NO:7:

(2) INFORMATION FOR SEQ ID NO:8:
(i) SEQ~N~ CHARACTERISTICS
(A) LENGTH: 59 BASE PAIRS
(B) TYPE: NUCLEIC ACID
~ (C) STRANDEDNESS: SINGLE
(D) TOPOLOGY: LINEAR
~ (ii) MOLECULE TYPE: Oligonucleotide (xi) ~Qu~ DESCRIPTION: SEQ ID NO:8:
GCAGATCTTC AAGCGTAGTC TGGGACGTCG TATGGGTAAG ArAr~AA~TGT ACGAACAGT 59

Claims (21)

WHAT IS CLAIMED IS:

1. An isolated polynucleotide comprising a member selected from the group consisting of:
(a) a polynucleotide encoding the polypeptide comprising amino acid 1 to 438 as set forth in SEQ ID NO:2;
(b) a polynucleotide capable of hybridizing to and which is at least 70% identical to the polynucleotide of (a); and (c) a polynucleotide fragment of the polynucleotide of (a) or (b).

2. The polynucleotide of Claim 1 wherein the polynucleotide is DNA.

3. The polynucleotide of Claim 1 wherein the polynucleotide is RNA.

4. The polynucleotide of Claim 1 wherein the polynucleotide is genomic DNA.

5. The polynucleotide of Claim 2 which encodes the polypeptide comprising amino acid 1 to 438 of SEQ ID NO:2.

6. An isolated polynucleotide comprising a member selected from the group consisting of:
(a) a polynucleotide which encodes a mature polypeptide having the amino acid sequence expressed by the DNA
contained in ATCC Deposit No. ______;
(b) a polynucleotide which encodes a polypeptide having the amino acid sequence expressed by the DNA contained in ATCC Deposit No.______;
(c) a polynucleotide capable of hybridizing to and which is at least 70% identical to the polynucleotide of (a); and (d) a polynucleotide fragment of the polynucleotide of (a), (b) or (c).

7. The polynucleotide of claim 1 comprising the sequence as set forth in SEQ ID NO:1 from nucleotide 1 to nucleotide 1435.

8. The polynucleotide of claim 1 comprising the sequence as set forth in SEQ ID NO:1 from nucleotide 10 to nucleotide 1323.

9. A vector containing the DNA of Claim 2.

10. A host cell genetically engineered with the vector of Claim 9.

11. A process for producing a polypeptide comprising:
expressing from the host cell of Claim 10 the polypeptide encoded by said DNA.

12. A process for producing cells capable of expressing a polypeptide comprising genetically engineering cells with the vector of Claim 9.

13. A polypeptide selected from the group consisting of (i) a polypeptide having the deduced amino acid sequence of SEQ ID NO:2 and fragments, analogs and derivatives thereof;
and (ii) a polypeptide encoded by the cDNA of ATCC Deposit No. ______ and fragments, analogs and derivatives of said polypeptide.

14. The polypeptide of Claim 13 wherein the polypeptide comprises amino acid 1 to amino acid 438 of SEQ ID NO:2.

15. A compound which inhibits acitivation of the polypeptide of claim 13.

16. A method for the treatment of a patient having need of hIAP comprising: administering to the patient a therapeutically effective amount of the polypeptide of claim 14.

17. The method of Claim 16 wherein said therapeutically effective amount of the polypeptide is administered by providing to the patient DNA encoding said polypeptide and expressing said polypeptide in vivo.

18. A method for the treatment of a patient having need to inhibit hIAP comprising: administering to the patient a therapeutically effective amount of the compound of Claim 15.

19. A process for diagnosing a disease or a susceptibility to a disease related to an under-expression of the polypeptide of claim 13 comprising:
determining a mutation in a nucleic acid sequence encoding said polypeptide.

20. A diagnostic process comprising:
analyzing for the presence of the polypeptide of claim 13 in a sample derived from a host.

21. A process for identifying compounds effective as antagonists against the polypeptide of Claim 14 comprising:
transfecting a cell with a nucleic acid sequence encoding hIAP-1;
contacting the cell with a compound to be screened; and determining if the cell undergoes apoptosis.