CA2204020A1 - Nucleic acid transfer system - Google Patents

Abstract

The invention pertains to a nucleic acid transfer system including a translocation domain of toxins, especially of diphtheria toxin suitable for targeting a nucleic acid, e.g. a gene, to a specific cell, and obtaining expression of said nucleic acid. The nucleic acid transfer system of the invention comprises a multidomain protein component and a nucleic acid component. Furthermore, the present invention relates to the multidomain protein, a nucleic acid encoding said protein, suitable amplification and expression systems for said nucleic acid, and processes for the preparation and uses of the above subject matters.

Description

-Nucleic acid transfer system The invention pertains to a nucleic acid transfer system suitable for lar~,eling a nucleic acid, e.g. a gene, to a specific cell, and obtaining ~ lession of said nucleic acid. The nucleic acid srer system of the invention comprises a multidomain protein component and a nucleic acid component. Furthermore, the present invention relates to the multidomain protein, a nucleic acid encoding said protein, suitable amplification and c,.plession systems for said nucleic acid, and processes for the plepalalion and uses of the above subject matters.

Gene Ll~lsrer to eukaryotic cells may be accompli~hed using viral vectors, such as recol.lbinalll adenoviruses, or non-viral gene lldnsrer vectors. Owing to several disadv~nt~g~, e.g. cor.sll~ s in the size of the DNA to be delivered, incapability of tr~n~during terminally di~erP..~ ed cells, potential safety hazards and insufficient targetability, such viral DNA
transfer systems seem to be of limited use in gene Ihel~py strategies. As an alternative to viral systems, ligand-me(1i~ted approaches via molecular conjugate vectors have been developed.
Such molecular conjugate vectors comprise the DNA molecule to be transferred and a target cell-specific ligand which is r,h~mic~lly coupled to a polycation, particularly a polyamine (for review, see e.g. Michael & Curiel, Gene Therapy 1: 223, 1994). The polycation binds to the DNA through electrostatic forces, thus acting to tie up the ligand with the gene to be delivered. For example, human Ll,lllsre..in or chicken conalbumin were covalently linked to poly-L-lysine or plolall.ille through a di~nlfi~le linkage. Complexes of protein-polycation--conjugate and a bacterial plasmid co.~ a luciferase encoding gene were supplied to eukaryotic cells, res..lting in c.~ ession of the luciferase gene (Wagner et al., Proc. Natl.
Acad. Sci. USA 87: 3410, l990). To achieve higher levels of gene c.~)less;on, adenovirus particles were chemically coupled to the complex (see e.g. Curiel et al., Proc. Natl. Acad. Sci.
USA 88: 8850, 1991; Christiano et al., Proc..Natl. Acad. Sci. USA 90: 11548, 1993).
However, molecular conjugate vectors also have limitations, inclutling large size, inhomogeneity, lack of specificity pe~ ~ail,ing to the binding of the DNA component, and non-specific binding due to electrostatic interactions between the polycation and the cell membrane, which may at least partially neutralize the ~a,~,e~ability imposed by the ligand.

CA 02204020 l997-04-29

-2-Thus there is still a need for a simple, P.ffi~i.o.nt nucleic acid Li~lsrel system which allows e.g.
the target cell-specific introduction of nudeic acids to be expressed, but lacks the disadvantages of the prior art concepts.

It is the object of the present invention to provide such a system. The nucleic acid Ll~lsrer system according to the invention is characleli~ed by the following two COmPOI1GI~

1) a multi-domain protein comprising several filnction~l dom~in~ inrlll(lin~ a nucleic acid binding domain 2) an effector nucleic acid, particularly a DNA, con.p~isil~g the nucleic acid, e.g. the gene, to be delivered to and expressed in a selected target cell, and a cognate structurerecognizable by the nucleic acid binding domain of the protein.

The multi-domain protein component combines in a single molecule a target cell recognition fim~.tion, also referred to as ligand domain, an endosome escape function and a nucleic acid binding function, particularly a DNA binding function. Such a protein does not occur in nature. The nucleic acid binding filn~.tion serves to me~i~te the specific, high affinity and non-covalent interaction of the protein co..lpollel.l with the G~;lor nucleic acid comi)oll~ll.
Unlike the above described molecular conjugate vector of the prior art, the protein/nucleic acid CO111PIeA of the present invention is formed by specific interaction of the nucleic acid binding domain with its cognate structure on the effector nucleic acid. Advantageously, the binding affinity of the prot~in~.eous nucleic acid binding domain for its cognate structure on the effector nucleic acid surpasses the affinity of the prot~in~seous target cell recognition function for its cognate molecular structure on the target cell. Within the nucleic acid L-~srt;.
system of the present invention the effector nucleic acid component may be e.g. a coll.~lete or partial pl~miti carrying the nudeic acid to be expressed in the target cell. The nucleic acid delivery system of the invention is decigned such that the rate of nucleic acid t-~-srer is opli...;~ed Advantageously, the present system makes use of physiological target-cell inherent mech~ni~m~ of macromolecular transport involving endosomes, particularly lec~lor-me~ te~
endocytosis. The protein/nucleic acid complex acco.dh~g to the invention is targetable in that it may be efficiently inteMalized only by a predetell..,..ed cell-type or cell population c~lyi-.~ a molec~ r structure, e.g. a rt;ceplor, which specifically interacts with the target cell reco~ition function of said complex. After entering the cell, the protein/nucleic acid complex of the .

-3-invention becomes localized in endosomes from where it is released into the cytoplasm. Owing to the selective intern~li7~tion of the proteinlnucleic acid complex, cA~les~ion of the particular nucleic acid(s) to be delivered by the complex of the invention occurs in a way that tin~ hes (transfected) target cells from (non-~ cled) non-target cells, e.g eAp.es~ion is ess~nti~lly confined to the predetelll~ned target cell. The nucleic acid to be transported to and cA~Iessed in the target cell may be therapeutically active or encode a thelap~;ulically active product, e.g. tumor cells may be transfected to introduce a gene coding for a therapeutically active protein.

More specifically, the present invention provides a two-component system for the target cell-speciffc delivery and uptake of a non-covalently linked protein/nucleic acid complex leading to the cAI~lession in said target cells of one or more nucleic acids comprised by the tl~sr~lled e~cLor nucleic acid. Plt;rerell~ially, such system of the invention çs~s~ y consists of a protein/nucleic acid complex co.~lAil~ g two components:

- a polypeptide chain Co"l~li";"g several di~lell~ functional dom~in~ of eukaryotic, prokaryotic or synthetic origin, and - an effector nucleic acid.

Adv~ntageou.~ly, the protein/nucleic acid conlpleA is sllffici~.ntly stable in physiological fluids to enable its application.in vivo. The complex of the invention is a moleclll~r complex, whose stochiometry is çc~nti~ily dt;Lt;~ ed by the number of cognate structures of the protein nucleic acid binding domain on the effector nucleic acid. For example, the cognate structure of the yeast GAL4 binding domain is thought to bind a protein dimer. Accol.lingly, the ratio of mlllsi~om~in protein to ~ or nucleic acid in the complex of the invention is 2:1 by using one nucleic acid binding dom~in However, it is pr~rellt;d to use nucleic acids which contain mllltiple seq~lçnces (preferably 2-8 which recognize the nucleic acid binding domain).

S~lcce.e~fill Ll~l~rer and ~,A~ ssion of the desired nucleic acid depends on the specific interaction of the protein/nucleic acid complex with the target cell and on the effiri~nt Ll~lsrer of the nucleic acid of interest across systemic or subcellular barriers. To-èx~minr whether the COIII~ICA of the invention is transported into or within the target cell, the complex may be suitably labeled and its accumlllation on and in cells determined, e.g. by fluoresc~ r,e ima~np;
For example, the complex may be fluoltisellce-labeled and its cellular loç~li7~tiQn be vi~u~li7e~1, e.g. by video-enh~nr,ed microscopy and q~ l;ve confocal laser sc~nning Other assays suitable for deterrnining the functionality of the nucleic acid L~ rel system of the invention, such as an assay for the ~.ession of a delivered reporter gene, are described in the P.Y~mples Further assays are known in the art and evident to the skilled person.
The nucleic acid delivery system of the invention provides for e.g. for P.ffir,i~.nt gene Ir~l~r~r in that it enables e.g. transit of said gene through the eukaryotic cell plasma ,.le..lbl~le, transport to the mlr~ s, nuclear entry and functional ~ e~ re within the nllcl~ P~ P~ce ofgene ~,A~,.ession can be achieved either by stable chromosomal integration of heterologous DNA or by m~intPn~nce of an extrachromosomal replicon. Preferably, the system of the invention lacks sequences which raise safety issues, e.g. complete viral genomes capable of autonomous replication or co..~ -g viral oncogenes. A system of the present invention may be designed such as to provide a safe, non-toxic and efflcient in vivo nucleic acid ~ srer system.

In a further aspect, the present invention relates to the above captioned multidomain protein which is capable of specifically binding to an effector nucleic acid as defined accordillg to the invention by its nucleic acid binding domain and me~ ting the introduction of said t;Lre~;Lor nucleic acid into a target cell.

The multidomain protein of the invention which may comprise one or more polypeptide chains is produced using çhpmic~l and/or ~eco--lbinal-~ methods known in the art. Preferably, said protein is a recombi.lanl single chain protein.

The fimr,ti~m~l domains char~ct~ri7ing the protein ofthe invention are:
(1) a target cell-specific binding or ligand domain recognizing a cellular surface structure, e.g. an antigenic structure, a rece~Lor protein or other surface protein, which metli~fes intern~li7~tion of a bound ligand.
(2) a translocation domain f~çilit~tin~ the escape of the effector nucleic acid from endocytic vesides after internalization of said complex into target cells, e.g. via receptor m~ ted endocytosis, (3) a nucleic acid binding domain recognizing and binding with high affnity to a defined structure of the effector nucleic acid component, e.g. to a specific DNA sequence on a suitable eukaryotic ~ es~ion plasmid or a suitable linear DNA ~gm.ont, and, optionally,

(4) an endoplasmic retiCulllm retention signal affecting the intr~cPll~ r routing of the intern~li7P~d protein/nucleic acid complex, and

(5) a nuclear localisation signal.

There is particularly pre~e,led - a mllltitlom~in protein comprising, as filnction~l dom~ine a target cell-specific binding dQm~in a translocation domain and a nucleic acid binding dom~in chara~;lel~ed in that the translocation domain is derivable from diphthPria toxin and does not include that part of said toxin molec~lle which confers to the cytotoxic effect of the molecule; or - a m~llti~om~in protein comprising, as functional dom~in.e, a target cell-specific binding domain, a translocation domain and a nucleic acid binding domain, characterized in that the translocation domain is derivable from bacterial toxins and the target cell-specific binding domain which recognizes a cell surface receptor selected from the group of the EGF receptor-related family of growth factor receptors; or - a m~lltidom~in protein comprising, as functional dom~ine, a target cell-specific binding domain, a translocation domain and a nucleic acid binding domain, charac~el~ed in that the translocation domain is derivable from a bacterial toxin and the target cell-specific binding domain recognizes a cell surface lecepLor on the effector cells of the ;..,...~.e system.

Within the multidomain protein of the invention the above captioned independent components function in a concerted manner to achieve targeted, highly efficient internalization of a nucleic acid of interest provided by an effector nucleic acid, e.g. by an eukaryotic ~,A~ression pl~em; l, to a sPIectecl cell or cell population, thereby contributing to the sllccesefill cA~Iession of said nucleic acid of interest. The arr~ngPmP.nt of the component dom~ine is chosen in accordance with the functionality of the individual domains. In an embodiment of the invention using a translocation domain derivable from a toxin, e.g., P. aeruginsosa exotoxin A or diphtheria toxin, the arr~Pment of domains in N- to C-terminal order may be as follows: ligand binding domain - translocation domain - nucleic acid binding domain - (optionally) endoplasmic retic.llllm retention signal.

The protein of the invention may comprise one or more functional domams serving the same function. For example, to f~rliit~te binding of the effector nucleic acid, the protein may W O96/13~99 PCT~EPg5/04270 --6--cc)mrri~e one or more nucleic acid binding dom~in~ recognizing the same or di~ clll cognate structures on the effector nucleic acid. The protein may comprise one or more ligand dom~in~
having the same or di~lt;ll~ sperifi~ities As evident form the FY~mpt~-., one copy of each filnr.tion~l domain is s~lfficiçnt for a mllltidom~in protein of the invention to pcl~llll its above captioned fimr,tion In addition to these functional dom~in~ the protein component may co-lll,lise one or more, particularly one, two, three or four further amino acid sequenr,es. For ç- 1...ple, such inserts, pr~îel~bly collsi~lillg of g~.netic~lly encoded amino acids, may advantageously be incol~ol~led into the multidomain protein of the invention to serve as a linker or spacer between the above identified functional dom~ins Thus the insert connects the C-terminal amino acid of one functional domain with the N-terminal amino acid of another functional dom~in A suitable insert may not impair the favorable properties of the multidomain protein as such. For example, a linker may be a peptide coniieting of about 1 to about 20 amino acids. F.x~ .y inserts include peptides having the amino acid seq~l~nr~,s GluLysLeuGluSerSerAspTyrLysAspGluLeu (SEQ ID NO:40), HisHis, ~i.~ (SEQ
ID NO:41), SerSerAspTyrLysAspGluLeu (SEQ ID NO:42), and other seqll~nres evidentfrom the Examples. Additional amino acids may also be incorporated at the N-terminus of the multidomain protein. Exemplary amino acid sequences include the FLAG epitope and are identified for SEQ ID NOs. 1, 3 and 5 in the Examples.

. .
The target cell-specific binding domain is chosen so as to achieve targetability and cellular intern~ tion of the protein/nucleic acid complex of the invention. It enables the specific interaction of the protein/nucleic acid complex of the invention with a selected structure on the target cell which structure merli~tes cellular intt~rn~ tion by, for example, the process of endocytosis. Preferably, said domain attaches to the target cells in a fashion co~ d~ le with a ligand ,ecep~or union, thereby medi~ting entry of the protein/nucleic acid complex into the cell. In the protein/nucleic acid complex of the invention said ligand domain ...~;..l;.;l.~ the ability of the "parent protein" it is derivable from to bind to the cognate structure, e.g. the receptor, in such a way that endocytosis of said complex is accomrli~hetl Plerelled is a target cell-specific binding dom~in, recognition and binding of which by its applop~ia~e cell surface receplor allows cellular intern~li7~tion of the protein/nucleic acid complex via ,ece~lor-medi~ted endocytosis.

A precondition for a proteinaceous molecule to be suitable as a binding domain in the multidomain protein of the invention is that it binds to a surface-structure on specific target .

cells, which surface structure is capable of me~ ting int~rn~ tion of its ligand into the target cell via an endocytotic paLllw~y and that these properties are not subst~nti~lly impaired for the multidomain protein of the invention.

A target cell-specific binding domain recognizing a cell surface structure, such as a recepLor protein or a surface antigen on the target cell, is e.g. derivable from a ligand of a cell specific receptor, such as a Fc receptor, ~ srt;l~m lece~"or, EGF receptor, asialoglycoplolein receptor, cytokine receptor, such as a lymphokine receplor, a T cell specific ~t;cep~or, e.g. CD
45, CD4 or CD8, the CD 3 lec~lor complex, TNF receplor, CD 25, erbB-2, an adhesion molecule, such as NCAM or ICAM, and mllcine Suitable ligands include antibodies specific for said receptor or antigen. Further molecules suitable as ligand domain in the mllltidom~in protein of the invention include factors and growth factors, e.g tumor necrosis factor, e.g.
TNF-a, human growth factor, epidermal growth factor (EGF), platelet-derived growth factor (PDGF), transforming growth factor (TGF), such as TGFa or TGFb, nerve growth factor, insulin-like growth factor, a peptide hormone, e.g. glllc~gQn, growth hormone, prolactin, or thyroid hormone, a cytokine, such as interleukin, e.g. IL-2 or IL-4, interferon, e.g. IF'N-g, or fr~gm~ntc or m-lt~nt.c of such proteins with the provision that such fr~ ntc and 111.1 fulfill the above requirements for a ligand domain. For example, suitable antibody L~
include Fab fr~gmentc, Fv constructs, e.g. single chain Fv contructs (scFv) or an Fv construct involving a lliclllfide bridge, and the heavy chain variable domain. The ligand domain may be of natural or synthetic origin and will vary with the particular type of target cell.

F~per;~lly pler~;lled, as target cell-specific binding dctm~inc, are domains which recognize (bind to) a cell surface leceplor selected from the groups of the EGF-receplor related family of growth factor recel)lol~. Such cell surface receplol~ are, e.g., TGFa r~ceplor, EGF
receptor, erbB2, erbB3 or erbB4 (Pelles, E., and Yarden, Y., Bioassays 15 (1993) 815-824).
;;d as binding domains in the transfer system are growth factors like herregulin, EGF, bet~c~lllllin~ TFG-a, amphiregulin or heparin binding EGF as well as antibodies against erbB2, erbB3, erbB4 or EGF r~ceplor.

Further pLe~lled are cell surface structures of effector cells of the immllne system, especi~lly of T cells. Such structures are, e.g., IL-2 receptor, CD4 or CD8.

Whether in the multidomain protein of the invention the ligand domain is capable of recognizing and binding its cognate structure may be dt;L~ ed according to methods known in the art. For example, a competition assay may be employed to determine whether entry of W O96/13599 PCT~EP95/04270 the protein/DNA complex of the invention is specific~lly medi~ted by the target cell-specific binding domain. For Px~mple, if excess of the free ligand serving as ligand dom~in~ or of the free protein the target cell-specific binding domain is derivable from, CO11~ eS with binding, endocytosis and nuclear localization of the suitably labeled complex, binding and entry of the complex into the cell is specifically m~ ted by said target cognate moiety ofthe comr~cy A p,~re~ed ligand domain is e.g. a single chain antigen binding domain of an antibody, e.g. a domain derivable from the heavy chain of an antibody, and particularly a single chain reco"lbina,lL antibody (scFv). Plere,e,l~ially, the antigen binding domain is a single-chain reco",l~ antibody comprising the light chain variable domain (VL) bridged to the heavy chain variable domain (VH) via a flexible linker (spacer), preferably a peptide. Advantageously, the peptide consists of about 10 to about 30 amino acids, particularly naturally occllrring amino acids, e.g. about 15 naturally occurring amino acids. Preferred is a peptide consisting of amino acids selected from L-glycine and L-serine, in particular the 15 amino acid peptide cnn~i~ting of three repetitive units of Gly-Gly-Gly-Gly-Ser (SEQ ID NO:43). Advs7nts7geQus is a single-chain antibody wherein VH is located at the N-terminus of the ,~co,n~h,~l~ antibody.
The antigen binding domain may be derivable from a monoclonal antibody, e.g. a monoclonal antibody directed against and specific for a suitable antigen on a tumor cell.

A suitable antigen is an antigen with P.nh~nced or specific eA~lt;ssion on the surface of a tumor cell as c~"~paled to a normal cell, e.g. an antigen evolving from con~i~tçnt genetic alterations in tumor cells. Fx~mples of suitable s7ntig~n~ include ductal-epithP.lis71 mllçine~ gp 36, TAG-72, growth factor recel~ol~ and glycosphingolirids and other carbohydrate s7ntigen~ ~,t;rerellLially expressed on tumor cells. Ductal-epitheli~l mucine is enhs7ncerl1y cA~ressed on breast, ovarian and panc,eas carcinoma cells and is recognized e.g. by monoclonal antibody SM3 (Zotter et al., Cancer Rev. 11, 55-101 (1988)). The glycoproteill gp 36 is found on the surface of human leuk~.mis7 and lymphoma cells. An ~xemrl~ry antibody recognizing said antigen is SN 10.
TAG-72 is a pancarcinoma antigen recognized by monoclonal antibody CC49 (Longe~Yl Pr, Sem. Cancer Biol. 2, 355-356). Growth factor recep~o,~ are e.g. the human epidenr al growth factor (EGF) receptor (Khazaie et al., Cancer and ~.t~t~ci~ Rev. 12, 255-274 (1993)) and HER2, also referred to as erbB-2 or gp 185 (A. Ullrich and J. Schle~ingP,r, Cell 61, 203-212 (1990)). The erbB-2 receptor is a tr~n~ P-~ e molecule which is over~,A~lessed in a high per~ age of human carrinom~ (N.E. Hynes, Sem. in Cancer Biol. 4, 19-26 (1993)).
Expression of erbB-2 in normal adult tissue is low. This difference in ~,A~res~ion i~. tifies the erbB-2 receptor as "tumor ~nh~nced".

-_ 9 _ Preferably, the antigen binding domain is obtainable from a monoclonal antibody produced by on with viable human tumor cells pres~ntin{~ the antigen in its native form. In a pl~rt;lled embodiment ofthe invention, the recognition part ofthe mlllti~om~in protein ofthe invention specifically binds to an antigenic d~t;lln,llall~ on the extrac~ r domain of a growth factor receptor, particularly HER 2. Monoclonal antibodies dirt~;led to the HER2 growth factor receptor are known and are described, for lo.Y~mple, by S.J McK~n7ie et al., Oncogene 4, 543-548 (1990), R.M. ~ ld7i~k et al., Molecular and Cellular Biology 9, 1165-1172 (1989), International Patent Applic~tion WO 89/06692 and J~p~nese Patent Applic~tion Kokai 02-150 293. Monoclonal antibodies raised against viable human tumor cells pr~
HER2 in its native form, such as SKBR3 cells, are described, for .o.~mplç, in European patent applic~tion EP-A-502 812 which is enclosed herein by rer~;rellce, and include antibodies FRP5, FSP16, FSP77 andFWP51 (ECACC 90112115, 90112116, 90112117 and 90112118).

Most plerelled is the single chain antibody scFv(FRP5) as described in the F.~mples and SEQ
ID NOs. 1 and 2.

Further prt;rell~;d as a ligand domain is a cognate structure binding fragment derivable from a cytokine, particularly TGF-a or interleukin-2. Particularly prer~lled is a TGF-a fragment having the sequence set forth in SEQ ID No. 4, which sequence extends from the amino acid at position 13 (Val) to the amino acid at position 62 (Ala). Equally pl~r~lled is a IL-2 fragment having the sequence set forth in SEQ ID No. 6, which sequence extends from the amino acid at position 18 (Ala) to the amino acid at position 150 (Thr).

Particularly p-ert;lled are the ligand dom~inc as employed in the Fx;l...plcs. The amino acid sequences ofthe domains deci~ted sc(Fv)FRP5, TGF-a and IL-2 are id~ntified for SEQ. ID.
Nos. 1, 3 and ~, respectively.

Within the present invention a target cell is a cell that via a specific cell surface structure is capable of selectively binding the target cell-specific binding domain colllplised in the protein/nucleic complex of the invention. The cell surface structure may be a protein, a ~ carbohydrate, a lipid or combination thereof. Advantageously, such target cell possesses a unique lec~Lor which - by binding to the target cell-specific binding domain of the multi-domain protein of the invention - merli~tes the efflcient internalization of ~ubs~ y the protein/nucleic acid complex into the target cell.

-~ CA 02204020 1997-04-29 W O96/13599 PCT/~r55/04270 Within the multidomain protein of the invention the translocation domain functions to çnh~nce nucleic acid escape from the cellular vesicle system and thus to ~l~P.nt nucleic acid Ll~re by this route. This domain serves to reduce or avoid Iysosomal degradation afterintern~li7~tion of the protein/nucleic acid complex into the target cell. WO 94/04696 describes a nucleic acid ~rhnsrel- system wherein, as a translocation domain and a receplor binding ~om~in~ the cognate domains of P. exotoxin A are used. However, the tr~n~fecfion Pfficion~y and specificity of such ll~lsrel systems are very low. The invention, therefore, provides an improved nucleic acid l,~lsrel system e~iling a high Ir~l~rt;.,lion effici~ncy and specificity.
Suitable translocation domains are derivable from toxins, particularly bacterial toxins, such as ~"~oluxill A, Colicin A, d-endotoxin, diphtheria toxin, R~cilllls anthrox toxin, Cholera toxin, Pertussis toxin, E.coli toxins, Shigatoxin or a Shiga-like toxin. The translocation domain does not include that part of the parent toxin molecule which confers the cytotoxic effect of the molecule. Advantageously, the translocation domain of the recoll~ protein of theinvention is derivable or essçnti~lly derivable from that very part of the parent toxin which mefli~tes intern~li7~tion ofthe toxin into the cell, e.g. amino acids 193 or 196 to 378 or 384 of diphtheria toxin. Therefore, the part of the toxin used in the nucleic acid llall~rt;r system according to the invention does not contain a cell binding domain of a toxin.

The nucleic acid binding domain enables the specific binding of the protein component of the nucleic acid L,~l~r system of the invention to the effector nucleic acid co",ponent of said complex. The high affinity interaction of the nucleic acid binding domain with the corresponding cognate sturctur on the effector nucleic acid links the cell recognition part to the c,.l~lession effector part. The nucleic acid binding domain may be a RNA binding dom~in~
or pl~rere,lLially, a DNA binding domain, e.g. the DNA binding domain of a transcription factor, particularly a yeast or human transcription factor. Pr~;relled is a GAL4 derivable ~lom~in, merli~tin~ the selective binding of the protein of the invention to the DNA sequence CGGAGGACAGTCCTCCG (SEQ ID NO:44). Accolding to Cavey et al. (J. Mol. Biol. 209:
423, 1989) GAL4 amino acids 1 to 147 exhibit a 50 % saturation binding to the GAL4 recognition sequence at 2x lO IlM. Most preferably, the DNA binding domain of the protein of the invention consists of GAL4 amino acids 2 to 147 and has the amino acid seq~lP.n~e as identified for SEQ ID NO. 1 (see Example 10). A DNA binding domain may bind to a single-stranded, or preferably, to a double-stranded DNA on the effector nucleic acid.

An endoplasmic retic~ lm retention signal functions to affect the intr~cp~ r routing Df the intPrn~li7scl protein/nucleic acid complex of the invention. A suitable endoplasmic retPntion signal may be a ~ n endoplasmic reticulum retention signal, e.g. the signal having the amino acid sequence LysAspGluLeu (SEQ ID NO:45), i.e. the KDEL signal idPntified for SEQ ID NOs. 1, 3 and 5, or a functionally equivalent amino acid seqll~nce derivable from a bacterial toxin, e.g. REDLK (SEQ ID NO:46) (single amino acid code, from ETA) or from yeast (HDEL (SEQ ID NO:47), single amino acid code).

A plerelled recombinant protein ofthe invention comprises ir~ e.g. as a ligand domain a single-chain antibody domain specific for the human erbB-2 receptor protein, a suitable TTF-a derivable fr~gm~nt, or an IL-2 derivable fr~gmçnt, a translocation domain derivable from Pse~ldomon~ exotoxin A or diphtheria toxin, a DNA binding domain derivable from the yeast GAL4 transcription factor and a l~A~lllllAli~n endoplasmic reticul.lm retention signal KDEL.
Particularly plt;r~lled are the multi-domain proteins compri~ing the following seq~l~nces:
amino acids 18 to 530 as set forth in SEQ ID No. 2, amino acids 13 to 342 as set forth in SEQ
ID No. 4, or amino acids 18 to 421 in SEQ ID No. 6.

In addition to the above identified functional domains a recolllbin&ll protein of the invention may also include a signal peptide, e.g. the E. coli OmpA signal sequence having the amino acid sequence MetLysLysThrAlaIleAlalleAlaValAlaLeuAlaGlyPheAlaThrValAlaGlnAla (SEQ IDNO:48).

The present invention also relates to a nucleic acid, i.e. a RNA or, particularly, a DNA, encoding the above described multidomain protein of the invention, or a fragment of such a nucleic acid. By definition, such a DNA comprises a coding single stranded DNA, a double stranded DNA of said coding DNA and complçm~nt~ry DNA thereto, or this comple~ .y (single stranded) DNA itself. F.~mpl~ry nucleic acids encoding a protein of the invention are represented in SEQ ID NOs. 1, 3 and 5. A DNA encoding the protein ~lçsign~ted TGFa-deltaETA-deltaGAL4 is obtainable from E. coli XLlBlue/pWF47-TGF which has been deposited with the Deutsche S~mmll-ng von Mikroor~ ni~m~n und 7.~11kll1tllren GmbH
~DSM), Mascheroder Weg lb, D-38124 Braunschweig, under access;on number 9513 on October24, 1994.

Preferred are nucleic acids having subst~nti~lly the same nucelotide sequ~nce as the coding seq~l~nces set forth in SEQ ID Nos. 1, 3 and 5, respectively, or novel fr~gmlo.nte thereo~ As used herein, nucleotide sequences which are subst~nti~lly the same share at least about 90 %
seq-~çnce identity.

W O96/13599 PCTAEP9~/04270 Exemplary nucleic acids can ~lt~rn~ively be characterized as those nucleic acids which encode a multidomain protein of the invention and hybridize to any of the DNA sequences set forth in SEQ ID Nos. 1, 3 and 5. Pler~lled are such sequ~nce~ which hybridize under high sLlillgellcy con~ition~ to the above mentioned DNAs.

Stringency of hybridization refers to con~ition~ under which polynucleic acids hybrids are stable. Such con~lition~ are evident to those of ordillaly skill in the field. As known to those of skill in the art, the stability of hybrids is reflected in the melting tempel~lule (Tm) of the hybrid which decreases applo~lllalely 1 to 1.5~C with every 1% decrease in sequence homology. In general, the stability of a hybrid is a function of sodium ion concentration and ttlllpt;l~lule.
Typically, the hybridization reaction is pc;lrolllled under conditions of higher stringency, followed by washes of varying stringency. The person skilled in the art is readily able to choose suitable hybridization contlition~

Given the ~ nce provided herein, the nucleic acids of the invention are obtainable according to methods well known in the art. For example, a DNA of the invention is obtainable by chemical synthesis, using polymerase chain reaction (PCR) or by screening a library expressing a protein of interest, e.g. a ligand domain or a parent protein the ligand domain is derivable from, at a detect~kle level. Suitable libraries are co.. ;icially available or can be prepared e.g. from cell lines, tissue samples, and the like. After screening the library, positive clones are id~ntified by detecting a hybridization signal.

Ch~mic~l methods for synthesis of a nucleic acid of interest are known in the art and include triester, phosphite, phosphoramidite and H-phosphonate methods, PCR and other auloplilllel methods as well as oligoml~.lec!tide synthesis on solid supports. These methods may be used if the entire nucleic acid sequ~n~.e of the nucleic acid is known, or the sequence of the nucleic acid complemçnt~ry to the coding strand is available. Altelllalivly, if the target amino acid seq~l~n~e is known, one may infer potential nucleic acid seq~çnces using known and p,~ d coding residues for each amino acid residue.

An alternative means to isolate a DNA coding for an above mentioned functional domain is to use PCR te~lmc)logy as described e.g. in section 14 of Sambrook et al., 1989. This method requires the use of oligonucleotide probes that vvill hybridize.to the nucleic acid of interest.

As used herein, a probe is e.g. a single-stranded DNA or RNA that has a sequence of nucleotides that inr.lll~les at least about 20 contiguous bases that are the same as (or the -_ 13 _ complement of) any 20 or more contiguous bases of the nucleic acid of interest. The nucleic acid sequences selected as probes should be of sl.ffir.irnt length and sllffic;ently unambiguous so that false positive results are ..,;n....;~e~l The nucleotide sequences are usually based on conserved or highly homologous nucleotide sequences or regions of the protein of interest.
The nucleic acids used as probes may be degenel~Le at one or more positions. The use of degr.n~rate oligonucleotides may be of particular importance where a library is screened from a species in which pl ~el enlial codon usage in that species is not known.

P~e~ d regions from which to construct probes include 5' and/or 3' coding sequences, seq~lrnces predicted to encode ligand binding sites, and the like. Preferably, nucleic acid probes are labelled with suitable label means for ready detection upon hybrirli7~tion For example, a suitable label means is a radiolabel. The prerel,ed method of labelling a DNA
fragment is by incorporating 32P-labelled a-dATP with the Klenow fragment of DNApolymerase in a random priming reaction, as is well known in the art. Oligonucleotides are usually end-labelled with 32P-labelled g-ATP and polynucleotide kinase. However, other methods (e.g. non-radioactive) may also be used to label the fragment or oli~omlrleQtide, inr.lll-ling e.g. enzyme labelling and biotinylation.

A nucleic acid of the invention can be readily modified by nucleotide ~ubsLiLuLion, nucleotide deletion, nucleotide insertion or inversion of a nucleotide stretch, and any cGInl)illalion thereo~ Such ~ can be used e.g. to produce a mllltifimc.itQn~l mutant protein colll,ulislllg one or more fimr,tion~l dom~in~ that have an amino acid sequence ~l;lT~.;.~g from the sequences as found in nature. Mutagenesis may be predet~rmined (site-specific) or random. A
mutation which is not a silent mutation must not place sequences out of reading frames and preferably will not_create co.l.~lr.m~nt~ry regions that could hybridize to produce secondary mRNA structure such as loops or hairpins.

The DNA encoding a mlllti(lom~in protein of the invention may be i..co~l,o~led into vectors for further manipulation. As used herein, vector (or plasmid) refers to discrt;le .o.l~ that are used to introduce heterologous DNA into cells for either t;A~lession or replication thereof.
Selection and use of such vehicles are well within the skill of the artisan. Many vectors are available, and selection of an applop,iate vector will depend on the intr.nl1ed use ofthe vector, i.e. whether it is to be used for DNA amplification or for DNA ~ ression, the size of the DNA to be inserted into the vector, and the host cell to be l,~lsroll"ed with the vector. Each vector COll~ S various co~llpollellL~ dependillg on its function (amplific~tion of DNA or ~ uression of DNA) and the host cell for which it is co,l"~a~il,le. The vector components wog6/13sss Pcr/EPsSlo427o generally inc.ll~dç, but are not limited to, one or more of the following: an origin of replic~tion, one or more marker genes, an Pnh~ncPr element, a promoter, a ~ sc,i~ion te....;~ on seq~lçnce and a signal sequence.

Both ei~ression and cloning vectors generally contain nudeic acid sequence that enable the vector to replicate in one or more selected host cells. Typically in cloning vectors, this seqll~nce is one that enables the vector to replicate indepP.nclP.ntly of the host chromosomal DNA, and incl~ldPs origins of replication or ~utonQmously replicating sequPncç~ Such seq~len~es are well known for a variety of bacteria, yeast and viruses. The origin of replication from the plasmid pBR322 is suitable for most Gram-negative bacteria, the 2m plasmid origin is suitable for yeast, and various viral origins (e.g. SV 40, polyoma, adenovirus) are useful for cloning vectors in ",~.~,",~ n cells. Generally, the origin of replication componelll is not needed for ~ n""~ n eA~Iession vectors unless these are used in ",~""~ n cells competent for high level DNA replication, such as COS cells.

Most eAples~ion vectors are shuttle vectors, i.e. they are capable of replir.~tion in at least one dass of or~ni~m~ but can be transfected into another organism for ~,A~ules~ion. For e,~ ple, a vector is cloned in E. coli and then the same vector is Ll~recLed into yeast or ",~ n cells even though it is not capable of replicating indepPn~lPntly of the host cell chromosome.
DNA may also be amplified by insertion into the host genome. However, the recovery of such DNA is more complex than that of exogenously replic~ted vector because it requires restriction enzyme ~li~sfiQn DNA can be amplified by PCR and be directly tl~lsre.;Led into the host cells without any replication component.

Advantageously, e~l-es~ion and cloning vector contain a selection gene also referred to as sPIect~ble marker. This gene encodes a protein neces~ry for the survival or growth of srolllled host cells grown in a selective culture merlillm Host cells not Lr~ srollned with the vector co~ g the selection gene will not survive in the culture m~ m TypicalsP.lection genes encode proteins that confer reci.~t~nce to antibiotics and other toxins, e.g.
ampicillin, neomycin, methotrexate or tetracycline, complement a~lxoLrophic ~lefic.iPncies, or supply critical nutrients not available from complex media.
_, = = ~
As to a selective gene marker appropl;ate for yeast, any marker gene can be used which f~ilit~tes the selection for L~lsr(jllll~lLs due to the phenotypic eAl~les~ion ofthe marker gene.
Suitable markers for yeast are, for example, those col~lling re~i~t~nce to antibiotics G418, W 096/13~99 PCTAEP95/04270 hyg~ ycill or bleomycin, or provide for plo~oL-ophy in an auxotrophic yeast mutant, for eY~mrle the URA3, LEU2, LYS2, TRPl~ or HIS3 gene.

Since the amplification of the vectors is conveniently done in E. coli, an E. coli genetic marker and an E. coli origin of replication are advantageously in~ de(l These can be obtained from E. coli pl~emi~ls, such as pBR322, Blueskript vector or a pUC pl~emid e.g. pUC18 or pUC19, which contain both E. coli replication origin and E. coli ~enetic marker conrelling le~:e~ ce to antibiotics, such as ~mpicillin Suitable selectable markers for "~""~ n cells are those that enable the identification of cells competent to take up the nucleic acid encoding a protein of the invention, such as dihydrofolate reduct~ee (DE~R, metho~ Le rçci~t~nce)~ thymidine kinase, or genescollrelillg reeiet~nce to G418 or hygfùllly~ill. The ",~.",n~ n cell ~l~lsrollll~lLs are placed under selection pl ~:S:~ule which only those transrUl llla lLs are uniquely adapted to survive which have taken up and are cAplessil1g the marker. In the case of the DE~ marker, s~lection pressure can be imposed by c~lltllring the Llallsrollll~lLs under conditions in which the methotrexate concentration of selection agent in the ~ne~li",n is succeseively increased, thereby leading to amplification (at its chromosomal integration site) of both the selection gene and the linked DNA that encodes the multidomain protein of the invnetion. In that case ~mplific~tiQn is the process by which genes in greater d~m~n.l for the production of a protein critical for growth are reiterated in tandem whithin the chromosomes of sllccessive genel~Lions of recombinant cells. Increased q~l~ntitiele of the protein of the invention are usually synthesi7ed from thus amplified DNA.

Expression and cloning vectors usually contain a promoter that is recognized by the host organism and is operably linked to the nucleic acid of the invention. Such promoter may be inducible or c~netitlltive. The promoters are operably linked to DNA encoding the protein of the invention by removing the promoter from the source DNA by restriction enzyme digestion and inserting the isolated plollloLer sequence into the vector.

Promoters suitable for use with prokaryotic hosts incll-de, for cA~l~le, the b-l~ct~m~ee and lactûse prûmoter systems, alkaline=phosph~t~ee, a tryptophan (trp) promoter system and hybrid promoters such as the tac promoter. Their nucleotide sequences have been published, thereby enabling the skilled worker operably to ligate them to DNA encoding a protein of the invention, using linkers or adaptors to supply any required restriction sites. Promoters for use W O96/13599 PCTnEP95/04270 in bactçri~l systems will also generally contain a Shine-Dalgarno sequence operably linked to the DNA encoding the protein of the invention.

Suitable promoting sequences for use with yeast hosts may be reg~ ted or con.~ /e and may be derivable from a highly expressed yeast gene, especially a Saccl-~onlyces cerevisiae gene. Such genes are known by those skilled in the art.

DNA transcription from vectors in ..,~.n,..~ n hosts may be controlled by promoters derived from the genomes of viruses such as polyoma virus, adenovirus, fowlpox virus, bovine papilloma virus, avian sarcoma virus, cytomegalovirus (CMV), a retrovirus and Simian Virus 40 (SV40), from heterologous m~rnm~ n promoters such as the actin promoter or a very strong promoter, e.g. a ribosomal protein promoter, provided such promoters are colllpalil)le with the host cell systems. ~~

Transcription of a DNA encoding a multidomain protein of the invention by higher eukalyoLes may be increased by inserting an enh~nr.Pr seqllçnre into the vector. Fnh~nr,ers are relatively oriPnt~tion and position independent. Many P.nh~ncer sequences are known from m~mm~ n genes (e.g. el~t~e and globin). However, typically one will employ an f~nh~nr,f~r from a eukaryotic cell virus. Examples include the SV40 P.nh~ncer on the late side of the replir,~tion origin (bp 100-270) and the CMV early promoter Pnh~n~Pr.

Expression vectors used in eukaryotic host cells - suitable envisaged host cells include yeast, fungi, insect, plant, animal, human, or nucle~ted cells from other mlllticP.lllll~r org~ s will also contain sequences necp~ss~ry for the tP-, I.~ ;on of transcription and for stabilizing the mRNA. Such seq lP.n-.es are commonly available from the 5' and 3' untr~n~l~ted regions of eukaryotic or viral DNAs or cDNAs.

An ~ ession vector refers to a recG,n~ an~ DNA or RNA construct, such as a pl~mt~1, a phage, reco",bin~ll virus or other vector, that upon introduction into an appropliate host cell, results in ~ ,ession of the cloned DNA. Appropriate e ,.p,es:jion vectors are well known to those with ol~li"a,y skill in the art and include those that are replicable in eukaryotic and/or prokaryotic cel'ls and those that remain episomal or those which integrate into the host cell gPnomP.

Construction of vectors according to the invention employs conventional ligation techni~ e~
Isolated pl~emitl~ or DNA fràgments are cleaved, tailored, and relig~ted in the form desired to .

generate the pl~emitlc required. If desired, analysis to confirm correct seq-lçnces in the constructed plasmids is pelroll..ed in a known fashion. Suitable methods for constructing ~;AI,ression vectors, pleph~illg in vitro transcripts, introducing DNA into host cells, and pelrulll~ing analyses for ~eseseing c A~lession of the DNA of the invention and fimction are known to those skilled in the art. DNA presence, amplifi~tion and/or eAples~ion may be measured in a sample directly, for example, by conventional Southern blotting, Northern blûtting to qu~ntit~te the transcription of mRNA, dot blotting (DNA or RNA analysis), or in situ hybridization, using an apprûp.iately labelled probe based on a seq~1ence provided herein.

In accordance with another embodiment of the present invention, there are provided cells co~ the above-described nucleic acids (i.e., DNA or mRNA). Such host cells such as prokaryote, yeast and higher eukaryote cells may be used for replicating DNA and producing the multidomain protein of the invention. Suitable prokaryotes include e~1bact~ria, such as Gram-negative or Gram-positive or~niem~ such as E. coli, e.g. E. coli K-12 strains, DHSa, HB101 and XL1 Blue or Bacilli. Further hosts suitable for mllltidom~in protein encoding vectors include eukaryotic microbes such as fil~ ."lous fungi or yeast, e.g. Saccl-~olllyces cerevisiae. Higher eukaryotic cells include insect and vertebrate cells, particularly ~ n cells. In recent years propagation of vertebrate cells in culture (tissue culture) has become a routine procedure. The host cells referred to in this disclosure comprise cells in in vitro culture as well as cells that are within a host animal.

DNA may be stably incorporated into cells or may be transiently ~-essed using mPthods known in the art. Stably ll~lsre~;~ed "~ n cells may be prepared by ~l,...~rec~ cells with an ~ .[ession vector having a selectable marker gene, and ~lOwillg the l~ re~;Led cells under conditions selective for cells cA~lessillg the marker gene. To prepare transient transre~;L~Ls, ~--~",--~ n cells are transfected with a reporter gene to monitor ll~ rç~ n ~ffi~i~nr,y.

To produce such stably or transiently transfected cells, the cells should be IrS~~.cre~led with an amount of protein-encoding nucleic acid s~1ffi-ient to form the multidomain protein of the invention.

Host cells are tr~ncfçcted or l~ srulnled with the above-captioned t;~lessiûn or cloning vectors of this invention and cultured in conventional nutrient media modified as appropliale for in~1çing promoters, selecting transformants, or amplifying the genes encoding the desired sequences. Heterologous DNA may be introduced into host cells by any method known in the W O96tl3599 PCT~EPg5/04270 art, such as transfection with a vector encoding a heterologous DNA by the c~ m phosphate coprecirit~tion technique or by electroporation. Numerous methods of ~ re~;l;on are known to the skilled worker in the field. S~lccessfi-l tr~n~fection is generally reco~ni7ed when any intlic~tiQn of the operation of this vector occurs in the host cell Tran~rolmalion is achieved using standard techniques appropliate to the particular host cells used.

Incorporation of cloned DNA into a suitable ~ ression vector, k~n~fection of eukaryotic cells with a pl~mi~l vector or a collll~illaLion of plasmid vectors, each encoding one or more distinct genes or with linear DNA, and selection of lr~ sre~led cells are well known in the art (see, e.g.
Sambrook et al. (1989) ~olec~ r Cloning: A Laboratory Manual, Second F.tlition, Cold Spring Harbor Laboratory Press).

Transfected or transformed cells are cultured using media and culturing methods known in the art, preferably under contlition~, whereby multidomain protein encoded by the DNA is expressed. The composition of suitable media is known to those in the art, so that they can be readily prepared. Suitable culturing media are also commercially available.

Within the present invention an effector nucleic acid colll~lises a desired nucleic acid, which may be e.g. a therapeutically active nucleic acid or a reporter gene, and a specific nucleic acid sequence (also referred to as nucleic acid recognition sequence or cognate structure) recognizable by the nucleic acid binding domain of the multi-domain fusion protein, and, if neede~, suitable regulatory elements for the c,.~ul es~ion of the desired nucleic acid. If le~ullcd, an effector nucleic acid suitable as a component in the CO111~J1eA of the invention is capable of dilecling the ~ ,lt;ssion of the desired nucleic acid to be delivered to the target cell. A
therapeutically active nucleic acid desired to be delivered to the target cell by the Ir~s~
system of the invention may be therapeutically active itself, e.g. by selectively a~ec~ing a prele~ ecl process within the target cell, e.g. inhibit sythesis of a particular protein, or it may code for a therapeutically active gene product to be eAplessed in the target cell. For c,.~l~ple, such a gene product may be a new or modified gene, e.g. a tumor supplessor gene or an antibody gene for intr~ctoll~ r immlmi7.~tion, a nucleic acid coding for a prodrug activating enzyme, e.g. herpex simplex thymidine kinase, a nucleic acid coding for ~I.;,.. ~odulator or a foreign antigen, which is suitable for "alienating" the target cell.
. ~
The cognate structure may be an RNA or, ~lt;rt;l~bly~ a DNA. The el~c~or nucleic acid may comprise one or more, preferably 2 to 8, nucleic acid recognition sequences. If two or more such sequences are present on an effector nucleic acid, advantageously these are arranged in a way to avoid sterically hindrance of the binding of the m-llti-lom~in protein of the invention.
Pler~- ed is an effector nucleic acid comprising one or more copies, particularly two copies, of the above identified GAL4 recognition sequence. Said seql~nce binds protein dimers.

Typically, the nucleic acid desired to be expressed in the target cell is a gene, generally in the form of DNA, which encodes a desired protein, e.g. a therapeutically active protein. The gene comprises a structural gene encoding the protein, e.g. an imml1nmodlll~tc!ry protein, in a form suitable for processing and secretion as a soluble or cell surface protein by the target cell. For ~Y~mple, the gene encodes app,up-iate signal sequences which direct processin~ and secretion of the protein or polypeptide. The signal sequence may be the natural sequence of the protein or an exogenous sequence. The structural gene is linked to applop.iate genetic regulatory elements required for t;A~ ssion of the gene-encoded protein or polypeptide by the target cell.
These include a promoter and optionally an çnh~ncer element operable in the target cell. The gene can be contained in an expression vector, such as a plasmid or a transposable genetic mPnt also with the genetic regulatory elements necçe~ry for cA~ ssion of the gene and secretion of the gene-encoded product. For example, a component of the nucleic acid delivery system of the invention may be a eukaryotic t;A~-es~ion plasmid, e.g. a plasmid comprising DNA coding for chloramphenicol acetyltransferase (CAT) driven by an SV-40 promoter, e.g.
pl~emi~l pSV2 CAT. The e~clor nucleic acid may also be a linear DNA fragm~nt The effector nucleic acid may comprise bacterial elements suitable for the selection and cloning of the vector.

Suitable eukaryotic ~A~-ession pl~cmitls or linear DNA fragm~nt~ carry a promoter structure, the nucleic acid to be introduced and expressed in the target cell, eukaryotic splice and polyadenylation signals, and a specific DNA sequence recognized by the DNA binding domain of the multi-domain fusion protein.
.
F.~mpl~ry genes to be expressed in the target cell also include reporter or marker genes, such as genes encoding luciferase or beta-galactosidase.

~ .
If required, the effector nucleic acid may comprise a eukaryotic splice signal or a polyadenylation signal.

The preparation of an effector nucleic acid accû~dillg to the invention involves methods well known in the art, e.g. those referred to in more detail above.

W O96tl3599 PCTAEP95/04270 The type and nature of the nucleic acid to be introduced into the target cell is determined by the effect envisaged to be achieved said target cell, e.g. in case of use in gene therapy by the gene or gene section to be expressed to replace a defective gene, or by the target seq~lence of a gene the '~ ession of which is to be inhibited. The nucleic acid to be delivered into the cell may be a DNA or a RNA, with no restrictions to the seqll~nce of said nucleic acid.

If the system of the invention is applied to tumor cells to be employed as tumor vacrin~e~ the DNA to be introduced into the cell preferably codes for an immlmomod~ tinf~ protein, e.g. a cytokine or a cell surface antigen suitable for activating a immllne response. Col,lbin~l;( ne of DNAs coding for cytokines, e.g. IL-2 and IFN-g, B7.1, B7.2, MHC1 or MHC2 are conei~red particularly useful.

If desired, two or more difre,~;"~ nucleic acids may be introduced into the cell, e.g. a plasmid comrriein~ cDNAs coding for di~ere"L proteins, under control of suitable regulatory sequences, or two di~lelll pl~emi~e comrri.eing di~l~lll cDNAs.

The present invention provides means for di~ ;ling or enhancing the ~Al,lession of desired proteins (or RNA) in target cells, transgenic animals or insects. The multidomain protein or the protein/nucleic acid complex of the invention is used to introduce nucleic acid into eukaryotic cells, particularly higher eukaryotic cells. ~ r~,led is the use for ll~ulsre~iLion of m~mm~ n, particularly human cells, e.g. tumor cells, myoblasts, fibroblasts, hep~tocytes, endothelial cells or re~il~Loly tract cells. The nucleic acid transfer system of the present invention is useful for the selective DNA ll~l:irer into target cells for in vitro applic~tione such as determine the immllne response to a particular antigen, and ex vivo or in vivo gene therapy protocols for the therapeutical or prophylactical tre~tm~nt of ~ le in need thereof, particularly hllm~ne Such ",~."",Ale include those suffering e.g. from inherited or acquired diee~ees, such as genetic defects, e.g. cystic fibrosis (cystic fibrosis lli...e..~...l r~ne contl~lct~nre gene), hypercholestemia (low density lipoprotein (LDL) receptor gene, b-th~ semi~ cancerous, autoimml.ne or infectious ~ise~eeS Ex vivo or in vivo application of the protein/nucleic acid complex of the present invention may result in prevention, stabili7~tion or reversion of diee~ees such as ~V, melanoma, diabetes, ~l7hçimer disease or heart cliee~ees According to the invention tre~tm~nt of cancer may be accompliehed by blockade of oncogene ~,Al,res~ion with antisense constructs, by the introduction and cA~ression of tumor supplessor genes, prodrug activating enzymes or toxic effectors, by ~lmini~ration of tumor vaccines or intracçll~ r ;~ ion. If appr~,p~ e, the nucleic acid l,~lsrer system of the present invention is applied in co,lll,inalion with a polycation, such as polylysine, poly~gilline or polyollliLhille, a heterologous polycation comprising two or more di~lenl, positively charged amino acid, non-peptidic synthetic polycations, e.g. polyethyl~nriminP~7 a pLoL~lline, or a histone. Adv~nt~geously, the polycation is added after the formation of the protein/nucleic acid complex of the invention, but before the application thereof.

The nucleic acid ~ srel system of the invention may also be used for immlmP, re~ tir,n in org~ni~m.~ particularly v~cçin~tion~ or for the production of antibodies for experimpnt~l~
diagnostic or therapeutic use. For the purpose of v~ccin~tic)n the eLreclor nucleic acid component of the complex of the invention collll,lises an e,.l~lessil~le gene encoding a desired immlmogenic protein or peptide, which preferably has a costimlll~tQry effect. The gene is lcoll,ol~led into the target cell, expressed and following secretion of the gene product as a soluble protein or a cell surface protein an immlme response against the immlmogenic protein or peptide, such as all or part of the hçp~titie B or C ~nfip~.n, is elicited in the host olgalf,slll. If the protein against which the immnne response is desired is non- or poorly immlmogenic, the protein may be coupled to a carrier protein providing for sufficient immlmogen;~ity. This is accomplished by recolllbh~ means by prep~ing a chimeric DNA construct encoding afusion protein comprising the protein of the invention and the carrier.

The introduction of genes into target cells with the aim of accomplishing in vivo ~ylllhesis of thel~eulically effective gene products, e.g. in case of a genetic dçfir;çncy to make up for the d~ficiPnt gene, may also be accomplished using the nucleic acid ll~lllsrer system of the invention. Apart from "conventional" gene therapy concepts which aim at achieving long-term success of tre~tmPnt following a one time tre~tment the present invention provides means for the single or multiple ~tlminictration of a therapeutically efficient nucleic acid like a pharm~r,e~ltical ("gene pharm~r,eutical"). The nucleic acid ll~l:~r system of the present invention may also be useful for transient gene therapy (TGT), preferably for l~ îer of a ;coll~in~lL antigen receptor into lymphocytes (especially CTLs). If desired, a co~
c.~lt;ssion level of l,~lsrelled genes may be ...A;..~ ed by repeated application of the protein/DNA complex of the invention.

The invention also provides a pharm~ce~ltical composition comprising as effective component a protein/nucleic acid complex of the invention and a pharm~r,e~ltically acceptable carrier. Said complex comprises a therapeutically effective nucleic acid, advantageously as a component of a gene construct. In a pl~lled embodiment the pharrn~r.eutir,~l composition is provided as a lyophili~te or frozen in a suitable buffer. A pharm~ce~tically acceptable carrier is any carrier in which the protein/nucleic acid complex can be solubilized such that it can be used acco,ding W O96/13599 PCT~EP95/04270 to the invention. A pharm~ce~ltical composition of the invention may ~d-lition~lly comrriee an above identified polycation.

Furthermore, the invention provides a tr~nefection kit comprising a carrier, co~ er or vial col~ the protein/nucleic acid complex of the invention and further materials needed for the transfection of higher eukaryotic cells according to the invention. In said kit, the two components of the complex may be $ored together or separately, depending on the inten-led use and the stability of the comrleY If stored sep~alely, the two cG~ ol~llls of the protein/nucleic acid complex of the invention may be mixed immetli~tP.ly before the compl~Y is used.

In vivo therapeutic ~t1minietration may be via a systemic route, transde-rmal applic~tiQn, e.g. as an aerosol formulation, and intravenous injection being plerelled. Target organs for such applications include liver, spleen, lung, bone lllallOW and tumors.

~tlministration for therapeutic purposes may also occur ex vivo involving removal of suitable cells from the patient or another subject, culturing and tre~tmP.nt of the cells with the protein/nucleic acid complex of the invention under conditions allowing internalization of said c~mpl~Y and subsequent (re-) ~minietration of the treated cells to the patient. Cells suitable for such ex vivo tre~tmpnt include bone llla~ w cêlls, hepatocytes or myeloblasts. Ex vivo tre~tmPnt is also possible for cancer v~cçines A therapeutic tre~tmPnt involving cancer vaccines comprises transfection of tumor cells isolated from a patient with a nucleic acid coding for a cytokine and subsequent re~dminietration of the ll~ilisrt;~iLed cells producing the cytokine.

In another aspect, the invention relates to a method for the delivery of a nucleic acid into a target cell, particularly a higher eukaryotic cell, said method colllplis;ng exposing the cells to the protein/nucleic acid delivery system of the invention in such a way that the colllpl~ is internalized and liberated from the endosomes.

The invention particularly relates to the specific embo~limP.nts as described in the F~mplee which serve to illustrate the present invention but should not be co~strued as a limit~tion thereof.

Abbreviations: Pse~ldomonas aeruginosa exotoxin A = ETA; GAL4 = Galactose gene cluster gene 4; DTT = dithiothreitol; aa = amino acids.

-W O96/13599 PCT~EP9S/04270 E~ample 1 Cloning of the Pseudomonas a~ o~ e~oto~in A gene fragment encoding amino acids 252 to 366 1.1 Derivation of DNA fragments and purifi~
Plasmid pWW20 (Wels et al., Cancer Res. 52: 6310, 1992) carries a trl.nc~ted ETA gene encoding amino acids 252 to 613 of exotoxin A from Pseudomonas aeruginosa PAK (Gray et al., Proc. Natl. Acad. Sci. USA 81: 2645, 1984; Lory et al., J. Ractçriol. 170: 714, 1989). This gene colllaills domains II and m, the translocation and ADP-ribosylation domains, respectively, of the wild-type toxin. pWW20 (1 mg) is tiigested with XbaI and XhoI. DNA
fr~gm~ntc are separated on a 1.0 % (w/v) agarose gel (ultra pure agarose, BRL) and the expected 769 bp XbaI/XhoI DNA fragment encoding ETA amino acids 252 to ~06 is eluted using the QIAquick gel extraction kit (QIAGEN) according to procedures provided by the m~mlf~c.tllrer. The eluted fragment is subsequently tlige,sted with MaeII, DNA fragm~ont~ are separated on a 1.5 % (w/v) agarose gel and the expected 349 bp XbaVMaeII DNA fragment encoding ETA amino acids 252 to 366 (design~tecl DETA) is eluted as described above.

1.2 Oligonucleotides:
A double stranded DNA adaptor with MaeII and EcoRI coll~alible ends is constructed by annealing 0.5 nmol of the oligonucleotide having the sequence set forth in SEQ ID NO. 7) with 0.5 nmol of the oligonucleotide having the sequence set forth in SEQ ID NO. 8 by incub~tion at 65~C for 3 min and cooling to room temperature The seql1~n~e of the partially double stranded MaeII/EcoRI adaptor oligonucleotide is 1-~ 20 30 40 5'- CGAGAAGCTT GAGAGCTCTG ACTACAAAGA CGAACTTTAAG.. - 3 3 ~ - . . TCTTCGAA CTCTCGAGAC TGATGTTTCT GCTTGAAATT CTTAA -5.

Bp 1 to 2 represent the MaeII compatible overh~nging end, bp 5 to 10 a HindIII restriction site, bp 13 to 18 a SacI restriction site, and bp 42 to 45 the EcoRI comp~tihle overh~nging end.
_ ~ = =

1.3 ~ ticn:
Plasmid pWW191 is a pUC19 derived plasmid wherein the original ~in-lm restriction site of the multiple cloning site of pUC19 is de~l,oyed and converted into a XbaI restriction site.
pWWl91 (50 ng) is digested with XbaI and EcoRI, and 30 ng of purified DETA fragment ~ = = ~ ~ =

WO 96/13599 _ PCTIEP95/04270 (see Fx~mple 1.1), and 20 pmol MaeII/EcoRI oligonucleotide adaptor are ligated using 0.5 U
T4 DNA ligase (New F.ngl~nll Biolabs) in 50 mM Tris-HCl, pH 7.8, 10 mM m~nPs;~lmr.l~loti(lç~ 10 mM DTT, and 0.8 mM ATP overnight at 16~C. One half of ligation ~ ule is used to l~ roll.. E.coli XL1 Blue (Stratagene) to obtain ampicillin resistant colonies. These are screened for the deslred ligation product using a NaOH based plasmid "~ fiplt;pl' method (~ni~tie et al., Molec~ r Cloning: A Laboratory M~ml~l/Second Edition, Cold Spring Harbor Laboratory, 1989). The obtained plasmid is (leeiP.n~ted pWW25. The partial DNA
sequence of pWW25 encoding modified exotoxin A from P. aeruginosa is shown in SEQ ID
NO. 9. Said DNA seqllPnr,e has the following re~lùres:

from 1 to 4 bp synthetic spacer from 5 to 349 bp encoding aa 252 to 366 of P.aeruginosa exotoxin A (DETA) from 349 to 393 bp synthetic MaeII/EcoRI adaptor from 386 to 388 bp ochre stop codon ~om 389 to 394 bp non-coding synthetic spacer.

)le 2 Cloning of the yeast transcription factor GAL4 gene fragment encoding amino acids 2 to 147 Plasmid pO2G2A (Yang et al., EMBO J. 10: 2291, 1991) which conlains a GAL4 gene fragment encoding amino acids 1 to 147 of GAL4 (Laughon and CTestPl~n(l, Mol. Cell. Biol. 4:
260, 1984) is used as a tP.mpl~te in a polyl,lel~se chain reactiori to amplify a GAL4 DNA
fragment encoding amino acids 2 to 147 (dçsign~ted DGAL4).

2.1 Polymerase chain reaction: =
12 ng of pO2G2A (Yang et al., EMBO J. 10: 2291, 1991) is used for DNA ~mplifir,ation in a 50 ml reaction co..~ g 50 pmol each of the two oli~omlcleotides complP.mPnt~ry to regions in the yeast GAL4 gene 5'- CAGATGAAGCTTCTGTCTTC -3' (SEQ ID NO. 10) and 5'- GAATGAGCTCGATACAGTCAACTG -3' (SEQ ID NO. 11), 4 ml 2.5 mM dNTP
(N= G, A, T, C) mixture, 5 ml 10x Taq DNA polymerase buffer (Boehringer M~nnhP,im) and 2.5 U of Taq DNA polymerase (Boehringer Mannheim). Taq DNA polymerase is added after initial den~lul~lion at-94~C for 2 min. For 30 cycles ~nnP~ling is pelr~llned for 1 min at 55~C, primer PYtPn~ion for 1 min at 72~C, denaturation for 1 min at 94~C. Finally, amplific~tion is complP~te~l by a 3 min primer P.xtP~n.~iQn step at 72~C.

, wo 96/13599 PCTIEPg5/04270 .2 Derivation of the GAL4 DNA fragment and purification:
Amplification products are sepal~Led on a 1.2 % (w/v) agarose gel (ultra pure agarose, BRL), DNA of the expected size is eluted, and subsequently r~ sted with ~inrll~T and SacI. The expected 441 bp DGAL4 DNA fragment encoding amino acids 2 to 147 of GAL4 is sep~aled on a 1.2 % agarose gel and purified by elution from the gel as described above.

.3 T ig~t;on:
pWW25 (50 ng) tligested with Hindm and SacI, and 30 ng of purified amplifi~tion product are ligated using 0.5 U T4 DNA ligase (New F.ng]~nrl Biolabs) in 50 mM Tris-HCl, pH 7.8, 10 mM m~gne~ m chloride, 10 mM DTT, and 0.8 mM ATP overnight at 16~C. One half of ligation Illi~Ult; iS used to ~ Ecoli XL1 Blue (Stratagene) to obtain ~mr:~illin resistant colonies. These are screened for the desired ligation product using a NaOH based plasmid "l~ i,prep" method (MAni~ti.~ et al., Molecular Cloning: A Laboratory ~ml~l/Second Edition, Cold Spring Harbor Laboratory, 1989). The obtained plasmid is de~ignAted pWW35.
The partial DNA sequence of pWVV35 encoding partial GAL4 from yeast is shown in SEQ 1D
NO: 12. The features of said sequence are as follows:

from 1 to 438 bp encoding amino acids 2 to 147 of yeast GAL4 from 439 to 443 bp synthetic spacer.

Example 3 Tcol~t:on of RNA from the hybridoma cell line FRP5 3.1 Growth of FRP5 cells:
F~P5 hybridoma cells (1 x 108; deposited under the Budapest Treaty on November 21, 1990 at the European Collection of Animal Cell Cultures (ECACC) in Porton Down, Salibury, UK, under accession number 90112115) are growvn in s~sp~n~ion culture at 37~C in DMEM
(Seromed) further co.~lA;~ 10% FCS (Amimed), 1 mM sodium pyruv~e (Seromed), 2 mMgllltAmine (Seromed), 50 mM 2-mercaptoethanol and 100 mg/ml of gellL~ll~cil1 (Seromed) in a hllmi~lified atmosphere of air and 7.5% CO2 in 175 cm tissue culture flasks (Falcon 3028).
The cells are harvested by centrifugation, washed once in PBS, flash frozen in liquid nitrogen and kept frozen as a pellet at - 80~C in a clean, sterile plastic capped tube.

3.2 Extraction of total cellular RNA from FRP~ cells:
Total RNA is extracted using the acid ~l~ni~lini~lm thiocyanate-phenol-chlo-or~-lll method described by Chomczynski & Sacchi (Anal. Biochem. 162: 156, 1987). Cell pellets of FRP5 cells (1 x lOg) are thawed directly in the tube in the presence of 10 ml of den~tllrin~ solution (4 M ~l~nitlinillm thiocyanate (Fluka), 25 mM sodium citrate, pH 7.0, 0.5% N-lauroyl-sarcosine (Sigma), O.lM 2-melcapLc~ethanol). The solution is homogenized at roomtelllpelalule. Sequentially, 1 ml of 2 M sodium acetate, pH 4, 10 ml of phenol (water s~Lul~led) and 2 ml of chlolofollll-isoamyl alcohol mixture (49:1) are added to the homogenate. The final suspension is shaken vigorously for 10 sec and cooled on ice for 15 min. The samples are centrifuged at 10,000 x g for 20 min at 4~C. After centrifil~tion~ RNA
which is present in the aqueous phase is mixed with 10 ml of isoplopallol and placed at -20~C
for 1 h. The RNA precip;l~le is collected by centrifi1~tion, the pellet dissolved in 3 ml water and the RNA r~reci~ ed by addition of 1 volume of isopropallol at -20~C. After centrifilg~tif)n and washing the pellet in ethanol, the final pellet of RNA is dissolved in water.
The method yields ap~ xi...~lely 300 mg of total cellular RNA. The final purified material is stored frozen at -20~C.

3.3 Isolation of poly~A) containing RNA:
Poly(A) con~ g RNA is selected from total RNA by chloll~ography on oligo(dT)--cellulose (Boehringer l\/ll~nnhçim) as described originally by Edmonds et al. (Proc. Natl. Acad.
Sci. USA 68: 1336, 1971) and modified by Maniatis et al. (Molecular Cloning: A Laboratory M~nu~l, Cold Spring Harbor Laboratory, 1982, p. 197). The poly(A)-co~ RNA isprepaled as described in the published procedure with the exception that the RNA is eluted from the oligo(dT)-cellulose with water rather than SDS-co~ g buffer. The poly(A)--CQI~ RNA is ~re~ aled with ethanol and collected by cçntrifilg~tion. The yield of poly(A)-col-~ g RNA is appro~ alely 30 mg from 300 mg of total cellular RNA. Thefinal punfied material is stored frozen at -20~C.

~mple 4 Cloning of functional heavy and light chain rearrangements from the FRP5 hybridoma cell line Poly(A)-co..l~il-;,~g RNA i~ol~ted from FRP5 hybridoma cells as described in Example 3.3 provides the source for cDNA synthesis and subseq l~nt ~mplific~tion of V-region mini~n~:s Amplification products of the expected size are purified from agarose gels and cloned into app,opliate vectors. Functional rearrangç.. ~ are idçnfified by sequ~ncin~ -W O96/13599 PCT~EFg5/04270 4.1 Oligonucleotides:
Oligonucleotide MCK2 is dç~i~n~.d to be compl~ . y to a region in the murine immllnoglobulin k (kappa) cQn~ mini~.ne and has the nucleotide seq~l~nce set forth in SEQ ID NO. 13. Oligonucleotide MCHC2 is desi~n~.d to be complem~nt~ry to a region in the murine immlmoglobulin gl con.clS~l mini~;ene and and has the nucleotide sequenre set forth in SEQ ID NO. 14. The oligonucleotides VHlFOR, VHlBACK, and VKlBACK are clç.~ d by Orlandi et al. (Proc. Natl. Acad. Sci. USA 86: 3833, 1989) to match cO~ s sequences.

VHlFOR: 5' - TGAGGAGACGGTGACCGTGGTCCCTTGGCCCCAG - 3' VHlBACK: 5' - AGGT(C/G)(C/A)A(G/A)CTGCAG(G/C)AGTC(T/A)GG - 3' VKlBACK: 5' - GACATTCAGCTGACCCAGTCTCCA - 3' 4.2 cDNA synthesis:
55 ng of poly(A)-co. ~ RNA is dissolved in a buffer cc. .l ~ 50 mM Tris-HCl, pH 8.3, 3 mM m~n~illm chloride, 10 mM DTT, 75 mM KCl, 400 mM dNTPs (N - G, A, T and C), 100 mg BSA (molecular biology grade, Boehringer M~nnh~im), 100 U RNAse inhibitor(Boehringer ~nnh~?im), 25 pmol MCK2 and 25 pmol MCHC2. The RNA is denatured at 70~C for 5 min and then chilled on ice for 2 min. After addition of 200 U of MMLV reverse transcriptase (Gibco, BRL) cDNA synthesis is achieved by inc~lb~tion for 1 h at 37~C.

4.3 Polymerase chain reaction:
One tenth of the cDNA reaction is used for DNA ~mrlific~tion in buffer c~ 10 mM
Tris-HCl, pH 8.3, 1.5 mM MgCl2, 50 mM KCl, 10 mM b-ll.t;rcaploethanol, 200 mM dNTPs (N= G, A, T and C), 0.05% Tween-20% (Merck), 0.05% NP-40% (Merck), 10% DMSO
(Merck), 25 pmol oligonucleotide 1 (see below), 25 pmol oli~onllcleotide 2 (see below) and 2.5 U Amplitaq% DNA polymerase (Perkin Elmer Cetus). Taq polymerase is added a~er initial denaturation at 93~C for 1 min and subseqll~nt ~nne~lin~ at 37~C. In the first 4 cycles primer extension is performed at 71~C for 0.2 min, denaturation at 93~C for 0.01 min and ~nne~lin~ at 37~C for 0.2 min. For the last 25 cycles the ~nne~lin~ te.llp~ re is raised to 62~C. Finally, amplification is completed by a 3 min primer extension step at 71~C.
.

PCR Product oligonucleotide 1 oligonucleotide 2 H VHlFOR = VHlBACK
LC MCK2 VKlBACK

W O96/13599 PCT~EP95104270 4.4 Modification and puri~lcation:
Amplified m~tPri~l is extracted with CHCl3 and pleci~ aled with ethanol in the presence of 200 mM LiCI. To f~ilit~te cloninp~, blunt ends are created by a 3 min l.e~ with 1 U T4 DNA polymerase (Boek.;,-ge, M~nnhPim) in 66 mM Tris-acetate, pH 7.9, 132 mM polass;.lln acetate, 20 mM m~g~ ;l,... acetate, 1 mM DTT, 200 mg/m~ BSA (molecular biology grade, Boe~-n~er ~nnheim), and 400 mM dNTPs (N = G, A, T and C). The polymerase is inactivated by heating for 15 min at 65~C before phosphorylation of the DNA with 10 U T4 polynucleotide kinase (Pharmacia) at 37~C for 1 h. For this purpose the buffer is ~dj~1sted to 50 mM EDTA and 1 mM ATP. The modified amplification products are sep~led on a 1.2%
(w/v) agarose gel (ultra pure DNA grade agarose, Biorad) and DNA of the expected size is eluted by means of DEAE NA 45 I--t;--lbl~nes (Schleicher & Schuell).

4.5 Ligation:
Bluescript% KS+ (70 ng) linearized with XbaI, treated with Klenow DNA polymerase(Boehringer M~nnhPim) to give blunt ends and dephosphorylated with calf i.~es~
phosph~t~ee, and 30 ng of purified amplification product are ligated using 0.5 U T4 DNA
ligase (New Fngl~n~l Biolabs) in 50 mM Tris-HCl, pH 7.8, 10 mM m~gnesillnt chloride, 10 mM DTT, and 0.8 mM ATP overnight at 16~C. One half of the ligation ~lixlure iS used to l-~-sro--,- E. coli K803 to obtain ampicillin resistant colonies. These are screened for the desired ligation products using a NaOH based plasmid "Il.il~iprep~ method (~ni~tie et al., Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory, 1982). The following plasmids are obtained:

PCR product Plasmid clones H pMZ16/1 LC pMZ18/1 4.6 Sequencing:
Seqll~nc.in~ is done using Sequenase% kits (United States Biochemicals) with T3 and T7 oligonucleotide primers according to procedures provided by the m~mlf~ct~lrer. Plasmid pMZ18/1 contains a fiunc,tional FRP5 kappa light chain variable domain insert. Plasmid pMZ16/1 contains a fimctiQn~l FRP5 heavy chain variable domain insert. Plasmids pMZ16/1 and pMZ18/1 are used as a source for further subr.loning steps.

Example 5 Construction of the MAb FRP5 single-chain Fv gene 5.1 Construction and sequence of a cloning linker for the heavy and light chain variable domain cDNAs:
Using oligQn-lcleotides, a linker sequence which allows the cloning of PCR amplified mouse heavy chain variable domain cDNA as a PstI~13stEII fragment and of PCR ~mplified mouse kappa light chain variable domain cDNA as a PvuII/BglII fragment is constructed as desc~ ;l.ed by Wels et al., Biotechnology 10: 1128, 1992 This creates an open reading frame in which heavy and light chain variable dom~in~ are connected by a sequence coding for the 15 amino acid stretch Gly-Gly-Gly-Gly-Ser-Gly-Gly-Gly-Gly-Ser Gly-Gly-Gly-Gly-Ser (SEQ IDNO:49). This amino acid linker has been shown to allow correct folding of an antigen binding domain present in heavy and light chain variable dom~in~ in a single-chain Fv (Huston et al., Proc. Natl. Acad. Sci. USA 85: 5879, 1988).

For the construction of the cloning linker the 6 complçmto.nt~ry oligonucleotides lA (SEQ ID
NO. 15), lB (SEQ ID NO. 16), 2A (SEQ ID NO. 17), 2B (SEQ ID NO. 18), 3A (SEQ ID
NO. 19), 3B (SEQ ID NO. 20) are used.

40 pM of oligonucleotides lB, 2A, 2B, 3A are phosphorylated at the 5' end using T4 polynucleotide kinase (Boehringer l~nnh~im) in four separate reactions in a total volume of 20 ml following the method described by Maniatis et al., supra. Oligon-lcleQtides lA and 3B
are not phosphorylated in order to avoid self ligation of the linker in the final ligation reaction.
After the kinase reaction, the enzyme is inactivated by inc~lb~tion at 70~C for 30min. In three separate reactions, each co.l~ g 40 pM of two oligonucleotides in a total volume of 40 ml, non-phosphorylated lA and phosphorylated lB, phosphorylated 2A and phosphorylated 2B, and phosphorylated 3A and non-phosphorylated 3B are mixed. Hybridization of the oligonucleotides in the three re~ctior~.~ is carried out by heating to 95~C for 5 min, incubation at 65~C for 5 min and slowly cooling to room te~ Ule. lOml from each of the three reactions are mixed, 4 ml of 10 x ligation buffer (Boehringer) and 4 units of T4 DNA ligase (Boehringer) are added and the total volume is adjusted to 40 ml with sterile water. The annealed pairs of oligonucleotides are ligated into one linker sequence for 16 h at 14~C. The reaction mixture is extracted with an equal volume of phenol/chloroform (1: 1) followed by re-extraction of the aqueous phase with an equal volume of chlororc.lll-/isoamylalcohol (24:1).
The aqueous phase is collected, O.lvolumes of 3 M sodium acetate pH 4.8 and 2 volumes of ethanol are added, and the DNA is plecipilaled at -70~C for 4 h and collected by W O96/13599 PCT~EP95/04270 centnfilg~tion. The resulting linker sequence has a SphI and a XbaI adaptor end. It is ligated to SphI and XbaI digested pUCl9 in a reaction co"~ ing 100 ng of ligated linker and 200 ng of SphVXbaI digested pUCl9. After tran~ro,~ ion into _. coli XLl Blue% (Strat~g~n~), plasmid DNA from 4independent colonies is isolated by the alkaline Iysis mini-plep~Lions method ~ni~ti~ et al., Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory, 1982). The DNA sequence of the linker doned in pUC19 is determined by seqllçnring double stranded DNA in both directions with Seq~l~n~e II (IJnited States Biochemicals) and pUC universal and reverse primers (Boehringer) following the m~nllf~ctllrer's protocol. Three out of the four lecolnbi~ pUCl9 isolates seq~l~nce~l contain the correct linker sequ~ce. One of them is design~ted pWWl9 and used in the further experiments. The partial DNA sequence of pWWl9 which is set forth in SEQ ID NO.
21 has the following features:

from 30 to 35 bp PstI site from 38 to 44 bp BstEII site for subcloning of heavy chain variable domain from 54 to 98 bp coding sequence of (GlyGlyGlyGlySer) 3 linker from 105 to 110 bp PvuII site from 112 to 117 bp BglII site from 120 to 125 bp BclI site for subcloning of light chain variable domain 5.2 Preparation of a pl~ for the subrlQning of variable domains:
The Fv cloning linker seq l~nce is derived as a 144 bp ~in-l~TT/SacI fragment ~om pWWl9 and inserted into ~in~1mlsacI digested Bluescript~/O KS+ (ex PvuII) (str~t~gene) which contains no PvuII restriction sites. The resl.lting plasmid, pWW15, allows cloning of heavy and light chain variable dom~in~ as PstI/BstEII and PvuIVBglII fr~gmto.nt~ respectively.

5.2.1 Subcloning of the FRP5 heavy chain variable domain:
Plasmid pMZ16/1 is di~ested with PstI and BstEII and the 338 bp heavy chain variable domain fragment of FRP5 is isolated. It is cloned into PstVBstEII digested pWW19 yielding the plasmid pWW3 1.

5.2.2 Mutation of the FRP5 light chain variable domain and ~-~f~hly of the Fv fusion gene:
To f~ilit~te subcloning of the FRP5 light chain variable domain into the Fv cloning linker, a PvuII restriction site and a BglII restriction site are introduced at the 5~ and 3' ends, respectively, of the coding region. The FRP5 light chain variable domain coding region is i~ol~ted as a SacI/BamHI fragment from pMZ18/1. SacI and BamH~ are restriction sites of the Bluescript% polylinker present in pMZ18/1. The fragment contains the cnmplete light chain variable domain fragment of 392 bp amplified by PCR using the ~ligQmlcleQtide MCK2 (see above). This fragment is mllt~ted and amplified by PCR using the oligonucleotides VL51: 5~-GACATTCAGCTGACCCAG-3~ ( SEQ ID NO. 22) and VL3~: 5'-GCCCGTTAGATCTCCAATTTTGTCCCCGAG-3' (SEQ ID NO. 23) for the introduction of a PvuII restriction site at the 51 end (VL51) and a BglII restriction site at the 3' end (VL31) of the kappa light chain variable domain DNA. 20 ng of the FRP5 variable light chain SacI/BamHI fragment are used as a template in a 100 ml reaction following the PCR conditions described in Example 4.3. The amplified and mllt~ted fragment is isolated after PvuII/BglII digestion as a 309 bp fragment from a 1.5% agarose gel and cloned into PvuII/BglII rligested PW W15 generating plasmid pWW41. The FRP5 kappa light chain variable domain is isolated as a BstEII/XbaI fragment from pWW41 and inserted into BstEII/XbaI digested PW W31. Thus the FRP5 heavy chain variable domain in P W W31 and the FRP5 kappa light chain variable domain are fused to one open reading frame. Double stranded DNA of three independent clones is sequenced with Sequenase II% kit (United Biochemicals) in both orientations using pUC universal and reverse primers (Boel~h~gel) following the m~mlf~ct~lrer~s protocol. One of the pl~mi~ls car~ing the FRP5 heavy chain variable domain fused to the mllt~ted FRP5 light chain variable domain is selected and de~ign~ted P~N52.

5.3 Mutation of the single-chain Fv(FRP5) gene:
To allow gene fusion with the single-chain FV(FRP5) encoding gene from PW W52 a stop codon at sequence the 3' end position in pWW52 is deleted as follows: plasmid DNA of pWW52 is digested with BstEII and BglII and the linker sequence and FRPS light chain variable domain encoding fragment is isolated. In another digestion, PW WS2 is cleaved with BstEII and BclI. Thus, the large fragment COI~ g vector sequences and the FRPS heavy chain variable domain encoding sequence is isolated. The BstEIItBglII VL fragment is now inserted into BstEII/BclI cleaved pWW52 COI~ VH. In the reslllting plasmid, pWW53, CA 02204020 l997-04-29 W O96/13599 PCT~EP9~/04270 the BglIVBclI junction is determined by seq~lP.nr.ing double stranded DNA as described above (SEQ ID NO. 24).

Example 6 Construction of rl~mi~ pWW152-5

6.1 Oligonucleotides:
A double stranded DNA adaptor with HindIII and PstI colllpa~ le ends is constructed by ~nne~ling 0.5 nmol of the oligonucleotide having the sequence set forth in SEQ ID NO. 25 with 0.5 nmol of the oligonucleotide having the sequence set forth in SEQ ID NO. 26 by inr.ub~tion at 65~C for 3 min and cooling to room telllpel~L-Ire. The structure of the oligonucleotide adaptor is:

5'- .AGCTTCAGGTACAACTGCA. - 3' 3'- ..... AGTCGATGTTG....... - 5'.

6.2 Derivation of pWW15 vector fragment and purification:
Plasmid pWW 15 (l mg; see Example 5.2) is (li~ested with HindIII and PstI. DNA fr~gmPn are separated on a 1.0 % (w/v) agarose gel (ultra pure agarose, BRL) and the expected 3.1 kb ~Tin~TTT/PstI vector fragment is eluted.

6.3 T i~t;~n of pWW15 HindIII/PstI fragment and oligon~ leQtir~e adaptor:
pWW15 (50 ng) ~Tint1TTT/PstI fragment and 50 pmol oligonucleotide adaptor are ligated using 0.5 U T4 DNA ligase (New Fngl~n~1 Biolabs) in 50 mM Tris-HCl, pH 7.8, 10 mM m~gnP.~ m chloride, 10 mM DTT, and 0.8 mM ATP overnight at 16~C. One half of ligation ~ ule is used to transform E. coli ~1 Blue (Stratagene) to obtain ~mpiçillin resistant colonies. These are screened for the desired ligation product using a NaOH based plasmid "Illiniprep" method.
The obtained plasmid is ~lçsi~n~ted pWW152.

6.4 Derivation of DNA fragments and purifi~t;Q~:
Plasmid pWW152 (1 mg) is digested with PstI and XbaI. DNA fr~gm~nt~ are separated on a 1.0 % (w/v) agarose gel (ultr pure agarose, BRL) and the expected 3.1 kb PstVXbaI vector fragment is eluted. Plasmid pWW53 (1 mg) is digested with PstI and XbaI. DNA fr~gmenti are sel~alaLed and the PstVXbaI DNA fragment encoding scFv(FRP5) is eluted as described above.

W O96/13~99 PCT~EP95/04270 6.5 Ligation of pWW152 vector fragment and the scFv(FRP5) gene fragment:
Plasmid pWW 152 (50 ng) tli~ested with PStI and XbaI, and 30 ng of purified PstVXbaI
scFv(FRP5) fragment are ligated using 0.5 U T4 DNA ligase (New Pn~]~n-l Biolabs) in 50 2 mM Tris-HCl, pH 7.8, 10 mM m~ n~ m chloride, 10 mM DTT, and 0.8 mM ATP overnight at 16~C. One halfofthe ligation mixture is used to ~ sr~ E. coli XL1 Blue (StMt~ne) to obtain ampicillin les;sl~l colonies. These are screened for the desired ligation product using a NaOH based plasmid "milfiplel," method. The obtained plasmid is dç~ign~ted pWW 152-5.
The DNA sequence of the scFv(FRP5) gene between the T-Tin-lm and XbaI restriction site is identical to the sequence of plasmid pWF46-5 (see F.x~mrle 8.) from nucleotide position bp 109 to bp 845 shown in SEQ ID NO: 1.

Example 7 Construction of the single-chain Fv (FRP5)-DETA-DGAL4 fusion gene

7.1 D~ alion of DNA fragments and purifir~ti~n pWW35 (1 mg) is digested with XbaI and EcoRI. DNA fr~gmPnt~ are separated on a 1.0 %
(w/v) agarose gel (ultra pure agarose, BRL) and the expected 821 bp XbaVEcoRI DNA
fragment carrying the DETA-DGAL4 fusion gene and ~ c~.nt synthetic sequences is eluted.
Plasmid pWW152-5 (1 mg) carrying the gene encoding the erbB-2 specific single-chain Fv (scFv) molecule scFv(FRP5) is digested with Hindm and XbaI. DNA fr~gm~nts are separated and the expected 735 bp T-TintlTTT/xbaI DNA fragment carrying the scFv gene is eluted as described above.

7.2 T.~ jQn pFLAG-l (50 ng) (IBI Bioc~mic~l~) digested with HindIII and EcoRI, and 30 ng of purified ~TintlTTT/XbaI scFv(FRP5) fr~gm~nt and 30 ng of purified XbaVEcoRI D ETA - D GAL4 fragment are ligated using 0.5 U T4 DNA ligase (New P.ngl~nd Biolabs) in 50 mM Tris-HCI, pH 7.8, 10 mM m~gn~Si~lm chloride, 10 mM DTT, and 0.8 mM ATP overnight at 16~C. One half of ligation mixture is used to transforrn E.coli XL1 Blue (Str~t~g~ne) to obtain ~mpi~.illin resistant colonies. These are screened for the desired ligation product using a NaOH based plasmid "llfilfiplep" method. The obtained plasmid is design~ted pWF45-5.

CA 02204020 l997-04-29 W O96/13599 PCT~EP95/04270 T~ .r,"'~ 8 Construction of an expression ~ mi(l carrying the scFv(~iRP5)-DETA-DGAL4 fusion gene

8.1 Derivation of DNA fragments and purification:
pWF45-5 (1 mg) is rli~sted with Hindm and SalI. DNA fr~ mpnt~ are sep~led on a 1.0 %
(w/v) agarose gel (ultra pure agarose, BRL) and the expected 907 bp ~inflm/SalI DNA
fragment car~ying the scFv(FRP5)-DETA252.308 (coding for ETA amino acids 252 to 308) fusion gene is eluted. pWF45-5 (1 mg) is digested with SalI and XbaI. DNA fr~gmP,nte are sepalaled and the expected 655 bp SalI/XbaI DNA fragment encoding DETA309.366-DGAL4 is eluted as described above.

8.2 T.jg~ti~n:
Plasmid pFLAG-1 is ~ligested with Hindm and XbaI and a double-stranded DNA linker encoding 6 His residues at its 5' end and the original Hindm-, EcoRI- and Xba-restriction sites of pFLAG-l at its 3' end are inserted 3' of the FLAG epitope. The resllltin~ plasmid pSW50 (50 ng) digested with HindIII and XbaI, and 30 ng of purified ~intlm/SalI
scFv(FRP5)-DETA252.308 fr~gmPnt and 30 ng of purified Sal/XbaI DETA309.366-DGAL4fragment are ligated using 0.5 U T4 DNA ligase (New Fn~l~ntl Biolabs) in 50 mM Tris-HCl, pH 7.8, 10 mM m~gnesil~m chloride, 10 mM DTT, and 0.8 mM ATP overnight at 16~C. One half of li~tion mixture is used to transform E.coli ~1 Blue (Str~t~g~ne) to obtain ampicillin colonies. These are screened for the desired ligation product using a NaOH basedpl~m;l "~ ~iple~" method (Maniatis et al., supra). The obtained pl~mi~l is desi~ted pWF46-5. The partial DNA sequence of pWF46-5 is shown in SEQID NO. 1. Said sequ~onee has the following features:

from 1 to 63 bp encoding the E.coli ompA signal peptide from 64 to 87 bp encoding the synthetic FLAG epitope from 88 to 114 bp synthetic spacer sequence from 115 to 834 bp encoding scFv(FRP5) from 835 to 843 bp synthetic spacer sequence from 844 to 1188 bp encoding amino acids 252 to 366 of ETA

from 1189 to ll91bp synthetic spacer sequence from 1192 to 1629 bp encoding amino acids 2 to 147 of yeast GAL4 from 1630 to 1653 bp synthetic spacer including sequence coding for KDEL retention signal CA 02204020 l997-04-29 from 1654 to 1656 bp ochre stop codon from 1657 to 1692 bp non-coding synthetic spacer The de~hlced amino acid sequence of the pW F46-5 encoded scFv(E;RP5)-DETA-DGAL4 protein inclll(ling a peptide spacer a the N-terminus (aa 1 to 17) is shown in SEQ ID NO. 2.

E~ample 9 Bacterial expression and purification of scFv(Ii~P5)-DETA-D GAL4:

Plasmid pW F46-5 iS ~ srol,lled into E.coli K12. A lecolll~hlan~ single colony is grown overnight in 50 ml LB medium cont~inin~ 100 ~Lg/ml ampicillin and 0.6 % glucose. The overnight culture is diluted 1:30 in 1 I fresh LB medillm co~ 100 ~g/ml ampicillin and 0.6 % glucose and grown at 37~C to an ODsso of 0.5. Isopropyl-beta-D-thiogalactopyranoside (IPTG) is added to a final concentration of 0.5 mM and c~plession is incluced for 1.5 h at room ~elllpel~ re. The cells are harvested at 4~C by centrifugation at 17,000 g for 10 min in a J2-HS centrifuge (Beckman) using a JA10 rotor (Becl~m~n).

9.1 Isolation of scFv(FRP5)-~ETA-~GAL4 from the bacterial cell pellet:
The bacterial cell pellet is resuspended in 30 ml of Iysis buffer c~ g 50 mM Tris-HCI, pH
8.0, 150 mM NaCI, 10 ,uM ZnC12, 0.3 mM PMSF, 8 M urea. The bacterial cells are Iysed by sonication for 3 min on ice. The Iysate is gently shaken for 1.5 h at room temperature and then c~ntrifilged at 4 ~C in a TL100 ultracentrifuge (Bec1~m~n) for 25 min at 100,000 g. The supernatant is collected, 10 mM imid~7:ole final concentration is added and stored at 4~C.

9.2 Purification of scFv(FRP5)-/~ETA-~GAL4 by af~mity chromatography:
A nickel-NTA affinity column (QIAGEN) is equilibrated in 50 mM Tris-HCI, pH 8.0, 150 mM
NaCI, 10 IlM ZnC12, 0.3 mM PMSF, 8 M urea, 10 mM imid~7:ole. Cleared supernatant from step 9.1 Co~ g the scFv(FRP5)-~ETA-~GAL4 protein is passed through the column. The column is washed with equilibration buffer. Bound protein is eluted with 250 mM imid~ole in equilibration buffer. The eluate is first dialysed for 16 h at 4~C against 60 volumes of 50 mM
Tris-HCI, pH 8.0, 50 mM KCI, 5 mM MgC12, 10 ~lM ZnC12, 20% glycerol, 400 mM L-al~ h~e. L-arginine is removed by a second dialysis for 16 h at 4~C against 60 volumes ofthe same dialysis buffer lacking the L-arginine. The dialysed protein solution is clarified at 4~C by c~ntrifi-~tion at 23,000 g for 30 min in a J2-HS centrifuge (Be~ m~n) using a JA20 rotor (Bec~m~n). The s~ a~ is collected and stored at 4~C. Protein purity is ~letrmined by =

W O96/13599 PCT~EPg5104270 SDS-polyacrylamide gel electrophoresis in a 12.5 % polyacrylamide gel. Typical protein purity after purification is greater than 90 %.

~m, ~e 10 Construction of eukaryotic expression plasmids cor~t~ ing GAL4 reco~rit:~n sequences A family of plasmids each Co~ g two GAL4 recognition sequ~nces are constructed. The pl~cmitls consist of a bacterial origin of replic~ti~ n, a bacterial s~lect~hle marker gene, and a eukaryotic e,~lession unit with the following general structure:

eukaryotic promoter - gene of interest - intron - dimeric GAL4 recognition sequence -polyadenylation site

10.1 Oligonucleotides:
A double stranded DNA adaptor with Hindm and BamHI compatible ends is constructed by ~nne~ling 0.5 nmol of the oligonucleotide set forth in SEQ ID NO. 27 with 0.5 nmol of the oligQmlcleotide set forth in SEQ ID NO. 28 by inr,llbation at 65~C for 3 min and cooling to room temperature. The partially double stranded DNA oligonucleotide co,~ g two GAL4 binding motifs is design~ted G4. The structure of the oligonucleotide adaptor is shown below:

lo 20 30 40 50 AGCTTGGATC CGGAGGACAG TCCTCCGGAG ACCGGAGGAC AGTCCTCC.. ..
....ACCTAG GCCTCCTGTC AGGAGGCCTC TGGCCTCCTG TCAGGAGGCT AG.

The realures are as follows:

bp 1 to 4 HindIII compatible overh~nging end; bp 6 to 11 BamHl restriction site; bp 11 to 27 GAL4 binding motif I; bp 28 to 32 spacer sequence; bp 33 to 49 GAL4 binding motif II; bp 48 to 52 BamHI co,..palible overh~nging end. Ligation of the BamHI comr~tihle end to the BamHI site of a restriction fragment results in the destruction of that Ban~I1 restriction site.

10.2 Derivation of pSV2CAT DNA fragments and purification:
Plasimid pSV2CAT (1 mg) (Gorman et al., Mol. Cell. Biol. 2: 1044, 1982) is ~ ested with HindIII and BamHI. DNA fr~ nt~ are sep~ed on a 1.0 % (w/v) agarose gel (ultra pure agarose, BRL) and the expected 3.4 kb T-TinclTTT/BamHI pSV2D vector fragment and the 1.6 W O96/13599 PCTAEP~S/04270 kb T-TinrlTTT/BamHI insert fragment carrying the chlor~mph~nicol acetyl ~r~lsrt;l~se (CAT) gene and a~1jacent vector sequences are eluted.

10.3 T ig~tiQn of pSV2D fragment and oligonucleotide adaptor:
pSV2D (50 ng) ~Tint1m/BamHI fragment and 50 pmol oligonucleotide adaptor are ligated using 0.5 U T4 DNA ligase (New Fngl~n-l Biolabs~ in 50 mM Tris-HCI, pH 7.8, 10 mM
mi9gnesi~lm chloride, 10 mM DTT, and 0.8 mM ATP overnight at 16~C. One half of ligation lwe is used to transform E.coli XLl Blue (Stratagene) to obtain ~mp:~illin les;sl~
colonies. These are screened for the desired ligation product using a NaOH based plasmid "lllillipl~pll method (Maniatis et al., supra). The following plasmid is obtained: pSV2D-G4.

10.4 Ligation of pSV2D-G4 and CAT DNA fragment:
pSV2D-G4 (50 ng) di~sted with HindIII and Bam~ and 30 ng of the 1.6 kb ~intlm/Ba~
insert fragment from pSV2CAT carrying the chloramphenicol acetyl Ll~lsr~lase (CAT) gene and ~cljacçnt vector sequences are ligated, the ligation ll~xlurt; is Ll~u-srol..led into E.coli, and lig~tion products are screened as described in 10.3. The following plasmid is obtained:
pSV2CAT-G4.

10.5 Derivation of the pSV2NEO DNA fragment and purifi~ti~r:
pSV2NEO (1 mg) (Southern & Berg, J. Mol. Appl. Genet. 1: 327, 1982) is tiig~sted with T-Tin~lm and R~mT~T DNA fr~gm~nt~ are sep~ed on a 1.0 % (w/v) agarose gel (ultra pure agarose, BRL) and the expected 2.3 kb ~Tin~1TTT/BamHI insert fragment carrying the neo...y.,i.
phosphoribosyl ~ srt;l~se (NEO) gene and a(ljac~nt vector sequences is eluted.

10.6 Ligation of pSV2D-G4 and NEO DNA fragment:
Plasmid pSV2D-G4 (50 ng) digested with HindIII and BamHI and 30 ng of the 2.3 kbT~in~lTTT/BarnHI insert fragment carrying the neo.l.ycill phosphoribosyl transferase (NEO) gene and a~j~cent vector sequences are ligated, the ligation mixture is L.~1~roll..ed into E.coli, and ligation products are screened as described in 10.3. The following plasmid is obtained:
pSV2NEO-G4.

10.7 Derivation of the pC~110 b-g~l~ctQsidase DNA fragment and purifi~tio Plasmid pCHl 10 (1 mg) ~Pharmacia) is digested with HindIII and R~mT-TT DNA fr~gm~nts are separated on a 1.0 % (w/v) agarose gel (ultra pure agarose, BRL) and the expected 3.7 kb ~inrlm/BamHI insert fragment carrying the b-galactosidase gene and ~(ljac~nt vector sequences is eluted.

W O96/13599 PCTnEP95/04270 10.8. T.igpti(!n of pSV2D-G4 and b-g~l~ctos;~ E DNA fragment:
pSV2D-G4 (50 ng) (ligeste~l with Hin~lTTT and BamHI and 30 ng of the 3 .7 kb T-Tin(lmlBamHI
insert L~gnlell~ carrying the b-galactosidase gene and ~dj~cenf vector sequçnce~ are ligated, the ligation mixture is transforrned into E.coli, and ligation products are screened as described in 6.3. The following plasmid is obtained: pSV2bGal-G4.

10.9 TJi~tion of pSV2D fragment and b-g~lnctosi~ E DNA fragment:
pSV2D (50 ng) ~TintlTTT/BamHI fragment and 30 ng of the 3.7 kb T~inrlTTT/BamHI insert fragment c~lying the b-g~l~ctoQ;~e gene and ~ cent vector sequences are ligated, the ligation mixture is ~ sr(,ll~led into E.coli, and ligation products are screened as described in 10.3. The following plasmid is obtained: pSV2bGal.

10.10 Derivation of the pSVDSLUC luciferase DNA fragment and purification:
pSVDSLUC (1 mg) (Gouilleux et al., Nuc. Acid Res. 19: 1563, 1991) is r~ ested with HindIII and R~m~T DNA fr~gment~ are separated on a 1.0 % (w/v) agarose gel (ultra pure agarose, BRL) and the expected 2.7 kb T-TintlnTlBamHI insert fragment carrying the luciferase gene and ~ cçnt vector seqll~.nc.o~ is eluted.

10.11 T~ ti~ of pSV2D-G4 and luciferase DNA fragment:
pSV2D-G4 (50 ng) t~ cted with HindIII and BamHI and 30 ng of the 2.7 kb T-TintlTTT/Ban~II
insert fragment car ying the luciferase gene and ~ c~nt vector seq~l~nres are ligated, the ligation mixture is transformed into E. , and ligation products are screened as described in 10.3. The following plasmid is obtained: pSV2LUC-G4.

10.12 T ig~tion of pSV2D fr~grent and luciferase DNA fragment:
pSV2D (50 ng) ~Tin(lmlBamHI fragment and 30 ng of the 2.7 kb T-Tin~TTTlBamHI insert fragment ca..yi..g the luciferase gene and ~ CIont vector sequences are ligated, the ligation n i~lul~e is transformed into E.coli, and ligation products are screened as described in 6.3. The following plasmid is obtained: pSV2LUC.

Example 11 Determir~tion of DNA binding activity of scFv(FRP5)-DETA-DGAL4 protein The DNA binding activity and specifity of the scFv(FRP5)-ETA-DGAI,4 protein described in Fx~mple 9 is analyzed in gel retardation assays.

11.1 ~'-DNA labeling reaction:
5 pmol of G4 partially double stranded DNA oligom.cleotide descl;l,ed in Example 6.1 co..l~i";~lg 2 GAL4 binding motifs is inc~lb~ted for 45 min at 37~C with 50 mCi (g 32p) dATP
(10 mCi/ml) (Amersham) and 10 U T4 polynucleotide kinase (Boehringer l~nnh~im) in a buffer co~ g 50 mM Tris-HCl, pH 7.6, 10 mM m~ m chloride, 5 mM DTT, and 0.1 mM EDTA. 32P-labeled G4 oligonl-çleotide is purified by extraction with 1 volume of a 1: 1 mixture of Tris-HCl, pH 8.0 saturated phenol and chloiofo.m/isoamyl alcohol (24:1) followed by extraction of the aqueous phase with 1 volume of chlororolll~/isoamyl alcohol (24:1) and plecipil;1l;on of G4 oligonucleotide from the aqueous phase by the addition of 1 volume of 4 M ammonium acetate, 0.2 volumes of 1 M magnesium chloride and 2 volumes of ethanol at -20~C overnight. The oligonucleotide pellet is dried under vacuum and the dry pellet is dissolved in water to a final concentration of 100 nM (1124 cpm/fmol).

11.2 Gel retardation assay:
1 pmol scFv(FRP5)-DETA-DGAL4 protein and 50 fmol 32P-labeled G4 oligQmlcleotide are mixed in a 20 ml reaction in a buffer cont~inin.F~ 50 mM Hepes, pH 7.5, 50 mM potassium chloride, S mM m~gnesillm chloride, 10 mM zinc chloride, 6 % glycerol, 200 mg/ml bovine serum albumin and 50 mg/ml poly-(dI-dC) (Boehringer M~nnh~.im) and inc~1b~ted for 30 min at room temperature. The samples are separated on a non-denaturating poly-acrylamide gel as described by Carey et al. (J. Mol. Biol. 209: 423, 1989). A 18 x 20 cm 4.5 % acrylamide gel is prepared in a buffer at pH 8.4 co"~ g 45 mM Tris-base, 45 mM boric acid, 1 % glycerol.
Samples are separated by electrophoresis for 2 to 3 h at 200 V with a running buffer at pH 8.4 co..l~ E 45 mM Tris-base, 45 mM boric acid, 1 % glycerol: Bands are v~ ed by overnight exposure of the gel at -80~C with X-OMAT DS film (Kodak). The inLellsi~y of bands is quantified using a FUJIX BAS1000 phosphorimager (Fuji). As a result of the gel r~L~d~lion assay two bands with decreased mobility compared to the free probe are visible, the more intense higher molec~ r weight complex ~e~les~ g two scFv(FRP5)-DETA-DGAL4 dimers bound to the tandem GAL4 binding sites on the rat1io~ctive probe, the lower molecular weight complex reprçs~nting one scFv(FRP5)-DETA-DGAL4 dimer bound to one of the tandem GAL4 binding sites on the r~dio~ctive probe. The unbound free probe is visible - at the bottom of the gel.

~ 11.3 Co~petition assay: .
A gel retardation assay is performed exactly as described in Example 10.2 by inc~1b~tin~ 1 pmol scFv~FRP5)-DETA-DGAL4 protein and 50 fmol 32P-labeled G4 oligonudeotide in the presence of increasing amounts from 50 fmol to 12.8 pmol of non-radioactive G4 W O96/13599 PCT/~5/04270 oligonucleotide as a competitor resl.lting in G4/32P-G4 ratios of 1, 4, 16, 64, 256. The results of the competition assay show that the binding of scFv(FRP5)-DETA-DGAL4 to the 32p_ labeled G4 oligonucleotide is specific since increasing conc~ntrations of the non-radioactive competitor reduce the amount of complex co~ ting of scFv~FRP5)-DETA-DGAL4 and 32p_ labeled G4 oli~ n~lcleotide exponentially.

Esample 12 Determination of pl85 erbB-2 binding ~per;fir;ty of scFv(FRP5)-DETA-DGAL4 protein The pl85 erbB-2 binding activity and specifity of the scPv(FRP5)-DETA-DGAL4 protein described in Example 9. is analyzed in an enzyme-linked immllnosorbent assay (ELISA).

12.1 Preparation of ELISA plates:
SK-BR-3 human breast carcinoma cells (ATCC HTB30) are seeded in 96-well tissue culture plates at a density of 1 x 10~ cells per well and grown for 24 h at 37~C. The cells are washed twice with PBS, fixed with 3.7 % forrnaldehyde in PBS for 20 min at room temperature and blocked with a buffer co"~ g 10 mM Tris-HCl, pH 7.5, 150 mM sodium chloride (TBS) and 3 % bovine serum albumin.

12.2 Binding assay:
100 ml of scFv(FRP5)-DETA-DGAL4 protein in TBS cQIl~ g 3 % bovine serum ~lhllminat concentrations ranging from 60 pM to 1 mM are added to the cells in triplicates and incubated for 1 h at 37~C in a h~lmified atmosphere. The cells are washed twice with TBS and 100 ml of a 1:2000 dilution of a polyclonal rabbit antiserum raised against purified Pse~ldomon~s exotoxin A (Wels et al., Cancer Res. 52: 6310, 1992) in TBS co,.l~ 3 %
bovine serum ~lbllmin are added to each well for 30 min at 37~C in a hllmified atmosphere.
The cells are washed twice with TBS and 100 ml of a 1 :4000 dilution of alkaline phosph~t~ee-coupled goat anti-rabbit serum (Sigma) in TBS colll;~ g 3 % bovine serum ~Ibllmin are added to each well for 30 min at 37~C in a humified atmosphere. The cells are washed twice with TBS and the activity of bound alkaline phosph~t~se is cletected by inc~lb~tiQn of the cells with 100 mVwell of 1 mg/ml p-nitrophenyl-phosphate in 1 M Tris-HCl, pH 8Ø Alkaline phosphatase activity in each well is ql~ntit~ted by m~uring the specific absorption at 405 nm versus non-specifc absorption at 490 nm in a microplate reader (Oyll~Lech). scFv(FRP5)-DETA-DGAL4 is binding to SK-BR-3 cells with a half m~im~l saturation value of 2 x 108 M.

Example 13 DNA-transfer e~periments

13.1 C~I~ir m-phosphate transfection:
C~lr;~-m phosphate tr~n~fection.~ of COS-l and SK-BR-3 cells are carried out with the pSV2LUC-G4 reporter plasmid described in Example 10. To DNA solutions in water 2.5 M
c~lc;~m chloride is added to a final concentration of 166 mM c~lci~lm chloride. 1 volume of 2x HBS buffer, pH 7.12, co.~ 50 mM HEPES, 15 rnM Na2HPO4, and 280 mM sodium chloride, is added dropwise with constant flow of air bubbles through the mixture. The final DNA conce"ll~lion in the mixture is 10 nM in the experiment with COS-l cells and 1.9 nM in the ~,A~t;l;lllent with SK-BR-3 cells. Crystals are allowed to form in the solution for 30 min at room tel,lpel~L~Ire. 100 ml ofthe solution is added to one well oftissue culture cells in 12 well tissue culture plates as described in 13.2, cells are harvested and luciferase units are dt;le~ ed as described in 13.3.

13.2 Cell culture and DNA transfer:
SK-BR-3 human breast carcinoma cells (ATCC HTB30) and COS-l SV40 tran~r~Jlnled African Green monkey kidney cells (ATCC CRL1650) are seeded in 12 well tissue culture plates at a density of 3.6 x 104 cells/well and grown overnight at 37~C. The tissue cuture me~ lm is ex~h~n~ecl with 1 mVwell fresh l--e~ ... and the cells are grown for another 5 h.
100 ml of the respective sample Co~ in;l~g the DNA-~ rel mixture described in 13.4, 13.5, 13.6 or 13.7 is added to each well and the cells are incllbated- at.37~C overnight. The tissue culture medium is replaced with 2 mVwell of fresh me~ Im and the cells are inc~lh~ted for another 24 h before they are harvested for analysis as descnbed in 13.3.

13.3 Luciferase assay:
The me-lium is removed from the cells and cells are washed twice with PBS. 100 ml of lysis buffer, pH 7.8, CO..~ 25 mM Gly-Gly dipeptide (Sigma), 1 mM DTT, 15 % glycerol, 8 rnM magnesium s--Iph~t~, 1 mM EDTA, 1 % Triton X100, is added to each well and the cells are in~.ub~ted for 15 min at room temperature. The Iysate is collected and centrifi-~ed for S sec in an Eppendorf centrifuge to remove particulate matter. 50 rnl of the supelllaLallL is mixed w-ith 50 rnl of dilution buffer, pH 7.8, co"l~in;..~ 25 mM Gly-Gly dipeptide, 10 mM
m~neSillm sulphate, 5 rnM ATP. 300 ml of luciferin solution, pH 7.8, co.~ ;n~ 25 mM Gly-Gly dipeptide, 0.5 rnM coenzyme A (Boehringer M~nnh~im), 250 mM luciferin (Sigma), is added to the sample and luciferase activity is deterrnined with a luminometer.

13.4 scFv(FRP5)-DETA-DGAL~ ne~ te(l DNA transferin COS-l cells:
DNA of pSV2LUC-G4 reporter plasmid described in Example 10 is mixed with scFv(FRP5)-DETA-DGAL4 protein at a final collce"L,~lion of 10 nM (DNA) and 40 nM (protein) in a buffer CO~ g 50 mM HEPES, pH 7.5, 50 mM potassium chloride, 5 mM m~P.s;~lm chloride and 100 mM zinc chloride. The mixture is incub~ted for 10 min at room temperature to allow the formation of proteinlDNA co,.,~ es. Poly-L-lysine (Sigma) is added to the ~l~lure to final concentrations of 100 or 500 nM, respe~iLi~ely, and the r..i~lule is inr,ub~te l for further 30 min at room temperature. 100 ml of the solution is added to one well of COS-l cells in 12 well tissue culture plates as described in 13.2 cells are harvested and luciferase units are determined as described in 13.3. Expression of luciferase is detected in cells ll1n~r~cled with the calcium-phosphate transfection method described in 13.1 and cells treated with scFv(FRP5)-DETA-DGAL4/pSV2LUC-G4 complex con~ poly-L-lysine, but not in cells treated with pSV2LUC-G4 and poly-L-lysine alone.

13.5 scFv(FRP5)-DETA-DGAL~I lerli~t~ DNA transfer in SK-BR-3 cells:
A mixture cont~inin~ DNA of pSV2LUC-G4 reporter pls~mi~ and scFv(FRP5)-DETA-DGAL4 protein is prepared as described in 13.4. The mixture is inrllb~ted for 10 min at room telllpe~ re to allow the formation of protein/DNA compl~Yes Poly-L-lysine (Sigma) is added to the mixture to a final concentration of 100 nM and the mixture is inc~-b~t~d for further 30 min at room temperature. 100 ml of the sollltion is added to one well of SK-BR-3 cells in 12 well tissue culture plates as described in 13.2, cells are harvested and lucffirase units are determined as described in 13.3. Expression of luciferase is detected in cells ll~lsrecled with the c~lr.illm-phosphate transfection method described in 13.1 and cells treated with scFv(FRP5)-DETA-DGAL4/pSV2LUC-G4 complex co"l~ g poly-L-lysine, but not in cells treated with pSV2LUC-G4 alone or scFv(FRP5)-DETA-DGAL4/pSV2LU~G4 complex without the addition of poly-L-lysine.

13.6 Competition assay:
A mixture co,.l~ g DNA of pSV2LUC-G4 reporter plasmid and scFv(FRP5)-DETA-DGAL4 protein is prepared as described in 13.4. The m-ixture is inc~lb~ted for 10 min at room tenll)el~ re to allow the formation of protein/DNA complexes. Poly-L-lysine (Sigma) is added to the mixture to a final concentration of 500 nM and the ll~ure is inr.~lb~te~l for further 30 min at room temperature. One sample is prepared co..~ in addition to pSV2LUC-G4 lepol~er pl~smi~l, scFv(FRP5)-DETA-DGAL4 and poly-L-lysine the monoclonal antibody FRP5 which has the same binding specificity as scFv(FRP5)-DETA-DGAL4 as a competitor for binding to pl85'rb~2 at a final concentration of 1.2 rnM. 100 ml of the solution is added to one well of COS-1 cells in 12 well tissue culture plates as described in 13.2, cells are harvested and luciferase units are determined as described in 13.3. Expression of luciferase is detected in cells treated with scFv(FRP5)-DETA-DGAL4/pSV2LUC-G4complex co~ poly-L-lysine, but not in cells treated only with pSV2LUC-G4 and poly-L-lysine or scFv(FRP5)-DETA-DGAL4/pSV2LUC-G4 complex co.~ g poly-L-lysine in the presence of an excess of monoclonal antibody FRP5 as colllpc;lilol .

Example 14 Isolation of RNA from the breast carcinoma cell line MDA-MB-468

14.1 Growth of MDA-MB-468 cells:
MDA-MB-468 breast carcinoma cells (ATCC HTB132) are grown as monolayers on tissue culture plates at 37~C in DMEM (Seromed) further cO..~ g 8 % FCS (Amined) and 100 mg/ml of gel,lalllycill (Seromed) in a hllmi~ified atmosphere of air and 7.5 % CO2. The cells are washed twice with PBS on ice, PBS is removed and the plates are kept on ice.
14.2 Extraction of total cellular RNA from MDA-MB-468 cells:
Total RNA is extracted using the acid ~l~ni~lini~lm thiocyanate-phenol-chlo~o~llll method described by Choczynski & Dacchi (Anal. Biochem. 162: 1~6, 1987). The cells from 2 semi-confiuent tissue culture plates are lysed on ice in the presence of 2 ml ~len~t lring soIution (see Example 3.2). The lysate is homog~ni7e~ at room temperature. Sequentially, 0.2 ml of 2 M
sodium acet~te, pH 4, 2 ml of phenol (water saturated) and 0.4 ml of chloro~ollll-isoamyl alcohol Il~ixlule (49:1) are added to the Iysate. The final suspension is shaken vigorously for 10 sec and cooled on ice for 15 min. The samples are centrifuged at 10,000 x g for 20 min at 4~C. After centrifugation, RNA which is present in the aqueous phase is mixed with 2 ml of isoplo~allol and placed at -20~C for 1 h. The RNA precipitate is collected by centrifi1g~tion the pellet dissolved in 0.5 ml water and the RNA preçipit~ted by addition of 1 volume of isoplop~lol at -20~C. After centrifugation and washing the pellet in eth~nol, the final pellet of RNA is dissolved in water. The method yields ap~rox;...~teIy 100 mg of total cellular RNA.
The final purified material is stored frozen at -20~C.

Example 15 ~ ~--Cloning of a human transforming growth factor-a cDNA fragment Total cellular RNA isolated from MDA-M-468 cells as described in Example 14 provides the source for cDNA synthesis an~subsequent ~mplific~tion of a human ~ lsrulmil-g growth CA 02204020 l997-04-29 W O96/13599 PCT~EPg5/04270 factor (TGF)-a encoding cDNA fr~gm~nt Amplification products of the expected size are purified from agarose gels and cloned into applopliate vectors. Intact cDNA clones are .ntified by seqllen~in~

15.1 cDNA synthesis:
5 mg of total RNA isolated from MDA-MB-468 cells is used in a 33 ml first strand cDNA
synthesis reaction with 11 ml Bulk First-Strand Reaction Mix (Pharmacia), 200 ng NotI-d(T)l8 primer (Pharmacia), and 1 ml 200 mM DTT solution accolding to procedures provided by the m~mlf~ctllrer.

15.2 Polymerase chain reaction:
2 ml of the cDNA reaction is used for l~NA amplification in a 50 ml reaction con~ 25 pmol each of the two oligonucleotides complem~.nt~ty to regions in the human TGF-a gene 5'-GACCCGAAGCTTGGTACCGGTGTGGTGTCCCATTTTAATG-3' (SEQ ID NO. 29) and 5'- TTCTGGGAGCTCTCTAGAGAGGCCAGGAGGTCCGC -3' (SEQ ID NO. 30), 4 ml 2.5 mM dNTP (N= G, A, T, C) mixture, and 5 ml lOx Vent DNA polymerase buffer (New F.ngl~ntl Biolabs) and 2.5 U of Vent DNA polymerase (New Fng]~n(l Biolabs). Vent DNA
polymerase is added a~er initial denaturation at 94~C for 4 min. For 30 cycles ~nnP~ling is performed for 1 min at 52~C, primer ~.~ten~ n for 45 sec at 72~C, denaturation for 1 min at 94~C. Finally, amplification is completed by a 2 min primer eYt~n~ion step at 72~C.

.
15.3 Modification and purifi~tior:
~mrlific~tion products are separated on a 1.5 % (w/v) agarose gel (ultra pure agarose, BRL), DNA of the expected size is eluted,= and subsequently cli~ested with HindIII and XbaI. The expected 171 bp DNA fragment encoding amino acids 1 to 50 of human TGF-a is separated on a 1.5 % agarose gel and purified by elution from the gel as described above.

15.4 T ig~tion:
Plasmid pFLAG-l is ~iigeste~ with SalI, and treated with the Klenow enzyme to create blunt ends; the linearized fragment is digested with XbaI. A tnln~ted Pseudomonas ETA gene lacking the cell-binding domain Ia is isolated ~om pWW20 (see Example 1.1) by EcoRI
cleavage, Klenow fill-in and Subsequent XbaI digestion. This blunt-ended XbaI fragment is inserted into the blunt-ended XbaI pFLAG-l vector. The resllting plasmid, pSG100, is digested with HindIII and XbaI and a double stranded DNA linker encoding 6 hi~tiriine residues is inserted in ~ame 5' of the ETA sequences yielding pSW200.~A DNA ~gmenl co,-'~;";i~g the ompA signal pept~e, the FLAG epitope and the N-terminal hi~tirline-encoding CA 02204020 l997-04-29 sequences is i.~ol~ted by NdeI and XbaI digestion of pSW50 (see Fx,Ample 8.2) and inserted into NdeI/XbaI digested pSW200. The res~lltinp~ plasmid is design~ted pSW202. pSW202 (50 ng) digested with HindIII and XbaI, and 30 ng of purified amplification product are ligated using 0.5 U T4 DNA ligase (New F.ng]. ntl Biolabs) in 50 mM Tris-HCl, pH 7.8, 10 mM
m, gne~ chloride, 10 mM DTT, and 0.8 rnM ATP overnight at 16~C. One half of ligation ~Lul'e is used to ~ srullll E.coli XL1 Blue (Stratagene) to obtain ampicillin res;sku.l colonies. These are screened for the desired ligation product using a NaOH based plasmid ep~t method (Maniatis et al., supra). The following pl~cmitl is obtained: pSW202-TGF.
The partial DNA sequence of pSW202-TGF is shown in SEQ ID NO. 31. Said sequence has the following features:

from 1 to 15 bp synthetic spacer from 16 to 165 bp encoding amino acids 1 to 50 of human TGF-a from 166 to 173 bp synthetic spacer ~p!A 16 Construction of the TGF-a-DETA-DGAL4 fusion gene

16.1 Derivation of DNA fragments and purifir~tic~:
pSW202-TGF (1 mg) is digested with HindIII and SalI. DNA fragments are se~ ed on a 1.0% (w/v) agarose gel (ultra pure agarose, BRL) and the expected bp Hin~lTTT/SalI DNA
~agment carrying the TGF-a-DETA252 30g fusion gene is eluted. Plasmid pWF45-5 (1 mg) is (ligested with SalI and XbaI. DNA fr~gm~nt~ are separated and the expected 655bp SalI/XbaI
DNA fragment encoding DETA309.366-DGAL4 is eluted as described above. pWF45-5 (1 mg) is tli~ested with HindIII and XbaI. DNA fragment~ are separated and the expected~TinrlTTT/XbaI vector fragment is eluted as described above.

16.2 Ligation:
50 ng of purified ~TintlTTT/XbaI pWF45-5 vector fr~mP.nt, and 30 ng of purified T-TinflTTT/SalI
TGF-a-DETA fragment, and 30 ng of purified SaVXbaI DETA-DGAL4 fragment are ligated using 0.5 U T4 DNA ligase (New F.ngl~nll Biolabs) in 50 mM Tris-HCI, pH 7.8, 10 mM
magnesium chloride, 10 mM DTT, and 0.8 rnM ATP overnight at 16~C. One half of ligation Lule iS used to transform E.coli XL1 Blue (str~t~gene) to obtain arnpicillin les;sl~ll colonies. These are screened for the desired ligation product using a NaOH based plasrnid "m.lliplep" method. The following plasrnid is obtained: pWF47-TGF. The partial DNA

CA 02204020 l997-04-29 wo 96/13599 PCTIEP95/04270 seq~l~nce of pWF47-TGF encodes TGF-a-DETA-DGAL4 fusion protein is shown in SEQ ID
NO. 3. Said sequence has the following features:

1 to 63 bp encoding the E.coli ompA signal peptide 64 to 87 bp encoding the synthetic FLAG epitope 88 to 99 bp spacer sequence 100 to 249 bp encoding amino acids l to 50 of human TGF-a 259 to 276 bp encoding 6 His residues 277 to 279 bp synthetic spacer sequence 280 to 624 bp encoding amino acid 252 to 366 of ETA
625 to 627 bp spacer 628 to 1065 bp encoding aa 2 to 147 of yeast GAL4 1066 to 1089 bp spacer including sequence coding for KDEL retention signal.

The partial cledllced amino acid sequence of the pWF47-TGF encoded TGF-a-DETA-D
GAL4 protein inr.lllrli~ a peptide spacer at the N-terminus (aa 1 to 12) is shown in SEQ lD
NO.4.

Example 17 Bacterial expression and purification of TGF-a-DETA-D GAL4 A translocation domain derivable from P. aeruginosa c,~O~O~ A (ETA), particularly a domain con~i~tin~ e~nti~11y of domain II of ETA (amino acids 253 to 364 of ETA as set forth in Gray et al., Proc. Natl. Acad. Sci. USA 81: 2645, 1984), e.g. a translocation domain col1~;sLillg of amino acids 252 to 366 of ETA is described in Ex~l-ples 17 and 18 in conjunction with SEQ ID NOs. 1, 3 and 5.

Plasmid pWF47-TGF is l-~-sro---,ed into E.coli K12 (Manoil & Beckwith, Proc. Natl. Acad.
Sci. USA 82: 8129, 1985). Expression and purification of TGF-a-DETA-D GAL4 is carried out as described in Example 9. for the ~x~--es~ion and purification of scFv(~RP5)-DETA-D
GAI,4.

W O96/13599 PCT~EP95/04270 Example 18 Construction of an interleukin-2-DETA-DGAL4 fusion gene 18.1 Polymerase chain reaction:
20 ng of a pBR322 derivative car~ying a human interleukin (IL)-2 cDNA insert (T~ni~-chi et al., Nature 302: 305, 1983) is used for DNA amplification in a 50 ml reaction co~ ini~g 25 pmol each of the two oligomlcleotides complen-~nt~ry to regions in the human IL-2 gene 5'-TATAATAAGCTTGCACCTACTTCAAG -3' (SEQ ID NO. 32) and 5'-TTGAATGCTAGCGTTAGTGTTGAGATG -3' (SEQ ID NO. 33), 4 ml 2.5 mM dNTP
(N= G, A, T, C) mixture, and 5 ml 10x Vent DNA polymerase buffer (New Fngl~n-l Biolabs) and 2.5 U of Vent DNA polymerase (New F.ng]~ntl Biolabs). Vent DNA polymerase is added after initial denaturation at 94~C for 4 min. For 30 cycles ~nne~ling is performed for 1 min at 50~C, primer extension for 45 sec at 72~C, denaturation for 1 min at 94~C. Finally, ~mplific~tion is completec~ by a 2 min primer eYt~n~ion step at 72~C.

18.2 Mo~lifi~ ion and purifi<~Q ~:
~mrlifif~tion products are sep~led on a 1.5 % (w/v) agarose gel (ultra pure agarose, BRL), DNA of the expected size is eluted, and subsequently digested with HindIII and NheI. The expected 408 bp DNA fragment encoding amino acids 1 to 113 of human IL-2 is separated on a 1.5 % agarose gel and purified by elution from the gel as described above.

18.3 Derivation of DNA fragments and purification:
pWF46-5 (1 mg) (see Example 8.) is tligested with XbaI and EcoRI. DNA fr~gm~nte are separated on a 1.0 % (w/v) agarose gel (ultra pure agarose, BRL) and the expected 821 bp XbaVEcoRI DNA fragment carlying the DETA-DGAL4 coding region is eluted. In a separate ~i~estion pWF46-5 (1 mg) is ~ligeste(l with HindIII and EcoRI. DNA fr~grnPnt~ are separated and the expected 5.4 kb T-TindTTT/EcoRI vector fragment is eluted as described above.
.
18.4 Ligation:
pWF46-5 T-Tinrlm/EcoRI vector fragment (50 ng), 30 ng of purified T-Tintlm/NheI IL-2 cDNA
fMgm~tlt, and 30 ng of purified XbaVEcoRI DETA-DGAL4 fragment are ligated using 0.5 U
T4 DNA ligase (New Fng]~n(1 Biolabs) in 50 mM Tris-HCI, pH 7.8, 10 mM magnesium r.111Oride 10 mM DTT, and 0.8 mM ATP overnight at 16~C. One half of ligation mixture is used to L~ sro.ll- E.coli XL1 Blue (Strat~gene) to obtain ampicillin resistant colonies. These are screened for the desired ligation product using a NaOH based pl~mid "~ rep" method - CA 02204020 l997-04-29 W O96/13599 PCT~EPg5/04270 The following pl~mi~l is obtained: pWF46-IL-2. The partial DNA seq~lPnce of pWF46-IL-2 is shown in SEQ ID NO. 5.

Said sequence has the following features:

1 to 63 bp encoding the E.coli ompA signal peptide 64 to 87 bp encoding the FLAG epitope 88 to 114 bp spacer sequence 109 to 114 bp spacer sequence 115 to 513 bp encoding human IL-2 amino acids 1 to 113 514 to 516 bp spacer sequence 517 to 861 bp encoding amino acid 252 to 366 of ETA
862 to 865 bp spacer 866 to 1302 bp encoding aa 2 to 147 of yeast GAl4 1303 to 1326 bp spacer including sequence coding for KDEL retention signal 1327 to 1329 bp ochre stop codon The partial ~leduced amino acid sequence of the pWF46-IL-2 encoded IL-2-DETA-D GAL4 protein in~ lrling an N-terminal peptide spacer (aa is shown in SEQ ID NO. 6.

18.5 Bacterial e~pression and purification of IIr2-DETA-D GAL4:
Plasmid pWF46-IL-2 is ~ s~~ ed into E.coli CC118 (Manoil & BecLwi~l~, Proc. Natl.
Acad. Sci. USA 82: 8129, 1985). Expression and purification of IL-2-DETA-D GAL4 is carried out as described in Example 8. for the ~r~;s~ion and purification of scFv(FRP5)-DETA-D GAL4.

Dc~,os;lion Data:
E. coli ~ 1 Blue/pWF47-TGF was deposited with the Deutsche S~mmllmg von MiLroorg~ni~men und 7e11kll1t-lren GmbH (DSM), Mascheroder Weg lb, D-38124 Braunschweig on October 24, 1994 under the ~cces~ion number DSM 9513.
.

W O96/13599 PCT~EP95104270 F.Y~ 19 Construction of r!~mi~ pSW50-GD5 A plasmid for the b~cteri~l eA~)les~ion of a fusion protein cQncicting of the ompA signal peptide, ~GAL4, a fragment sp~nnin~ amino acids Vall96 to Gly384 of the rliphth~ria toxin (DT) B fragment (translocation domain), the scFv(FRP5) single chain antibody domain and ~djac~nt linker sequences is constructed.

19.1 Deletion of scFv(FRP5) and ~ETA domains from ~ mid pWF46-5:
pWF46-5 (1 ~g) is digested with T-TintlTTT DNA fr~gment~ are sep~Led on a 1.0 % (w/v) agarose gel (ultra pure agarose, BRL) and the DNA fragment concieting of the pSW50 vector and the ~GAL4 fragment is eluted as described above. The eluted fragment is subsequently ligated using 0.5 U T4 DNA ligase (New Fngl~n~ Biolabs) in 50 mM Tris-HCI, pH 7.8, 10 mM m~n~cillm chloride, 10 mM DTT, and 0.8 mM ATP overnight at 16~C. One half of ligation mixture is used to transform E.coli XLl Blue (Stratagene) to obtain ~mpiçillin resistant colonies. These are screened for the desired ligation product using a NaOH based plasmid "llfilfiplep" method (M~ni~tic et al., Molecular Cloning: A Laboratory Manual /
Second Edition, Cold Spring Harbor Laboratory, 1989). The following plasmid is obtained:
pSW50-G.

19.2 Insertion of a linker sequence:
A double stranded DNA adaptor with SacI and SalI co,..p~l;hle ends and col~ g aninternal NheI restriction site is constructed by anne~lin~ 0.5 nniol of the oligonucleotide 5'-CGCTAGCTGGTGGTG -3' (SEQ ID NO:50) with 0.5 nmol of the oligonucleotide 5'-TCGACACCACCAGCTAGCGAGCT -3' (SEQ ID NO:51) by incubation at 65~C for 3 min and cooling to room temperature. pSW50-G (1 ~lg) is digested with SacI and SalI. DNA
fragm~nts are separated on a 1.0 % (w/v) agarose gel (ultra pure agarose, BRL) and the DNA
fragment cnn~icting of the pSW50 vector and the ~GAL4 fragment is eluted as described above. The eluted fragment (50 ng) and 20 pmol SacI/SalI oligonucleotide adaptor are subsequently ligated using 0.5 U T4 DNA ligase (New F.n~l~nd Biolabs) in 50 mM Tris-HCI, pH 7.8, 10 mM m~n~ci~lm chloride, 10 mM DTT, and 0.8 mM ATP overnight at 16~C. One half of ligation mixture is used to transform E.coli XLl Blue (strs~t~g~në) to obtain ~mp cillin resistant colonies. These are screened for the desired ligation product using a NaOH based plasmid "llfilJ,plep" method (Maniatis et al., Molecular Cloning: A Laboratoly Manual /
Second F.~lition~ Cold Spring Harbor Laboratoly, 1989). The following plasmid is ob~a;ned:
pSW50-G/NheI.

wo 96/13599 PCT/~ 3;~ ~270 19.3 Isolation of the Diphtheria toxin gene fragment encoding the tr~r~lo~ticn domain (~DT):
A pl~mit~ (pJV127) which cont~in~ the diphtheria toxin - interleukin-2 fusion gene fragment encoding DAB389-IL-2 (Williams et al., J. Biol. Chem. 265: 1 i885-11889, 1990) is used as a template in a polymerase chain reaction to amplify a DNA fragment comprising amino acids Vall96 to Gly384 of the diphtheria toxin (DT) B fragment (translocation domain), de~ ted ~DT.

50 ng of pJV127 is used for DNA amplification in a 50 ~11 reaction cc,..l;.;..;l-~ 50 pmol each of the two oli~omlcleQtides compl~m~nt~y to regions in the dirhthPri~
toxin gene 5'-CGTGTCAGGCTAGCAGTAGGTAGC -3' (SEQ ID NO:52) and 5'-CATGCGTGTCGACACCCGGAGAGTAAGC -3' (SEQ ID NO:53), 4 ~l 2.5 mM dNTP
(N= G, A, T, C) mixture, 5 ~ll 10x Taq DNA polymerase buffer (Boehringer ~nnheim) and 2.5 U of Taq DNA polymerase (Boehringer M~nnheim). Taq DNA polymerase is added a~er initial denaturation at 94~C for 2 min. For 30 cycles ~nne~ling is pelro,l.led for 1 mjn at 55~C, primer ~ n~ion for 1 min at 72~C, denalul~Lion for 1 min at 94~C. Finally, amplification is completed by a 3 min primer extension step at 72~C.

Amplification products are separated on a 1.2 % (w/v) agarose gel (ultra pure agarose, BRL), DNA of the expected size is eluted as described above, and subsequ~ntly ~ este~l with NheI
and SalI. The expected 575 bp diphtheria toxin DNA fragment encoding the translocation domain and ~djacçnt synthetic linker sequences is separated on a 1.2 % agarose gel and purified by elution from the gel as described above.

19.4 T.igs~tiQn pSW50-G/NheI (50 ng) digested with NheI and SalI, and 30 ng of purified amplification product are ligated using 0.5 U T4 DNA ligase (New Fngl~ntl Biolabs) in 50 mM Tris-HCl, pH 7.8, 10 mM m~gnecil~m chloride, 10 rnM DTT, and 0.8 mM ATP overnight at 16~C. One half of ligation ~ ule is used to ~ ls~llll E.coli XLl Blue (Stratagene) to obtain ampicillin resisL~l colonies. These are screened for the desired ligation product using a NaOH based plasmid "n~l~rep" method (Maniatis et al., Molecular Cloning: A Laboratory Manual /
Second Edition, Cold Spring Harbor Laboratory, 1989). The following plasmid is obtained:
pSW50-GD.

W O96/13599 PCT~EP95/04270 19.5 Derivation of scFv(FRP5) DNA fragment and ligation of pSW50-GD5:
pWW152-5 (1 ,ug) car~ging the gene encoding the ErbB-2 specific single chain Fv (scFv) molecule scFv(FRP5) described by Wels et al., Int. J. Cancer 60: 137-144, 1995, is ~ ested with SalI and BamHI. DNA fr~gm.o.nt~ are separated on a 1.0 % (w/v) agarose gel (ultra pure agarose, BRL) and the expected 756 bp SalI/Bam~ DNA fragment c~lyin~ the scFv(FRP5) domain and ~dj~cent synthetic sequences is eluted as described above. pSW50-GD (50 ng) rligested with SalI and BglII and scFv(FE~P5) SalI/BamHI (50 ng) DNA fra m~nte are ligated using 0.5 U T4 DNA ligase (New F.ngl~n~l Biolabs) in 50 mM Tris-HCI, pH 7.8, 10 mM
m~gn~ m chloride, 10 mM DTT, and 0.8 mM ATP overnight at 16~C. One half of ligation mixture is used to transform E coli ~1 Blue (Stratagene) to obtain ampicillin lt;si~
colonies. These are screened for the desired ligation product using a NaOH based plasmid "l.ln~iplel)" method (Maniatis et al., Molecular Cloning: A Laboratory Manual / Second Edition, Cold Spring Harbor Laboratory, 1989). The following plasmid is obtained: pSW50-GD5. The partial DNA sequence of pSW50-GD5 is shown in SEQ ID NO. 34. Said sequence has the following re~lures:
from 1 to 63 bp encoding the E.coli ompA signal peptide from 64 to 87 bp encoding the synthetic FLAG epitope from 88 to 108 bp synthetic spacer sequence from 109 to 546 bp encoding amino acids 2 to 147 of yeast GAL4 from 547 to 558 bp synthetic spacer sequence from 559 to 1125 bp encoding amino acids Vall96 to Gly384 of tliphth~ria toxin from 1126 to 1146bp synthetic spacer sequence from 1147 to 1866 bp encoding scFv(FRP5) from 1867 to 1908 bp synthetic spacer sequence from 1909 to 1911 bp stop codon from 1912 to 1919 bp non-coding synthetic spacer Th~e ded~.ced amino acid sequence of the pSW50-GD5 encoded ~GAL4-~DT-scFv(FRP5) (=GD5) protein inclll-lin~ a peptide spacer at the N-terminus (aa 1 to 15) is shown in SEQ ID
NO. ~5.

W O96/13599 PCTnEP95/04270 E~ample 20 Construction of p~ pSW55-GD5 A plasmid for the bacterial ~ ,ression of a fusion protein con~ictin~ of ~GAL4, a fragment spA~ -g amino acids Vall96 to Gly384 of the rliphth~ria toxin (DT) B fragment (translocation domain), the scFv(FRP5) single chain antibody domain and ~SIdjSlcçnt linker seq~lçnce~ is constructed.

20.1 Insertion of a linker sequence:
A double stranded DNA adaptor with NdeI and HindIII con-palible ends is constructed by ~nn~s~ling 0.5 nmol ofthe oligonllcleotide 5'-TATGGACTACAAGGACGACGATGACAAGAAGCTGCACCATCATCACCATCACA
-3' (SEQ ID NO 54) with 0.5 nmol of the oligonucleotide 5'-AGCTTGTGATGGTGATGATGGTGCAGCTTCTTGTCATCGTCGTCCTTGTAGTCCA
-3' (SEQ ID NO:55) by in~ubation at 65~C for 3 min and cooling to room temperature.

pSW50 (1 llg) is digested with NdeI and T~in~lTTT DNA frStgmf~nt~ are se~ted on a 1.0 %
(w/v) agarose gel (ultra pure agarose, BRL) and the pSW50 vector DNA fragment is eluted as described above. The eluted fragment (50 ng) and 20 pmol NdeItHindIII oligonucleotide adaptor are subsequently ligated using 0.5 U T4 DNA ligase (New Fn~lan~ Biolabs) in 50 mM Tris-HCI, pH 7.8, 10 mM mSIgnPcillm chloride, 10 m~I DTT, and 0.8 mM ATP
overnight at 16~C. One half of ligation rnixture is used to transform E.coli XLl Blue (StrSIta~ne) to obtain sltnpicillin re~;s~ colonies. These are screened for the desired ligation product using a NaQH based plasmid "n~ ep" method (Maniatis et al., Molecular Cloning:
A Laboratory Manual / Second Edition, Cold Spring Harbor Laboratory, 1989). The following plasmid is obtained: pSW55.

20.2 Derivation of DNA fragments and ligation:
pSW50-GD5 (1 llg) is digested with HindIII and KpnI and in a separate reaction with KpnI
and XhoI. DNA fr~gmenti are separated on a 1.0 % (w/v) agarose gel (ultra pure agarose, BRI,) and the expected 673 bp ~in~lmlKpnI DNA fragment carrying the ~GAIA dQmS~in, the 5' part of the ~DT domain and adjacçnt synthetic sequences, and the 1106 bp KpnI/XhoI
f=ragment carrying the 3' part of the ~DT domain, the scFv(FRP5) domain and ~dj~çPnt syl.~L~Lic sequences are eluted as described above. pSW55 (50 ng) ~iigested with Hindm and XhoI, and the Hin~m/KpnI and KpnI/XhoI (50 ng each) DNA fr~ mçnt~ are ligated using 0.5 . .

W O96tl3599 PCT~EY9S/04270 U T4 DNA ligase (New Fn~l~nd Biolabs) in 50 mM Tris-HCl, pH 7.8, 10 mM ma~.e.~;"...
chloride, 10 mM DTT, and 0.8 mM ATP overnight at 16~C. One half of ligation n~ ule is used to transform E.coli XLl Blue (Str~t~ne) to obtain ampicillin lt;sis~ colonies. These are screened for the desired ligation product using a NaOH based plasmid "mil~plep" method (M~ni~ti~ et al., Molecular Cloning: A Laboratory Manual / Second Edition, Cold Spring Harbor Laborato~, 1989). The following plasmid is obtained: pSW55-GD5. The partial DNA
sequence of pSW55-GD5 is shown in SEQ ID NO. 36. Said sequence has the followingreaLules:

from 1 to 3 bp synthetic spacer sequence from 4 to 27 bp encoding the ~yllLhelic FLAG epitope from 28 to 51 bp synthetic spacer sequence from 52 to 489 bp encoding amino acids 2 to 147 of yeast GAL4 from 490 to 501 bp synthetic spacer sequence from 502 to 1068 bp encoding amino acids Vall96 to Gly384 of r1iphth~.ria toxin from 1069 to 1089 bp synthetic spacer sequenr,e from 1090 to 1809 bp encoding scFv(FRP5) from 1810 to 1851 bp synthetic spacer sequence from 1852 to 1854 bp stop codon from 1855 to 1862 bp non-coding synthetic spacer The ded~lced amino acid sequence of the pSW55-GD5 encoded ~GAL4-~DT-scFv(F~P5) (=GD5) protein inr.lllrling a peptide spacer at the N-terminus (aa 1 to 17) is shown in SEQ ID
NO. 37.

Example 21 Construction of plasmid pSW50-GDI
.
A plasmid for the bacterial expression of a fusion protein con~icting of the ompA signal peptide, ~GAL4, a fragment spanning amino acids Vall96 to Gly384 of the diphtheria toxin (DT) B fragment (translocation domain), the human interleukin-2 (IL-2) domain and ~dj~cent linker sequences is constructed.

21.1 Construction of r~ l pWW152-IL 2:
Plasmid pSW50-IL-2 (1 ~lg) is rligçsted with EcoRI. The linearized DNA is treated with DNA
polymerase I ~Klenow fragment) (Boehringer M~nnheim) to create blunt ends (Maniatis et al., Molecular ~loning A Laboratory Manual / Second F.dition Cold Spring Harbor Laboratory, 1989) and subseqll~ntly tli~este~l with Hin~lTTT DNA fr~gm~.nts are separated on a l.0 % (w/v) agarose gel (ultra pure agarose, BRL) and the expected 418 bp ~in~lm/blunt ended DNA
fragment carrying the IL-2 domain and ~ cçnt synthetic sequences is eluted as described above. Plasmid pWWl52 di~ested with Hindm and PvuII (50 ng) and the HindIII/blunt ended IL-2 DNA fragment are ligated using 0.5 U T4 DNA ligase (New F.np;l~n~l Biolabs) in 50 mM
Tris-HCl, pH 7.8, 10 mM m~gnç~ m chloride, 10 mM DTT, and 0.8 mM ATP overnight at 16~C. One half of ligation mixture is used to ~ sr~r"l E.coli ~Ll Blue (Stratagene) to obtain ampicillin resistant colonies. These are screened for the desired ligation product using a NaOH
based plasmid "nlll)iplep'l method (M~ni~ti~ et al., Molecul~r Cloning: A Laboratory Manual /
Second F.tlitiQn, Cold Spring Harbor Laboratory, 1989). The following plasmid is obtained:
pWWl 52-IL-2.

21.2 Derivation of DNA fragments and ligation:
pWW152-IL-2 (1 ,ug) is ~ligested with SalI and BglII. DNA fr~gm~nt~ are se~ ed on a 1.0 % (w/v) agarose gel (ultra pure agarose, BRL) and the SalI/BglII DNA fragment c~lying the IL-2 domain and adjac~.nt synthetic sequences is eluted as described above. pSW50-GD
(50 ng) ~igested with SalI and BglII and IL-2 SalI/BglII (50 ng) DNA fragment~ are ligated using 0.5 U T4 DNA ligase (New F.n?~l~n~l BioIabs) in 50 mM Tris-HCl, pH 7.8, 10 mM
m~gnç~illm chloride, 10 mM DTT, and 0.8 mM ATP overnight at i6~C. One half of ligation mixture is used to transform E.coli XLl Blue (Stratagene) to obtain ampicillin resistant colonies. These are screened for the desired ligation produc~ using a NaOH based plasmid ~ inil,le~l' method (l~ni~ti~ et al., Molecular Cloning: A Laboratory Manual / Second F.~lition, Cold Spring Harbor Laboratory, 1989). The following plasmid is obtained: pSW50-GDI. The partial DNA seq~nce of pSW50-GDI is shown in SEQ ID NO. 38. Said sequence has the following features:
from 1 to 63 bp encoding the E.coli ompA signal peptide from 64 to 87 bp encoding the synthetic FLAG epitope from 88 to 108 bp synthetic spacer sequence from l09 to 546 bp encoding amino acids 2 to 147 of yeast GAL4 from 547 to 558 bp synthetic spacer sequence _ 55 _ from 559 to 1125 bp encoding amino acids Vall96 to Gly384 of diphtheria toxin from 1126 to 1152 bp synthetic spacer sequence from 1153 to 1551 bp encoding human IL-2 amino acids 1 to 113 from 1552 to 1554 bp stop codon from 1555 to 1605 bp non-coding synthetic spacer The dedl1ced amino acid sequence of the pSW50-GDI encoded ~GAL4-~DT-IL-2 (=GDI) protein in~ a peptide spacer at the N-terminus (aa 1 to 15) is shown in SEQ ID NO. 39.

F.~ le 22 Bacterial expression and purification of GD5 Plasmids pSW50-GD5 or pSW55-GD5 are ~ srolllled into E coli K12. Expression and purification of ~GAL4-aDT-scFv(FRP5) protein GD5 is carried out as described in Fx~mple 9. for the expression and purification of scFv(FRP5)-~ETA-~ GAL4.

Example 23 GD~me~ t~ DNA transfer in COS-l cells COS-l cells are seeded inl2 well tissue culture plates as described in FY;..~1,lC 13.2. DNA of pSV2LUC-G4 reporter plasmid described in Fx~mple 10 is mixed with the GD5 protein at a final concentration of 10 nM (DNA) and 40 nM (protein) using the buffer and inc~b~tiQn conditions described in 13.4. Poly-L-lysine (Sigma) is added to the mixture as described in 13.4 and the complex is added to COS-l cells as described in 13.2. The cells are harvested and luciferase units are determined as described in 13.3. Expression of luciferase is detected in cells treated with GD5/pSV2LUC-G4 complex co~ g poly-L-lysine, but not in cells treated with pSV2LUC-G4 and poly-L-lysine alone.

WO96/13599 PCT~P95/04270 SEQUENCE LISTING

tl) GENERAL INFORMATION.
(i) APPLICANT:
(A) NAME: WELS, Winfried, Dr. -(B) STREET: Glimpenheimer Str. 55 (C) CITY: Emmendingen (E) COUNTRY: Germany (F) POSTAL CODE (ZIP): D-79312 (G) TELEPHONE: 0761-206-1630 (H) TELEFAX: 0761-206-1599 (ii) TITLE OF INVENTION: Nucleic Acid Transfer System (iii) NUMBER OF SEQUENCES: 55 (iv) COMPUTER READABLE FORM:
(A) MEDIUM TYPE: Floppy disk (B) COMPUTER: IBM PC compatible (C) OPERATING SYSTEM: PC-DOS/MS-DOS
(D) SOFTWARE: PatentIn Release #1.0, Version #1.25 (EPO) (2) INFORMATION FOR SEQ ID NO: 1:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 1692 base pairs (B) TYPE: nucleic acid (C) STR~NDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) (vii) IMMEDIATE SOURCE:
(B) CLONE: pWF46-5 (ix) FEATURE: ~~
(A) NAME/KEY: sig_peptide (B) LOCATION: 1..63 (D) OTHER INFORMATION: /product= "E. coIi OmpA signal peptide"
(ix) FEATURE:
(A) NAME/KEY: CDS
(B) LOCATION: 64..1656 (D) OTHER INFOR,MATION: /product= "scFv(FRP5)-delta ETA-delta-GAL4"

(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 1:
ATGA~AAAGA CAGCTATCGC GATTGCAGTG GCACTGGCTG GTTTCGCTAC CGTTGCGCAA 60 WO96/13599 PCT~P95/04270 Asp Tyr Lys Asp Asp Asp Asp Lys Leu His His His His His His Lys Leu Gln Val Gln Leu Gln Gln Ser Gly Pro Glu Leu Lys Lys Pro Gly Glu Thr Val Lys Ile Ser Cys Lys Ala Ser Gly Tyr Pro Phe Thr Asn Tyr Gly Met Asn Trp Val Lys Gln Ala Pro Gly Gln Gly Leu Lys Trp Met Gly Trp Ile Asn Thr Ser Thr Gly Glu Ser Thr Phe Ala Asp Asp Phe Lys Gly Arg Phe Asp Phe Ser Leu Glu Thr Ser Ala Asn Thr GCC TAT TTG CAG ATC AAC AAC CTC A~A AGT GAA GAC ATG GCT ACA TAT 396 Ala Tyr Leu Gln Ile Asn Asn Leu Lys Ser Glu Asp Met Ala Thr Tyr Phe Cys Ala Arg Trp Glu Val Tyr His Gly Tyr Val Pro Tyr Trp Gly Gln Gly Thr Thr Val Thr Val Ser Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Asp Ile Gln Leu Thr Gln Ser His A~A TTC CTG TCC ACT TCA GTA GGA GAC AGG GTC AGC ATC ACC TGC AAG 588 Lys Phe Leu Ser Thr Ser Val Gly Asp Arg Val Ser Ile Thr Cys Lys Ala Ser Gln Asp Val Tyr Asn Ala Val Ala Trp Tyr Gln Gln Lys Pro GGA CAA TCT CCT A~A CTT CTG ATT TAC TCG GCA TCC TCC CGG TAC ACT 684Gly Gln Ser Pro Lys Leu Leu Ile Tyr Ser Ala Ser Ser Arg Tyr Thr Gly Val Pro Ser Arg Phe Thr Gly Ser Gly Ser Gly Pro Asp Phe Thr .;

CA 02204020 l997-04-29 W O96/13599 PCTnEP95/04270 Phe Thr Ile Ser Ser Val Gln Ala Glu Asp Leu Ala Val Tyr Phe Cys CAG CAA CAT TTT CGT ACT CCA TTC ACG TTC GGC TCG GGG ACA A~A TTG 828 Gln Gln His Phe Arg Thr Pro Phe Thr Phe Gly Ser Gly Thr Lys Leu GAG ATC A~A GCT CTA GAG GGC GGC AGC CTG GCC GCG CTG ACC GCG CAC 876 Glu Ile Lys Ala Leu Glu Gly Gly Ser Leu Ala Ala Leu Thr Ala His Gln Ala Cys His Leu Pro Leu Glu Thr Phe Thr Arg His Arg Gln Pro Arg Gly Trp Glu Gln Leu Glu Gln Cys Gly Tyr Pro Val Gln Arg Leu G'~C GCC CTC TAC CTG GCG GCG CGA CTG TCA TGG AAC CAG GTC GAC CAG 1020Val Ala Leu Tyr Leu Ala Ala Arg Leu Ser Trp Asn Gln Val Asp Gln Val Ile Arg Asn Ala Leu Ala Ser Pro Gly Ser Gly Gly Asp Leu Gly Glu Ala Ile Arg Glu Gln Pro Glu Gln Ala Arg Leu Ala Leu Thr Leu Ala Ala Ala Glu Ser Glu Arg Phe Val Arg Gln Gly Thr Gly Asn Asp Glu Ala Gly Ala Ala Asn Ala Asp Glu Lys Leu Leu Ser Ser Ile Glu CAA GCA TGC GAT ATT TGC CGA CTT A~A AAG CTC AAG TGC TCC A~A GAA 1260 Gln Ala Cys Asp Ile Cys Arg Leu Lys Lys Leu Lys Cys Ser Lys Glu A~A CCG AAG TGC GCC AAG TGT CTG AAG AAC AAC TGG GAG TGT CGC TAC 1308 Lys Pro Lys Cys Ala Lys Cys Leu Lys Asn Asn Trp Glu Cys Arg Tyr TCT CCC A~A ACC A~A AGG TCT CCG CTG ACT AGG GCA CAT CTG ACA GAA 1356 Ser Pro Lys Thr Lys Arg Ser Pro Leu Thr Arg Ala His Leu Thr Glu W O96/13599 PCT~EP~5/04270 Val Glu Ser Arg Leu Glu Arg Leu Glu Gln Leu Phe Leu Leu Ile Phe CCT CGA GAA GAC CTT GAC ATG ATT TTG A~A ATG GAT TCT TTA CAG GAT 1452 Pro Arg Glu Asp Leu Asp Met Ile Leu Lys Met Asp Ser Leu Gln Asp Ile Lys Ala Leu Leu Thr Gly Leu Phe Val Gln Asp Asn Val Asn Lys Asp Ala Val Thr Asp Arg Leu Ala Ser Val Glu Thr Asp Met Pro Leu Thr Leu Arg Gln His Arg Ile Ser Ala Thr Ser Ser Ser Glu Glu Ser Ser Asn Lys Gly Gln Arg Gln Leu Thr Val Ser Ser Ser Asp Tyr Lys Asp Glu Leu (2) INFORMATION FOR SEQ ID NO: 2:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 530 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 2:
Asp Tyr Lys Asp Asp Asp Asp Lys Leu His His His His His His Lys Leu Gln Val Gln Leu Gln Gln Ser Gly Pro Glu Leu Lys Lys Pro Gly Glu Thr Val Lys Ile Ser Cys Lys Ala Ser Gly Tyr Pro Phe Thr Asn 35 40 45 -~~
Tyr Gly Met Asn Trp Val Lys Gln Ala Pro Gly Gln Gly Leu Lys Trp Met Gly Trp Ile Asn Thr Ser Thr Gly Glu Ser Thr Phe Ala Asp Asp WO96/13599 PCT~P95/04270 Phe Lys Gly Arg Phe Asp Phe Ser Leu Glu Thr Ser Ala Asn Thr Ala ~yr Leu Gln Ile Asn Asn Leu Lys Ser Glu Asp Met Ala Thr Tyr Phe Cys Ala Arg Trp Glu Val Tyr His Gly Tyr Val Pro Tyr Trp Gly Gln Gly Thr Thr Val Thr Val Ser Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Asp Ile Gln Leu Thr Gln Ser His Lys ~he Leu Ser Thr Ser Val Gly Asp Arg Val Ser Ile Thr Cys Lys Ala ~er Gln Asp Val Tyr Asn Ala Val Ala Trp Tyr Gln Gln Lys Pro Gly Gln Ser Pro Lys Leu Leu Ile Tyr Ser Ala Ser Ser Arg Tyr Thr Gly Val Pro Ser Arg Phe Thr Gly Ser Gly Ser Gly Pro Asp Phe Thr Phe Thr Ile Ser Ser Val Gln Ala Glu Asp Leu Ala Val Tyr Phe Cys Gln ~ln His Phe Arg Thr Pro Phe Thr Phe Gly Ser Gly Thr Lys Leu Glu ~le Lys Ala Leu Glu Gly Gly Ser Leu Ala Ala Leu Thr Ala His Gln Ala Cys His Leu Pro Leu Glu Thr Phe Thr Arg His Arg Gln Pro Arg 275 280 285 ~.
Gly Trp Glu Gln Leu Glu Gln Cys Gly Tyr Pro Val Gln Arg Leu Val Ala Leu Tyr Leu Ala Ala Arg Leu Ser Trp Asn Gln Val Asp Gln Val ~le Arg A~n Ala Leu Ala Ser Pro Gly Ser Gly Gly Asp Leu Gly Glu ~la Ile Arg Glu Gln Pro Glu Gln Ala Arg Leu Ala Leu Thr Leu Ala 340 345 . 350 Ala Ala Glu Ser Glu Arg Phe Val Arg Gln Gly Thr Gly Asn Asp Glu Ala Gly Ala Ala Asn Ala Asp Glu Lys Leu Leu Ser Ser Ile Glu Gln W O96tl3599 PCT~EP95/04270 Ala Cys Asp Ile Cys Arg Leu Lys Lys Leu Lys Cys Ser Lys Glu Lys Pro Lys Cys Ala Lys Cys Leu Lys Asn Asn Trp Glu Cys Arg Tyr Ser Pro Lys Thr Lys Arg Ser Pro Leu Thr Arg Ala His Leu Thr Glu Val Glu Ser Arg Leu Glu Arg Leu Glu Gln Leu Phe Leu Leu Ile Phe Pro Arg Glu Asp Leu Asp Met Ile Leu Lys Met Asp Ser Leu Gln Asp Ile Lys Ala Leu Leu Thr Gly Leu Phe Val Gln Asp Asn Val Asn Lys Asp Ala Val Thr Asp Arg Leu Ala Ser Val Glu Thr Asp Met Pro Leu Thr Leu Arg Gln His Arg Ile Ser Ala Thr Ser Ser Ser Glu Glu Ser Ser Asn Lys Gly Gln Arg Gln Leu Thr Val Ser Ser Ser Asp Tyr Lys Asp Glu Leu ~ . ~ ~
(2) INFORMATION FOR SEQ ID NO: 3:
(i) SEQUENCE CHARACTERISTICS:
- (A) LENGTH: 1128 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) (vii) IMMEDIATE SOURCE:
(B) CLONE: pWF47-TGF
(ix) FEATURE:
(A) NAME/KEY: CDS
(B) LOCATION: 64..1092 (D) OTHER INFORMATION: /partial /product= "TGF-alpha-delta ETA-delta GAL4 fusion protein"

WO96/13599 PCT~5/04270 (ix) FEATURE:
(A) NAME/KEY: sig_peptide (B) LOCATION: 1..63 (D) OTHER INFORMATION: /product= "E. coli OmpA signal peptide"

(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 3:

Asp Tyr Lys Asp Asp Asp Asp Lys Leu Gly Thr Gly Val Val Ser His Phe Asn Asp Cys Pro Asp Ser His Thr Gln Phe Cys Phe His Gly .

Thr Cys Arg Phe Leu Val Gln Glu Asp Lys Pro Ala Cys Val Cys His Ser Gly Tyr Val Gly Ala Arg Cys Glu His Ala Asp Leu Leu Ala Ser Leu Glu His His His His His His Leu Glu Gly Gly Ser Leu Ala Ala CTG AC~C GCG CAC CAG GCC TGC CAC CTG CCG CTG GAG ACT TTC ACC CGT 348Leu Thr Ala His Gln Ala Cys His Leu Pro Leu Glu Thr Phe Thr Arg CAT CGC C~AG CCG CGC GGC TGG GAA CAA CTG GAG CAG TGC GGC TAT CCG 396His Arg Gln Pro Arg Gly Trp Glu Gln Leu Glu Gln Cys Gly Tyr Pro Val Gln Arg Leu Val Ala Leu Tyr Leu Ala Ala Arg Leu Ser Trp Asn Gln Val Asp Gln Val Ile Arg Asn Ala Leu Ala Ser Pro Gly Ser Gly Gly Asp Leu Gly Glu Ala Ile Arg Glu Gln Pro Glu Gln Ala Arg Leu Ala Leu Thr Leu Ala Ala Ala Glu Ser Glu Arg Phe Val Arg~Gln Gly 160 165~ 170 175 WO96/13599 PCT~P95/04270 ~ -63-Thr Gly Asn Asp Glu Ala Gly Ala Ala Asn Ala Asp Glu Lys Leu Leu 180 185 lg0 TCT TCT ATC GAA CAA GCA TGC GAT ATT TGC CGA CTT A~A AAG CTC AAG 684 Ser Ser Ile Glu Gln Ala Cys Asp Ile Cys Arg Leu Lys Lys Leu Lys ~ 195 200 205 Cys Ser Lys Glu Lys Pro Lys Cys Ala Lys Cys Leu Lys Asn Asn Trp Glu Cys Arg Tyr Ser Pro Lys Thr Lys Arg Ser Pro Leu Thr Arg Ala His Leu Thr Glu Val Glu Ser Arg Leu Glu Arg Leu Glu Gln Leu Phe Leu Leu Ile Phe Pro Arg Glu Asp Leu Asp Met Ile Leu Lys Met Asp Ser Leu Gln Asp Ile Lys Ala Leu Leu Thr Gly Leu Phe Val Gln Asp Asn Val Asn Lys Asp Ala Val Thr Asp Arg Leu Ala Ser Val Glu Thr Asp Met Pro Leu Thr Leu Arg Gln His Arg Ile Ser Ala Thr Ser Ser Ser Glu Glu Ser Ser Asn Lys Gly Gln Arg Gln Leu Thr Val Ser Ser Ser Asp Tyr Lys Asp Glu Leu - . 340 (2) INFORMATION FOR SEQ ID NO: 4:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 342 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) MOLECULE TYPE: protein W O96/13599 _ PCTAEP95/04270 (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 4:
Asp Tyr Lys Asp Asp Asp Asp Lys Leu Gly Thr Gly Val Val Ser His ~he Asn Asp Cys Pro Asp Ser His Thr Gln Phe Cys Phe His Gly Thr Cys Arg Phe Leu Val Gln Glu Asp Lys Pro Ala Cys Val Cys His Ser Gly Tyr Val Gly Ala Arg Cys Glu His Ala Asp Leu Leu Ala Ser Leu Glu His His His His His His Leu Glu Gly Gly Ser Leu Ala Ala Leu ~hr Ala His Gln Ala Cys His Leu Pro Leu Glu Thr Phe Thr Arg His ~rg Gln Pro Arg Gly Trp Glu Gln Leu Glu Gln Cys Gly Tyr Pro Val Gln Arg Leu Val Ala Leu Tyr Leu Ala Ala Arg Leu Ser Trp Asn Gln Val Asp Gln Val Ile Arg Asn Ala I,eu Ala Ser Pro Gly Ser Gly Gly Asp Leu Gly Glu Ala Ile Arg Glu Gln Pro Glu Gln Ala Arg Leu Ala ~eu Thr Leu Ala Ala-Ala Glu Ser Glu Arg Phe Val Arg Gln Gly Thr ~ly Asn Asp Glu Ala Gly Ala Ala Asn Ala Asp Glu Lys Leu Leu Ser Ser Ile Glu Gln Ala Cys Asp Ile Cys Arg Leu Lys Lys Leu Lys Cys Ser Lys Glu Lys Pro Lys Cys Ala Lys Cys Leu Lys Asn Asn Trp Glu 210 . 215 220 Cys Arg Tyr Ser Pro Lys Thr Lys Arg Ser Pro Leu Thr Arg Ala His ~eu Thr Glu Val Glu Ser Arg Leu Glu Arg Leu Glu Gln Leu Phe Leu ~eu Ile Phe Pro Arg Glu Asp Leu Asp Met Ile Leu Lys Met Asp Ser ~eu Gln Asp Ile Lys Ala Leu Leu Thr Gly Leu Phe Val Gln Asp Asn W O96/13599 PCT~EP95/04270 Val Asn Lys Asp Ala Val Thr Asp Arg Leu Ala Ser Val Glu Thr Asp Met Pro Leu Thr Leu Arg Gln His Arg Ile Ser Ala Thr Ser Ser Ser Glu Glu Ser Ser Asn Lys Gly Gln Arg Gln Leu Thr Val Ser Ser Ser ~sp Tyr Lys Asp Glu Leu (2) INFORMATION FOR SEQ ID NO: 5:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 1365 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) (vii) IMMEDIATE SOURCE:
(B) CLONE: pWF46-IL-2 (ix) FEATURE:
(A) NAME/KEY: sig_peptide (B) LOCATION: 1..63 (ix) FEATURE:
(A) NAME/KEY: CDS
(B) LOCATION: 64..1329 (D) OTHER INFORMATION: /product= "IL-2-deltaETA-deltaGAL4"

(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 5:
ATGA~AAAGA CAGCTATCGC GATTGCAGTG GCACTGGCTG GTTTCGCTAC CGTTGCGCAA 60 Asp Tyr Lys Asp Asp Asp Asp Lys Leu His His His His His His AAG CTT GCA CCT ACT TCA AGT TCT ACA AAG A~A ACA CAG CTA CAA CTG 156 Lys Leu Ala Pro Thr Ser Ser Ser Thr Lys Lys Thr Gln Leu Gln Leu Glu His Leu Leu Leu Asp Leu Gln Met Ile Leu Asn Gly Ile Asn Asn ~AC AAG AAT CCC A~A CTC ACC AGG ATG CTC ACA TTT AAG TTT TAC ATG 252 WO96/13S99 PCT~P9S/04270 ~yr Lys Asn Pro Lys L~eu Thr Arg Met Leu Thr Phe Lys Phe Tyr Met Pro Lys Lys Ala Thr Glu Leu Lys His Leu Gln Cys Leu Glu Glu Glu Leu Lys Pro Leu Glu Glu Val Leu Asn Leu Ala Gln Ser Lys Asn Phe His Leu Arg Pro Arg Asp Leu Ile Ser Asn Ile Asn Val Ile Val Leu Glu Leu Lys Gly Ser Glu Thr Thr Phe Met Cys Glu Tyr Ala Asp Glu Thr Ala Thr Ile Val Glu Phe Leu Asn Arg Trp Ile Thr Phe Cys Gln Ser Ile Ile Ser Thr Leu Thr Leu Glu Gly Gly Ser Leu Ala Ala Leu Thr Ala His Gln Ala Cys His Leu Pro Leu Glu Thr Phe Thr Arg His Arg Gln Pro Arg Gly Trp Glu Gln Leu Glu Gln Cys Gly Tyr Pro Val Gln Arg Leu Val Ala Leu Tyr Leu Ala Ala Arg Leu Ser Trp Asn Gln Val Asp Gln Val Ile Arg Asn Ala Leu Ala Ser Pro Gly Ser Gly Gly Asp Leu Gly Glu Ala Ile Arg Glu Gln Pro Glu Gln Ala Arg Leu Ala Leu Thr Leu Ala Ala Ala Glu Ser Glu Arg Phe Val Arg Gln Gly Thr GGC AAC GAC GAG GCC GGC GCG GCC AAC GCC GAC GAG AAG CTT CTG TCT~ 876Gly Asn Asp Glu Ala Gly Ala Ala Asn Ala Asp Glu Lys Leu Leu Ser 260 265 270 ~ -WO96/13599 PCT~P95/0~270 Ser Ile Glu Gln Ala Cys Asp Ile Cys Arg Leu Lys Lys Leu Lys Cys TCC AAA GAA A~A CCG AAG TGC GCC AAG TGT CTG AAG AAC AAC TGG GAG 972 Ser Lys Glu Lys Pro Lys Cys Ala Lys Cys Leu Lys Asn Asn Trp Glu TGT CGC TAC TCT CCC A~A ACC A~A AGG TCT CCG CTG ACT AGG GCA CAT 1020 Cys Arg Tyr Ser Pro Lys Thr Lys Arg Ser Pro Leu Thr Arg Ala His Leu Thr Glu Val Glu Ser Arg Leu Glu Arg Leu Glu Gln Leu Phe Leu Leu Ile Phe Pro Arg Glu Asp Leu Asp Met Ile Leu Lys Met Asp Ser Leu Gln Asp Ile Lys Ala Leu Leu Thr Gly Leu Phe Val Gln Asp Asn GTG AAT A~A GAT GCC GTC ACA GAT AGA TTG GCT TCA GTG GAG ACT GAT 1212 Val Asn Lys Asp Ala Val Thr Asp Arg Leu Ala Ser Val Glu Thr Asp Met Pro Leu Thr Leu Arg Gln His Arg Ile Ser Ala Thr Ser Ser Ser GAA GAG AGT AGT AAC A~A GGT CAA AGA CAG TTG ACT GTA TCG AGC TCT 1308 Glu Glu Ser Ser Asn Lys Gly Gln Arg Gln Leu Thr Val Ser Ser Ser GAC TAC A~A GAC GAA CTT TAAGAATTCT CTAGAGATAT CGTCGACAGA TCTCTCGAG I~
Asp Tyr Lys Asp Glu Leu (2) INFORMATION FOR SEQ ID NO: 6:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 421 amino acids (B) TYPE: amino acid ~ (D) TOPOLOGY: linear (ii) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 6:
Asp Tyr Lys Asp Asp Asp Asp Lys Leù His His His His His His Lys .

Leu Ala Pro Thr Ser Ser Ser Thr Lys Lys Thr Gln Leu Gln Leu Glu ~is Leu Leu Leu Asp Leu Gln Met Ile Leu Asn Gly Ile Asn Asn Tyr Lys Asn Pro Lys Leu Thr Arg Met Leu Thr Phe Lys Phe Tyr Met Pro Lys Lys Ala Thr Glu Leu Lys His Leu Gln Cys Leu Glu Glu Glu Leu ~ys Pro Leu Glu Glu Val Leu Asn Leu Ala Gln Ser Lys Asn Phe His ~eu Arg Pro Arg Asp Leu Ile Ser Asn Ile Asn Val Ile Val Leu Glu Leu Lys Gly Ser Glu Thr Thr Phe Met Cys Glu Tyr Ala Asp Glu Thr Ala Thr Ile Val Glu Phe Leu Asn Arg Trp Ile Thr Phe Cys Gln Ser Ile Ile Ser Thr Leu Thr Leu Glu Gly Gly Ser Leu Ala Ala Leu Thr ~la His Gln Ala Cys His Leu Pro Leu Glu Thr Phe Thr Arg His Arg ~ln Pro Arg Gly Trp Glu Gln Leu Glu Gln Cys Gly Tyr Pro Val Gln Arg Leu Val Ala Leu Tyr Leu Ala Ala Arg Leu Ser Trp Asn Gln Val Asp Gln Val Ile Arg Asn Ala Leu Ala Ser Pro Gly Ser Gly Gly Asp Leu Gly Glu Ala Ile Arg Glu Gln Pro Glu Gln Ala Arg Leu Ala Leu ~hr Leu Ala Ala Ala Glu Ser Glu Arg Phe Val Arg Gln Gly Thr Gly ~sn Asp Glu Ala Gly Ala Ala Asn Ala Asp Glu Lys Leu Leu Ser Ser Ile Glu Gln Ala Cys Asp Ile Cys Arg Leu Lys Lys Leu Lys Cys Ser 275 280 . ~ 285 Lys Glu Lys Pro Lys Cys Ala Lys Cys Leu Lys Asn Asn Trp Glu Cys Arg Tyr Ser Pro Lys Thr Lys Arg Ser Pro Leu Thr Arg Ala His Leu -CA 02204020 l997-04-29 Thr Glu Val Glu Ser Arg Leu Glu Arg Leu Glu Gln Leu Phe Leu Leu Ile Phe Pro Arg Glu Asp Leu Asp Met Ile Leu Lys Met Asp Ser Leu ~ 340 345 350 Gln Asp Ile Lys Ala Leu Leu Thr Gly Leu Phe Val Gln Asp Asn Val Asn Lys Asp Ala Val Thr Asp Arg Leu Ala Ser Val Glu Thr Asp Met Pro Leu Thr Leu Arg Gln His Arg Ile Ser Ala Thr Ser Ser Ser Glu Glu Ser Ser Asn Lys Gly Gln Arg Gln Leu Thr Val Ser Ser Ser Asp Tyr Lys Asp Glu Leu (2) INFORMATION FOR SEQ ID NO: 7:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 41 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 7:
CGAGA~ÇÇTT C-AGAGGTGTG ACTA~AP~;A C~;AACTTT'''' G 41 (2) INFORMATION FOR SEQ ID NO: 8:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 43 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) - -- (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 8:

WO96/13599 PCT~P95/04270 (2) INFORMATION FOR SEQ ID NO: 9:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 394 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) (vii) IMMEDIATE SOURCE:
(B) CLONE: pWW 25 (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 9:

GGTGCAGCGG CTGGTCGCCC TCTACCTGGC GGCGCGACTG TCATGGAACC AGGTCGACCA l80 GAGCTCTGAC TACA~AGACG AACTTTAAGA ATTC 394 (2) INFORMATION FOR SEQ ID NO: l0: ~
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 20 base pairs (B)--TYPE: nucleic acid (C) STR~NDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) (xi) SEQUENCE DESCRIPTION: SEQ ID NO: l0:

(2) INFORMATION FOR SEQ ID NO: ll:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 24 base pairs (B) TYPE: nucleic acid (C) STR~NDEDNESS: single WO96/13599 PCT~P95/04270 (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 11:

(2) INFORMATION FOR SEQ ID NO: 12:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 443 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear ~~ (ii) MOLECULE TYPE: DNA (genomic) (vii) IMMEDIATE SOURCE:
(B) CLONE: pWW35 (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 12:
AAGCTTCTGT CTTCTATCGA ACAAGCATGC GATATTTGCC GACTTA~AAA GCTCAAGTGC 60 CCCA~ACCA AAAGGTCTCC GCTGACTAGG GCACATCTGA CAGAAGTGGA ATCAAGGCTA 180 A~AATGGATT CTTTACAGGA TATA~AAGCA TTGTTAACAG GATTATTTGT ACAAGATAAT 300 GTGAATA~AG ATGCCGTCAC AGATAGATTG GCTTCAGTGG AGACTGATAT GCCTCTAACA 360 TTGAGACAGC ATAGAATAAG TGCGACATCA TCATCGGAAG AGAGTAGTAA CA~AGGTCAA 420 (2) INFORMATION FOR SEQ ID NO: 13:
(i) SEQUENCE CHARACTERISTICS:
(A~ LENGTH: 23 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) WO96/13599 PCT~95/04270 (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 13:

(2) INFORMATION FOR SEQ ID NO: 14:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 23 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 14:
~-~ AGATCCAGGG GCCAGTGGAT AGA 23 (2) INFORMATION FOR SEQ ID NO: 15:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 47 base pairs (B) TYPE: nucleic acid (C) STR~NDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 15:

(2) INFORMATION FOR SEQ ID NO: 16:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 42 base pairs (B) TYPE: nucleic acid (C) STR~NDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) (xi) SEQUENCE DESCRIPTION~ SEQ ID NO: 16:
GAAACGGTGA CCTCCTGCAG TTGTACCTGA GAAGCTTGCA TG

. . _ W O96/13599 PCT~EP95/04270 (2) INFORMATION FOR SEQ ID NO: 17:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 43 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear --(ii) MOLECULE TYPE: DNA (genomic) (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 17:
TGGCGGTTCT GGTGGCGGTG GCTCCGGCGG TGGCGGTTCT GAC

(2) INFORMATION FOR SEQ ID NO: 18:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 43 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 18:

(2) INFORMATION FOR SEQ ID NO: 19:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 30 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 19:
ATCCAGCTGG AGATCTAGCT GATCA~AGCT 30 (2) INFORMATION FOR SEQ ID NO: 20:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 43 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single WO96/13599 PCT~P95/04270 (D) TOPOLOGY: Linear (ii) MOLECULE TYPE: DNA (genomic) (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 20:

(2) INFORMATION FOR SEQ ID NO: 21:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 175 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 21:

TGATCA~AGC TCTAGAGGAT CCCCGGGTAC CGAGCTCGAA TTCACTGGCC GTCGT 175 (2) INFORMATION FOR SEQ ID NO: 22:

(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 18 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 22:

(2) INFORMATION FOR SEQ ID NO: 23:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 30 base pairs (B) TYPE: nucleic acid (C) STR~NDEDNESS: single (D) TOPOLOGY: linear WO96/13599 PCT~P95/04270 (ii) MOLECULE TYPE: DNA (genomic) (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 23:

(2) INFORMATION FOR SEQ ID NO: 24:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 26 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 24:
ACA~AATTGG AGATCA~AGC TCTAGA 26 (2) INFORMATION FOR SEQ ID NO: 25:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: l9 base pairs (B) TYPE: nucleic acid (C) STR~NDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic~

(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 25:
AGCTTCAGGT ACA~CTGCA l9 (2) INFORMATION FOR SEQ ID NO: 26:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: ll base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY:.linear (ii) MOLECULE TYPE: DNA (genomic) (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 26:
GTTGTACCTG A ll -W O96/13599 PCTAEP9~104270 (2) INFORMATION FOR SEQ ID NO: 27:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 48 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 27:

(2) INFORMATION FOR SEQ ID NO: 28:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 48 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 28:

(2) INFORMATION FOR SEQ ID NO: 29:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 40 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 29:
- GACCCGAAGC TTGGTACCGÇ TGTGGTGTCC CATTTTAATG 40 (2) INFORMATION FOR SEQ ID NO: 30:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 35 base pairs (B) TYPE: nucleic acid W O96/13599 PCT~EP95/04270 (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) ~ (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 30:

(2) INFORMATION FOR SEQ ID NO: 31:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 173 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 31:

TGCTTTCATG GAACCTGCAG ~ GGTG CAGGAGGACA AGCCAGCATG TGTCTGCCAT 120 (2) INFORMATION FOR SEQ ID NO: 32:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 26 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 32:

-(2) INFORMATION FOR SEQ ID NO: 33: ---(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 27 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear WO96/13599 PCT~P95104270 (ii) MOLECULE TYPE: DNA (genomic) (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 33:

(2) INFORMATION FOR SEQ ID NO: 34:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 1919 base pairs (B) TYPE: nucleic acid (C) STR~NDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) (ix) FEATURE:
(A) NAME/KEY: CDS
(B) LOCATION: 64..1908 (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 34:
ATGA~AAAGA CAGCTATCGC GATTGCAGTG GCACTGGCTG GTTTCGCTAC CGTTGCGCAA 60 Asp Tyr Lys Asp Asp Asp Asp Lys Leu His His His His His His Lys Leu Leu Ser Ser Ile Glu Gln Ala Cys Asp Ile Cys Arg Leu Lys AAG CTC AAG TGC TCC A~A GAA A~A CCG AAG TGC GCC AAG TGT CTG AAG 204 Lys Leu Lys Cys Ser Lys Glu Lys Pro Lys Cys Ala Lys Cys Leu Lys 40~ 45 Asn Asn Trp Glu Cys Arg Tyr Ser Pro Lys Thr Lys Arg Ser Pro Leu Thr Arg-Ala His Leu Thr Glu Val Glu Ser Arg Leu Glu Arg Leu Glu Gln Leu Phe Leu Leu Ile Phe Pro Arg Glu Asp Leu Asp Met Ile Leu A~A ATG GAT TCT TTA CAG GAT ATA A~A GCA TTG TTA ACA GGA TTA TTT 396 Lys Met Asp Ser Leu Gln Asp Ile Lys Ala Leu Leu Thr Gly Leu Phe . -79-GTA CAA GAT AAT GTG AAT AAA GAT GCC GTC ACA GAT AGA TTG GCT TCA 444Val Gln Asp Asn Val Asn Lys Asp Ala Val Thr Asp Arg Leu Ala Ser Val Glu Thr Asp Met Pro Leu Thr Leu Arg Gln His Arg Ile Ser Ala Thr Ser Ser Ser Glu Glu Ser Ser Asn Lys Gly Gln Arg Gln Leu Thr Val Ser Ser Ser Leu Ala Val Gly Ser Ser Leu Ser Cys Ile Asn Leu GAT TGG GAT GTT ATC CGT GAT AAA ACT A~A ACT AAG ATC GAA TCT CTG 636 Asp Trp Asp Val Ile Arg Asp Lys Thr Lys Thr Lys Ile Glu Ser Leu A~A GAA CAC GGT CCG ATC A~A AAC A~A ATG AGC GAA AGC CCG AAC A~A 684 Lys Glu His Gly Pro Ile Lys Asn Lys Met Ser Glu Ser Pro Asn Lys ACT GTA TCT GAA GA~ A~A GCT A~A CAG TAC CTG GAA GAA TTC CAC CAG 732 Thr Val Ser Glu Glu Lys Ala Lys Gln Tyr Leu Glu Glu Phe His Gln Thr Ala Leu Glu His Pro Glu Leu Ser Glu Leu Lys Thr Val Thr Gly Thr Asn Pro Val Phe Ala Gly Ala Asn Tyr Ala Ala Trp Ala Val Asn.

GTT GCT CAG GTT_ATC GAT AGC GAA ACT GCT GAT AAC CTG GAA A~A ACT 876 Val Ala Gln Val Ile Asp Ser Glu Thr Ala Asp Asn Leu Glu Lys Thr Thr Ala Ala Leu Ser Ile Leu Pro Gly Ile Gly Ser Val Met Gly Ile Ala Asp Gly Ala Val His His Asn Thr Glu Glu Ile Val Ala Gln Ser Ile Ala Leu Ser Ser Leu Met Val Ala Gln Ala Ile Pro Leu Val Gly W O96/13~99 PCT~EP95/04270 Glu Leu Val Asp Ile Gly Phe Ala Ala Tyr Asn Phe Val Glu Ser Ile Ile Asn Leu Phe Gln Val Val His Asn Ser Tyr Asn Arg Pro Ala Tyr Ser Pro Gly Val Asp Gly Ile Asp Lys Leu Gln Val Gln Leu Gln Gln Ser Gly Pro Glu Leu Lys Lys Pro Gly Glu Thr Val Lys Ile Ser Cys Lys Ala Ser Gly Tyr Pro Phe Thr Asn Tyr Gly Met Asn Trp Val Lys Gln Ala Pro Gly Gln Gly Leu Lys Trp Met Gly Trp Ile Asn Thr Ser Thr Gly Glu Ser Thr Phe Ala Asp Asp Phe Lys Gly Arg Phe Asp Phe Ser Leu Glu Thr Ser Ala Asn Thr Ala Tyr Leu Gln Ile Asn Asn Leu A~A AGT GAA GAC ATG GCT ACA TAT TTC TGT GCA AGA TGG GAG GTT TAC 1452 Lys Ser Glu Asp Met Ala Thr Tyr Phe Cys Ala Arg~Trp Glu Val Tyr 450 455 460 ~ =.

His Gly Tyr Va~ Pro Tyr Trp Gly Gln Gly Thr Thr Val Thr Val Ser Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser GAC ATC CAG CTG ACC CAG TCT CAC A~A TTC CTG TCC ACT TCA GTA GGA 1596 Asp Ile Gln Leu Thr Gln Ser His Lys Phe Leu Ser Thr Ser Val Gly Asp Arg Val Ser Ile--Thr Cys Lys Ala Ser Gln Asp Val Tyr Asn Ala 515 520 . 525 ... .~ . _ , W O96/13599 PCT~EP95104270 Val Ala Trp Tyr Gln Gln Lys Pro Gly Gln Ser Pro Lys Leu Leu Ile Tyr Ser Ala Ser Ser Arg Tyr Thr Gly Val Pro Ser Arg Phe Thr Gly Ser Gly Ser Gly Pro Asp Phe Thr Phe Thr Ile Ser Ser Val Gln Ala Glu Asp Leu Ala Val Tyr Phe Cys Gln Gln His Phe Arg Thr Pro Phe Thr Phe Gly Ser Gly Thr Lys Leu Glu Ile Lys Ala Leu Glu Asp Leu Ser Ser Glu Arg Arg Phe Ser Ala (2) INFORMATION FOR SEQ ID NO: 35:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 615 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 35:
Asp Tyr Lys Asp Asp Asp Asp Lys Leu His His His His His His Lys Leu Leu Ser Ser Ile Glu Gln Ala Cys Asp Ile Cys Arg Leu Lys Lys Leu Lys Cys Ser Lys Glu Lys Pro Lys Cys Ala Lys Cys Leu Lys Asn . 40 45 Asn Trp Glu Cys Arg Tyr Ser Pro Lys Thr Lys Arg Ser Pro Leu Thr ~ Arg Ala His Leu Thr Glu Val Glu Ser Arg Leu Glu Arg Leu Glu Gln Leu Phe Leu Leu Ile Phe Pro Arg Glu Asp Leu Asp Met Ile Leu Lys W O96/13599 PCT/~-N127o Met Asp Ser Leu Gln Asp Ile Lys Ala Leu Leu Thr Gly Leu Phe Val Gln Asp Asn Val Asn Lys Asp Ala Val Thr Asp Arg Leu Ala Ser Val Glu Thr Asp Met Pro Leu Thr Leu Arg Gln His Arg Ile Ser Ala Thr Ser Ser Ser Glu Glu Ser Ser Asn Lys Gly Gln Arg Gln Leu Thr Val ~er Ser Ser Leu Ala Val Gly Ser Ser Leu Ser Cys Ile Asn Leu Asp ~rp Asp Val Ile Arg Asp Lys Thr Lys Thr Lys Ile Glu Ser Leu Lys Glu His Gly Pro Ile Lys Asn Lys Met Ser Glu Ser Pro Asn Lys Thr Val Ser Glu Glu Lys Ala Lys Gln Tyr Leu Glu Glu Phe His Gln Thr Ala Leu Glu His Pro Glu Leu Ser Glu Leu Lys Thr Val Thr Gly Thr ~sn Pro Val Phe Ala Gly Ala Asn Tyr Ala Ala Trp Ala Val Asn Val ~la Gln Val Ile Asp Ser Glu Thr Ala Asp Asn Leu Glu Lys Thr Thr Ala Ala Leu Ser Ile Leu Pro Gly Ile Gly Ser Val Met Gly Ile Ala Asp Gly Ala Val His His Asn Thr Glu Glu Ile Val Ala Gln Ser Ile Ala Leu Ser Ser Leu Met Val Ala Gln Ala Ile Pro Leu Val Gly Glu ~eu Val Asp Ile Gly Phe Ala Ala Tyr Asn Phe Val Glu Ser Ile Ile ~sn Leu Phe Gln Val Val His Asn Ser Tyr Asn Arg Pro Ala Tyr Ser Pro Gly Val Asp Gly Ile Asp Lys Leu Gln Val Gln Leu Gln Gln Ser Gly Pro Glu Leu Lys Lys Pro Gly Glu Thr Val Lys Ile Ser Cys Lys Ala Ser Gly Tyr Pro Phe Thr Asn Tyr Gly Met Asn Trp Val Lys Gln -CA 02204020 l997-04-29 Ala Pro Gly Gln Gly Leu Lys Trp Met Gly Trp Ile Asn Thr Ser Thr Gly Glu Ser Thr Phe Ala Asp Asp Phe Lys Gly Arg Phe Asp Phe Ser ~ 420 425 .- 430 Leu Glu Thr Ser Ala Asn Thr Ala Tyr Leu Gln Ile Asn Asn Leu Lys Ser Glu Asp Met Ala Thr Tyr Phe Cys Ala Arg Trp Glu Val Tyr His Gly Tyr Val Pro Tyr Trp Gly Gln Gly Thr Thr Val Thr Val Ser Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Asp Ile Gln Leu Thr Gln Ser His Lys Phe Leu Ser Thr Ser Val Gly Asp Arg Val Ser Ile Thr Cys Lys Ala Ser Gln Asp Val Tyr Asn Ala Val Ala Trp Tyr Gln Gln Lys Pro Gly Gln Ser Pro Lys Leu Leu Ile Tyr Ser Ala Ser Ser Arg Tyr Thr Gly Val Pro Ser Arg Phe Thr Gly Ser Gly Ser Gly Pro Asp Phe Thr Phe Thr Ile Ser Ser Val Gln Ala Glu Asp Leu Ala Val Tyr Phe Cys Gln Gln His Phe Arg Thr Pro Phe Thr Phe Gly-Ser Gly Thr Lys Leu Glu Ile Lys Ala Leu Glu Asp Leu Ser Ser Glu Arg Arg Phe Ser Ala (2) INFORMATION FOR SEQ ID NO: 36:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 1862 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) W O96/13599 PCTnEPg5/04270 (ix) FEATURE:
(A) NAME/KEY: CDS
(B) LOCATION: 11851 (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 36:

Met Asp Tyr Lys Asp Asp Asp Asp Lys Lys Leu His His His His His His Lys Leu Leu Ser Ser Ile Glu Gln Ala Cys Asp Ile Cys Arg Leu A~A AAG CTC AAG TGC TCC AAA GAA A~A CCG AAG TGC GCC AAG TGT CTG 144 Lys Lys Leu Lys Cys Ser Lys Glu Lys Pro Lys Cys Ala Lys Cys Leu AAG AAC AAC TGG GAG TGT CGC TAC TCT CCC AAA ACC A~A AGG TCT CCG 192 Lys Asn Asn Trp Glu Cys Arg Tyr Ser Pro Lys Thr Lys Arg Ser Pro Leu Thr Arg Ala His Leu Thr Glu Val Glu Ser Arg Leu Glu Arg Leu Glu Gln Leu Phe Leu Leu Ile Phe Pro Arg Glu Asp Leu Asp Met Ile Leu Lys Met Asp Ser Leu Gln Asp Ile Lys Ala Leu Leu Thr Gly Leu TTT GTA CAA GAT AAT GTG AAT A~A GAT GCC GTC ACA GAT AGA TTG GCT 384 Phe Val Gln Asp Asn Val Asn Lys Asp Ala Val Thr Asp Arg Leu Ala Ser Val Glu Thr Asp Met Pro Leu Thr Leu Arg Gln His Arg Ile Ser 130 135 ~ 140 Ala Thr Ser Ser Ser Glu Glu Ser Ser Asn Lys Gly Gln Arg Gln Leu Thr Val Ser Ser Ser Leu Ala Val Gly Ser Ser Leu Ser Cys Ile Asn 165 170. 175 CTG GAT TGG GAT GTT ATC CGT GAT A~A ACT AAA ACT AAG ATC GAA TCT 576 Leu Asp Trp Asp Val Ile Arg Asp Lys Thr Lys Thr Lys Ile Glu Ser WO96/13599 PCT~P95/04270 -g5-Leu Lys Glu His Gly Pro Ile Lys Asn Lys Met Ser Glu Ser Pro Asn AAA ACT GTA TCT GAA GAA AAA GCT A~A CAG TAC CTG GAA GAA TTC CAC 672 Lys Thr Val Ser Glu Glu Lys Ala Lys Gln Tyr Leu Glu Glu Phe His Gln Thr Ala Leu Glu His Pro Glu Leu Ser Glu Leu Lys Thr Val Thr Gly Thr Asn Pro Val Phe Ala Gly Ala Asn Tyr Ala Ala Trp Ala Val Asn Val Ala Gln Val Ile Asp Ser Glu Thr Ala Asp Asn Leu Glu Lys Thr Thr Ala Ala Leu Ser Ile Leu Pro Gly Ile Gly Ser Val Met Gly Ile Ala Asp Gly Ala Val His His Asn Thr Glu Glu Ile Val Ala Gln Ser Ile Ala Leu Ser Ser Leu Met Val Ala Gln Ala Ile Pro Leu Val Gly Glu Leu Val Asp Ile Gly Phe Ala Ala Tyr Asn Phe Val Glu Ser .

Ile Ile Asn Leu Phe Gln Val Val His Asn Ser Tyr Asn Arg Pro Ala Tyr Ser Pro Gly Val Asp Gly Ile Asp Lys Leu Gln Val Gln Leu Gln Gln Ser Gly Pro Glu Leu Lys Lys Pro Gly Glu Thr Val Lys Ile Ser Cys Lys Ala Ser Gly Tyr Pro Phe Thr Asn Tyr Gly Met Asn Trp Val 385 ~390 . 395 400 Lys Gln Ala Pro Gly Gln Gly Leu Lys Trp Met Gly Trp Ile Asn Thr CA 02204020 l997-04-29 W O96113599 _ PCTAEP95/04270 Ser Thr Gly Glu Ser Thr Phe Ala Asp Asp Phe Lys Gly Arg Phe Asp Phe Ser Leu Glu Thr Ser Ala Asn Thr Ala Tyr Leu Gln Ile Asn Asn CTC A~A AGT GAA GAC ATG GCT ACA TAT TTC TGT GCA AGA TGG GAG GTT 1392 Leu Lys Ser Glu Asp Met Ala Thr Tyr Phe Cys Ala Arg Trp Glu Val Tyr His Gly Tyr Val Pro Tyr Trp Gly Gln Gly Thr Thr Val Thr Val Ser Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly TCT GAC ATC CAG CTG ACC CAG TCT CAC A~A TTC CTG TCC ACT TCA GTA 1536 Ser Asp Ile Gln Leu Thr Gln Ser His Lys Phe Leu Ser Thr Ser Val Gly Asp Arg Val Ser Ile Thr Cys Lys Ala Ser Gln Asp Val Tyr Asn GCT GTT GCC TGG TAT CAA CAG AAA CCA GGA CAA TCT CCT A~A CTT CTG 1632 Ala Val Ala Trp Tyr Gln Gln Lys Pro Gly Gln Ser Pro Lys Leu Leu Ile Tyr Ser Ala Ser Ser Arg Tyr Thr Gly Val Pro Ser Arg Phe Thr Gly Ser Gly Ser Gly Pro Asp Phe Thr Phe Thr Ile Ser Ser Val Gln Ala Glu Asp Leu Ala Val Tyr Phe Cys Gln Gln His Phe Arg Thr Pro TTC ACG TTC GGC TCG GGG ACA A~A TTG GAG ATC A~A GCT CTA GAG GAT 1824 Phe Thr Phe Gly Ser Gly Thr Lys Leu Glu Ile Lys Ala Leu Glu Asp Leu Ser Ser Glu Arg Arg Phe Ser Ala 610 615 ~_ WO96/13599 PCT~P95/04270 (2) INFORMATION FOR SEQ ID NO: 37:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 617 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 37:
Met Asp Tyr Lys Asp Asp Asp Asp Lys Lys Leu His His His His His His Lys Leu Leu Ser Ser Ile Glu Gln Ala Cys Asp Ile Cys Arg Leu Lys Lys Leu Lys Cys Ser Lys Glu Lys Pro Lys Cys Ala Lys Cys Leu Lys Asn Asn Trp Glu Cys Arg Tyr Ser Pro Lys Thr Lys Arg Ser Pro Leu Thr Arg Ala His Leu Thr Glu Val Glu Ser Arg Leu Glu Arg Leu Glu Gln Leu Phe Leu Leu Ile Phe Pro Arg Glu Asp Leu Asp Met Ile Leu Lys Met Asp Ser Leu Gln Asp Ile Lys Ala Leu Leu Thr Gly Leu Phe Val Gln Asp Asn Val Asn Lys Asp Ala Val Thr Asp Arg Leu Ala Ser Val Glu Thr Asp Met Pro Leu Thr Leu Arg Gln His Arg Ile Ser Ala Thr Ser Ser Ser Glu Glu Ser Ser Asn Lys Gly Gln Arg Gln Leu Thr Val Ser Ser Ser Leu Ala Val Gly Ser Ser Leu Ser Cys Ile Asn Leu Asp=Trp Asp Val Ile Arg Asp Lys Thr Lys Thr Lys Ile Glu Ser = 180 185 190 Leu Lys Glu His Gly Pro Iie Lys Asn Lys Met Ser Glu Sèr Pro Asn Lys Thr Val Ser Glu Glu Lys Ala Lys Gln Tyr Leu Glu Glu Phe His , .

WO96/13599 PCT~P95/04270 - 8g _ ..

Gln Thr Ala Leu Glu His Pro Glu Leu Ser Glu Leu Lys Thr Val Thr ~ly Thr Asn Pro Val Phe Ala Gly Ala Asn Tyr Ala Ala Trp Ala Val ~sn Val Ala Gln Val Ile Asp Ser Glu Thr Ala Asp Asn Leu Glu Lys Thr Thr Ala Ala Leu Ser Ile Leu Pro Gly Ile Gly Ser Val Met Gly Ile Ala Asp Gly Ala Val His His Asn Thr Glu Glu Ile Val Ala Gln Ser Ile Ala Leu Ser Ser Leu Met Val Ala Gln Ala Ile Pro Leu Val ~ly Glu Leu Val Asp Ile Gly Phe Ala Ala Tyr Asn Phe Val Glu Ser ~le Ile Asn Leu Phe Gln Val Val His Asn Ser Tyr Asn Arg Pro Ala Tyr Ser Pro Gly Val Asp Gly Ile Asp Lys Leu Gln Val Gln Leu Gln Gln Ser Gly Pro Glu Leu Lys Lys Pro Gly Glu Thr Val Lys Ile Ser Cys Lys Ala Ser Gly Tyr Pro Phe Thr Asn Tyr Gly Met Asn Trp Val ~ys Gln Ala Pro Gly Gln Gly Leu Lys Trp Met Gly Trp Ile Asn Thr ~er Thr Gly Glu Ser Thr Phe Ala Asp Asp Phe Lys Gly Arg Phe Asp Phe Ser Leu Glu Thr Ser Ala Asn Thr Ala Tyr Leu Gln Ile Asn Asn Leu Lys Ser Glu Asp Met Ala Thr Tyr Phe Cys Ala Arg Trp Glu Val Tyr His Gly Tyr Val Pro Tyr Trp Gly Gln Gly Thr Thr Val Thr Val ~er Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly ~er Asp Ile Gln Leu Thr Gln Ser His Lys Phe Leu Ser Thr Ser Val ~ly Asp Arg Val Ser Ile Thr Cys Lys Ala Ser Gln Asp Val Tyr Asn CA 02204020 l997-04-29 W O96/13599 PCT~EP95/04270 Ala Val Ala Trp Tyr Gln Gln Lys Pro Gly Gln Ser Pro Lys Leu Leu Ile Tyr Ser Ala Ser Ser Arg Tyr Thr Gly Val Pro Ser Arg Phe Thr Gly Ser Gly Ser Gly Pro Asp Phe Thr Phe Thr Ile Ser Ser Val Gln Ala Glu Asp Leu Ala Val Tyr Phe Cys Gln Gln His Phe Arg Thr Pro Phe Thr Phe Gly Ser Gly Thr Lys Leu Glu Ile Lys Ala Leu Glu Asp Leu Ser Ser Glu Arg Arg Phe Ser Ala (2) INFORMATION FOR SEQ ID NO: 38:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 1605 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) . . =
(ix) FEATURE:
(A) NAME/KEY: CDS
(B) LOCATION: 64..1551 (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 38:
ATGA~ GA CAGCTATCGC GATTGCAGTG GCACTGGCTG GTTTCGCTAC CGTTGCGCAA 60 Asp Tyr Lys Asp Asp Asp Asp Lys Leu His His His His His His Lys Leu Leu Ser Ser Ile Glu Gln Ala Cys Asp Ile Cys Arg Leu Lys ~ AAG CTC AAG TGC TCC AAA GAA AAA CCG AAG TGC GCC AAG TGT CTG AAG 204 Lys Leu Lys Cys Ser Lys Glu Lys Pro Lys Cys Ala Lys Cys Leu Lys AAC AAC TGG GAG TGT CGC~ AC TCT CCC AAA ACC AAA AGG TCT CCG CTG 252 Asn Asn Trp Glu Cys Arg Tyr Ser Pro Lys Thr Lys Arg Ser Pro Leu W O96/1359~ PCTnEP95/04270 ACT AGG GCA CAT CTG ACA GA~ GTG GAA TCA AGG CTA GAA AGA CTG GAA 300 Thr Arg Ala His Leu Thr Glu Val Glu Ser Arg Leu Glu Arg Leu Glu Gln Leu Phe Leu Leu Ile Phe Pro Arg Glu Asp Leu Asp Met Ile Leu Lys Met Asp Ser Leu Gln Asp Ile Lys Ala Leu Leu Thr Gly Leu Phe Val Gln Asp Asn Val Asn Lys Asp Ala Val Thr Asp Arg Leu Ala Ser Val Glu Thr Asp Met Pro Leu Thr Leu Arg Gln~His Arg Ile Ser Ala ACA TCA TCA TCG GA~ GAG AGT AGT AAC A~A GGT CAA AGA CAG TTG ACT 540 Thr Ser Ser Ser Glu Glu Ser Ser Asn Lys Gly Gln Arg Gln Leu Thr Val Ser Ser Ser Leu Ala Val Gly Ser Ser Leu Ser Cys Ile Asn Leu GAT TGG GAT GTT ATC CGT GAT A~A ACT AAA ACT AAG ATC GAA TCT CTG 636 Asp Trp Asp Val Ile Arg Asp Lys Thr Lys Thr Lys Ile Glu Ser Leu AAA GAA CAC GGT CCG ATC A~A AAC A~A ATG AGC GAA AGC CCG AAC A~A 684 Lys Glu His Gly Pro Ile Lys Asn Lys Met Ser Glu Ser Pro Asn Lys Thr Val Ser Glu Glu Lys Ala Lys Gln Tyr Leu Glu Glu Phe His Gln ACT GCA CTG GAA CAC CCG GAA CTG TCT GA~ CTT AAG ACC GTT ACT GGT 780 Thr Ala Leu Glu His Pro Glu Leu Ser Glu Leu Lys Thr Val Thr Gly Thr Asn Pro Val Phe Ala Gly Ala Asn Tyr Ala Ala Trp Ala Val Asn 240 245 ' 250 255 Val Ala Gln Val Ile Asp Ser Glu Thr Ala Asp Asn Leu Glu Lys Thr 260 265 ~ ~ 270 WO96/13599 PCT~P95/04270 ~ - 91 -Thr Ala Ala Leu Ser Ile Leu Pro Gly Ile Gly Ser Val Met Gly Ile Ala Asp Gly Ala Val His His Asn Thr Glu Glu Ile Val Ala Gln Ser Ile Ala Leu Ser Ser Leu Met Val Ala Gln Ala Ile Pro Leu Val Gly Glu Leu Val Asp Ile Gly Phe Ala Ala Tyr Asn Phe Val Glu Ser Ile Ile Asn Leu Phe Gln Val Val His Asn Ser Tyr Asn Arg Pro Ala Tyr Ser Pro Gly Val Asp Gly Ile Asp Lys Leu Glu Leu Ala Pro Thr Ser Ser Ser Thr Lys Lys Thr Gln Leu Gln Leu Glu His Leu Leu Leu Asp Leu Gln Met Ile Leu Asn Gly Ile Asn Asn Tyr Lys Asn Pro Lys Leu Thr Arg Met Leu Thr-Phe Ly-s Phe Tyr Met Pro Lys Lys Ala Thr Glu CTG AAA CAT CTT CAG TGT CTA GAA GAA GAA CTC A~A CCT CTG GAG GAA 1356 Leu Lys His Leu Gln Cys Leu Glu Glu Glu Leu Lys Pro Leu Glu Glu GTG CTA AAT TTA GCT CAA AGC A~A AAC TTT CAC TTA AGA CCC AGG GAC 1404 Val Leu Asn Leu Ala Gln Ser Lys Asn Phe His Leu Arg Pro Arg Asp Leu Ile Ser Asn Ile Asn Val Ile Val Leu Glu Leu Lys Gly Ser Glu Thr Thr Phe Met Cys Glu Tyr Ala Asp Glu Thr Ala Thr Ile Val Glu Phe Leu Asn Arg Trp Ile Thr Phe Cys Gln Ser Ile Ile Ser Thr Leu W O96tl3599 PCTnEP95/04270 Thr (2) INFORMATION FOR SEQ ID NO: 39:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 496 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 39:
Asp Tyr Lys Asp Asp Asp Asp Lys Leu His His His His His His Lys ~eu Leu Ser Ser Ile Glu Gln Ala Cys Asp Ile Cys Arg Leu Lys Lys Leu Lys Cys Ser Lys Glu Lys Pro Lys Cys Ala Lys Cys Leu Lys Asn Asn Trp Glu Cys Arg Tyr Ser Pro Lys Thr Lys Arg Ser Pro Leu Thr Arg Ala His Leu Thr Glu Val Glu Ser Arg Leu Glu Arg Leu Glu Gln ~eu Phe Leu Leu Ile-Phe PEO Arg Glu Asp Leu Asp Met Ile Leu Lys ~et Asp Ser Leu Gln Asp Ile Lys Ala Leu Leu Thr Gly Leu Phe Val Gln Asp Asn Val Asn Lys Asp Ala Val Thr Asp Arg Leu Ala Ser Val Glu Thr Asp Met Pro Leu Thr Leu Arg Gln His Arg Ile Ser Ala Thr Ser Ser Ser Glu Glu Ser Ser Asn Lys Gly Gln Arg Gln Leu Thr Val ~er Ser Ser Leu Ala Val Gly Ser Ser Leu Ser Cys Ile Asn Leu Asp ~rp Asp Val Ile Arg Asp Lys Thr Lys Thr Lys Ile Glu Ser Leu Lys ~lu His Gly Pro Ile Lys Asn Lys Met Ser Glu Ser Pro Asn Lys Thr W O96/13599 PCTAEPg5/04270 Val Ser Glu Glu Lys Ala Lys Gln Tyr Leu Glu Glu Phe His Gln Thr Ala Leu Glu His Pro Glu Leu Ser Glu Leu Lys Thr Val Thr Gly Thr Asn Pro Val Phe Ala Gly Ala Asn Tyr Ala Ala Trp Ala Val Asn Val Ala Gln Val Ile Asp Ser Glu Thr Ala Asp Asn Leu Glu Lys Thr Thr Ala Ala Leu Ser Ile Leu Pro Gly Ile Gly Ser Val Met Gly Ile Ala Asp Gly Ala Val His His Asn Thr Glu Glu Ile Val Ala Gln Ser Ile Ala Leu Ser Ser Leu Met Val Ala Gln Ala Ile Pro Leu Val Gly Glu Leu Val Asp Ile Gly Phe Ala Ala Tyr Asn Phe Val Glu Ser Ile Ile Asn Leu Phe Gln Val Val His Asn Ser Tyr Asn Arg Pro Ala Tyr Ser Pro Gly Val Asp Gly Ile Asp Lys Leu Glu Leu Ala Pro Thr Ser Ser Ser Thr Lys Lys Thr Gln Leu Gln Leu Glu His Leu Leu Leu Asp Leu Gln Met Ile Leu Asn Gly Ile Asn Asn Tyr Lys Asn Pro Lys Leu Thr Arg Met Leu Thr Phe T-ys !~h~ Tyr Met Pro T yS Ly~ Ala Thr Glu Leu Lys His Leu Gln Cys Leu Glu Glu Glu Leu Lys Pro Leu Glu Glu Val Leu Asn Leu Ala Gln Ser Lys Asn Phe His Leu Arg Pro Arg Asp Leu Ile Ser Asn Ile Asn Val Ile Val Leu Glu Leu Lys Gly Ser Glu Thr Thr Phe Met Cys Glu Tyr Ala Asp Glu Thr Ala Thr Ile Val Glu Phe Leu Asn Arg Trp Ile Thr Phe Cys Gln Ser Ile Ile Ser Thr Leu Thr 485 490 495 - - =

W O96/13599 PCTnEP95/04270 (2) INFORMATION FOR SEQ ID NO: 40:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 12 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) MOLECULE TYPE: peptide (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 40:
Glu Lys Leu Glu Ser Ser Asp Tyr Lys Asp Glu Leu (2) INFORMATION FOR SEQ ID NO: 41:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 4 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) MOLECULE TYPE: peptide (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 41:
His His His His (2) INFORMATION FOR SEQ ID NO: 42:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 8 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) MOLECULE TYPE: peptide (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 42:
Ser Ser Asp Tyr Lys Asp Glu Leu ... . .
(2) INFORMATION FOR--SEQ ID NO: 43:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 5 amino acids (B) TYPE: amino acid ~ -(D) TOPOLOGY: linear W O96113599 PCT~EP95/04270 (ii) MOLECULE TYPE: peptide (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 43:
Gly Gly Gly Gly Ser (2) INFORMATION FOR SEQ ID NO: 44:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 17 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 44:

(2) INFORMATION FOR SEQ ID NO: 45:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 4 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) MOLECULE TYPE: peptide (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 45:
Lys Asp Glu Leu (2) INFORMATION FOR SEQ ID NO: 46:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 5 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) MOLECULE TYPE: peptide ~ . .

(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 46:
Arg Glu Asp Leu Lys WO96113599 PCT/~ 0~270 (2) INFORM~TION FOR SEQ ID NO: 47:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 4 amino acids (B) TYPE: amino acid (D) TOPOLOGY: l;ne~ r (ii) MOLECULE TYPE: peptide (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 47:
His Asp Glu Leu (2) INFORMATION FOR SEQ ID NO: 48:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 2l amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) MOLECULE TYPE: peptide (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 48:

Met Lys Lys Thr Ala Ile Ala Ile Ala Val Ala Leu Ala Gly Phe Ala l 5 l0 15 Thr Val Ala Gln Ala (2) INFORMATION FOR SEQ ID NO: 49:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 15 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) MOLECULE TYPE: peptide (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 49:
Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser l 5 l0 15 (2) INFORMATION FOR SEQ ID NO: 50:

. .

,_. .

WO96/13599 PCT~P95/04270 (i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 15 base pairs (B) TYPE: nucleic acid (C) STR~NDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 50:
CGCTAGCTGG TGGTG l5 (2) INFORMATION FOR SEQ ID NO: 5l:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 23 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 51:

(2) INFORMATION FOR SEQ ID NO: 52:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 24 base pairs - -(B) TYPE: nucleic acid (C) STR~NDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 52:

(2) INFORMATION FOR SEQ ID NO: 53:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 28 base pairs (B) TYPE: nucleic acid - --- ~ (C) STR~NDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) WO96/13599 PCT~P95/04270 (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 53:

(2) INFORMATION FOR SEQ ID NO: 54:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 53 base pairs (B) TYPE: nucleic acid (C) STR~NDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 54:

(2) INFORMATION FOR SEQ ID NO: 55:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 55 base pairs (B) TYPE: nucleic acid (C) STR~NDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) _ (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 55:

-

Claims (19)

Claims

1. A multidomain protein comprising, as functional domains, a target cell-specific binding domain, a translocation domain and a nucleic acid binding domain, characterized in that the translocation domain is derivable from diphtheria toxin and does not include that part of said toxin molecule which confers to the cytotoxic effect of the molecule.

2. A multidomain protein comprising, as functional domains, a target cell-specific binding domain, a translocation domain and a nucleic acid binding domain, characterized in that the translocation domain is derivable from bacterial toxins and the target cell-specific binding domain which recognizes a cell surface receptor selected from the group of the EGF receptor-related family of growth factor receptors.

3. A multidomain protein comprising, as functional domains, a target cell-specific binding domain, a translocation domain and a nucleic acid binding domain, characterized in that the translocation domain is derivable from a bacterial toxin and the targetcell-specific binding domain recognizes a cell surface receptor on the effector cells of the immune system.

4. A multidomain protein according to claims 1 to 3, characterized in that thetranslocation domain is derivable from that part of said toxin which mediates internalization of the toxin into the cell.

5. A multidomain protein according to claims 1 to 4, characterized in that thetranslocation domain is derivable from amino acids 193-378 or 196-384 of diphtheria toxin.

6. A multidomain protein according to claims 1 to 5, characterized in that the target cell-specific binding domain is a single chain antigen binding domain of an antibody.

7. A multidomain protein according to claim 1 comprising as functional domains a target-cell specific binding domain a transloction domain, a nucleic acid binding domain and, optionally, an endoplasmic reticulum retention signal and a nuclear localisation signal, particularly a protein selected from the group consisting of a protein having the amino acid sequence set forth in SEQ ID NO. 2, SEQ ID NO. 4, SEQ ID NO. 6, SEQ ID
NO:35, SEQ ID NO:37 or SEQ ID NO: 39.

8. A nucleic acid encoding a protein according to claims 1 to 7.

9. A vector comprising a nucleic acid according to claim 8.

10. A protein/nucleic acid complex comprising a multidomain protein according to claims 1 to 7 and an effector nucleic acid to be delivered to a target cell.

11. Use of a complex according to claim 10 for the delivery of a desired nucleic acid to a target cell.

12. A nucleic acid delivery system comprising the complex according to claim 10.

13. Composition for the transfection of eukaryotic cells comprising the complex according to claim 10.

14. Pharmaceutical composition comprising a complex according to claim 10.

15. A complex according to claim 10 for use in the therapeutical or prophylactical treatment of a mammal.

16. Use of a complex according to claim 10 for the preparation of a pharmaceutical composition for the therapeutical or prophylactical treatment of a mammal.

17. A transfection kit comprising a protein according to claims 1 to 7 and an effector nucleic acid to be delivered to a target cell.

18. A method for the delivery of a nucleic acid into a target cell, particularly a higher eukaryotic cell, said method comprising exposing the cells to the complex according to claim 10.

19. A host cell containing a nucleic acid according to claim 8.