CA2205824A1 - Pharmaceutical preparation with factor viii procoagulant activity and vwf binding activity - Google Patents

Abstract

The invention is drawn to a stable pharmaceutical preparation containing a protein with factor VIII
procoagulant activity and vWF binding activity, which protein has an amino acid sequence derived from the amino acid sequence of the factor VIII protein, comprising at least one mutation in at least one immunodominant region of factor VIII. Further, methods for producing such a stable pharmaceutical preparation and medical uses for such preparations are described.

Description

CA 02205824 l997-05-22 PATENT RULES
SECTION 111(c) STATEMENT
The content of the sequence listing in computer-readable form is the same as the content of the sequence listing contained in the description.

Feb. 3, 1997 JDM:sbt C:\KEEP~I10-INFO.PGS

CA 0220~824 1997-0~-22 The invention relates to a stable pharmaceutical preparation with factor VIII procoagulant activity and vWF binding activity.

Factor VIII functions in the intrinsic pathway of blood coagulation as a cofactor, in the presence of Ca2+ and phospholipids for the factor IXa-dependent conversion of factor X to Xa. Molecular cloning of factor VIII
cDNA revealed that factor VIII consists of a series of homologous domains which can be represented as follows:
Al-A2-B-A3-Cl-C2. In plasma, factor VIII circulates as a metal-ion linked hetero-dimer which is noncovalently bound to von Willebrand factor (vWF). The heavy-chain of factor VIII with a molecular weight of 90 000 to 200 000 comprises the Al and A2-domain as well as a variable portion of the 8-domain. The factor VIII light chain of 80 kDa consists of the A3, Cl and C2 domain.
Activation of factor VIII occurs by limited proteolysis by thrombin at amino acid position Arg372, Arg740 in the heavy chain and Argl639 in the light chain.
Consequently, activated factor VIII consists of a hetero-trimer of the separate Al and A2 domain together with a thrombin-cleaved light chain.

The X-linked bleeding disorder haemophilia A has been associated with (functional) absence of factor VIII.

CA 0220~824 1997-0~-22 Over the years the molecular defect in the factor VIII
gene has been localized in an impressive number of haemophilia A patients (Tuddenham et al., NAR 22 (1994), 3511-3533; Antonarakis et al., Human Mutation 5 (1995), 1-22). Particular interest has been directed to haemophilia A patients that contain cross reacting material (CRM+) in their plasma. Elegant studies employing micro-purification of factor VIII from plasma of CRM+-haemophilia A patients have significantly contributed to thé current knowledge of structure-function relations of factor VIII. Mutations at the thrombin cleavage sites at amino acid position Arg372 and Arg1689 have been shown to interfere with activation of factor VIII, in agreement with data ob-tained with recombinant proteins in which the cleavage sites of thrombin have been altered by site directed mutagenesis.
Furthermore, two mutations in the factor VIII gene were shown to result in additional glycosilation of the protein that interfered with factor VIII activity. The molecular basis of the genetic defect in patients with a reduced level of factor VIII in their plasma has been less well explored. Higuchi and co-workers have identified a mutation in the factor VIII gene of a patient suffering from mild haemophilia A that resulted in the substitution of a tyrosine for a phenylalanine at amino acid position 1680 (PNAS 88 (1991), 8307-CA 0220~824 1997-0~-22 8311). A recombinant factor VIII protein containing this particular amino acid substitution was shown to be defective in binding to vWF.

Another mutation of the factor VIII molecule in which the arginine at amino acid position 2307 is replaced by a glutamine has been associated with mild to moderate haemophilia A (Gitschier et al., Science 232 (1986j, 1415-1416; Casula et al., Blood (1990), 662-670).
Functional importance of residue Arg2307 in function of factor VIII is suggested by the ability of a synthetic peptide containing this particular residue, to inhibit binding of factor VIII to phospholipids. Furthermore, evidence has been presented that this portion of the native factor VIII molecule is capable of binding to vWF. Initial attempts to characterise the defect that is caused by this mutation using material purified from plasma have been unsuccesful.

On the other side, it is known that about 20~ of haemophilia A patients which are treated with factor VIII concentrates develop factor VIII inhibitors (i.e.
antibodies against factor VIII), thereby inhibiting the effects of the administered factor VIII preparations.

The treatment of factor VIII inhibitor patients is very difficult and to date there is only a limited number of CA 0220~824 1997-0~-22 special methods to treat those haemophilia A inhibitor patients.

It is possible, yet very costly to apply high doses of factor VIII, thereby neutralizing the factor VIII
antibodies in vivo. The surplus factor VIII then acts haemostatically. In many cases desensibilisation takes place and it is again possible to apply standard factor VIII treatments. Such a high dose treatment, however, requires large amounts of factor VIII, is time consuming and may be afflicted with severe anaphylactic side reactions.

Another cost-intensive method for removing factor VIII
inhibitors employs the extracorporal immunoadsorption on lectins which bind to immunoglobulins (protein A, protein G) or on immobilised factor VIII. Since the patient has to be connected to the apherese machine during this treatment, this method is also a big burden in financial terms and for the patient. Despite from that it is also not possible to achieve blood clotting of an acute bleeding with this method.

The therapy of choice to date, however, is the administration of activated prothrombin complex concentrates (APCC), like FEIBA~ and AUTOPLEX~, which is suitable to treat acute bleedings even in patients CA 0220~824 1997-0~-22 with high inhibitor titer (see: e.g. DE-PS 31 27 318).

Other methods which are at present under intensive investigations are the administration of immunoglobulin preparations which contain antiidiotypic antibodies and the administration of recombinant factor VIIa. Yet for both methods it is not possible to make final assesments to their clinical efficacy to date.

It is an object of the present invention to provide a pharmaceutical preparation for the treatment of patients with factor VIII inhibitors and related coagulation disorders which allows a simple administration, a high stability of the product to be administered, an effective treatment and a longer half life thereby lessening the burden of the patients.

This object is solved by a stable pharmaceutical preparation containing a protein with factor VIII
procoagulant activity and vWF binding activity, which protein has an amino acid sequence derived from the amino acid sequence of the factor VIII protein, preferably the human factor VIII protein, with at least one mutation in at least one immunodominant region of factor VIII.
An immunodominant region of the factor VIII protein is defined as an epitope, structure or domain of the CA 0220~824 1997-0~-22 protein which predominately causes antibody formation.

The mutation(s) may be a point mutation, which results in the replacement of an amino acid by another, substitutions, deletions (e.g. deletions of regions not being essential for the action of factor VIII in vivo) or insertions (e.g. doubling of certain regions).

Preferably, the mutation(s) are present in the C2 and/or the A2 domain of the factor VIII molecule.

According to the present invention, the protein contained in the preparation should exhibit both, factor VIII procoagulant activity and vWF binding activity.

It is advantageous that the factor VIII mutant protein in the pharmaceutical preparation exhibits a factor VIII procoagulant activity and/or vWF binding activity of at least 30 ~, preferably at least 50 %, more preferably at least 80 %, particularly at least 100 %, of the factor VIII procoagulant activity and/or the vWF
binding activity of a factor VIII protein without the mutation in the immunodominant region, for example, of a commercially available factor VIII preparation based on recombinant factor VIII:C.

CA 0220~824 1997-0~-22 The evaluation of the factor VIII procoagulant activity and the vWF binding activity can be performed by any suitable test for these properties, especially by those tests which are routinely carried out when assaying factor VIII samples, like the one stage clotting assay, a chromogenic assay such as factor VIII IMMUNOCHROM
(IMMUNO) and adsorptin of the factor VIII on immo-bilized vWF or vice versa, respectively (see also Veltkamp et al., Thromb. Diath. Haemos. 19 (1968), 279-303)-Factor VIII coagulant activity of the mutant proteinaccording to the present invention is preferably tested by a "one-stage ¢lotting assay" as describèd e.g. in Mikaelsson and Oswaldsson Scand.J.Haematol.Suppl.33 (1984), 79-86.

Factor VIII activity may also be assessed by measuring the ability of factor VIII to function as a cofactor for factor IXa in the conversion of factor X to factor Xa employing a chromogenic substrate for factor Xa (Coatest Factor VIII, Chromogenix, Moelndal, Sweden).
In addition other assays that serve to determine the amount of factor VIII activity in a sample may be utilized to test the factor VIII activity of the mutant proteins that are described in the present invention.

CA 0220~824 1997-0~-22 The actual assay whether any new mutant factor VIII
protein exhibits a certain percentage of factor VIII
procoagulant activity is preferably carried out in parallel with an assay for the same factor VIII mo-lecule without the mutation in the immunodominant region (e.g. factor VIII wild type or a fully active B-domain deleted factor VIII). With such a calibrated assay of the mutated factor VIII molecule, the relative procoagulant activity (the percentage of activity compared to 100 ~ activity of the wild type or the B-domain deleted factor VIII) may be assayed without the risk of an environmental error.

The VWF-binding activity may also be assayed by any test system, capable of determining a factor VIII:C/vWF
complex which has been formed in the course of the assay for vWF binding. Binding of the mutant factor VIII proteins to vWF may be performed using assays that are described in the literature (e.g. Leyte et al.
Biochem. J., 257 (1990), pp 679-683; Donath et al.
Biochem. J., 312 (1995), pp 49-55). In these assays purified or non-purified vWF may be used. The vWF used is preferably purified vWF protein. These methods include but are not limited to coating of purified vWF
onto microtiter wells (Leyte et al., Biochem. J., 257 (1990), pp 679-683). Alternatively, purified or non-purified vWF may be immobilized with the help of CA 0220~824 1997-0~-22 monoclonal antibodies that are directed to vWF (Leyte et al., Biochem. J., 274 (1991), pp 257-261; Donath et al., Biochem J., 312 (1995), pp 49-55). Subsequently different amounts of factor VIII are added to the immobilized vWF and the amount of bound factor VIII is deter- mined by common methods. The assay described above may be utilized to address the binding of factor VIII mutant proteins to vWF. Similarly other methods that serve to determine the affinity of a factor VIII
protein for vWF may be employed to address the vWF-binding properties of the mutant proteins disclosed in the present invention.

Since with in vitro-tests for factor VIII procoagulant activity and vWF-binding activity, the results may often be affected with errors due to their artificial design, both properties are preferably also assayed by in vivo or ex vivo tests to obtain more reliable results with respect to the activity values.

As with the in vitro assays, parallel testing of the factor VIII molecule without the mutation in the immunodominant region is also preferred when performing the in vivo tests. Suitable animal models for evaluating the factor VIII:C activity in the presence of inhibitor are described by W0 95/01570 and A 987/95.

CA 0220~824 1997-0~-22 According to a preferred embodiment, the factor VIII
mutant protein in the stable pharmaceutical preparation of the present invention exhibits the factor VIII
procoagulant activity and/or the vWF binding activity in the presence of a factor VIII inhibitor, which can be isolated from inhibitor patients or an equivalent antibody produced by hybridoma technology, especially in the presence of anti-factor VIII antibodies which include but are not limited to antibodies of human origin directed against the C2-domain and A2-domain of factor VIII, mouse monoclonal antibodies which include but are not limited to CLB-CAg 117. It is preferred to provide a factor VIII mutant, which is active in the presence of a plurality of inhibitors, at least in the presence of two antibodies, which bind to the immunodominant region of the factor VIII molecule.

The fact that these preferred mutant proteins are not inhibited or inhibited only to a small extent by the factor VIII inhibitors makes them suitable for the successful treatment of factor VIII inhibitor patients.

Preferred mutations of the factor VIII molecule in the prepara- tion according to the present invention are in immunodominant epitopes or regions of factor VIII, especially in the C2 or A2 domain. Preferable regions for site directed mutagenesis are around Arg2307 and CA 0220~824 1997-0~-22 Arg593, for instance in the region of amino acid 2182 to 2332, like Thr2303-Trp2313. Arginine is then preferably substituted to Glutamin or Cystein.
Preferable examples are the mutations R2307Q and R593C.
A further immunodominant region of the A2 domain is located between Arg484 and Ile508 (Healey G.F. et al., JBC 270 (1995), 14505-14509) and the regions around this location. Each new mutation can be assayed as outlined above whether it exhibits the properties necessary for the preparation according to the present invention.

The factor VIII mutant according to the present invention preferably exhibits a further mutation, namely a deletion of at least part of the B-domain, a region which is not essential for the physiological activity of factor VIII. Deletion mutants as exemplified in EP-0 690 126 can be used for producing the mutation according to the present invention. The comparative assays for factor VIII coagulant activity and for vWF binding activity for such a B-domain de-leted factor VIII mutant according to the invention are then preferably carried out in parallel with a B-domain deleted factor VIII protein without the mutation in the immunodominant region.

Further mutants and/or fragments as well as derivatives CA 0220~824 1997-0~-22 of the factor VIII protein can be used as long as they have factor VIII:C activity and vWF binding activity.

It surprisingly turned out that the factor VIII mutant according to the invention still retained vWF binding activity even though it is not inhibited by common inhibitors. This finding is the more surprising because it was know in the art that the binding sites for vWF
and inhibitors overlap.

The binding to vWF in vitro or in vivo is a prerequisite for the stability of the factor VIII
mutant in a preparation or after the administration of the preparation to the patient. In the presence of vWF
the factor VIII:C activity is stabilized so that its activity is substantially preserved even after a prolonged period of storage time. Also the factor VIII:C level in a patient is elevated even after a prolonged period of time after administration due to the vWF binding and a longer half-life of the thus stabilized factor VIII mutant.

A further aspect of the present invention relates to a biologically active factor VIII complex comprising a factor VIII mutant as described above and vWF or a vWF
fragment. It is preferred to use recombinant vWF, such as described in EP-O 197 592.

CA 0220~824 1997-0~-22 Yet another aspect of the present invention is a method of producing a pharmaceutical preparation according to the present invention comprising the expression of a factor VIII mutant protein as described above in mammalian cells, purification of this mutant protein from these cells and formulating of the purified mutant protein to a pharmaceutical preparation.

The expression and purification step may be performed according to any method known for recombinant production of factor VIII, factor VIII mutants or related proteins. The formulating to a pharmaceutical preparation may comprise the addition of pharmaceutically acceptable additives, stabilizers, further active components, as well as the providing of a suitable dosage form and a ready-for-use package.

Expression is preferably performed at temperatures ranging from 20 to 45~C. For production of mutant proteins disclosed in this invention expression at a temperature from 25 to 37~C may prove useful in obtaining significant amounts of factor VIII in the conditioned medium; more preferably a temperature of 28~C may be employed to facilitate expression of mutant proteins.

CA 0220~824 1997-0~-22 It is also possible to co-express the factor VIII
mutant protein together with vWF or fragments thereof using standard techniques for coexpression.

Alternatively, it is also possible to purify the mutant factor VIII protein from plasma of a patient carrying this special mutation in an immunodominant region of factor VIII and use the purified protein for preparing a stable pharmaceutical preparation according to the invention.

The addition of vWF and/or vWF fragments is preferably performed during the purification or formulating steps.

The invention also relates to the use of a factor VIII
mutant protein as described above for manufacturing a pharmaceutical preparation to treat patients with factor VIII inhibitors or patients with a risk for factor VIII inhibitors.

According to the invention such patients are treated with an effective dose of the present stable pharmaceutical preparation. The effective dosage may be easily determined for each individual patient according to the severity of the disorders he or she suffers from and according to inhibitor titers of the patient; the dosages of standard factor VIII therapies may be an im-CA 0220~824 1997-0~-22 .

portant standard to rely upon as a first dosage of the pharmaceutical preparation according to the present invention. It is likely (although not essentially necessary) that during the further treatment with the present preparation the dosage will be decreased due to the longer half-life of the mutant protein.

According to a further aspect, an antibody preparation comprising antibodies raised against a factor VIII
mutant protein as described above is provided by the present invention. These antibody preparation may be used e.g. for the purification or detection and/or determination of a factor VIII mutant protein according to the present invention or for distinguishing between the factor VIII mutant and native factor VIII, particularly in the blood or plasma of the patient.

The invention will be explained in more detail by way of the following examples and the associated drawing figures to which, however, it shall not be limited.

There are illustrated in: Fig.1: a schematic representation of factor VIII dB695 and factor VIII
dB695-R2307Q; Fig.2: the pulse-chase analysis of cells transfected with factor VIII dB695-cDNA; Fig.3: the pulse-chase analysis of cells transfected with factor VIII dB695-R2307Q-cDNA; Fig.4: Endoglycosidase H

CA 0220~824 1997-0~-22 digestions of factor VIII dB695 and factor VIII dB695-R2307Q; Fig.5: the expression of factor VIII dB695 in SKHEP cells; Fig.6 and Fig.7: the expression of factor VIII dB695-R2307Q in SKHEP cells; Fig.8 and Fig.9:
Inhibition of factor VIII by CLB-CAgll7; Fig.10: factor VIII-vWF binding.

E x a m p l e s :

EXAMPLE 1: Plasmid constructions The plasmid pCLB-BPVdB695, encoding a factor VIII
mutant in which Ala867 is fused to Asp1583 has been described by Mertens et al. (Brit.J.Haematol.85 (1993), 133-145). Plasmid pCLB-BPVdB695 has been modified by introducing a synthetic linker (5' TCGACCTCCAGTTGAACATTTGTAGCAAGCCACCATGGAAATAGAGCT 3'), containing part of the 5' untranslated region of the factor VIII cDNA linked to a consensus sequence for initiation of translation, in front of the start-codon (underlined) at the 5' end of the factor VIII cDNA
(Kozak, J.Biol.Chem.266 (1991), 19867-19870). At the 3'-end, the PstI site at nucleotide-position 7066 of the factor VIII cDNA (nucleotide 1 corresponding to the first nucleotide of the start codon), a linker was inserted that contains a NotI site that was utilized to clone the factor VIII dB695 cDNA into plasmid pBPV

CA 0220~824 1997-0~-22 yielding plasmid pCLB-dB695. The plasmid pCLB-dB695-R2307Q was constructed by site-directed mutagenesis using overlap extension (Ho et al., Gene 77 (1989), 51-59). Oligonucleotide primer RQ2307-1 (5' CGCTACCTTC_AATTCACCCC 3'; nucleotide position 6967-6987 of factor VIII; sense) and oligonucleotide primer RQ2307-2 (5'CCATAGGTTGGAATCTAA 3'; nucleotide 1221-1239 of pBPV; anti-sense) were used to amplify a 302 bp fragment that contained part of the factor VIII cDNA
and the plasmid pBPV. Oligonucleotide primer RQ2307-3 (5' TTAGGATCCCACTAAAGATGAGTTT 3'; nucleotide position 5530-5547; sense) was used together with oligonucleotide primer RQ2307-4 (5' GGGGTGAATTTGAAGGTAGCG 3'; nucleotide position 6967-6987 of factor VIII; anti-sense) to amplify a 1464 bp fragment of factor VIII. Reaction conditions were: 2 min 90~C, 20 min 50~C, 3 min 72~C; 37 times 45 sec 90~C, 90 sec 50~C, 3 min 72~C; 5 min 65~C in the presence of 1 mM dNTPs, Pfu-polymerase reaction buffer, 50 pMol of each oligonucleotide primer and 2.5 U of Pfu-Polymerase (Lundberg et al., Gene 108 (1991), 1-6).
Both the 302 bp and 1464 bp fragment were purified and used as template in a second PCR using primer RQ2307-1 and RQ2307-4 in order to amplify a 1738 bp fragment that contains the carboxy-terminus of the factor VIII
cDNA in which Arg2307 has been replaced by a Gln. The amplified fragment was digested with SalI and ApaI and CA 0220~824 1997-0~-22 the resulting 879 bp fragment containing a mutation at amino acid position Arg2307 was used to replace the corresponding ApaI-SalI fragment of pCLB-dB695. The resulting construct was termed pCLB-dB695-R2307Q. The nucleotide sequence of the SalI-ApaI fragment used for construction of pCLB-dB695-R2307Q was verified.

EXAMPLE 2: Tissue culture and transfection C127 cells were maintained in Iscove's medium supplemented with 10 % fetal calf serum, 100 U/ml penicillin and 100 pg/ml streptomycin. Subconfluent monolayers of C127 cells were transfected essentially as described in Donath et al. (Biochem.J.312 (1995), 49-55). The presence of factor VIII protein in the culture medium was monitored by measuring both factor VIII activity as well as factor VIII antigen (Mertens et al. (1993)). Factor VIII cofactor activity was assessed by the ability of factor VIII to function as a cofactor for the factor IXa-dependent formation of factor Xa, employing a chromogenic substrate for factor Xa (Coatest Factor VIII, Chromogenix, Molndal, Sweden).
Factor VIII antigen was determined using monoclonal antibodies that have been characterized previously (see: Lenting et al., J.Biol.Chem. 264 (1994), 7150-7155). Monoclonal antibody CLB-CAg 12, directed against the factor VIII light chain was used as a solid phase, CA 0220~824 1997-0~-22 while peroxidase-labeled monoclonal antibody CLB-CAg 117, also directed against the light chain was used to quantify the amount of factor VIII bound. The amount of factor VIII heavy chain was determined as follows:
monoclonal antibody ESH-5 (2.5 ~g/ml) was immobilized to microtiter wells overnight at 4~C in 50 mM NaHC0 3 (pH 9.5). Wells were washed with 50 mM Tris-HCl (pH
7.4). 100 mM NaCl, 0.1% (v/v) Tween-20 and blocked for 1 hour in the same buffer containing 1 % (w/v) HSA.
Factor VIII samples were diluted into blocking buffer and incubated for 2 hours at 37~C with the immobilized antibody. Subsequently the wells were washed and the amount of factor VIII heavy chain bound was determined employing peroxidase-labeled monoclonal antibody CLB-CAg 9 at a concentration of 0.7 pg/well. The detection-limit of this particular ELISA is 10 mU/ml. Normal plasma from a pool of 40 donors was used as a standard.
The results of these expression experiments are depicted in table 1 (values expressed as mU/ml:

CA 0220~824 1997-0~-22 Table 1:
factor VIII factor VIII
dB695 dB695-R2307Q

cofactor activity 181.4 + 2.4 1.73 + 0.06 antigen (light chain) 199 + 4.4 not detectable antigen (heavy chain) 225 + 39 not detectable In contrast to factor VIII dB695, only limited amounts of cofactor acitivity could be detected in the medium of cells transfected with factor VIII dB695-R2307Q
cDNA. No immuno-reactive material could be detected with the ELISA specific for factor VIII light chain.
Since the presence of the Arg2307 to Gln mutation may affect binding of the monoclonal antibodies used, factor VIII antigen was examined employing monoclonal antibody CLB-CAg 9, directed against an acidic region at the carboxy-terminus of the A2-domain of factor VIII, in conjuction with monoclonal antibody ESH-5 directed against the heavy chain of factor VIII
(Griffin et al., Thromb.Haemostasis 55 (1986), 40-46).
No factor VIII antigen could be detected in the medium of cells that have been stably transfected with factor VIII dB695-R2307Q cDNA, while factor VIII dB695 could CA 0220~824 1997-0~-22 be detected using this particular combination of antibodies.
EXAMPLE 3: Metabolic labeling and immunoprecipitation Transfected cells, maintained in Iscove's medium supplemented with 10% fetal calf serum and 100 U/ml penicillin and lOOpg/ml streptomycin were metabolically labeled upon 80% confluency. Cells were washed twice with PBS and incubated for 30 min in RPMI (Voorberg et al., J. Cell. Biol. 113 (1991), 195-205), lacking methionine, which was supplemented with 10% fetal calf serum dialyzed against 25 mM HEPES (pH 7.0).
Subsequently, the cells were labeled for 30 min in the presence of [35S]-methionine (50 ~Ci/ml, spec. act.
>800 Ci/mmol). Medium of metabolically labeled cells was collected in an equal volume of 2 times concentrated immunoprecipitation buffer (IPB) consisting of 1% NP-40, 50 mM Tris-HCl (pH 7,5), 150 mM
NaCl, 0.5% SDS, 10 ~g/ml soybean trypsin inhibitor, 10 mM benzamidine and 5 mM N-ethylmaleimide. Cells were washed twice with phosphate buffered saline (PBS) and the cells were lysed in IPB. Lysates and conditioned media were either stored at -20~C or used immediately for immunoprecipitation. Cell extracts and conditioned media were precleared by incubation for one hour at room temperature with gelatin Sepharose and two successive incubations with protein A Sepharose.

CA 0220~824 1997-0~-22 Specific adsorption was performed overnight at 4~C, by preformed complexes of protein A Sepharose with polyclonal rabbit anti-factor VIII antiserum raised against factor VIII purified from plasma.
Immunoprecipitates were extensively washed with IPB and finally with 20 mM Tris-HCl (pH 7.4) and analyzed under reducing conditions on a 7.5 % (w/v) SDS-polyacrylamide gel. Following electrophoresis gels were fixed in 30%
methanol, 10% acetic acid and treated with 20%
diphenyloxazol in acetic acid for 30 minutes.
Subsequently, gels were incubated in H 2~~ dried and exposed for variable times. Endoglycosidase H
digestions of immunoprecipitated material were performed according to Voorberg et al. (J.Cell Biol.113 (1991), 195-205).

It could be shown by the present experiments that in the cell factor VIII dB695 appears as a single-chain molecule that disappears from the cell gradually in time (Fig.2A: analysis of cell extracts of transfected cells at different periods of chase: lane 1: 0 hour chase, lane 2: 1 hour chase, lane 3: 3 hour chase, lane 4: 4 hour chase, lane 5: 6 hour chase, lane 6: control;
Fig.2B: analysis of conditioned medium at different periods of chase: lane 1: 0 hour chase, lane 2: 1 hour chase, lane 3: 3 hour chase, lane 4: 4 hour chase, lane 5: 6 hour chase, lane 6: control; single chain (sc), CA 0220~824 1997-0~-22 light chain (lc) and heavy chain (hc) of factor VIII
are indicated in the figure; molecular weight markers are indicated at the right of the figure).

Concomitant with the decrease in signal observed in the cell, an increase in factor VIII-reactive material is observed in the medium. In agreement with previous data, factor VIII dB695 is secreted in part as a single-chain protein, while two forms can be detected that have previously been characterized as light chain and heavy chain containing a portion of the B-domain of factor VIII dB695 (Mertens et al.(1993)). Biosynthesis of factor VIII dB695-R2307Q inside the cell is similar to that observed for factor VIII dB695. However, no immuno-reactive material could be detected in the me-dium of the stably transfected cells, indicating that factor VIII dB695-R2307Q is not secreted from the cell (Fig.3A: analysis of cell extracts of transfected cells at different times of chase: lane 1: 0 hour, lane 2: 1 hour, lane 3: 3 hour, lane 4: 4 hour, lane 5: 6 hour, lane 6: control; Fig.3B: analysis of conditioned medium at different periods of chase: lane 1: 0 hour, lane 2:
1 hour, lane 3: 3 hour, lane 4: 4 hour, lane 5: 6 hour, lane 6: control; molecular weight markers are indicated at the right and the single chain factor VIII dB695-R2307Q is indicated at the left of the figure). This observation suggests that the vast majority of the CA 0220~824 1997-0~-22 initially synthesized factor VIII dB695-R2307Q is processed within the cell via a mechanism different from factor VIII dB695.

EXAMPLE 4: Biochemical analysis of factor VIII inside the cell In order to assess the intracellular localization of both factor VIII dB695 and factor VIII dB695-R2307Q, pulse-chase analysis was performed. Sensitivity of immuno-purified proteins towards endo H provides a marker for the intracellular localization of both proteins. As shown in Fig.4 both factor VIII dB695 as well as factor VIII dB695-R2307Q remain sensitive towards endo H at the different time-points indicated (Fig.4A: cells transfected with factor VIII dB695 cDNA:
lane 1: 0 hour chase + endo H, lane 2: 0 hour chase -endo H, lane 3: 2 hour chase + endo H, lane 4: 4 hours chase + endo H, lane 5: 6 hour chase + endo H; Fig.4B:
cells transfected with factor VIII dB695-R2307Q cDNA:
lane 1: 0 hour chase - endo H, lane 2: 0 hour chase +
endo H, lane 3: 2 hour chase + endo H, lane 4: 4 hours chase + endo H, lane 5: 6 hour chase + endo H; molecu-lar weight markers are indicated at the right of the gels.

These results indicate that both factor VIII dB695 and CA 0220~824 1997-0~-22 factor VIII dB695-R2307Q are predominantly present in a compartment prior to the medial-Golgi.

EXAMPLE 5: Expression of factor VIII dB695 and factor VIII dB695-R2307Q at 28~C and 37~C

The results given in the previous paragraphs indicate that factor VIII dB695-R2307Q is poorly secreted from mouse fibroblasts C127 cells. To assess whether intracellular retention of factor VIII dB695-R2307Q is a phenomenon specific for C127 cells factor VIII dB695-R2307Q and factor VIII dB695 cDNA was expressed in SKHEP cells. Both factor VIII dB695 and factor VIII
dB695-R2307Q cDNA were used to replace the factor VIII
dB928 cDNA in plasmid pCMV-dB928 (EP-0 711 835-A).

The plasmid pCLB-dB695 (see example 1) was modified as follows a synthetic double stranded linker 5' GGCCGCCCGGGC 3' was inserted into the NotI-site of pCLB-dB695 and pCLB-dB695-R2307Q. Subsequently, a KpnI-XmaI fragment derived of pCLB-dB695 corresponding to the carboxy-terminus of the factor VIII CDNA was used to replace the corresponding KpnI-XmaI fragment of pCMV-dB928. The resulting plasmid was termed pCLB-CMV-dB695. Similarly, a BglII-XmaI fragment that corresponds to the carboxy terminus of the factor VIII-dB695-R2307Q cDNA was used to replace the corresponding CA 0220~824 1997-0~-22 fragment of pCMV-dB928 which resulted in the plasmid pCLB-CMV-dB695-R2307Q. SKHEP cells were maintained in Iscove's medium supplemented with 10~ fetal calf serum, 100 U/ml penicillin and 100 ~g/ml streptomycin.
Subconfluent monolayers of SKHEP cells were transfected essentially as described in Donath et al.
(Biochem.J.312 (1995), 49-55). Transfected cells were selected at hygromycin concentrations of 100-1050 mg/ml and individual clones were isolated and propagated in selective medium. The presence of factor VIII protein in the conditioned medium of the transfected cells was monitored by measuring factor VIII activity as well as factor VIII antigen. Factor VIII cofactor activity was measured by probing the abilty of factor VIII to function as a cofactor for the factor IXa-dependent formation of factor Xa, employing a chromogenic substrate for factor Xa (Coatest Factor VIII, Chromogenix, Molndal, Sweden). Factor VIII antigen was determined using monoclonal antibodies that have been characterized previously (see: Leyte et al., Biochem J.263 (1989) 187-194). Monoclonal antibody CLB-CAg 12 directed against the light chain of factor VIII was used as a solid phase, while peroxidase conjugated monoclonal antibody CLB-CAg 69 or CLB-CAg 117, also directed against the light chain of factor VIII was used to quantify the amount of factor VIII bound.

CA 0220~824 1997-0~-22 Transfected SKHEP cells expressing factor VIII dB695 were grown at 28~C and 37~C and the amount of factor VIII protein secreted into the medium was monitored by determining factor VIII cofactor activity as outlined above. At 37~C factor VIII-dB695 is secreted from transfected SKHEP cells at a level of 2 U/ml. On day 4 the expression of factor VIII dB695 is somewhat higher and reaches a value of 5 U/ml (Figure 5). At 28~C the amount of factor VIII activity encountered in the conditioned medium ranges from 2-10 U/ml (Figure 5).
Transfected SKHEP cells expressing factor VIII dB695-R2307Q were analyzed in a similar manner. At 37~C only limited amounts of factor VIII activity are secreted from the transfected cell (+ 10 mU/ml). Surprisingly at 28~C significant amounts of factor VIII activity are encountered in the conditioned medium of cells transfected with factor VIII dB695-R2307Q cDNA (Figure 6). Next the amount of factor VIII antigen in the conditioned medium of SKHEP cells stably transfected with factor VIII dB695-R2307Q cDNA was determined using the monoclonal antibodies that have been described above. The amount of factor VIII antigen as determined with the monoclonal antibodies CLB-CAg 12 and CLB-CAg 69 was found to be similar to the amount of cofactor activity present in the conditioned medium (Figure 7).

CA 0220~824 1997-0~-22 This observation reveals that factor VIII dB695-R2307Q
can be secreted from transfected SKHEP cells at 28~C as functional fully active factor VIII protein. Next the amount of factor VIII antigen using monoclonal antibodies CLB-CAg 12 and CLB-CAg 117 was assessed.
Surprisingly, no factor VIII antigen could be detected in the conditioned medium of cells transfected with factor VIII dB695-R2307Q cDNA using this particular combination of monoclonal antibodies (Figure 7). These data indicate that monoclonal antibody CLB-CAg 117 does not react with factor VIII dB695-R2307Q. Analysis of transfected SKHEP cells employing immunofluorescence confirmed that CLB-CAg 117 did not react with factor VIII dB695-R2307Q. The observations on the lack of reactivity of CLB-CAg 117 with factor VIII-dB695-R2307Q
revealed that substitution of amino acid Arg2307~Gln in factor VIII interferes with binding of monoclonal antibody CLB-CAg 117.

EXAMPLE 6: Characterization of monoclonal antibody CLB-CAg 117.

In the previous example it was shown that monoclonal antibody CLB-CAg 117 is not reactive with factor VIII

dB695-R2307Q. In addition it could be shown that factor VIII dB695-R2307Q is a functionally fully active factor VIII protein that can be expressed in SKHEP cells at CA 0220~824 1997-0~-22 28~C. The properties of monoclonal antibody CLB-CAg 117 were further characterized. The epitope of monoclonal antibody CLB-CAg 117 has been localized to the factor VIII light chain. The observation that monoclonal antibody CLB-CAg 117 does not react with factor VIII
dB695-R2307Q strongly suggests that the epitope of this antibody is localized in the C2-domain of factor VIII.
Plasmids pCLB-GP67-80K and pCLB-GP67-C2 were constructed. Plasmid pCLB-GP67-80K encoding the light chain of factor VIII was constructed by amplifying a 689 bp fragment using oligonucleotide primers 80K-1 (5' GCCCCATGGGGGAAATAACTCGTACTACTC 3'; nucleotide position 5000-5020 of factor VIII, sense) and 80K-2 (5' CTGTACTGTCACTTGTCTCCC 3'; nucleotide position 5659-5679 of factor VIII; antisense). The 689 bp product was purified and digested with NcoI and NdeI. The plasmid pCLB-dB695 was digested with NdeI (nucleotide position 5521 of factor VIII) and NotI resulting in a fragment that corresponds to the carboxy terminal part of the factor VIII light chain. The NcoI-NdeI fragment and the NdeI-NotI fragment were cloned together into plasmid pAcGP67B (Pharmingen, San Diego, CA, USA) and this yielded plasmid pCLB-GP67-80K. Plasmid pCLB-GP67-C2 was constructed using oligonucleotide primer C2-1 (5' GTGCCATGGGTAGTTGCAGCATGCCATTG 3'; nucleotide position 6574-6591 of factor VIII; sense) and primer C2-2 (5' CCATAGGTTGGAATGTAA 3'; nucleotide position 1222-1239 of CA 0220~824 1997-0~-22 pBPV; anti-sense) which were used to amplify a fragment which corresponds to the C2-domain of factor VIII.
Following amplification the fragment was digested with NcoI and NotI and cloned into plasmid PAcGP67B. The nucleotide sequence of the cloned sequence was verified by oligonucleotide sequencing. Recombinant baculo-viruses expressing the factor VIII light chain and the C2-domain of factor VIII were obtained by transfection in Sf-9 cells in conjunction with BaculogoldTM
Baculovirus Autographa californica DNA (Pharmingen, San Diego, CA, USA). Recombinant viruses expressing the factor VIII light chain and the C2-domain of factor VIII were used to infect High FiveTM cells at a multi-plicity of infection of 7. The cells were maintained in culture medium which consisted of 25% (v/v) Grace's insect medium and 75 % (v/v) of EX-CELL 401 medium supplemented with 2.5 % fetal calf serum, 100 U/ml penicillin and 100 mg/ml streptomycin. At 24 hours post-infection the cells were pulse-labeled with [35S]methionine (50 ~Ci/ml, spec. act. > 800 Ci/mmol) for 24 hours in a similar culture medium lacking methionine. Medium of metabolically labeled cells was collected in an equal volume of 2 times concentrated immunoprecipitation buffer (IPBB). IPBB consists of 50 mM Tris-HCl (pH 7.6); 1 M NaCl; 1.2% (v/v) Triton-X-100; 0.1~ (w/v) Tween-20; 1.0 % (v/v) BSA; 35 mM EDTA;
10 ~g/ml soybean trypsin inhibitor; 10 mM benzamidine CA 0220~824 1997-0~-22 and 5 mM N-ethylmaleimide. Immunoprecipitation with monoclonal antibody CLB-CAg 117 was performed as follows. Conditioned media were precleared by incubation for two hours at room temperature with Gelatin Sepharose 4B and two successive incubations with Protein G Sepharose 4FF. Specific adsorption was performed overnight at 4~C by adding 1 ~g/ml of monoclonal antibody CLB-CAg 117 to Protein G Sepharose.
Immunoprecipitates were washed extensively with IPBB
and finally with 20 mM Tris-HCl (pH 7.6). Bound protein was eluted by boiling for 5 minutes in SDS PAGE-sample buffer and analyzed under reducing conditions on a 10 %
(w/v) SDS-polyacrylamide gel. Following electrophoresis gels were fixed in 30% methanol, 10% acetic acid and treated with 10% diphenyloxazol in acetic acid for 30 minutes. Finally, gels were incubated in H20, dried and exposed for variable times. Immunoprecipitation with monoclonal antibody CLB-CAg 117 revealed that this particular antibody reacted both with the radiolabeled factor VIII light chain and the C2-domain. The epitope of CLB-CAg 117 is located in the C2-domain of factor VIII. As such CLB-CAg 117 resembles anti-factor VIII
antibodies that develop in haemophilia A patients following treatment with factor VIII. The epitope of a significant portion of these anti-factor VIII
antibodies is located in the C2-domain. Clearly, CLB-CAg 117 provides an useful model to mimic the action of CA 0220~824 1997-0~-22 the anti-factor VIII antibodies that develop upon treatment with factor VIII in patients with haemophilia A. The capacity of CLB-CAg 117 to inhibit factor VIII
activity was monitored. Different amounts of CLB-CAg 117 were incubated with normal plasma for 2 hours at 37~C. Subsequently the factor VIII activity of normal plasma was determined using a one-stage clotting assay (Mertens et al., Brit. J. Haematol. 85. (1993), 133-145). The results of the experiments are depicted in Figure 8 and show that monoclonal antibody CLB-CAg 117 is a strong inhibitor of factor VIII activity. As little as 10 ~g/ml of CLB-CAg 117 is capable of reducing factor VIII activity to 10 % of its initial value. In summary, these results reveal that CLB-CAg 117 has its epitope on the C2-domain of the factor VIII
light chain and acts as a strong inhibitor of factor VIII activity. The above experiments show that the properties of CLB-CAg 117 closely resemble that of human allo or auto-antibodies directed against the C2-domain of factor VIII, that develop either spontaneously or as a consequence of factor VIII
replacement therapy of patients with haemophilia A.

EXAMPLE 7: Inhibition of factor VIII dB695-R2307Q by CLB-CAg 117 In the previous examples monoclonal antibody CLB-CAg CA 0220~824 1997-0~-22 117 an inhibitory antibody directed against the C2-domain of factor VIII have been characterized. In example 5 the expression of factor VIII dB695-R2307Q in SKHEP cells has been described. Surprisingly, secretion of factor VIII dB695-R2307Q was found to be temperature dependent and significant amounts of factor VIII dB695-R2307Q were secreted into the conditioned medium at 28~C. Secreted factor VIII dB695-R2307Q was found to be functionally active. Inspection of the reactivity of CLB-CAg 117 employing both a factor VIII antigen assay and immunofluorescence revealed that factor VIII dB695-R2307Q did not react with monoclonal antibody CLB-CAg 117. This observation suggests that factor VIII dB695-R2307Q was also insensitive towards the factor VIII
inhibiting activity of CLB-CAg 117. To test this hypothesis the ability of monoclonal antibody CLB-CAg 117 to inhibit factor VIII dB695-R2307Q was determined.
As a control inhibition of factor VIII dB695 by monoclonal antibody CLB-CAg 117 was tested. Different amounts of CLB-CAg 117 were incubated for 2 hours at room temperature with factor VIII dB695 or factor VIII
dB695-R2307Q. Subsequently, the residual factor VIII
activity was determined using a one-stage clotting assay (Mertens et al. Brit. J. Haematol. 85 (1993), 133-145). Inspection of the pattern obtained for the inhibition of factor VIII dB695 by monoclonal antibody CLB-CAg 117 revealed that as little as 0.2 ~g/ml of .

CA 0220~824 1997-0~-22 CLB-CAg 117 resulted in a residual activity of 20~.
Higher amounts of CLB-CAg 117 did not yield an extra inhibition of factor VIII activity. The pattern obtained following incubation of CLB-CAg 117 with factor VIII dB695-R2307Q was entirely different. The activity of factor VIII dB695-R2307Q could not be inhibited by CLB-CAg 117. Even high amount of antibody (20 ~g/ml) were not able to block the factor VIII
activity of factor VIII dB695-R2307Q (Figure 9). These results show that point mutations at immuno-dominant regions of factor VIII may be used to selectively interfere with the binding of inhibiting anti- bodies while retaining factor VIII activity. Similar to substitution of Arg2307 by Gln, other amino acid substitutions may be utilized to interfere with binding of factor VIII inhibiting antibodies.

EXAMPLE 8: Determination of vWF bin~in~ activity of factor VIII dB695-R2307Q

In the previous example it was shown that CLB-CAg 117 is not able to inhibit the biological activity of factor VIII dB695-R2307Q. The vWF-binding properties of factor VIII dB695-R2307Q were determined using a binding assay that has been described previously (Leyte et al. Biochem. J. (1990) vol. 257, 679-683; Donath et CA 0220~824 1997-0~-22 al. Biochem. J. (1995) vol. 312, 49-55)). Purified von Willebrand factor (5 ~g/ml) was immobilized onto microtiter wells overnight at 4~C. Subsequently serum free medium containing different amount of factor VIII
dB695-R2307Q and factor VIII dB695 were incubated for one hour with the immobilized von Willebrand factor.
The amount of factor VIII that binds to the immobilized von Willebrand factor was quantified. The results are displayed in Figure 10 and from these data it appears that factor VIII dB695 is capable of binding to immo-bilized von Willebrand factor in accordance with previous data (Mertens et al. Brit. J. Haematol., 85 (1993), 133-142). Surprisingly, also factor VIII dB695-R2307Q was bound in a quantitative manner to the immobilized von Willebrand factor. These results indicate that similar to factor VIII dB695, factor VIII
dB695-R2307Q is capable of binding with high affinity to von Willebrand factor. The present data show that an Arg2307~Gln substitution in factor VIII does not effect the von Willebrand factor binding properties of the molecule. Taken together, these results show that factor VIII dB695-R2307Q possess normal factor VIII
activity and is capable of binding to von Willebrand factor. In addition it was shown that factor VIII
dB695-R2307Q is resistant to the inhibitory effect of an anti-factor VIII antibody. This may render factor VIII dB695-R2307Q useful in the treatment of patients CA 0220~824 1997-0~-22 anti-factor VIII antibodies which are capable of inhibiting the coagulant activity of factor VIII.
Consequently, factor VIII dB695-R2307Q may be used as part of a pharmaceutical preparation that is used in treatment of patients with acquired haemophilia A or in treatment of haemophilia A patients that have developed allo-antibodies following factor VIII replacement therapy.

EXAMPLE 9: Preparation of an A2-domain mutant In the previous examples it was have established that factor VIII dB695-R2307Q cannot be inhibited by CLB-CAg 117, an anti-factor VIII antibody that is directed against the C2-domain of factor VIII. Anti-factor VIII
antibodies may also be directed against other regions of the factor VIII protein. An immunodominant epitope of factor VIII is present on the A2-domain of factor VIII. A panel of patients was screened for the occurrence of anti-factor VIII antibodies that are directed against the A2-domain of factor VIII. To facilitate screening of patients, recombinant baculoviruses expressing the heavy chain and A2-domain of factor VIII were constructed. The plasmid PCLB-GP67-A2 encoding the A2 domain of factor VIII was constructed by amplifying a 1135 bp fragment employing oligonucleotide primers A2-1 (5' CA 0220~824 1997-0~-22 ATTCCATGGGATCAGTTGCCAAGAAGCAT 3'; nucleotide position 1174-1191 of factor VIII, sense) and A2-2 (5' CTTGCGGCCGCGGAGAATCATCTTGGTTCAATGGC 3'; nucleotide position 2263-2277 of factor VIII, antisense). The 1135 bp fragment was purified, digested with NcoI and NotI
and cloned into plasmid pAcGP67B. In the resulting construct designated pCLB-GP67-A2, amino acid sequence Ser373-Arg740 of factor VIII is fused to the leader peptide of the acidic glycoprotein GP67. The plasmid pCLB-GP67-9OK encoding amino acid Alal-Arg740 of the heavy chain of factor VIII was constructed by amplifying a 548 bp fragment using oligonucleotide primers 90K-1 (5' TCTCCATGGGTGCCACCAGAAGATACTAC 3';
nucleotide position 58-75 of factor VIII sense) and 90K-2 (5' ACATACTAGTAGGGCTCC 3'; nucleotide position 577-594 of factor VIII; antisense). The 548 bp PCR
product was purified and digested with NcoI and NdeI.
Plasmid pCLB-BPVdB695 was digested with NdeI
(nucleotide position 461 of factor VIII) and KpnI
(nucleotide position 1811 of factor VIII) resulting in a 1351 bp fragment. Plasmid pCLB-GP67-A2 was digested with KpnI and NotI and the resulting frgament was cloned into pAcGP67B together with the NcoI-NdeI
fragment and the KpnI-NotI fragments described above.
The resulting construct was termed pCLB-GP67-9OK.
Recombinant viruses expressing the factor VIII heavy chain and the A2 domain were prepared as described in CA 0220~824 1997-0~-22 Example 5. Immunoprecipitation experiments employing 20 ~l of patients plasma were performed as described in Example 5. Metabolically labeled A2-domain and factor VIII heavy chain were used in the studies described below. Screening of plasma of a panel of patients with haemophilia A revealed that plasma derived of a patient with mild haemophilia A contained anti-factor VIII
antibodies that were reactive with both metabolically labeled A2-domain and factor VIII heavy chain.
Development of anti-factor VIII antibodies in patients affected with mild haemophilia is relatively rare, since significant amount of endogeneous factor VIII are often present in plasma of these patients. This suggests that the anti-factor VIII antibodies that develop under these condities are directed against an epitope that is present on exogeneous factor VIII and that is not localized on endogeneous factor VIII. To assess this possibility the mutation in the factor VIII
gene of the patient with the anti-factor VIII antibody was determined by amplification of the 26 exons of factor VIII employing the polymerase chain reaction.
The presence of point mutations in the factor VI I I gene was investigated using single stranded conformation polymorphism (SSCP) in combination with direct sequencing of the amplified PCR-fragments. Following SSCP an aberrant migration of a PCR fragment corresponding to exon 12 of the factor VIII gene was CA 0220~824 1997-0~-22 observed. Direct sequencing revealed a point mutation (C~T) which predicted replacement of Arg593 by a Cys.
It is likely that the missense mutation could cause a conformational change in the endogeneously synthesized factor VIII protein. To address this issue the Arg593~Cys mutation was introduced into the construct that encodes the factor VIII A2-domain. Plasmid pCLB-GP67B-A2-R593C encoding the A2 domain of factor VIII in which Arg593 is replaced by a Cys was constructed by site-directed mutagenesis using overlap extension.
Oligonucleotide primer R593C (5' GAGAATATACAATGCTTTCTCCC 3'; nucleotide position 1822-1844 of factor VIIIi sense) was used together with oligonucleo-tide primer A2-2 to amplify a fragment of 476 bp. Oligonucleotide primer R593C-2 (5' GGGAGAAAGCATTGTATATTCTC 3'; nucleotide position 1822-1844 of factor VIII; antisense) and oligonucleotide primer A2-1 were used to amplify a 682 bp fragment.
Both amplified fragments were purified and used as a template in a PCR employing oligonucleotide primer A2-1 and A2-2 in order to amplify a DNA fragment which was purified and subsequently digested with NcoI and NotI
and cloned into the plasmid pAcGP67B yielding pCLB-GP67-A2R593C. The nucleotide sequence of the modified A2-domain was verified by oligonucleotide sequencing.
Conditioned medium containing metabolically labeled A2-domain with the Arg593~Cys mutation was prepared as CA 0220~824 1997-0~-22 described in examples 2 and 3. Immunoprecipitation of the metabolically labeled modified A2 domain, termed A2R593C, with monoclonal antibody CLB-CAg 9 showed that A2R593C was present in the conditioned medium in amounts similar to the wild type A2 domain of factor VIII. However, the antibody present in the plasma of the patient did not react with the modified A2 domain (A2R593C). This observation suggests that the anti-factor VIII antibody that developed in the patient during treatment with factor VIII is solely directed to wild type factor VIII. The anti-factor VIII antibody does not react with the recombinant A2 domain that contains the Arg593~Cys mutation. The data presented above show that binding of anti-factor VIII antibodies can be modulated by selective modification of immuno-dominant sites on the factor VIII protein. Similar to the example given above selective modification of other immuno-dominant regions of factor VIII may be utilized to interfere with the binding of anti-factor VIII
antibodies.

EXAMPLE 10: Eormulating the purified mutant protein preparation to a pharmaceutical preparation The mutant proteins produced according to Example 2 and 9 have been purified by conventional means among them CA 0220~824 1997-0~-22 chromatographic procedures and/or precipitation techniques. The purified protein preparation was then formulated to a physiologically acceptable preparation using standard techniques like sterile filtration and ultra/diafiltration. The preferred buffer used in the pharmaceutical preparation is a physiological NaCl buffer or a tris-buffer, having a pH in the range of 6-8, preferably between 7 and 7.5. The concentration of the protein in the pharmaceutical preparation is chosen according to the dose required to treat a patient.

The dose of the factor VIII preparations according to the invention is dependent on the nature, extend and duration of the bleeding lesion as well as on the severity of the hemophilia and the inhibitor titer, respectively. The initial dose usually lies between 1 and 500 U/kg, preferably between 10 and 200 U/kg of body weight.

Claims (36)

1. A stable pharmaceutical preparation comprising a protein having factor VIII procoagulant activity and vWF binding activity, said protein having an amino acid sequence derived from the amino acid sequence of the factor VIII protein, said derived amino acid sequence including at least one mutation in at least one immunodominant region of factor VIII.

2. A preparation as set forth in claim 1, wherein said immunodominant region is at least one of the C2 and the A2 domain.

3. A preparation as set forth in claim 1, wherein said protein exhibits a factor VIII procoagulant activity of at least 30 % of the factor VIII procoagulant activity of a factor VIII protein without said mutation.

4. A preparation as set forth in claim 3, wherein said factor VIII procoagulant activity is at least 50 %.

5. A preparation as set forth in claim 3, wherein said factor VIII procoagulant activity is at least 80 %.

6. A preparation as set forth in claim 3, wherein said factor VIII procoagulant activity is at least 100 %.

7. A preparation as set forth in claim 1, wherein said protein exhibits a vWF binding activity of at least 30 % of the vWF binding activity of a factor VIII
protein without said mutation.

8. A preparation as set forth in claim 7, wherein said vWF binding activity is at least 50 %.

9. A preparation as set forth in claim 7, wherein said vWF binding activity is at least 80 %.

10. A preparation as set forth in claim 7, wherein said vWF binding activity is at least 100 %.

11. A preparation as set forth in claim 1, wherein said protein exhibits said factor VIII procoagulant activity or said vWF binding activity in the presence of a factor VIII inhibitor.

12. A preparation as set forth in claim 11, wherein said factor VIII inhibitor is isolated from factor VIII
inhibitor patients.

13. A preparation as set forth in claim 11, wherein said factor VIII inhibitor is an antibody produced by hybridoma technology.

14. A preparation as set forth in claim 11, wherein said factor VIII inhibitor is CLB-CAg117 produced by hybridoma technology.

15. A preparation as set forth in claim 1, wherein said immunodominant region is recognized by a factor VIII
inhibitor isolated from factor VIII inhibitor patients.

16. A preparation as set forth in claim 1, wherein said immunodominant region is recognized by an antibody produced by hybridoma technology.

17. A preparation as set forth in claim 1, wherein said immunodominant region is recognized by CLB-CAg117 produced by hybridoma technology.

18. A preparation as set forth in claim 1, wherein said at least one mutation is selected from the group consisting of the mutations R2307Q and R563C.

19. A preparation as set forth in claim 1, wherein said protein is a B-domain deleted factor VIII protein comprising said at least one mutation.

20. A preparation as set forth in claim 1, further comprising at least one of vWF and fragments of vWF.

21. A biologically active factor VIII complex comprising a protein having factor VIII procoagulant activity and vWF binding activity, said protein having an amino acid sequence derived from the amino acid sequence of the factor VIII protein, said derived amino acid sequence including at least one mutation in at least one immunodominant region of factor VIII, and vWF.

22. A biologically active factor VIII complex comprising a protein having factor VIII procoagulant activity and vWF binding activity, said protein having an amino acid sequence derived from the amino acid sequence of the factor VIII protein, said derived amino acid sequence including at least one mutation in at least one immunodominant region of factor VIII, and a fragment of vWF.

23. A method of producing a stable pharmaceutical preparation including a protein having factor VIII

procoagulant activity and vWF binding activity, said protein having an amino acid sequence derived from the amino acid sequence of the factor VIII protein, said derived amino acid sequence including at least one mutation in at least one immunodominant region of factor VIII, said method comprising - providing mammalian cells, - expressing said protein in said mammalian cells, - purifying said expressed protein from said mammalian cells, and - formulating said purified protein to a pharmaceutical preparation.

24. A method as set forth in claim 23, wherein said protein is expressed in said mammalian cells at a temperature of between 20 and 45°C.

25. A method as set forth in claim 23, wherein said protein is expressed in said mammalian cells at a temperature of between 25 and 37°C.

26. A method as set forth in claim 23, wherein said protein is coexpressed with vWF.

27. A method as set forth in claim 23, wherein said protein is coexpressed with fragments of vWF.

28. A method as set forth in claim 23, further comprising adding at least one of vWF and fragments of vWF during purifying of said protein.

29. A method as set forth in claim 23, further comprising adding at least one of vWF and fragments of vWF during the formulating of said purified protein into a pharmaceutical preparation.

30. A method of producing a stable pharmaceutical preparation including a protein having factor VIII
procoagulant activity and vWF binding activity, said protein having an amino acid sequence derived from the amino acid sequence of the factor VIII protein, said derived amino acid sequence including at least one mutation in at least one immunodominant region of factor VIII, said method comprising - providing a plasma from a patient carrying said at least one mutation in an immunodominant region of factor VIII, - purifying said protein from said plasma, and - formulating said purified protein into a pharmaceutical preparation.

31. A method as set forth in claim 30, further comprising adding at least one of vWF and fragments of vWF during the purifying of said protein.

32. A method as set forth in claim 30, further comprising adding at least one of vWF and fragments of vWF during the formulating of said purified protein into a pharmaceutical preparation.

33. A method for treating patients harboring factor VIII inhibitors or patients harboring a risk for factor VIII inhibitors comprising administering an effective dose of a pharmaceutical preparation including a protein having factor VIII procoagulant activity and vWF binding activity, said protein having an amino acid sequence derived from the amino acid sequence of the factor VIII protein, said derived amino acid sequence including at least one mutation in at least one immunodominant region of factor VIII.

34. An antibody preparation comprising antibodies raised against a protein having factor VIII
procoagulant activity and vWF binding activity, said protein having an amino acid sequence derived from the amino acid sequence of the factor VIII protein, said derived amino acid sequence including at least one mutation in at least one immunodominant region of factor VIII.

35. A method for purifying a protein having factor VIII

procoagulant activity and vWF binding activity, said protein having an amino acid sequence derived from the amino acid sequence of the factor VIII protein, said derived amino acid sequence including at least one mutation in at least one immunodominant region of factor VIII comprising the use of an antibody preparation.

36. A method for determining a protein having factor VIII procoagulant activity and vWF binding activity, said protein having an amino acid sequence derived from the amino acid sequence of the factor VIII protein, said derived amino acid sequence including at least one mutation in at least one immunodominant region of factor VIII comprising the use of an antibody preparation.