CA2201871C - An enzyme and enzyme preparation with endoglucanase activity - Google Patents
An enzyme and enzyme preparation with endoglucanase activity Download PDFInfo
- Publication number
- CA2201871C CA2201871C CA 2201871 CA2201871A CA2201871C CA 2201871 C CA2201871 C CA 2201871C CA 2201871 CA2201871 CA 2201871 CA 2201871 A CA2201871 A CA 2201871A CA 2201871 C CA2201871 C CA 2201871C
- Authority
- CA
- Canada
- Prior art keywords
- enzyme
- dna sequence
- dsm
- acremonium
- seq
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Classifications
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02W—CLIMATE CHANGE MITIGATION TECHNOLOGIES RELATED TO WASTEWATER TREATMENT OR WASTE MANAGEMENT
- Y02W30/00—Technologies for solid waste management
- Y02W30/50—Reuse, recycling or recovery technologies
- Y02W30/64—Paper recycling
Landscapes
- Enzymes And Modification Thereof (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Paper (AREA)
Abstract
An enzyme composition with substantial cellulolytic, especially endoglucanase, activity at alkaline conditions which is derived from or producible by fungi from the genus Acremonium, provided that the enzyme composition is not immunologically cross-reactive with antibodies raised against endoglucanases (EC 3.2.1.4) from Humicola insolens, DSM 1800, Fusarium oxysporum, DSM 2672, Myceliophthora thermophila, CBS 117.65, or Cephalosporium sp., RYM-202. The invention further relates to a DNA construct comprising a DNA sequence encoding an enzyme exhibiting endoglucanase activity. The enzyme composition and the isolated or cloned and expressed cellulase of the invention may be useful in any industrial process requiring an alkaline cellulase, e.g. for providing localised variation in the colour density of dyed fabric such as stone-washing of denim, for improving the drainage of an aqueous suspension of paper pulp, for the de-inking of recycled paper, in detergent compositions and in fabric softeners.
Description
'i WO 96/11262 PCT/DK95/00400 AN ENZYME AND ENZYME PREPARATION WITH ENDOGLUCANASE ACTIVITY
The present invention relates to an enzyme composition, an isolated enzyme with cellulolytic (endoglucanase) activity at alkaline conditions, a DNA construct encoding the enzyme, a method of producing the enzyme or enzyme composition, a detergent composition comprising the enzyme or the composi-tion, and use of the enzyme e.g. in the detergent industry, the textile industry and the paper pulp industry.
BACKGROUND OF THE INVENTION
Endoglucanases (EC No. 3.2.1.4) constitute a group of hydrolases, which catalyse endo hydrolysis of 1,4-~i-D-glycosidic linkages in cellulose, cellulose derivatives (such as carboxy methyl cellulose and hydroxy ethyl cellulose), lichenin, (3-1,4 bonds in mixed ~3-1,3 glucans such as cereal i(i-D-glucans or xyloglucans and other plant material contain-ing cellulosic parts. The authorized name is endo-1,4-(3-D-glucan 4-glucano hydrolase, but the abbreviated term endoglucanase is used in the present specification. Reference can be made to T.-M. Enveri, '°Microbial Cellulases" in W.M.
Fogarty, Microbial Enzymes and Biotechnology, Applied Science Publishers, p. 183-224 (1983); Methods in Enzymology, (1988) Vol. 160, p. 200-391 (edited by Wood, W.A. and Kellogg, S.T.); Beguin, P., "Molecular Biology of Cellulose Degrada-tion", Annu. Rev. Microbiol. (1990)., Vol. 44, pp. 219-248;
Beguin, P. and Aubert, J-P., "The biological degradation of cellulose", FEMS Microbiology Reviews 13 (1994) p.25-58;
Henrissat, B., "Cellulases and their interaction with cellu-lose", Cellulose (1994), Vol. 1, pp. 169-196. Celluloses are found in connection with many gums and they are components of cell walls in e.g. fruits, vegetables and cereals.
Endoglucanases have been found to be produced by various ' 2 types of organisms such as plants and microorganisms, and endoglucanases of a wide variety of specificities have been identified .
Fungal endoglucanases have been described by Sheppard, P.O., et al., "The use of conserved cellulase family-specific sequences to clone Cellulase homologue cDNAs from Fusarium oxysporum, Gene, (1994), Vol. 15, pp. 163-167, Saloheimo, A., et al., "A novel, small endoglucanase gene, egl5, from Trichoderma reesei isolated by expression in yeast", Molecu-lar Microbiology (1994), Vol. 13(2), pp. 219-228; van Arsdell, J.N. et al, (1987), Cloning, characterization, and expression in Saccharomyces cerevisiae of endoglucanase I
from Trichoderma reesei, Bio/Technology 5: 60-64; Penttila, M. et al., (1986), '°Homology between cellulase genes of Trichoderma reesei: complete nucleotide sequence of the endoglucanase I gene", Gene 45:253-263; Saloheimo, M. et al, (1988), "EGIII, a new endoglucanase from Trichoderma reesei:
the characterization of both gene and enzyme", Gene 63:11-21;
Gonz~les, R., et al., "Cloning, sequence analysis and yeast expression of the egll gene from Trichoderma longibrachia-tum", Appl. Microbiol. Biotechnol., (1992), Vol. 38, pp. 370-375; Ooi, T. et al. "Cloning and sequence analysis of a cDNA
for cellulase (FI-CMCase) from Aspergillus aculeatus", Curr.
Genet., (1990), Vol. 18, pp. 217-222; Ooi, T. et al, "Com-plete nucleotide sequence of a gene coding for Asper-gillus aculeatus cellulase (FI-CMCase)", Nucleic Acids Research, (1990), Vol. 18, No. 19, p. 5884; Xue, G. et al., "Cloning and expression of multiple cellulase cDNAs from the anaerobic rumen fungus Neocallimastix patriciarum in E. coli°', J. Gen.
Microbiol., (1992), Vol. 138, pp. 1413-1420; Xue, G. et al., .
"A novel polysaccharide hydrolase cDNA (celD) from Neocallimastix patriciarum encoding three multi-functional catalytical domains with high endoglucanase, cellobio-hydrolase and xylanase activities", J. Gen. Microbiol., (1992), Vol. 138, pp. 2397-2403; Zhou, L. et al., "Intronless celB from the anaerobic fungus Neocallimastix patriciarum WD 96111262 ~ ~ ~ '~ PC~'/DK95I00400 encodes a modular family A endoglucanase", Biochem. J., (1994), Vol. 297, pp. 359-364; Dalb~sge, H. and Heldt-Hansen, H.P., "A novel method for efficient expression cloning of fungal enzyme genes", Mol. Gen. Genet., (1994), Vol. 243, pp.
253-260; Ali, B.R.S. et al., "Cellulases and hemicellulases of the anaerobic fungus Piromyces constitute a multiprotein cellulose-binding complex and are encoded by multigene fam-ilies", FEMS Microbiol. Lett., (1995), Vol. 125, No. 1, pp.
15-21.
WO 91/17243 (Novo Nordisk A/S) discloses a cellulase prepara-tion consisting of a homogenous endoglucanase component immunoreactive with an antibody raised against a highly purified 43 kDa endoglucanase derived from Humicola insolens, DSM 1800.
The present invention relates to an enzyme composition, an isolated enzyme with cellulolytic (endoglucanase) activity at alkaline conditions, a DNA construct encoding the enzyme, a method of producing the enzyme or enzyme composition, a detergent composition comprising the enzyme or the composi-tion, and use of the enzyme e.g. in the detergent industry, the textile industry and the paper pulp industry.
BACKGROUND OF THE INVENTION
Endoglucanases (EC No. 3.2.1.4) constitute a group of hydrolases, which catalyse endo hydrolysis of 1,4-~i-D-glycosidic linkages in cellulose, cellulose derivatives (such as carboxy methyl cellulose and hydroxy ethyl cellulose), lichenin, (3-1,4 bonds in mixed ~3-1,3 glucans such as cereal i(i-D-glucans or xyloglucans and other plant material contain-ing cellulosic parts. The authorized name is endo-1,4-(3-D-glucan 4-glucano hydrolase, but the abbreviated term endoglucanase is used in the present specification. Reference can be made to T.-M. Enveri, '°Microbial Cellulases" in W.M.
Fogarty, Microbial Enzymes and Biotechnology, Applied Science Publishers, p. 183-224 (1983); Methods in Enzymology, (1988) Vol. 160, p. 200-391 (edited by Wood, W.A. and Kellogg, S.T.); Beguin, P., "Molecular Biology of Cellulose Degrada-tion", Annu. Rev. Microbiol. (1990)., Vol. 44, pp. 219-248;
Beguin, P. and Aubert, J-P., "The biological degradation of cellulose", FEMS Microbiology Reviews 13 (1994) p.25-58;
Henrissat, B., "Cellulases and their interaction with cellu-lose", Cellulose (1994), Vol. 1, pp. 169-196. Celluloses are found in connection with many gums and they are components of cell walls in e.g. fruits, vegetables and cereals.
Endoglucanases have been found to be produced by various ' 2 types of organisms such as plants and microorganisms, and endoglucanases of a wide variety of specificities have been identified .
Fungal endoglucanases have been described by Sheppard, P.O., et al., "The use of conserved cellulase family-specific sequences to clone Cellulase homologue cDNAs from Fusarium oxysporum, Gene, (1994), Vol. 15, pp. 163-167, Saloheimo, A., et al., "A novel, small endoglucanase gene, egl5, from Trichoderma reesei isolated by expression in yeast", Molecu-lar Microbiology (1994), Vol. 13(2), pp. 219-228; van Arsdell, J.N. et al, (1987), Cloning, characterization, and expression in Saccharomyces cerevisiae of endoglucanase I
from Trichoderma reesei, Bio/Technology 5: 60-64; Penttila, M. et al., (1986), '°Homology between cellulase genes of Trichoderma reesei: complete nucleotide sequence of the endoglucanase I gene", Gene 45:253-263; Saloheimo, M. et al, (1988), "EGIII, a new endoglucanase from Trichoderma reesei:
the characterization of both gene and enzyme", Gene 63:11-21;
Gonz~les, R., et al., "Cloning, sequence analysis and yeast expression of the egll gene from Trichoderma longibrachia-tum", Appl. Microbiol. Biotechnol., (1992), Vol. 38, pp. 370-375; Ooi, T. et al. "Cloning and sequence analysis of a cDNA
for cellulase (FI-CMCase) from Aspergillus aculeatus", Curr.
Genet., (1990), Vol. 18, pp. 217-222; Ooi, T. et al, "Com-plete nucleotide sequence of a gene coding for Asper-gillus aculeatus cellulase (FI-CMCase)", Nucleic Acids Research, (1990), Vol. 18, No. 19, p. 5884; Xue, G. et al., "Cloning and expression of multiple cellulase cDNAs from the anaerobic rumen fungus Neocallimastix patriciarum in E. coli°', J. Gen.
Microbiol., (1992), Vol. 138, pp. 1413-1420; Xue, G. et al., .
"A novel polysaccharide hydrolase cDNA (celD) from Neocallimastix patriciarum encoding three multi-functional catalytical domains with high endoglucanase, cellobio-hydrolase and xylanase activities", J. Gen. Microbiol., (1992), Vol. 138, pp. 2397-2403; Zhou, L. et al., "Intronless celB from the anaerobic fungus Neocallimastix patriciarum WD 96111262 ~ ~ ~ '~ PC~'/DK95I00400 encodes a modular family A endoglucanase", Biochem. J., (1994), Vol. 297, pp. 359-364; Dalb~sge, H. and Heldt-Hansen, H.P., "A novel method for efficient expression cloning of fungal enzyme genes", Mol. Gen. Genet., (1994), Vol. 243, pp.
253-260; Ali, B.R.S. et al., "Cellulases and hemicellulases of the anaerobic fungus Piromyces constitute a multiprotein cellulose-binding complex and are encoded by multigene fam-ilies", FEMS Microbiol. Lett., (1995), Vol. 125, No. 1, pp.
15-21.
WO 91/17243 (Novo Nordisk A/S) discloses a cellulase prepara-tion consisting of a homogenous endoglucanase component immunoreactive with an antibody raised against a highly purified 43 kDa endoglucanase derived from Humicola insolens, DSM 1800.
4 (Novo Nordisk A/S) discloses a new (hemi)-cellu-lose degrading enzyme, such as an endoglucanase, a cellobiohydrolase or a ~3-glucosidase, which may be derived from fungi other that Trichoderma and Phanerochaete.
WO 93/20193 discloses an endoglucanase derivable from Aspergillus aculeatus.
WO 94/00578 (Commonwealth Scientific and Industrial Research Organisation) describes a method for cloning a cellulase with the activity of anaerobic rumen fungi, which includes Neocallimastix patriciarum.
WO 94/14953 (Novo Nordisk A/S) describes a fungal endoglucan-ase for degrading or modifying plant cell wall components, e.g. for producing wine or juice etc. The endoglucanase may be derived from Aspergillus aculeatus, CBS 101.43.
WO 94/21801 (Genencor Inc.) concerns a cellulase system isolated from Trichoderma longibranchiatum exhibiting en doglucanase activity.
WO 96!11262 WO 94/26880 (Gist Brocades N.V.) discloses an isolated mix-ture of cellulose degrading enzymes, which preferable are obtained from Trichoderma, Aspergillus or Disporotrichum, comprising endoglucanase, cellobiohydrolase, and xyloglu-canase activity.
WO 95/02043 (Novo Nordisk A/S) describes an enzyme with endoglucanase activity derived from Trichoderma harzianum, which can be used for a number of purposes including e.g.
degradation or modification of plant cell walls.
Kang, M.G., Park, H.M., Kim, Y.S, Lee, J.R., Kim, Y.K., Lee, Y.H.: Abstract from 94th General Meeting, American Society Microbiology, K-112, 1994, discloses the strain Cephalo-sporium sp., RYM-202, and the purification of 3 cellulases (EC 3.2.1.4, P-I, P-II, P-III) having optimum pH values in the alkaline range.
In Peberdy, J.F., (1987), is disclosed that Cephalosporium species are generally speaking now renamed Acremonium with some exceptions.
Endoglucanases are widely used industrially, e.g. within the detergent industry, in the textile industry, in paper pulp processing and in the food and feed industry.
There is an ever existing need for providing novel en-doglucanases, preferably in single-component or mono-compo-nent form, which may be used for applications where a single or dominating endoglucanase activity is desirable.
The object of the present invention is to provide novel enzymes having substantial cellulolytic activity at alkaline , conditions and improved performance in paper pulp processing, textile treatment, laundry processes and/or in animal feed;
preferably novel mono-component cellulases, more preferably mono-component endoglucanases, which may be produced by WO 96/11262 ~ ~ ~ ~ ~ ~ PCT/DK95l00400 recombinant techniques.
SUMMARY OF THE INVENTION
It has now surprisingly been found that an enzyme composition exhibiting high cellulolytic (endoglucanase) activity at 5 alkaline conditions, i.e. a cellulase enzyme, is producible by or derivable from fungi of the genus Acremonium which fungi are not immunologically cross-reactive with antibodies raised against Humicola insolens, DSM 1800, Fusarium -oxysporum, DSM 2672, Myceliopthora thermophile, CBS 117.65, l0 and Cephalosporium sp., RYM-202.
Since the fungal organisms belonging to Acremonium (or Cephalosporium) are generalluy known as capable of producing antibiotics, the cellulase should preferably be produced by recombinant techniques, i.e. should be cloned and expressed.
Thus, more specifically, the present invention relates to novel cellulases which are derivable from or producible by fungi selected from the group of strains consisting of Acremonium sp., Cephalosporium sp., Acremonium acremonium, Acremonium persicinum, Acremonium brachypenium, Acremonium dichromosporum, Acremonium obclavatum, Acremonium pin-kertoniae, Acremonium roseogriseum, Acremonium incoloratum, and Acremonium furatum, especially Acremonium sp., CBS
478.94, Acremonium sp., CBS 265.95, Acremonium persicinum, CBS 169.65, Acremonium acremonium,~AHU 9519, Cephalosporium sp., CBS 535.71, Acremonium brachypenium, CBS 866.73, Acremonium dichromosporum, CBS 683.73, Acremonium obclavatum, CBS 311.74, Acremonium pinkertoniae, CBS 157.70, Acremonium roseogriseum, CBS 134.56, Acremonium incoloratum, CBS 146.62, and Acremonium furatum, CBS 299.70H.
Further, the present invention relates to a DNA construct comprising a DNA sequence encoding an enzyme exhibiting WO 96111262 ' PCT/DK95/00400 endoglucanase activity, which DNA seguence comprises the N-terminal DNA sequence shown in SEQ ID No. 1 and the C-termi-nal DNA sequence shown in SEQ ID No. 2, and/or the DNA sequ-ence obtainable from the plasmid in Saccharomyces cerevisiee DSM 10076, or an analogue thereof; or which DNA sequence comprises the DNA sequence shown in SEQ ID No. 3, and/or the DNA sequence obtainable from the plasmid in Saccharomyces cerevisiae DSM 9969, or an analogue thereof; or which DNA
sequence comprises the DNA sequence shown in SEQ ID No. 4, and/or the DNA sequence obtainable from the plasmid in Sac-charomyces cerevisiae DSM 9977, or an analogue thereof; or which DNA sequence comprises the DNA sequence shown in SEQ ID
No. 5, and/or the DNA sequence obtainable from the plasmid in Saccharomyces cerevisise DSM 10077, or an analogue thereof;
or Which DNA sequence comprises the DNA sequence shown in SEQ
ID No. 6, and/or the DNA~sequence obtainable from the plasmid in Saccharomyces cerevisiae DSM 10079, or an analogue there-of; or which DNA sequence comprises the N-terminal (partial) DNA sequence shown in SEQ ID No. 7, and/or the DNA sequence obtainable from the plasmid in Saccharomyces cerevisiae DSM
10084, or an analogue thereof. The DNA sequences obtainable from the plasmid(s) in DSM 10076 and DSM 9969 have Acremonium sp., DSM 265.95, as the donor organism. The DNA sequences obtainable from the plasmid(s) in DSM 9977, DSM 10077, DSM
10079 and DSM 10084 have Acremonium sp., DSM178,94, as the donor organism.
The enzyme composition and the isolated or cloned and expressed cellulase of the invention may be useful in any industrial process requiring an alkaline cellulase, e.g. for providing localised variation in the colour density of dyed fabric such as stone-washing of denim, for improving the drainage of an aqueous suspension of paper pulp, for the de-inking of recycled paper, in detergent compositions and in fabric softeners.
WO 96/11262 ~ ~ ~ ~ PCTIDK95/00400 7.
DETAILED DESCRIPTION OF THE INVENTION
f In the primary screening of fungal sources which may be capable of producing an enzyme with substantial cellulytic activity at alkaline conditions, the screening for fungal sources (obtained e.g. from soil) may be carried out by soil dilution, direct inoculation by soil dust, small particles or plant roots on solid Chapek and Hetchinson media, and the species may be identified by inoculation of isolated culture on a conventional solid medium in petri dishes. Then, the presence of cellulolytic activity may be qualitatively esti-mated by visual observation of fungal growth on filter paper or formation of clear zones on solid media containing amor-phous cellulose. Further, the presence of cellulase activity under alkaline conditions may be estimated by 7-10 days of cultivation on agar-amorphous acid swollen cellulose at 28°C, installation of block into agar HEC-LAS (linear alkylbenzene sulphonate, concentration 0.12-0.24%) at pH 9-10.6 and incu-bation at 40°C for ~-2 days, and visual detection of cellulolytic activity by observing a white clearing zone in the blue stained HES (1% AZCL-HEC solution obtained from Megazyme, Australia).
In a preferred embodiment, the present invention relates to an enzyme composition which is derived from or producible by fungi selected from the genus Acremonium. More preferred, the invention relates to an enzyme composition having endoglucanase activity which is derived from or producible by fungi selected from the group consisting of the species Acremonium sp., Acremonium persicinum, Acremonium brachypenium, Acremonium dichromosporum, Acremonium obclavatum, Acremonium pinkertoniae, Acremonium roseogriseum, Acremonium incoloratum, and Acremonium furatum. Examples of useful strains are Acremonium sp., CBS 478.94, Acremonium sp., CBS 265.95, Acremonium persicinum, CBS 169.65, Acremonium acremonium, AHU 9519, Cephalosporium sp., CBS
535.71, Acremonium brachypenium, CBS 866.73, Acremonium WO 96/11262 ~ ~ ~ _~, PCTlDK95/00400 dichromosporum, CBS 683.73, Acremonium obclavatum, CBS
311.74, Acremonium pinkertoniae, CBS 157.70, Acremonium roseogriseum, CBS 134.56, Acremonium incoloratum, CBS 146.62, and Acremonium furatum, CBS 299.70H.
The strains Acremonium persicinum, CBS 169.65, Acremonium acremonium, AHU 9519, Acremonium brachypenium, CBS 866.73, Acremonium dichromosporum, CBS 683.73, Acremonium obclavatum, CBS 311.74, Acremonium pinkertoniae, CBS 157.70, Acremonium roseogriseum, CBS 134.56, Acremonium incoloratum, CBS 146.62, and Acremonium furatum, CBS 299.70H and Cephalosporium sp., CBS 535.71, are all believed to be commercially available strains which were published in the catalogue of the relevant depositary institution at the priority date of this patent application.
The strain which was deposited on 28 September 1994 at Centraalbureau voor Schimmelcultures under number CBS 478.94 in accordance with the provisions of the Budapest Treaty belongs to Acremonium sp. The culture is characterized by a hyaline mycelium and the formation of individually occurring erect and slender phialides, from which hyaline conidia are produced. The phialides are delimited by a distinct basal septum. The conidia are ellipsoid (0.5-1) x (1-2) ~Cm. These observations are based on a culture grown on YPG-agar.
The strain which was deposited on 7 April 1995 at Centraalbureau voor Schimmelcultures under number CBS 265.95 in accordance with the provisions of the Budapest Treaty belongs to Acremonium sp.
The enzyme In the present context, the term "cellulolytic activity"
refers to the ability of the enzyme to degrade cellulose to glucose, cellobiose, triose and other cello-oligosaccharides.
WO 96/11262 ~ ~ ~ PCT/DK95J00400 This ability may be determined by the formation of clearing zones in a carboxymethyl cellulose (CMC) gel under the condi-tions specified below.
In the present context the term "enzyme" is understood to include a mature protein or a precursor form thereof as well to a functional fragment thereof which essentially has the activity of the full-length enzyme. Furthermore, the term "enzyme" is intended to include homologues of said enzyme.
Such homologues comprise an amino acid sequence exhibiting a degree of identity of at least 60% with the amino acid sequence of the parent enzyme, i.e. the parent cellulase. The degree of identity may be determined by conventional methods, see for instance, Altshul et al., Bull. Math. Bio. 48: 603-616, 1986, and Henikoff and Henikoff, Proc. Natl. Acad. Sci.
USA 89: 10915-10919, 1992. Briefly, two amino acid sequences are aligned to optimize the alignment scores using a gap opening penalty of l0, a gap extension penalty of 1, and the "blosum 62" scoring matrix of Henikoff and Henikoff, supra.
Alternatively, the homologue of the enzyme may be one encoded by a nucleotide sequence hybridizing with an oligonucleotide probe prepared on the basis of the nucleotide sequence or an amino acid sequence under the following conditions:
presoaking in 5 X SSC and prehydbridizing for 1 hr. at about 40'C in a solution of 20% formamide, 5 X Denhardt's solution, 50 mM sodium phosphate, pH 6.8, and 50 ~Cg denatured sonicated calf thymus DNA, followed by hybridization in the same sol-ution supplemented with 100 uM ATP~for 18 hrs. at about 40'C, followed by a wash in 0.4 X SSC at a temperature of about 45'C.
Molecules to which the oligonucleotide probe hybridizes under these conditions are detected using standard detection pro cedures (e. g. Southern blotting).
Homologues of the present enzyme may have one or more amino WO 96/11262 ~ PCT/DK95/00400 acid substitutions, deletions or additions. These changes are preferably of a minor nature, that is conservative amino acid substitutions that do not significantly affect the folding or activity of the protein, small deletions, typically of one to 5 about 30 amino acids; small amino- or carboxyl-terminal extensions, such as an amino-terminal methionine residue, a small linker peptide of up to about 20-25 residues, or a small extension that facilitates purification, such as a poly-histidine tract, an antigenic epitope or a binding 10 domain. See in general Ford et al. , Protein Expression and Purification 2: 95-107, 1991. Examples of conservative sub-stitutions are within the group of basic amino acids (such as arginine, lysine, histidine), acidic amino acids (such as glutamic acid and aspartic acid), polar amino acids (such as glutamine and asparagine), hydrophobic amino acids (such as leucine, isoleucine, valine), aromatic amino acids (such as phenylalanine, tryptophan, tyrosine) and small amino acids (such as glycine, alanine, serine, threonine, methionine).
It will be apparent to persons skilled in the art that such substitutions can be made outside the regions critical to the function of the molecule and still result in an active enzyme. Amino acids essential to the activity of the enzyme of the invention, and therefore preferably not subject to substitution, may be identified according to procedures known in the art, such as site-directed mutagenesis or alanine-scanning mutagenesis (Cunningham and Wells, Science 244, 1081-1085, 1989). In the latter technique mutations are introduced at every residue in the~molecule, and the result-ant mutant molecules are tested for cellulolytic activity to identify amino acid residues that are critical to the activ- , ity of the molecule. Sites of ligand-receptor interaction can also be determined by analysis of crystal structure as deter- .
mined by such techniques as nuclear magnetic resonance, crystallography or photoaffinity labelling. See, for example, de Vos et al., Science 255: 306-312, 1992; Smith et al., J.
yiol. Biol. 224: 899-904, 1992; Wlodaver et al., FEBS Lett.
WO 93/20193 discloses an endoglucanase derivable from Aspergillus aculeatus.
WO 94/00578 (Commonwealth Scientific and Industrial Research Organisation) describes a method for cloning a cellulase with the activity of anaerobic rumen fungi, which includes Neocallimastix patriciarum.
WO 94/14953 (Novo Nordisk A/S) describes a fungal endoglucan-ase for degrading or modifying plant cell wall components, e.g. for producing wine or juice etc. The endoglucanase may be derived from Aspergillus aculeatus, CBS 101.43.
WO 94/21801 (Genencor Inc.) concerns a cellulase system isolated from Trichoderma longibranchiatum exhibiting en doglucanase activity.
WO 96!11262 WO 94/26880 (Gist Brocades N.V.) discloses an isolated mix-ture of cellulose degrading enzymes, which preferable are obtained from Trichoderma, Aspergillus or Disporotrichum, comprising endoglucanase, cellobiohydrolase, and xyloglu-canase activity.
WO 95/02043 (Novo Nordisk A/S) describes an enzyme with endoglucanase activity derived from Trichoderma harzianum, which can be used for a number of purposes including e.g.
degradation or modification of plant cell walls.
Kang, M.G., Park, H.M., Kim, Y.S, Lee, J.R., Kim, Y.K., Lee, Y.H.: Abstract from 94th General Meeting, American Society Microbiology, K-112, 1994, discloses the strain Cephalo-sporium sp., RYM-202, and the purification of 3 cellulases (EC 3.2.1.4, P-I, P-II, P-III) having optimum pH values in the alkaline range.
In Peberdy, J.F., (1987), is disclosed that Cephalosporium species are generally speaking now renamed Acremonium with some exceptions.
Endoglucanases are widely used industrially, e.g. within the detergent industry, in the textile industry, in paper pulp processing and in the food and feed industry.
There is an ever existing need for providing novel en-doglucanases, preferably in single-component or mono-compo-nent form, which may be used for applications where a single or dominating endoglucanase activity is desirable.
The object of the present invention is to provide novel enzymes having substantial cellulolytic activity at alkaline , conditions and improved performance in paper pulp processing, textile treatment, laundry processes and/or in animal feed;
preferably novel mono-component cellulases, more preferably mono-component endoglucanases, which may be produced by WO 96/11262 ~ ~ ~ ~ ~ ~ PCT/DK95l00400 recombinant techniques.
SUMMARY OF THE INVENTION
It has now surprisingly been found that an enzyme composition exhibiting high cellulolytic (endoglucanase) activity at 5 alkaline conditions, i.e. a cellulase enzyme, is producible by or derivable from fungi of the genus Acremonium which fungi are not immunologically cross-reactive with antibodies raised against Humicola insolens, DSM 1800, Fusarium -oxysporum, DSM 2672, Myceliopthora thermophile, CBS 117.65, l0 and Cephalosporium sp., RYM-202.
Since the fungal organisms belonging to Acremonium (or Cephalosporium) are generalluy known as capable of producing antibiotics, the cellulase should preferably be produced by recombinant techniques, i.e. should be cloned and expressed.
Thus, more specifically, the present invention relates to novel cellulases which are derivable from or producible by fungi selected from the group of strains consisting of Acremonium sp., Cephalosporium sp., Acremonium acremonium, Acremonium persicinum, Acremonium brachypenium, Acremonium dichromosporum, Acremonium obclavatum, Acremonium pin-kertoniae, Acremonium roseogriseum, Acremonium incoloratum, and Acremonium furatum, especially Acremonium sp., CBS
478.94, Acremonium sp., CBS 265.95, Acremonium persicinum, CBS 169.65, Acremonium acremonium,~AHU 9519, Cephalosporium sp., CBS 535.71, Acremonium brachypenium, CBS 866.73, Acremonium dichromosporum, CBS 683.73, Acremonium obclavatum, CBS 311.74, Acremonium pinkertoniae, CBS 157.70, Acremonium roseogriseum, CBS 134.56, Acremonium incoloratum, CBS 146.62, and Acremonium furatum, CBS 299.70H.
Further, the present invention relates to a DNA construct comprising a DNA sequence encoding an enzyme exhibiting WO 96111262 ' PCT/DK95/00400 endoglucanase activity, which DNA seguence comprises the N-terminal DNA sequence shown in SEQ ID No. 1 and the C-termi-nal DNA sequence shown in SEQ ID No. 2, and/or the DNA sequ-ence obtainable from the plasmid in Saccharomyces cerevisiee DSM 10076, or an analogue thereof; or which DNA sequence comprises the DNA sequence shown in SEQ ID No. 3, and/or the DNA sequence obtainable from the plasmid in Saccharomyces cerevisiae DSM 9969, or an analogue thereof; or which DNA
sequence comprises the DNA sequence shown in SEQ ID No. 4, and/or the DNA sequence obtainable from the plasmid in Sac-charomyces cerevisiae DSM 9977, or an analogue thereof; or which DNA sequence comprises the DNA sequence shown in SEQ ID
No. 5, and/or the DNA sequence obtainable from the plasmid in Saccharomyces cerevisise DSM 10077, or an analogue thereof;
or Which DNA sequence comprises the DNA sequence shown in SEQ
ID No. 6, and/or the DNA~sequence obtainable from the plasmid in Saccharomyces cerevisiae DSM 10079, or an analogue there-of; or which DNA sequence comprises the N-terminal (partial) DNA sequence shown in SEQ ID No. 7, and/or the DNA sequence obtainable from the plasmid in Saccharomyces cerevisiae DSM
10084, or an analogue thereof. The DNA sequences obtainable from the plasmid(s) in DSM 10076 and DSM 9969 have Acremonium sp., DSM 265.95, as the donor organism. The DNA sequences obtainable from the plasmid(s) in DSM 9977, DSM 10077, DSM
10079 and DSM 10084 have Acremonium sp., DSM178,94, as the donor organism.
The enzyme composition and the isolated or cloned and expressed cellulase of the invention may be useful in any industrial process requiring an alkaline cellulase, e.g. for providing localised variation in the colour density of dyed fabric such as stone-washing of denim, for improving the drainage of an aqueous suspension of paper pulp, for the de-inking of recycled paper, in detergent compositions and in fabric softeners.
WO 96/11262 ~ ~ ~ ~ PCTIDK95/00400 7.
DETAILED DESCRIPTION OF THE INVENTION
f In the primary screening of fungal sources which may be capable of producing an enzyme with substantial cellulytic activity at alkaline conditions, the screening for fungal sources (obtained e.g. from soil) may be carried out by soil dilution, direct inoculation by soil dust, small particles or plant roots on solid Chapek and Hetchinson media, and the species may be identified by inoculation of isolated culture on a conventional solid medium in petri dishes. Then, the presence of cellulolytic activity may be qualitatively esti-mated by visual observation of fungal growth on filter paper or formation of clear zones on solid media containing amor-phous cellulose. Further, the presence of cellulase activity under alkaline conditions may be estimated by 7-10 days of cultivation on agar-amorphous acid swollen cellulose at 28°C, installation of block into agar HEC-LAS (linear alkylbenzene sulphonate, concentration 0.12-0.24%) at pH 9-10.6 and incu-bation at 40°C for ~-2 days, and visual detection of cellulolytic activity by observing a white clearing zone in the blue stained HES (1% AZCL-HEC solution obtained from Megazyme, Australia).
In a preferred embodiment, the present invention relates to an enzyme composition which is derived from or producible by fungi selected from the genus Acremonium. More preferred, the invention relates to an enzyme composition having endoglucanase activity which is derived from or producible by fungi selected from the group consisting of the species Acremonium sp., Acremonium persicinum, Acremonium brachypenium, Acremonium dichromosporum, Acremonium obclavatum, Acremonium pinkertoniae, Acremonium roseogriseum, Acremonium incoloratum, and Acremonium furatum. Examples of useful strains are Acremonium sp., CBS 478.94, Acremonium sp., CBS 265.95, Acremonium persicinum, CBS 169.65, Acremonium acremonium, AHU 9519, Cephalosporium sp., CBS
535.71, Acremonium brachypenium, CBS 866.73, Acremonium WO 96/11262 ~ ~ ~ _~, PCTlDK95/00400 dichromosporum, CBS 683.73, Acremonium obclavatum, CBS
311.74, Acremonium pinkertoniae, CBS 157.70, Acremonium roseogriseum, CBS 134.56, Acremonium incoloratum, CBS 146.62, and Acremonium furatum, CBS 299.70H.
The strains Acremonium persicinum, CBS 169.65, Acremonium acremonium, AHU 9519, Acremonium brachypenium, CBS 866.73, Acremonium dichromosporum, CBS 683.73, Acremonium obclavatum, CBS 311.74, Acremonium pinkertoniae, CBS 157.70, Acremonium roseogriseum, CBS 134.56, Acremonium incoloratum, CBS 146.62, and Acremonium furatum, CBS 299.70H and Cephalosporium sp., CBS 535.71, are all believed to be commercially available strains which were published in the catalogue of the relevant depositary institution at the priority date of this patent application.
The strain which was deposited on 28 September 1994 at Centraalbureau voor Schimmelcultures under number CBS 478.94 in accordance with the provisions of the Budapest Treaty belongs to Acremonium sp. The culture is characterized by a hyaline mycelium and the formation of individually occurring erect and slender phialides, from which hyaline conidia are produced. The phialides are delimited by a distinct basal septum. The conidia are ellipsoid (0.5-1) x (1-2) ~Cm. These observations are based on a culture grown on YPG-agar.
The strain which was deposited on 7 April 1995 at Centraalbureau voor Schimmelcultures under number CBS 265.95 in accordance with the provisions of the Budapest Treaty belongs to Acremonium sp.
The enzyme In the present context, the term "cellulolytic activity"
refers to the ability of the enzyme to degrade cellulose to glucose, cellobiose, triose and other cello-oligosaccharides.
WO 96/11262 ~ ~ ~ PCT/DK95J00400 This ability may be determined by the formation of clearing zones in a carboxymethyl cellulose (CMC) gel under the condi-tions specified below.
In the present context the term "enzyme" is understood to include a mature protein or a precursor form thereof as well to a functional fragment thereof which essentially has the activity of the full-length enzyme. Furthermore, the term "enzyme" is intended to include homologues of said enzyme.
Such homologues comprise an amino acid sequence exhibiting a degree of identity of at least 60% with the amino acid sequence of the parent enzyme, i.e. the parent cellulase. The degree of identity may be determined by conventional methods, see for instance, Altshul et al., Bull. Math. Bio. 48: 603-616, 1986, and Henikoff and Henikoff, Proc. Natl. Acad. Sci.
USA 89: 10915-10919, 1992. Briefly, two amino acid sequences are aligned to optimize the alignment scores using a gap opening penalty of l0, a gap extension penalty of 1, and the "blosum 62" scoring matrix of Henikoff and Henikoff, supra.
Alternatively, the homologue of the enzyme may be one encoded by a nucleotide sequence hybridizing with an oligonucleotide probe prepared on the basis of the nucleotide sequence or an amino acid sequence under the following conditions:
presoaking in 5 X SSC and prehydbridizing for 1 hr. at about 40'C in a solution of 20% formamide, 5 X Denhardt's solution, 50 mM sodium phosphate, pH 6.8, and 50 ~Cg denatured sonicated calf thymus DNA, followed by hybridization in the same sol-ution supplemented with 100 uM ATP~for 18 hrs. at about 40'C, followed by a wash in 0.4 X SSC at a temperature of about 45'C.
Molecules to which the oligonucleotide probe hybridizes under these conditions are detected using standard detection pro cedures (e. g. Southern blotting).
Homologues of the present enzyme may have one or more amino WO 96/11262 ~ PCT/DK95/00400 acid substitutions, deletions or additions. These changes are preferably of a minor nature, that is conservative amino acid substitutions that do not significantly affect the folding or activity of the protein, small deletions, typically of one to 5 about 30 amino acids; small amino- or carboxyl-terminal extensions, such as an amino-terminal methionine residue, a small linker peptide of up to about 20-25 residues, or a small extension that facilitates purification, such as a poly-histidine tract, an antigenic epitope or a binding 10 domain. See in general Ford et al. , Protein Expression and Purification 2: 95-107, 1991. Examples of conservative sub-stitutions are within the group of basic amino acids (such as arginine, lysine, histidine), acidic amino acids (such as glutamic acid and aspartic acid), polar amino acids (such as glutamine and asparagine), hydrophobic amino acids (such as leucine, isoleucine, valine), aromatic amino acids (such as phenylalanine, tryptophan, tyrosine) and small amino acids (such as glycine, alanine, serine, threonine, methionine).
It will be apparent to persons skilled in the art that such substitutions can be made outside the regions critical to the function of the molecule and still result in an active enzyme. Amino acids essential to the activity of the enzyme of the invention, and therefore preferably not subject to substitution, may be identified according to procedures known in the art, such as site-directed mutagenesis or alanine-scanning mutagenesis (Cunningham and Wells, Science 244, 1081-1085, 1989). In the latter technique mutations are introduced at every residue in the~molecule, and the result-ant mutant molecules are tested for cellulolytic activity to identify amino acid residues that are critical to the activ- , ity of the molecule. Sites of ligand-receptor interaction can also be determined by analysis of crystal structure as deter- .
mined by such techniques as nuclear magnetic resonance, crystallography or photoaffinity labelling. See, for example, de Vos et al., Science 255: 306-312, 1992; Smith et al., J.
yiol. Biol. 224: 899-904, 1992; Wlodaver et al., FEBS Lett.
309: 59-64, 1992.
The homologue may be an allelic variant, i.e. an alternative form of a gene that arises through mutation, or an altered enzyme encoded by the mutated gene, but having substantially the same activity as the enzyme of the invention. Hence mutations can be silent (no change in the encoded enzyme) or may encode enzymes having altered amino acid sequence.
The homologue of the present enzyme may also be a genus or species homologue, i.e. an enzyme with a similar activity derived from another species.
A homologue of the enzyme may be isolated by preparing a genomic or cDNA library of a cell of the species in ques-tion, and screening for DNA sequences coding for all or part of the homologue by using synthetic oligonucleotide probes in accordance with standard techniques, e.g. as described by Sambrook et al., Molecular Cloninct:A Laboratory Manual, 2nd.
Ed. Cold Spring Harbor Laboratory, Cold Spring Harbor, New York, 1989, or by means of polymerase chain reaction (PCR) using specific primers as described by Sambrook et al., 2 0 supra .
The enzyme of the invention is in isolated form, i.e. pro-vided in a condition other than its native environment which is soil, possibly Mongolian soils. In a preferred form, the isolated enzyme is substantially free of other proteins, par-ticularly other enzymes of fungal origin. The enzyme of the present invention may, for instance, be isolated from fungi ~ from the genus Acremonium, provided that the enzyme is not immunologically cross-reactive with antibodies raised against - endoglucanases (EC 3.2.1.4) from Humicola insolens, DSM 1800, Fusarium oxysporum, DSM 2672, Myceliopthora thermophile, CBS
117.65, or Cephalosporium sp., RYM-202. In one embodiment, the enzyme of the present invention is obtainable from the supernatant of Acremonium sp., Acremonium persicinum, WO 96/11262 ~ ~ ~ ~ ~ ~ ~ PCT/DK95/00400 '~
The homologue may be an allelic variant, i.e. an alternative form of a gene that arises through mutation, or an altered enzyme encoded by the mutated gene, but having substantially the same activity as the enzyme of the invention. Hence mutations can be silent (no change in the encoded enzyme) or may encode enzymes having altered amino acid sequence.
The homologue of the present enzyme may also be a genus or species homologue, i.e. an enzyme with a similar activity derived from another species.
A homologue of the enzyme may be isolated by preparing a genomic or cDNA library of a cell of the species in ques-tion, and screening for DNA sequences coding for all or part of the homologue by using synthetic oligonucleotide probes in accordance with standard techniques, e.g. as described by Sambrook et al., Molecular Cloninct:A Laboratory Manual, 2nd.
Ed. Cold Spring Harbor Laboratory, Cold Spring Harbor, New York, 1989, or by means of polymerase chain reaction (PCR) using specific primers as described by Sambrook et al., 2 0 supra .
The enzyme of the invention is in isolated form, i.e. pro-vided in a condition other than its native environment which is soil, possibly Mongolian soils. In a preferred form, the isolated enzyme is substantially free of other proteins, par-ticularly other enzymes of fungal origin. The enzyme of the present invention may, for instance, be isolated from fungi ~ from the genus Acremonium, provided that the enzyme is not immunologically cross-reactive with antibodies raised against - endoglucanases (EC 3.2.1.4) from Humicola insolens, DSM 1800, Fusarium oxysporum, DSM 2672, Myceliopthora thermophile, CBS
117.65, or Cephalosporium sp., RYM-202. In one embodiment, the enzyme of the present invention is obtainable from the supernatant of Acremonium sp., Acremonium persicinum, WO 96/11262 ~ ~ ~ ~ ~ ~ ~ PCT/DK95/00400 '~
Acremonium acremonium, Cephalosporium sp., Acremonium brachypenium, Acremonium dichromosporum, Acremonium obclavatum, Acremonium pinkertoniae, Acremonium roseogriseum, Acremonium incoloratum, and Acremonium furatum. , The isolated enzyme may be characterized by e.g. SDS-PAGE and assayed using procedures known in the art. For example, the enzyme of the invention has a pH optimum above about 7, more preferably above about 8, especially above about 9.
Further, the isolated enzyme and the enzyme composition of the invention preferably have a relative activity at pH 10 of at least 50~ as compared to the activity at pH 8.5, the activity being measured in Savi U units on a suitable substrate.
Preferably, the isolated enzyme and the enzyme composition of the invention are stable in the presence of sodium linear alkylbenzene sulphonate, sodium polyoxyethylene alkyl sul-phate, sodium dodecyl sulphate, sodium a-olefin sulphonate, sodium alkyl sulphonate, and a-sulpho-fatty acid ester.
It may be preferred to provide the enzyme in a highly purified form, i.e. greater than 90~ pure, more preferably 95~ and most preferably 99°s pure, as determined by SDS-PAGE.
In a further aspect, the present invention relates to a DNA
construct comprising a DNA sequence encoding an enzyme exhi-biting endoglucanase activity, which DNA sequence comprises a) the N-terminal DNA sequence shown in SEQ ID No. 1 and the C-terminal DNA sequences shown in SEQ ID No. 2, and/or the DNA sequence obtainable from the plasmid in Saccharomyces cerevisiae DSM 10076, or b) an analogue of the N-terminal DNA sequence shown in SEQ ID
No. 1 and the C-terminal DNA sequences shown in SEQ ID No. 2 and/or the DNA sequence obtainable from the plasmid in Saccharomyces cerevisiae DSM 10076, which i) is homologous with the N-terminal DNA sequence shown in SEQ ID No. 1 and the C-terminal DNA sequences shown in SEQ ID No. 2 and/or the DNA sequence obtainable from the plasmid in Saccharomyces cerevisiae DSM 10076, or ii) hybridizes with the same oligonucleotide probe as the N-terminal DNA sequence shown in SEQ ID No. 1 and the C-terminal DNA sequences shown in SEQ ID No. 2 and/or the DNA sequence obtainable from the plasmid in Saccharomyces cerevisiae DSM 10076, or iii) encodes a polypeptide which is homologous with the polypeptide encoded by a DNA sequence comprising the N-terminal DNA sequence shown in SEQ ID No. 1 and the C-terminal DNA sequences shown in SEQ ID No. 2 and/or the DNA sequence obtainable from the plasmid in Saccharomyces cerevisiae DSM 10076, or iv) encodes a polypeptide which is immunologically reactive with an antibody raised against the purified endoglucanase encoded by the N-terminal DNA sequence shown in SEQ ID No. 1 and the C-terminal DNA sequences shown in SEQ ID No. 2 and/or obtainable from the plasmid in Saccharomyces cerevisiae, DSM 10076.
It is believed that the N-terminal~and C-terminal partial DNA
sequences shown in SEQ ID No. 1 and 2, respectively, are identical to the corresponding partial DNA sequences obtain-able from the plasmid in Saccharomyces cerevisiae, DSM 10076.
The strain Saccharomyces cerevisiae was deposited under the deposition number DSM 10076 on 30 June 1995 at the DSM -Deutsche Sammlung von Mikroorganismen and Zellkulturen GmbH, Maascheroder Weg lb, D-38125 Braunschweig, Germany, according WO 9G/11262 ~ ~ PCT/DK95/00400 to the Budapest Treaty.
In yet a further aspect, the present invention relates to a DNA construct comprising a DNA sequence encoding an enzyme exhibiting endoglucanase activity, which DNA sequence com-prises a) the DNA sequence shown in SEQ ID No. 3 and/or the DNA
sequence obtainable from the plasmid in Saccharomyces cerevisiae DSM 9969, or b) an analogue of the DNA sequence shown in SEQ ID No. 3 and/or the DNA sequence obtainable from the plasmid in Saccharomyces cerevisiae DSM 9969, which i) is homologous with the DNA sequence shown in SEQ ID
No. 3 and/or the DNA sequence obtainable from the plasmid in Saccharomyces cerevisiae DSM 9969, or ii) hybridizes with the same oligonucleotide probe as the DNA sequence shown in SEQ ID No. 3 and/or the DNA
sequence obtainable from the plasmid in Saccharomyces cerevisiae DSM 9969, or iii) encodes a polypeptide which is homologous with the polypeptide encoded by a DNA sequence comprising the DNA sequence shown in SEQ ID No. 3 and/or the DNA
sequence obtainable from the plasmid in Saccharomyces cerevisiae DSM 9969, or iv) encodes a polypeptide which is immunologically reactive with an antibody raised against the purified endoglucanase encoded by the DNA sequence shown in SEQ , ID No 3 and/or obtainable from the plasmid in Saccharomyces cerevisiae, DSM 9969.
It is believed that the DNA sequence shown in SEQ ID No. 3 is WO 96/11262 ~ Q '~ ~ ~ PCT/DK95/00400 identical to the corresponding partial DNA sequences obtain-able from the plasmid in Saccharomyces cerevisiae, DSM 9969.
The strain Saccharomyces cerevisiae was deposited under the deposition number DSM 9969 on 11 May 1995 at the DSM -5 Deutsche Sammlung von Mikroorganismen and Zellkulturen GmbH, Maascheroder Weg lb, D-38125 Braunschweig, Germany, according to the Budapest Treaty.
In yet a further aspect, the present invention relates to a DNA construct comprising a DNA sequence encoding an enzyme 10 exhibiting endoglucanase activity, which DNA sequence com-prises a) the DNA sequence shown in SEQ ID No. 4, and/or the DNA
sequence obtainable from the plasmid in Saccharomyces cerevisiae DSM 9977, or 15 b) an analogue of the DNA sequence shown in SEQ ID No. 4 and/or the DNA sequence obtainable from the plasmid in Saccharomyces cerevisiae DSM 9977, which i) is homologous with the DNA sequence shown in SEQ ID
No. 4 and/or the DNA sequence obtainable from the plasmid in Saccharomyces cerevisiae DSM 9977, or ii) hybridizes with the same oligonucleotide probe as the DNA sequence shown in SEQ ID No. 4 and/or the DNA
sequence obtainable from the~plasmid in Saccharomyces cerevisiae DSM 9977, or iii) encodes a polypeptide which is homologous with the polypeptide encoded by a DNA sequence comprising the DNA sequence shown in SEQ ID No. 4 and/or the DNA
sequence obtainable from the plasmid in Saccharomyces cerevisiae DSM 9977, or WD 96/11262 _ PCT/DK95/00400 it iv) encodes a polypeptide which is immunologically reactive with an antibody raised against the purified endoglucanase encoded by the DNA sequence shown in SEQ
ID No 4 and/or obtainable from the plasmid in Saccharomyces cerevisiae, DSM 9977.
It is believed that the DNA sequence shown in SEQ ID No. 4 is identical to the corresponding partial DNA sequences obtain-able from the plasmid in Saccharomyces cerevisiae, DSM 9977.
The strain Saccharomyces cerevisiae was deposited under the deposition number DSM 9977 on 11 May 1995 at the DSM -Deutsche Sammlung von Mikroorganismen and Zellkulturen GmbH, Maascheroder Weg lb, D-38125 Braunschweig, Germany, according to the Budapest Treaty.
In yet a further aspect, the present invention relates to a DNA construct comprising a DNA sequence encoding an enzyme exhibiting endoglucanase activity, which DNA sequence com-prises a) the DNA sequence shown in SEQ ID No. 5, and/or the DNA
sequence obtainable from the plasmid in Saccharomyces cerevisiae DSM 10077, or b) an analogue of the DNA sequence shown in SEQ ID No. 5 and/or the DNA sequence obtainable from the plasmid in Saccharomyces cerevisiae DSM 10077, which i) is homologous with the DNA sequence shown in SEQ ID
No. 5 and/or the DNA sequence obtainable from the plasmid in Saccharomyces cerevisiae DSM 10077, or ii) hybridizes with the same oligonucleotide probe as the DNA sequence shown in SEQ ID No. 5 and/or the DNA
sequence obtainable from the plasmid in Saccharomyces cerevisiae DSM 10077, or WO 96/11262 ~ ~ ~ ~ ~ ~ ~ ~ PCT/DK95/00400 iii) encodes a polypeptide which is homologous with the polypeptide encoded by a DNA sequence comprising the DNA sequence shown in SEQ ID No. 5 and/or the DNA
- sequence obtainable from the plasmid in Saccharomyces cerevisiae DSM 10077, or iv) encodes a polypeptide which is immunologically reactive with an antibody raised against the purified endoglucanase encoded by the DNA sequence shown in SEQ
ID No. 5 and/or obtainable from the plasmid in l0 Saccharomyces cerevisiae, DSM 10077.
It is believed that the DNA sequence shown in SEQ ID No. 5 is identical to the corresponding partial DNA sequences obtain-able from the plasmid in Saccharomyces cerevisiae, DSM 10077.
The strain Saccharomyces cerevisiae was deposited under the deposition number DSM 10077 on 30 June 1995 at the DSM -Deutsche Sammlung von Mikroorganismen and Zellkulturen GmbH, Maascheroder Weg lb, D-38125 Braunschweig, Germany, according to the Budapest Treaty.
In yet a further aspect, the present invention relates to a DNA construct comprising a DNA sequence encoding an enzyme exhibiting endoglucanase activity, which DNA sequence com-prises a) the DNA sequence shown in SEQ ID No. 6, and/or the DNA
sequence obtainable from the plasmid in Saccharomyces cerevisiae DSM 10079, or b) an analogue of the DNA sequence shown in SEQ ID No. 6 - and/or the DNA sequence obtainable from the plasmid in Saccharomyces cerevisiae DSM 10079, which i) is homologous with the DNA sequence shown in SEQ ID
No. 6 and/or the DNA sequence obtainable from the WO 96/11262 ~ ~ f' ~ ) PCT/DK95/00400 plasmid in Saccharomyces cerevisiae DSM 10079, or ii) hybridizes with the same oligonucleotide probe as the DNA sequence shown in SEQ ID No. 6 and/or the DNA
sequence obtainable from the plasmid in Saccharomyces cerevisiae DSM 10079, or iii) encodes a polypeptide which is homologous with the polypeptide by a DNA sequence comprising the DNA
sequence shown in SEQ ID No. 6 and/or the DNA sequence obtainable from the plasmid in Saccharomyces cerevisiae DSM 10079, or iv) encodes a polypeptide which is immunologically reactive with an antibody raised against the purified endoglucanase encoded by the DNA sequence shown in SEQ
ID No. 6 and/or obtainable from the plasmid in Saccharomyces cerevisiae, DSM 10079.
It is believed that the DNA sequence shown in SEQ ID No. 6 is identical to the corresponding partial DNA sequences obtain-able from the plasmid in Saccharomyces cerevisiae, DSM 10079.
The strain Saccharomyces cerevisiae was deposited under the deposition number DSM 10079 on 30 June 1995 at the DSM -Deutsche Sammlung von Mikroorganismen and Zellkulturen GmbH, Maascheroder Weg 1b, D-38125 Braunschweig, Germany, according to the Budapest Treaty.
In yet a further aspect, the present invention relates to a DNA construct comprising a DNA sequence encoding an enzyme exhibiting endoglucanase activity, which DNA sequence com-prises a) the N-terminal DNA sequence shown in SEQ ID No. 7, and/or the DNA sequence obtainable from the plasmid in Saccharomyces cerevisiae DSM 10084, or WO 96/11262 ~ ~ PCT/DK95/00400 b) an analogue of the N-terminal DNA sequence shown in SEQ ID
No. 7 and/or the DNA sequence obtainable from the plasmid in Saccharomyces cerevisiae DSM 10084, which i) is homologous with the N-terminal DNA sequence shown in SEQ ID No. 7 and/or the DNA sequence obtainable from the plasmid in Saccharomyces cerevisiae DSM 10084, or ii) hybridizes with the same oligonucleotide probe as the N-terminal DNA sequence shown in SEQ ID No. 7 and/or the DNA sequence obtainable from the plasmid in Saccharomyces cerevisiae DSM 10084, or iii) encodes a polypeptide which is homologous with the polypeptide encoded by a DNA sequence comprising the N-terminal DNA sequence shown in SEQ ID No. 7 and/or the DNA sequence obtainable from the plasmid in Saccharomyces cerevisiae DSM 10084, or iv) encodes a polypeptide which is immunologically reactive with an antibody raised against the purified endoglucanase encoded by the N-terminal DNA sequence shown in SEQ ID No. 7 and/or obtainable from the plasmid in Saccharomyces cerevisiae, DSM 10084.
It is believed that the N-terminal partial DNA sequence shown in SEQ ID No. 7 is identical to the corresponding partial DNA
sequences obtainable from the plasmid in Saccharomyces cerevisiae, DSM 10084.
- 25 The strain Saccharomyces cerevisiae was deposited under the deposition number DSM 10084 on 30 June 1995 at the DSM -Deutsche Sammlung von Mikroorganismen and Zellkulturen GmbH, Maascheroder Weg ib, D-38125 Braunschweig, Germany, according to the Budapest Treaty.
In the present context, the "analogue" of the partial DNA
VVU 96/11262 ~ ~ ~ ~ w PCT/DK95100400 sequences shown in SEQ ID No. 1 or 2 or 3 or 4 or 5 or 6 is intended to indicate any DNA sequence encoding an enzyme exhibiting endoglucanase activity, which has any or all of the properties i)-iv). The analogous DNA sequence 5 a) may be isolated from another or related (e. g. the same) organism producing the enzyme with endoglucanase activity on the basis of the DNA sequences shown in SEQ ID No. 1 or 2 or 3 or 4 or 5 or 6, e.g. using the procedures described herein, and thus, e.g. be an allelic or species variant of the DNA
10 sequence comprising the DNA sequences shown herein, b) may be constructed on the basis of the DNA sequences shown in SEQ ID No. 1 or 2 or 3 or 4 or 5 or 6, e.g. by introduc-tion of nucleotide substitutions which do not give rise to another amino acid sequence of the endoglucanase encoded by 15 the DNA sequence, but which correspond to the codon usage of the host organism intended for production of the enzyme, or by introduction of nucleotide substitutions which may give rise to a different amino acid sequence. However, in the latter case amino acid changes are preferably of a minor 20 nature, that is conservative amino acid substitutions that do not significantly affect the folding or activity of the protein, small deletions, typically of one to about 30 amino acids; small amino- or carboxyl-terminal extensions, such as an amino-terminal methionine residue, a small linker peptide of up to about 20-25 residues, or a small extension that facilitates purification, such as a poly-histidine tract, an antigenic epitope or a binding domain. See in general Ford et al., Protein Expression and Purification 2: 95-107, 1991.
Examples of conservative substitutions are within the group of basic amino acids (such as arginine, lysine, histidine), acidic amino acids (such as glutamic acid and aspartic acid), .
polar amino acids (such as glutamine and asparagine), hydrophobic amino acids (such as leucine, isoleucine, valine), aromatic amino acids (such as phenylalanine, tryptophan, tyrosine) and small amino acids (such as glycine, WO 96/11262 f 7 ~ PCT/DK95/00400 alanine, serine, threonine, methionine).
It will be apparent to persons skilled in the art that such substitutions can be made outside the regions critical to the function of the molecule and still result in an active poly-peptide. Amino acids essential to the activity of the poly-peptide encoded by the DNA construct of the invention, and therefore preferably not subject to substitution, may be identified according to procedures known in the art, such as site-directed mutagenesis or alanine-scanning mutagenesis (Cunningham and Wells, Science 244, 1081-1085, 1989). In the latter technique mutations are introduced at every residue in the molecule, and the resultant mutant molecules are tested for biological (i.e. endoglucanase) activity to identify amino acid residues that are critical to the activity of the molecule. Sites of substrate-enzyme interaction can also be determined by analysis of crystal structure as determined by such techniques as nuclear magnetic resonance, crystallo-graphy or photoaffinity labeling. See, for example, de Vos et al., Science 255: 306-312, 1992; Smith et al., J. Mol. Biol.
224: 899-904, 1992; Wlodaver et al., FEBS Lett. 309: 59-64, 1992.
The endoglucanase encoded by the DNA sequence of the DNA
construct of the invention may comprise a cellulose binding domain (CBD) existing as an integral part of the encoded enzyme, or a CBD from another origin may be introduced into the endoglucanase enzyme.
The homology referred to in i) above is determined as the degree of identity between the two sequences indicating a derivation of the first sequence from the second. The homology may suitably be determined by means of computer programs known in the art such as GAP provided in the GCG
program package (Needleman, S.B. and Wunsch, C.D., Journal of Molecular Biology, 48: 443-453, 1970). Using GAP with the following settings for DNA sequence comparison: GAP Creat1o11 WD 96/11262 ~-~, ~ ~ ~, PCT/DK95100400 penalty of 5.0 and GAP extension penalty of 0.3, the coding region of the DNA sequence exhibits a degree of identity , preferably of at least 40%, more preferably at least 50%, more preferably at least 60%, more preferably at least 70%, , even more preferably at least 80%, especially at least 90%, with the coding region of the (full or partial) DNA sequences shown in SEQ ID No.l or 2 or 3 or 4 or 5 or 6 or 7, respect-ively, or the DNA sequences) obtainable from the plasmid in Saccharomyces cerevisiae, DSM 10076, DSM 9969, DSM 9977, DSM
10077, DSM 10079 or DSM 10084, respectively.
The hybridization referred to in ii) above is intended to indicate that the analogous DNA sequence hybridizes to the same probe as the DNA sequence encoding the endoglucanase enzyme under certain specified conditions which are described in detail in the Materials and Methods section hereinafter.
Normally, the analogous DNA sequence is highly homologous to the DNA sequence such as at least 70% homologous to the (full or partial) DNA sequences shown in SEQ ID No. 1 or 2 or 3 or 4 or 5 or 6 or 7, respectively, encoding an endoglucanase of the invention, such as at least 75%, at least 80%, at least 85%, at least 90% or even at least 95% homologous to said DNA
sequence.
The homology referred to in iii) above is determined as the degree of identity between the two sequences indicating a derivation of the first sequence from the second. The homo-logy may suitably be determined by means of computer programs known in the art such as GAP provided in the GCG program package (Needleman, S.B. and Wunsch, C.D., Journal of Molecu-lar Biology, 48: 443-453, 1970). Using GAP with the following settings for polypeptide sequence comparison: GAP creation penalty of 3.0 and GAP extension penalty of 0.1, the polypeptide encoded by an analogous DNA sequence exhibits a degree of identity preferably of at least 70%, more preferab-ly at least 80%, especially at least 90%, with the enzyme encoded by a DNA construct comprising the (full or partial) WO 96/11262 ~ ~ ~ ~ ~ ~ ~ PCT/DK95/00400 DNA sequence shown in SEQ ID No.l or 2 or 3 or 4 or 5 or 6 or 7, respectively, or the DNA sequence obtainable from the plasmid in Saccharomyces cerevisiae, DSM 10076, DSM 9969, DSM
9977, DSM 10077, DSM 10079 or DSM 10084, respectively.
In connection with property iv) above it is intended to indicate an endoglucanase encoded by a DNA sequence isolated from strain DSM 10076 or DSM 9969 or DSM 9977 or DSM 10077 or DSM 10079 or DSM 10084, respectively, and produced in a host organism transformed with said DNA sequence or produced by the strain DSM 10076 or DSM 9969 or DSM 9977 or DSM 10077 or DSM 10079 or DSM 10084, respectively. The immunological reac-tivity may be determined by the method described in the Materials and Methods section below.
In further aspects the invention relates to an expression vector harbouring a DNA construct of the invention, a cell comprising the DNA construct or expression vector and a method of producing an enzyme exhibiting endoglucanase activ-ity which method comprises culturing said cell under condi-tions permitting the production of the enzyme, and recovering the enzyme from the culture.
In a still further aspect the invention relates to an enzyme exhibiting endoglucanase activity, which enzyme a) is encoded by a DNA construct of the invention b) produced by the method of the invention, and/or c) is immunologically reactive with an antibody raised against a purified endoglucanase encoded by the (full or par-- tial) DNA sequence shown in SEQ ID No.l or 2 or 3 or 4 or 5 or 6 or 7, respectively, or the DNA sequence obtainable from the plasmid in Saccharomyces cerevisiae, DSM 10076 or DSM
9969 or DSM 9977 or DSM 10077 or DSM 10079 or DSM 10084, respectively.
The endoglucanase mentioned in c) above may be encoded by the i WO 96l112G2 ~ ' ~ PCT/DK95100400 DNA sequence isolated from the strain Saccharomyces cexevisise, DSM 10076 or DSM 9969 or DSM 9977 or DSM 10077 or DSM 10079 or DSM 10084, respectively, and produced in a host organism transformed with said DNA sequence or produced by the strain DSM 10076 or DSM 9969 or DSM 9977 or DSM 10077 or DSM 10079 or DSM 10084, respectively.
Fxgression cloning i,D yeast The DNA sequence of the invention encoding an enzyme exhibit-ing endoglucanase activity may be isolated by a general method involving - cloning, in suitable vectors, a DNA library from Acremonium sp., especially from Acremonium sp., CBS
478.94 or CBS 265.95, - transforming suitable yeast host cells with said vectors, - culturing the host cells under suitable conditions to express any enzyme of interest encoded by a clone in the DNA library, - screening for positive clones by determining any endoglucanase activity of the enzyme produced by such clones, and - isolating the enzyme encoding DNA from such clones.
The general method is further disclosed in WO 94/14953r A
more detailed description of the screening method is given in Example 6 below.
The DNA sequence coding for the enzyme may for instance be isolated by screening a cDNA library of Acremonium sp., and selecting for clones expressing the appropriate,enzyme activ-ity (i.e. endoglucanase activity) or from Saccharomyces cerevisiae, DSM 10076 or DSM 10077 or DSM 10079 or DSM 10084, each deposited under the Budapest Treaty on 30 June, 1995, at W~ 96111262 ~ ~ ~ PCT/DK95/00400 DSM (Deutsche sammlung von Mikroorganismen and Zellkulturen GmbH, Mascheroder Weg 16, D-38124 Braunschweig, Germany) or from Saccharomyces cerevisiae, DSM 9969 or DSM 9977, each deposited under the Budapest Treaty on 11 May, 1995, at DSM
5 (Deutsche Sammlung von Mikroorganismen and Zellkulturen GmbH). The appropriate DNA sequence may then be isolated from the clone by standard procedures, e.g. as described in Example 6.
It is expected that a DNA sequence coding for a homologous 10 enzyme, i.e. an analogous DNA sequence, is obtainable from other microorganisms. For instance, the DNA sequence may be derived by similarly screening a cDNA library of another fungus, such as a strain of an Aspergillus sp., in particular a strain of A. aculeatus or A. niger, a strain of 15 Trichoderma sp., in particular a strain of T. reesei, T.
viride, T. longibrachiatum, T. harzianum or T. koningil or a strain of a Fusarium sp., in particular a strain of F.
oxysporum, or a strain of a Humicola sp., or a strain of a Neocallimastix sp., a Piromyces sp., a Penicillium sp., an 20 Agaricus sp. , or a Phanerochaete sp.
Alternatively, the DNA coding for a endoglucanase of the invention may, in accordance with well-known procedures, conveniently be isolated from DNA from a suitable source, such as any of the above mentioned organisms, by use of 25 synthetic oligonucleotide probes prepared on the basis of a DNA sequence disclosed herein. For instance, a suitable oligonucleotide probe may be prepared on the basis of the nucleotide sequence shown in any of the (full or partial) sequences listed in SEQ ID No. 1, 2, 3, 4, 5 or 6 or 7, respectively, or any suitable subsequence thereof.
A wide range of indicator systems for the different types of enzymes may be used for the screening of yeast colonies on agar plates. For instance, cellulases and endoglucanases may be identified by clearing zones in carboxymethyl cellulose WO 9G/11262 ~ ~ PCT/DK95/00400 after staining with Congo Red.
N~~cleic acid construct As used herein the term "nucleic acid construct" is intended to indicate any nucleic acid molecule of cDNA, genomic DNA, synthetic DNA or RNA origin. The term "construct" is intended to indicate a nucleic acid segment which may be single- or double-stranded, and which may be based on a complete or partial naturally occurring nucleotide sequence encoding an enzyme of interest. The construct may optionally contain other nucleic acid segments.
The nucleic acid construct encoding the enzyme of the inven-tion may suitably be of genomic or cDNA origin, for instance obtained by preparing a genomic or cDNA library and screening for DNA sequences coding for all or part of the enzyme by hybridization using synthetic oligonucleotide probes in accordance with standard techniques (cf. Sambrook et al., supra ) .
The nucleic acid construct encoding the enzyme may also be prepared synthetically by established standard methods, e.g.
the phosphoamidite method described by Beaucage and Caruthers, Tetrahedron Letters 22 (1981), 1859 - 1869, or the method described by Matthes et al., EMBO Journal 3 (1984), 801 - 805. According to the phosphoamidite method, oligonucleotides are synthesized, e.g. in an automatic DNA
synthesizer, purified, annealed, ligated and cloned in suit-able vectors.
Furthermore, the nucleic acid construct may be of mixed synthetic and genomic, mixed synthetic and cDNA or mixed genomic and cDNA origin prepared by ligating fragments of synthetic, genomic or cDNA origin (as appropriate), the fragments corresponding to various parts of the entire nucleic acid construct, in accordance with standard tech-niques.
The nucleic acid construct may also be prepared by polymerase chain reaction using specific primers, for instance as described in US 4,683,202 or Saiki et al., Science 239 (1988), 487 - 491.
The nucleic acid construct is preferably a DNA construct which term will be used exclusively in this specification and claims.
Recombinant vector A recombinant vector comprising a DNA construct encoding the enzyme of the invention may be any vector which may conveni-ently be subjected to recombinant DNA procedures, and the choice of vector will often depend on the host cell into which it is to be introduced. Thus, the vector may be an autonomously replicating vector, i.e. a vector which exists as an extrachromosomal entity, the replication of which is independent of chromosomal replication, e.g. a plasmid.
Alternatively, the vector may be one which, when introduced into a host cell, is integrated into the host cell genome and replicated together with the chromosomes) into which it has been integrated.
The vector is preferably an expression vector in which the DNA sequence encoding the enzyme of the invention is operably linked to additional segments required for transcription of the DNA. In general, the expression vector is derived from plasmid or viral DNA, or may contain elements of both. The term, "operably linked" indicates that the segments are arranged so that they function in concert for their intended purposes, e.g. transcription initiates in a promoter and proceeds through the DNA sequence coding for the enzyme.
WO 96/11262 ~ ~, ~ ~ ~ ~ ~, PCTIDK95100400 The promoter may be any DNA sequence which shows transcriptional activity in the host cell of choice and may , be derived from genes encoding proteins either homologous or heterologous to the host cell.
Examples of suitable promoters for use in yeast host cells include promoters from yeast glycolytic genes (Hitzeman et al., J. $iol. Chem. 255 (1980), 12073 - 12080; Alber and Kawasaki, J. Mol. Appl. Gen. 1 (1982), 419 - 434) or alcohol dehydrogenase genes (Young et al., in Genetic Engineering of Microorganisms for Chemicals (Hollaender et al, eds.), Plenum Press, New York, 1982), or the TPI1 (US 4,599,311) or ADH2-4c (Russell et al., Nature 304 (1983), 652 - 654) promoters.
Examples of suitable promoters for use in filamentous fungus host cells are, for instance, the ADH3 promoter (McKnight et al., The EMBO J. 4 (1985), 2093 - 2099) or the tt~l.A promoter.
Examples of other useful promoters are those derived from the gene encoding A. oryzae TAKA amylase, Rhizomucor miehei aspartic proteinase, A. niger neutral a-amylase, A. niger acid stable cz-amylase, A. niger or A. awamori glucoamylase (gluA), Rhizomucor miehei lipase, A. oryzae alkaline protease, A. oryzae triose phosphate isomerase or A. nidulans acetamidase. Preferred are the TAKA-amylase and gluA promo-ters.
Examples of suitable promoters for use in bacterial host cells include the promoter of the Bacillus stearothermophilus maltogenic amylase gene, the Bacillus licheniformis alpha-amylase gene, the Bacillus amyloliquefaciens BAN amylase gene, the Bacillus subtilis alkaline protease gen, or the .
Bscillus pumilus xylosidase gene, or by the phage Lambda PR
or PL promoters or the E. coli lac, trp or tac promoters.
The DNA sequence encoding the enzyme of the invention may also, if necessary, be operably connected to a suitable terminator.
WO 96/11262 ~ ~ ~ ~ ~ ~ PCT/DK95/00400 t The recombinant vector of the invention may further comprise a DNA sequence enabling the vector to replicate in the host cell in question.
The vector may also comprise a selectable marker, e.g. a gene the product of which complements a defect in the host cell, such as the gene coding for dihydrofolate reductase (DHFR) or the Schizosaccharomyces pombe TPI gene (described by P.R.
Russell, Gene 40, 1985, pp. 125-130). For filamentous fungi, selectable markers include amdS, pyre, araB, niaD, sC.
To direct an enzyme of the present invention into the secre-tory pathway of the host cells, a secretory signal sequence (also known as a leader sequence, prepro sequence or pre sequence) may be provided in the recombinant vector. The secretory signal sequence is joined to the DNA sequence encoding the enzyme in the correct reading frame. Secretory signal sequences are commonly positioned 5' to the DNA
sequence encoding the enzyme. The secretory signal sequence may be that normally associated with the enzyme or may be from a gene encoding another secreted protein.
For secretion from yeast cells, the secretory signal sequence may encode any signal peptide which ensures efficient direc-tion of the expressed enzyme into the secretory pathway of the cell. The signal peptide may be naturally occurring signal peptide, or a functional part thereof, or it may be a synthetic peptide. Suitable signal peptides have been found to be the a-factor signal peptide (cf. US 4,870,008), the signal peptide of mouse salivary amylase (cf. O. Hagenbuchle et al., Nature 289, 1981, pp. 643-646), a modified carboxypeptidase signal peptide (cf. L.A. Valls et al., Cell 48, 1987, pp. 887-89?), the yeast BAR1 signal peptide (cf. WO
87/02670), or the yeast aspartic protease 3 (YAP3) signal peptide (cf. M. Egel-Mitani et al., Yeast 6, 1990, pp. 127-137) .
WD 96/11262 ~ ~ ~ ~ PCT/DK95/00400 For efficient secretion in yeast, a sequence encoding a leader peptide may also be inserted downstream of the signal , sequence and upstream of the DNA sequence encoding the enzyme. The function of the leader peptide is to allow the , 5 expressed enzyme to be directed from the endoplasmic reticulum to the Golgi apparatus and further to a secretory vesicle for secretion into the culture medium (i.e. exporta-tion of the enzyme across the cell wall or at least through the cellular membrane into the periplasmic space of the yeast 10 cell). The leader peptide may be the yeast a-factor leader (the use of which is described in e.g. US 4,546,082, EP 16 201, EP 123 294, EP 123 544 and EP 163 529). Alternatively, the leader peptide may be a synthetic leader peptide, which is to say a leader peptide not found in nature. Synthetic 15 leader peptides may, for instance, be constructed as described in WO 89/02463 or WO 92/11378.
For use in filamentous fungi, the signal peptide may conveni-ently be derived from a gene encoding an Aspergillus sp.
amylase or glucoamylase, a gene encoding a Rhizomucor miehei 20 lipase or protease, a Humicola lanuginosa lipase. The signal peptide is preferably derived from a gene encoding A. oryzae TAKA amylase, A. niger neutral a-amylase, A. niger acid-stable amylase, or A. niger glucoamylase.
The procedures used to ligate the DNA sequences coding for 25 the present enzyme, the promoter and optionally the termin-ator and/or secretory signal sequence, respectively, and to insert them into suitable vectors containing the information necessary for replication, are well known to persons skilled in the art (cf., for instance, Sambrook et al., op.cit.).
Further, the isolated enzyme and the enzyme composition of the invention preferably have a relative activity at pH 10 of at least 50~ as compared to the activity at pH 8.5, the activity being measured in Savi U units on a suitable substrate.
Preferably, the isolated enzyme and the enzyme composition of the invention are stable in the presence of sodium linear alkylbenzene sulphonate, sodium polyoxyethylene alkyl sul-phate, sodium dodecyl sulphate, sodium a-olefin sulphonate, sodium alkyl sulphonate, and a-sulpho-fatty acid ester.
It may be preferred to provide the enzyme in a highly purified form, i.e. greater than 90~ pure, more preferably 95~ and most preferably 99°s pure, as determined by SDS-PAGE.
In a further aspect, the present invention relates to a DNA
construct comprising a DNA sequence encoding an enzyme exhi-biting endoglucanase activity, which DNA sequence comprises a) the N-terminal DNA sequence shown in SEQ ID No. 1 and the C-terminal DNA sequences shown in SEQ ID No. 2, and/or the DNA sequence obtainable from the plasmid in Saccharomyces cerevisiae DSM 10076, or b) an analogue of the N-terminal DNA sequence shown in SEQ ID
No. 1 and the C-terminal DNA sequences shown in SEQ ID No. 2 and/or the DNA sequence obtainable from the plasmid in Saccharomyces cerevisiae DSM 10076, which i) is homologous with the N-terminal DNA sequence shown in SEQ ID No. 1 and the C-terminal DNA sequences shown in SEQ ID No. 2 and/or the DNA sequence obtainable from the plasmid in Saccharomyces cerevisiae DSM 10076, or ii) hybridizes with the same oligonucleotide probe as the N-terminal DNA sequence shown in SEQ ID No. 1 and the C-terminal DNA sequences shown in SEQ ID No. 2 and/or the DNA sequence obtainable from the plasmid in Saccharomyces cerevisiae DSM 10076, or iii) encodes a polypeptide which is homologous with the polypeptide encoded by a DNA sequence comprising the N-terminal DNA sequence shown in SEQ ID No. 1 and the C-terminal DNA sequences shown in SEQ ID No. 2 and/or the DNA sequence obtainable from the plasmid in Saccharomyces cerevisiae DSM 10076, or iv) encodes a polypeptide which is immunologically reactive with an antibody raised against the purified endoglucanase encoded by the N-terminal DNA sequence shown in SEQ ID No. 1 and the C-terminal DNA sequences shown in SEQ ID No. 2 and/or obtainable from the plasmid in Saccharomyces cerevisiae, DSM 10076.
It is believed that the N-terminal~and C-terminal partial DNA
sequences shown in SEQ ID No. 1 and 2, respectively, are identical to the corresponding partial DNA sequences obtain-able from the plasmid in Saccharomyces cerevisiae, DSM 10076.
The strain Saccharomyces cerevisiae was deposited under the deposition number DSM 10076 on 30 June 1995 at the DSM -Deutsche Sammlung von Mikroorganismen and Zellkulturen GmbH, Maascheroder Weg lb, D-38125 Braunschweig, Germany, according WO 9G/11262 ~ ~ PCT/DK95/00400 to the Budapest Treaty.
In yet a further aspect, the present invention relates to a DNA construct comprising a DNA sequence encoding an enzyme exhibiting endoglucanase activity, which DNA sequence com-prises a) the DNA sequence shown in SEQ ID No. 3 and/or the DNA
sequence obtainable from the plasmid in Saccharomyces cerevisiae DSM 9969, or b) an analogue of the DNA sequence shown in SEQ ID No. 3 and/or the DNA sequence obtainable from the plasmid in Saccharomyces cerevisiae DSM 9969, which i) is homologous with the DNA sequence shown in SEQ ID
No. 3 and/or the DNA sequence obtainable from the plasmid in Saccharomyces cerevisiae DSM 9969, or ii) hybridizes with the same oligonucleotide probe as the DNA sequence shown in SEQ ID No. 3 and/or the DNA
sequence obtainable from the plasmid in Saccharomyces cerevisiae DSM 9969, or iii) encodes a polypeptide which is homologous with the polypeptide encoded by a DNA sequence comprising the DNA sequence shown in SEQ ID No. 3 and/or the DNA
sequence obtainable from the plasmid in Saccharomyces cerevisiae DSM 9969, or iv) encodes a polypeptide which is immunologically reactive with an antibody raised against the purified endoglucanase encoded by the DNA sequence shown in SEQ , ID No 3 and/or obtainable from the plasmid in Saccharomyces cerevisiae, DSM 9969.
It is believed that the DNA sequence shown in SEQ ID No. 3 is WO 96/11262 ~ Q '~ ~ ~ PCT/DK95/00400 identical to the corresponding partial DNA sequences obtain-able from the plasmid in Saccharomyces cerevisiae, DSM 9969.
The strain Saccharomyces cerevisiae was deposited under the deposition number DSM 9969 on 11 May 1995 at the DSM -5 Deutsche Sammlung von Mikroorganismen and Zellkulturen GmbH, Maascheroder Weg lb, D-38125 Braunschweig, Germany, according to the Budapest Treaty.
In yet a further aspect, the present invention relates to a DNA construct comprising a DNA sequence encoding an enzyme 10 exhibiting endoglucanase activity, which DNA sequence com-prises a) the DNA sequence shown in SEQ ID No. 4, and/or the DNA
sequence obtainable from the plasmid in Saccharomyces cerevisiae DSM 9977, or 15 b) an analogue of the DNA sequence shown in SEQ ID No. 4 and/or the DNA sequence obtainable from the plasmid in Saccharomyces cerevisiae DSM 9977, which i) is homologous with the DNA sequence shown in SEQ ID
No. 4 and/or the DNA sequence obtainable from the plasmid in Saccharomyces cerevisiae DSM 9977, or ii) hybridizes with the same oligonucleotide probe as the DNA sequence shown in SEQ ID No. 4 and/or the DNA
sequence obtainable from the~plasmid in Saccharomyces cerevisiae DSM 9977, or iii) encodes a polypeptide which is homologous with the polypeptide encoded by a DNA sequence comprising the DNA sequence shown in SEQ ID No. 4 and/or the DNA
sequence obtainable from the plasmid in Saccharomyces cerevisiae DSM 9977, or WD 96/11262 _ PCT/DK95/00400 it iv) encodes a polypeptide which is immunologically reactive with an antibody raised against the purified endoglucanase encoded by the DNA sequence shown in SEQ
ID No 4 and/or obtainable from the plasmid in Saccharomyces cerevisiae, DSM 9977.
It is believed that the DNA sequence shown in SEQ ID No. 4 is identical to the corresponding partial DNA sequences obtain-able from the plasmid in Saccharomyces cerevisiae, DSM 9977.
The strain Saccharomyces cerevisiae was deposited under the deposition number DSM 9977 on 11 May 1995 at the DSM -Deutsche Sammlung von Mikroorganismen and Zellkulturen GmbH, Maascheroder Weg lb, D-38125 Braunschweig, Germany, according to the Budapest Treaty.
In yet a further aspect, the present invention relates to a DNA construct comprising a DNA sequence encoding an enzyme exhibiting endoglucanase activity, which DNA sequence com-prises a) the DNA sequence shown in SEQ ID No. 5, and/or the DNA
sequence obtainable from the plasmid in Saccharomyces cerevisiae DSM 10077, or b) an analogue of the DNA sequence shown in SEQ ID No. 5 and/or the DNA sequence obtainable from the plasmid in Saccharomyces cerevisiae DSM 10077, which i) is homologous with the DNA sequence shown in SEQ ID
No. 5 and/or the DNA sequence obtainable from the plasmid in Saccharomyces cerevisiae DSM 10077, or ii) hybridizes with the same oligonucleotide probe as the DNA sequence shown in SEQ ID No. 5 and/or the DNA
sequence obtainable from the plasmid in Saccharomyces cerevisiae DSM 10077, or WO 96/11262 ~ ~ ~ ~ ~ ~ ~ ~ PCT/DK95/00400 iii) encodes a polypeptide which is homologous with the polypeptide encoded by a DNA sequence comprising the DNA sequence shown in SEQ ID No. 5 and/or the DNA
- sequence obtainable from the plasmid in Saccharomyces cerevisiae DSM 10077, or iv) encodes a polypeptide which is immunologically reactive with an antibody raised against the purified endoglucanase encoded by the DNA sequence shown in SEQ
ID No. 5 and/or obtainable from the plasmid in l0 Saccharomyces cerevisiae, DSM 10077.
It is believed that the DNA sequence shown in SEQ ID No. 5 is identical to the corresponding partial DNA sequences obtain-able from the plasmid in Saccharomyces cerevisiae, DSM 10077.
The strain Saccharomyces cerevisiae was deposited under the deposition number DSM 10077 on 30 June 1995 at the DSM -Deutsche Sammlung von Mikroorganismen and Zellkulturen GmbH, Maascheroder Weg lb, D-38125 Braunschweig, Germany, according to the Budapest Treaty.
In yet a further aspect, the present invention relates to a DNA construct comprising a DNA sequence encoding an enzyme exhibiting endoglucanase activity, which DNA sequence com-prises a) the DNA sequence shown in SEQ ID No. 6, and/or the DNA
sequence obtainable from the plasmid in Saccharomyces cerevisiae DSM 10079, or b) an analogue of the DNA sequence shown in SEQ ID No. 6 - and/or the DNA sequence obtainable from the plasmid in Saccharomyces cerevisiae DSM 10079, which i) is homologous with the DNA sequence shown in SEQ ID
No. 6 and/or the DNA sequence obtainable from the WO 96/11262 ~ ~ f' ~ ) PCT/DK95/00400 plasmid in Saccharomyces cerevisiae DSM 10079, or ii) hybridizes with the same oligonucleotide probe as the DNA sequence shown in SEQ ID No. 6 and/or the DNA
sequence obtainable from the plasmid in Saccharomyces cerevisiae DSM 10079, or iii) encodes a polypeptide which is homologous with the polypeptide by a DNA sequence comprising the DNA
sequence shown in SEQ ID No. 6 and/or the DNA sequence obtainable from the plasmid in Saccharomyces cerevisiae DSM 10079, or iv) encodes a polypeptide which is immunologically reactive with an antibody raised against the purified endoglucanase encoded by the DNA sequence shown in SEQ
ID No. 6 and/or obtainable from the plasmid in Saccharomyces cerevisiae, DSM 10079.
It is believed that the DNA sequence shown in SEQ ID No. 6 is identical to the corresponding partial DNA sequences obtain-able from the plasmid in Saccharomyces cerevisiae, DSM 10079.
The strain Saccharomyces cerevisiae was deposited under the deposition number DSM 10079 on 30 June 1995 at the DSM -Deutsche Sammlung von Mikroorganismen and Zellkulturen GmbH, Maascheroder Weg 1b, D-38125 Braunschweig, Germany, according to the Budapest Treaty.
In yet a further aspect, the present invention relates to a DNA construct comprising a DNA sequence encoding an enzyme exhibiting endoglucanase activity, which DNA sequence com-prises a) the N-terminal DNA sequence shown in SEQ ID No. 7, and/or the DNA sequence obtainable from the plasmid in Saccharomyces cerevisiae DSM 10084, or WO 96/11262 ~ ~ PCT/DK95/00400 b) an analogue of the N-terminal DNA sequence shown in SEQ ID
No. 7 and/or the DNA sequence obtainable from the plasmid in Saccharomyces cerevisiae DSM 10084, which i) is homologous with the N-terminal DNA sequence shown in SEQ ID No. 7 and/or the DNA sequence obtainable from the plasmid in Saccharomyces cerevisiae DSM 10084, or ii) hybridizes with the same oligonucleotide probe as the N-terminal DNA sequence shown in SEQ ID No. 7 and/or the DNA sequence obtainable from the plasmid in Saccharomyces cerevisiae DSM 10084, or iii) encodes a polypeptide which is homologous with the polypeptide encoded by a DNA sequence comprising the N-terminal DNA sequence shown in SEQ ID No. 7 and/or the DNA sequence obtainable from the plasmid in Saccharomyces cerevisiae DSM 10084, or iv) encodes a polypeptide which is immunologically reactive with an antibody raised against the purified endoglucanase encoded by the N-terminal DNA sequence shown in SEQ ID No. 7 and/or obtainable from the plasmid in Saccharomyces cerevisiae, DSM 10084.
It is believed that the N-terminal partial DNA sequence shown in SEQ ID No. 7 is identical to the corresponding partial DNA
sequences obtainable from the plasmid in Saccharomyces cerevisiae, DSM 10084.
- 25 The strain Saccharomyces cerevisiae was deposited under the deposition number DSM 10084 on 30 June 1995 at the DSM -Deutsche Sammlung von Mikroorganismen and Zellkulturen GmbH, Maascheroder Weg ib, D-38125 Braunschweig, Germany, according to the Budapest Treaty.
In the present context, the "analogue" of the partial DNA
VVU 96/11262 ~ ~ ~ ~ w PCT/DK95100400 sequences shown in SEQ ID No. 1 or 2 or 3 or 4 or 5 or 6 is intended to indicate any DNA sequence encoding an enzyme exhibiting endoglucanase activity, which has any or all of the properties i)-iv). The analogous DNA sequence 5 a) may be isolated from another or related (e. g. the same) organism producing the enzyme with endoglucanase activity on the basis of the DNA sequences shown in SEQ ID No. 1 or 2 or 3 or 4 or 5 or 6, e.g. using the procedures described herein, and thus, e.g. be an allelic or species variant of the DNA
10 sequence comprising the DNA sequences shown herein, b) may be constructed on the basis of the DNA sequences shown in SEQ ID No. 1 or 2 or 3 or 4 or 5 or 6, e.g. by introduc-tion of nucleotide substitutions which do not give rise to another amino acid sequence of the endoglucanase encoded by 15 the DNA sequence, but which correspond to the codon usage of the host organism intended for production of the enzyme, or by introduction of nucleotide substitutions which may give rise to a different amino acid sequence. However, in the latter case amino acid changes are preferably of a minor 20 nature, that is conservative amino acid substitutions that do not significantly affect the folding or activity of the protein, small deletions, typically of one to about 30 amino acids; small amino- or carboxyl-terminal extensions, such as an amino-terminal methionine residue, a small linker peptide of up to about 20-25 residues, or a small extension that facilitates purification, such as a poly-histidine tract, an antigenic epitope or a binding domain. See in general Ford et al., Protein Expression and Purification 2: 95-107, 1991.
Examples of conservative substitutions are within the group of basic amino acids (such as arginine, lysine, histidine), acidic amino acids (such as glutamic acid and aspartic acid), .
polar amino acids (such as glutamine and asparagine), hydrophobic amino acids (such as leucine, isoleucine, valine), aromatic amino acids (such as phenylalanine, tryptophan, tyrosine) and small amino acids (such as glycine, WO 96/11262 f 7 ~ PCT/DK95/00400 alanine, serine, threonine, methionine).
It will be apparent to persons skilled in the art that such substitutions can be made outside the regions critical to the function of the molecule and still result in an active poly-peptide. Amino acids essential to the activity of the poly-peptide encoded by the DNA construct of the invention, and therefore preferably not subject to substitution, may be identified according to procedures known in the art, such as site-directed mutagenesis or alanine-scanning mutagenesis (Cunningham and Wells, Science 244, 1081-1085, 1989). In the latter technique mutations are introduced at every residue in the molecule, and the resultant mutant molecules are tested for biological (i.e. endoglucanase) activity to identify amino acid residues that are critical to the activity of the molecule. Sites of substrate-enzyme interaction can also be determined by analysis of crystal structure as determined by such techniques as nuclear magnetic resonance, crystallo-graphy or photoaffinity labeling. See, for example, de Vos et al., Science 255: 306-312, 1992; Smith et al., J. Mol. Biol.
224: 899-904, 1992; Wlodaver et al., FEBS Lett. 309: 59-64, 1992.
The endoglucanase encoded by the DNA sequence of the DNA
construct of the invention may comprise a cellulose binding domain (CBD) existing as an integral part of the encoded enzyme, or a CBD from another origin may be introduced into the endoglucanase enzyme.
The homology referred to in i) above is determined as the degree of identity between the two sequences indicating a derivation of the first sequence from the second. The homology may suitably be determined by means of computer programs known in the art such as GAP provided in the GCG
program package (Needleman, S.B. and Wunsch, C.D., Journal of Molecular Biology, 48: 443-453, 1970). Using GAP with the following settings for DNA sequence comparison: GAP Creat1o11 WD 96/11262 ~-~, ~ ~ ~, PCT/DK95100400 penalty of 5.0 and GAP extension penalty of 0.3, the coding region of the DNA sequence exhibits a degree of identity , preferably of at least 40%, more preferably at least 50%, more preferably at least 60%, more preferably at least 70%, , even more preferably at least 80%, especially at least 90%, with the coding region of the (full or partial) DNA sequences shown in SEQ ID No.l or 2 or 3 or 4 or 5 or 6 or 7, respect-ively, or the DNA sequences) obtainable from the plasmid in Saccharomyces cerevisiae, DSM 10076, DSM 9969, DSM 9977, DSM
10077, DSM 10079 or DSM 10084, respectively.
The hybridization referred to in ii) above is intended to indicate that the analogous DNA sequence hybridizes to the same probe as the DNA sequence encoding the endoglucanase enzyme under certain specified conditions which are described in detail in the Materials and Methods section hereinafter.
Normally, the analogous DNA sequence is highly homologous to the DNA sequence such as at least 70% homologous to the (full or partial) DNA sequences shown in SEQ ID No. 1 or 2 or 3 or 4 or 5 or 6 or 7, respectively, encoding an endoglucanase of the invention, such as at least 75%, at least 80%, at least 85%, at least 90% or even at least 95% homologous to said DNA
sequence.
The homology referred to in iii) above is determined as the degree of identity between the two sequences indicating a derivation of the first sequence from the second. The homo-logy may suitably be determined by means of computer programs known in the art such as GAP provided in the GCG program package (Needleman, S.B. and Wunsch, C.D., Journal of Molecu-lar Biology, 48: 443-453, 1970). Using GAP with the following settings for polypeptide sequence comparison: GAP creation penalty of 3.0 and GAP extension penalty of 0.1, the polypeptide encoded by an analogous DNA sequence exhibits a degree of identity preferably of at least 70%, more preferab-ly at least 80%, especially at least 90%, with the enzyme encoded by a DNA construct comprising the (full or partial) WO 96/11262 ~ ~ ~ ~ ~ ~ ~ PCT/DK95/00400 DNA sequence shown in SEQ ID No.l or 2 or 3 or 4 or 5 or 6 or 7, respectively, or the DNA sequence obtainable from the plasmid in Saccharomyces cerevisiae, DSM 10076, DSM 9969, DSM
9977, DSM 10077, DSM 10079 or DSM 10084, respectively.
In connection with property iv) above it is intended to indicate an endoglucanase encoded by a DNA sequence isolated from strain DSM 10076 or DSM 9969 or DSM 9977 or DSM 10077 or DSM 10079 or DSM 10084, respectively, and produced in a host organism transformed with said DNA sequence or produced by the strain DSM 10076 or DSM 9969 or DSM 9977 or DSM 10077 or DSM 10079 or DSM 10084, respectively. The immunological reac-tivity may be determined by the method described in the Materials and Methods section below.
In further aspects the invention relates to an expression vector harbouring a DNA construct of the invention, a cell comprising the DNA construct or expression vector and a method of producing an enzyme exhibiting endoglucanase activ-ity which method comprises culturing said cell under condi-tions permitting the production of the enzyme, and recovering the enzyme from the culture.
In a still further aspect the invention relates to an enzyme exhibiting endoglucanase activity, which enzyme a) is encoded by a DNA construct of the invention b) produced by the method of the invention, and/or c) is immunologically reactive with an antibody raised against a purified endoglucanase encoded by the (full or par-- tial) DNA sequence shown in SEQ ID No.l or 2 or 3 or 4 or 5 or 6 or 7, respectively, or the DNA sequence obtainable from the plasmid in Saccharomyces cerevisiae, DSM 10076 or DSM
9969 or DSM 9977 or DSM 10077 or DSM 10079 or DSM 10084, respectively.
The endoglucanase mentioned in c) above may be encoded by the i WO 96l112G2 ~ ' ~ PCT/DK95100400 DNA sequence isolated from the strain Saccharomyces cexevisise, DSM 10076 or DSM 9969 or DSM 9977 or DSM 10077 or DSM 10079 or DSM 10084, respectively, and produced in a host organism transformed with said DNA sequence or produced by the strain DSM 10076 or DSM 9969 or DSM 9977 or DSM 10077 or DSM 10079 or DSM 10084, respectively.
Fxgression cloning i,D yeast The DNA sequence of the invention encoding an enzyme exhibit-ing endoglucanase activity may be isolated by a general method involving - cloning, in suitable vectors, a DNA library from Acremonium sp., especially from Acremonium sp., CBS
478.94 or CBS 265.95, - transforming suitable yeast host cells with said vectors, - culturing the host cells under suitable conditions to express any enzyme of interest encoded by a clone in the DNA library, - screening for positive clones by determining any endoglucanase activity of the enzyme produced by such clones, and - isolating the enzyme encoding DNA from such clones.
The general method is further disclosed in WO 94/14953r A
more detailed description of the screening method is given in Example 6 below.
The DNA sequence coding for the enzyme may for instance be isolated by screening a cDNA library of Acremonium sp., and selecting for clones expressing the appropriate,enzyme activ-ity (i.e. endoglucanase activity) or from Saccharomyces cerevisiae, DSM 10076 or DSM 10077 or DSM 10079 or DSM 10084, each deposited under the Budapest Treaty on 30 June, 1995, at W~ 96111262 ~ ~ ~ PCT/DK95/00400 DSM (Deutsche sammlung von Mikroorganismen and Zellkulturen GmbH, Mascheroder Weg 16, D-38124 Braunschweig, Germany) or from Saccharomyces cerevisiae, DSM 9969 or DSM 9977, each deposited under the Budapest Treaty on 11 May, 1995, at DSM
5 (Deutsche Sammlung von Mikroorganismen and Zellkulturen GmbH). The appropriate DNA sequence may then be isolated from the clone by standard procedures, e.g. as described in Example 6.
It is expected that a DNA sequence coding for a homologous 10 enzyme, i.e. an analogous DNA sequence, is obtainable from other microorganisms. For instance, the DNA sequence may be derived by similarly screening a cDNA library of another fungus, such as a strain of an Aspergillus sp., in particular a strain of A. aculeatus or A. niger, a strain of 15 Trichoderma sp., in particular a strain of T. reesei, T.
viride, T. longibrachiatum, T. harzianum or T. koningil or a strain of a Fusarium sp., in particular a strain of F.
oxysporum, or a strain of a Humicola sp., or a strain of a Neocallimastix sp., a Piromyces sp., a Penicillium sp., an 20 Agaricus sp. , or a Phanerochaete sp.
Alternatively, the DNA coding for a endoglucanase of the invention may, in accordance with well-known procedures, conveniently be isolated from DNA from a suitable source, such as any of the above mentioned organisms, by use of 25 synthetic oligonucleotide probes prepared on the basis of a DNA sequence disclosed herein. For instance, a suitable oligonucleotide probe may be prepared on the basis of the nucleotide sequence shown in any of the (full or partial) sequences listed in SEQ ID No. 1, 2, 3, 4, 5 or 6 or 7, respectively, or any suitable subsequence thereof.
A wide range of indicator systems for the different types of enzymes may be used for the screening of yeast colonies on agar plates. For instance, cellulases and endoglucanases may be identified by clearing zones in carboxymethyl cellulose WO 9G/11262 ~ ~ PCT/DK95/00400 after staining with Congo Red.
N~~cleic acid construct As used herein the term "nucleic acid construct" is intended to indicate any nucleic acid molecule of cDNA, genomic DNA, synthetic DNA or RNA origin. The term "construct" is intended to indicate a nucleic acid segment which may be single- or double-stranded, and which may be based on a complete or partial naturally occurring nucleotide sequence encoding an enzyme of interest. The construct may optionally contain other nucleic acid segments.
The nucleic acid construct encoding the enzyme of the inven-tion may suitably be of genomic or cDNA origin, for instance obtained by preparing a genomic or cDNA library and screening for DNA sequences coding for all or part of the enzyme by hybridization using synthetic oligonucleotide probes in accordance with standard techniques (cf. Sambrook et al., supra ) .
The nucleic acid construct encoding the enzyme may also be prepared synthetically by established standard methods, e.g.
the phosphoamidite method described by Beaucage and Caruthers, Tetrahedron Letters 22 (1981), 1859 - 1869, or the method described by Matthes et al., EMBO Journal 3 (1984), 801 - 805. According to the phosphoamidite method, oligonucleotides are synthesized, e.g. in an automatic DNA
synthesizer, purified, annealed, ligated and cloned in suit-able vectors.
Furthermore, the nucleic acid construct may be of mixed synthetic and genomic, mixed synthetic and cDNA or mixed genomic and cDNA origin prepared by ligating fragments of synthetic, genomic or cDNA origin (as appropriate), the fragments corresponding to various parts of the entire nucleic acid construct, in accordance with standard tech-niques.
The nucleic acid construct may also be prepared by polymerase chain reaction using specific primers, for instance as described in US 4,683,202 or Saiki et al., Science 239 (1988), 487 - 491.
The nucleic acid construct is preferably a DNA construct which term will be used exclusively in this specification and claims.
Recombinant vector A recombinant vector comprising a DNA construct encoding the enzyme of the invention may be any vector which may conveni-ently be subjected to recombinant DNA procedures, and the choice of vector will often depend on the host cell into which it is to be introduced. Thus, the vector may be an autonomously replicating vector, i.e. a vector which exists as an extrachromosomal entity, the replication of which is independent of chromosomal replication, e.g. a plasmid.
Alternatively, the vector may be one which, when introduced into a host cell, is integrated into the host cell genome and replicated together with the chromosomes) into which it has been integrated.
The vector is preferably an expression vector in which the DNA sequence encoding the enzyme of the invention is operably linked to additional segments required for transcription of the DNA. In general, the expression vector is derived from plasmid or viral DNA, or may contain elements of both. The term, "operably linked" indicates that the segments are arranged so that they function in concert for their intended purposes, e.g. transcription initiates in a promoter and proceeds through the DNA sequence coding for the enzyme.
WO 96/11262 ~ ~, ~ ~ ~ ~ ~, PCTIDK95100400 The promoter may be any DNA sequence which shows transcriptional activity in the host cell of choice and may , be derived from genes encoding proteins either homologous or heterologous to the host cell.
Examples of suitable promoters for use in yeast host cells include promoters from yeast glycolytic genes (Hitzeman et al., J. $iol. Chem. 255 (1980), 12073 - 12080; Alber and Kawasaki, J. Mol. Appl. Gen. 1 (1982), 419 - 434) or alcohol dehydrogenase genes (Young et al., in Genetic Engineering of Microorganisms for Chemicals (Hollaender et al, eds.), Plenum Press, New York, 1982), or the TPI1 (US 4,599,311) or ADH2-4c (Russell et al., Nature 304 (1983), 652 - 654) promoters.
Examples of suitable promoters for use in filamentous fungus host cells are, for instance, the ADH3 promoter (McKnight et al., The EMBO J. 4 (1985), 2093 - 2099) or the tt~l.A promoter.
Examples of other useful promoters are those derived from the gene encoding A. oryzae TAKA amylase, Rhizomucor miehei aspartic proteinase, A. niger neutral a-amylase, A. niger acid stable cz-amylase, A. niger or A. awamori glucoamylase (gluA), Rhizomucor miehei lipase, A. oryzae alkaline protease, A. oryzae triose phosphate isomerase or A. nidulans acetamidase. Preferred are the TAKA-amylase and gluA promo-ters.
Examples of suitable promoters for use in bacterial host cells include the promoter of the Bacillus stearothermophilus maltogenic amylase gene, the Bacillus licheniformis alpha-amylase gene, the Bacillus amyloliquefaciens BAN amylase gene, the Bacillus subtilis alkaline protease gen, or the .
Bscillus pumilus xylosidase gene, or by the phage Lambda PR
or PL promoters or the E. coli lac, trp or tac promoters.
The DNA sequence encoding the enzyme of the invention may also, if necessary, be operably connected to a suitable terminator.
WO 96/11262 ~ ~ ~ ~ ~ ~ PCT/DK95/00400 t The recombinant vector of the invention may further comprise a DNA sequence enabling the vector to replicate in the host cell in question.
The vector may also comprise a selectable marker, e.g. a gene the product of which complements a defect in the host cell, such as the gene coding for dihydrofolate reductase (DHFR) or the Schizosaccharomyces pombe TPI gene (described by P.R.
Russell, Gene 40, 1985, pp. 125-130). For filamentous fungi, selectable markers include amdS, pyre, araB, niaD, sC.
To direct an enzyme of the present invention into the secre-tory pathway of the host cells, a secretory signal sequence (also known as a leader sequence, prepro sequence or pre sequence) may be provided in the recombinant vector. The secretory signal sequence is joined to the DNA sequence encoding the enzyme in the correct reading frame. Secretory signal sequences are commonly positioned 5' to the DNA
sequence encoding the enzyme. The secretory signal sequence may be that normally associated with the enzyme or may be from a gene encoding another secreted protein.
For secretion from yeast cells, the secretory signal sequence may encode any signal peptide which ensures efficient direc-tion of the expressed enzyme into the secretory pathway of the cell. The signal peptide may be naturally occurring signal peptide, or a functional part thereof, or it may be a synthetic peptide. Suitable signal peptides have been found to be the a-factor signal peptide (cf. US 4,870,008), the signal peptide of mouse salivary amylase (cf. O. Hagenbuchle et al., Nature 289, 1981, pp. 643-646), a modified carboxypeptidase signal peptide (cf. L.A. Valls et al., Cell 48, 1987, pp. 887-89?), the yeast BAR1 signal peptide (cf. WO
87/02670), or the yeast aspartic protease 3 (YAP3) signal peptide (cf. M. Egel-Mitani et al., Yeast 6, 1990, pp. 127-137) .
WD 96/11262 ~ ~ ~ ~ PCT/DK95/00400 For efficient secretion in yeast, a sequence encoding a leader peptide may also be inserted downstream of the signal , sequence and upstream of the DNA sequence encoding the enzyme. The function of the leader peptide is to allow the , 5 expressed enzyme to be directed from the endoplasmic reticulum to the Golgi apparatus and further to a secretory vesicle for secretion into the culture medium (i.e. exporta-tion of the enzyme across the cell wall or at least through the cellular membrane into the periplasmic space of the yeast 10 cell). The leader peptide may be the yeast a-factor leader (the use of which is described in e.g. US 4,546,082, EP 16 201, EP 123 294, EP 123 544 and EP 163 529). Alternatively, the leader peptide may be a synthetic leader peptide, which is to say a leader peptide not found in nature. Synthetic 15 leader peptides may, for instance, be constructed as described in WO 89/02463 or WO 92/11378.
For use in filamentous fungi, the signal peptide may conveni-ently be derived from a gene encoding an Aspergillus sp.
amylase or glucoamylase, a gene encoding a Rhizomucor miehei 20 lipase or protease, a Humicola lanuginosa lipase. The signal peptide is preferably derived from a gene encoding A. oryzae TAKA amylase, A. niger neutral a-amylase, A. niger acid-stable amylase, or A. niger glucoamylase.
The procedures used to ligate the DNA sequences coding for 25 the present enzyme, the promoter and optionally the termin-ator and/or secretory signal sequence, respectively, and to insert them into suitable vectors containing the information necessary for replication, are well known to persons skilled in the art (cf., for instance, Sambrook et al., op.cit.).
30 Host cells The DNA sequence encoding the present enzyme introduced into the host cell may be either homologous or heterologous to the WO 96/11262 ~ ~ ~ ~ ~ PCT/DK95/00400 host in question. If homologous to the host cell, i.e. pro-duced by the host cell in nature, it will typically be oper-ably connected to another promoter sequence or, if appli-cable, another secretory signal sequence and/or terminator sequence than in its natural environment. The term "homologous" is intended to include a cDNA sequence encoding an enzyme native to the host organism in question. The term "heterologous" is intended to include a DNA sequence not expressed by the host cell in nature. Thus, the DNA sequence l0 may be from another organism, or it may be a synthetic sequence.
The host cell into which the DNA construct or the recombinant vector of the invention is introduced may be any cell which is capable of producing the present enzyme and includes bacteria, yeast, fungi and higher eukaryotic cells.
Examples of bacterial host cells which, on cultivation, are capable of producing the enzyme of the invention are gram-positive bacteria such as strains of Bacillus, such as strains of B. subtilis, B. licheniformis, B. lentus, B.
brevis, B. stearothermophilus, B. alkalophilus, B.
amyloliquefaciens, B. coagulans, B. circulars, B. Zautus, B.
megatherium or B. thurangiez.~sis, or strains of Streptomyces, such as S. Iividans or S. murinus, or gram-negative bacteria such as ~cherichia coli. The transformation of the bacteria may be effected by protoplast transformation or by using competent cells in a manner known per se (cf. Sambrook et al., su ra).
When expressing the enzyme in bacteria such as E. coli, the enzyme may be retained in the cytoplasm, typically as insol-- 30 uble granules (known as inclusion bodies), or may be directed to the periplasmic space by a bacterial secretion sequence.
In the former case, the cells are lysed and the granules are recovered and denatured after which the enzyme is refolded by diluting the denaturing agent. In the latter case, the enzyme may be recovered from the periplasmic space by disrupting the cells, e.g. by sonication or osmotic shock, to release the contents of the periplasmic space and recovering the enzyme.
Examples of suitable yeasts cells include cells of Saccharomyces spp. or Schizosaccharomyces spp., in particular strains of saccharomyces cerevisiae or Saccharomyces kluyveri. Methods for transforming yeast cells with heterologous DNA and producing heterologous enzymes therefrom are described, e.g. in US 4,599,311, US 4,93,373, LAS
4,870,008, 5,037,743, and US 4,845,075. Transformed cells are selected by a phenotype determined by a selectable marker, commonly drug resistance or the abi,3,a~y to grow in the absence of a particular nutrient, e.g. leucine. A"preferred vector for use in yeast is the POT1 vector disclosed in US
4,931,373. The DNA sequence encoding the enzyme of the inven-tion may be preceded by a signal sequence and optionally a leader sequence , e.g. as described above. Further examples of suitable yeast cells are strains of Rluyveromyces, such as It. Iactis, Hansenula, e.g. H. polymorpha, or Pichia, e.g. P.
pastoris (cf. Gleeson et al., J. Gen. Microbial. 3.32, 7.986, pp. 3459-3465; US 4,882,279).
Examples of other fungal cells are cells of filamentous fungi, e.g. Aspergillus spp., Neurospora spp., Fusarium spp.
or Trichoderma spp., in particular strains of A. oryzae, A.
nidulans or A. niger. The use of Aspergillus spp. for the expression of proteins is described in, e.g., EP 272 277, EP
230 023. The transformation of F. oxysporum may, for instance, be carried out as described by Malardier et al., 1989, Gene 78: 147-156.
When a filamentous fungus is used as the host cell, it may be transformed with the DNA construct of the invention, conveni-ently by integrating the DNA construct in the host chromosome to obtain a recombinant host cell. This integration is . ... ~~. . ~,. _.__._ .~ _ T ..
___....
.~. _~ .__.... ..~ . _. ....
WO 96/11262 i ~ PCT/DK95/00400 generally considered to be an advantage as the DNA sequence is more likely to be stably maintained in the cell. Integra-tion of the DNA constructs into the host chromosome may be performed according to conventional methods, e.g. by homologous or heterologous recombination.
The transformed or transfected host cell described above is then cultured in a suitable nutrient medium under conditions permitting the expression of the present enzyme, after which the resulting enzyme is recovered from the culture.
The medium used to culture the cells may be any conventional medium suitable for growing the host cells, such as minimal or complex media containing appropriate supplements. Suitable media are available from commercial suppliers or may be prepared according to published recipes (e. g. in catalogues of the American Type Culture Collection). The enzyme produced by the cells may then be recovered from the culture medium by conventional procedures including separating the host cells from the medium by centrifugation or filtration, precipitat-ing the proteinaceous components of the supernatant or fil-trate by means of a salt, e.g. ammonium sulphate, purifica-tion by a variety of chromatographic procedures, e.g. ion exchange chromatography, gel filtration chromatography, affinity chromatography, or the like, dependent on the type of enzyme in question.
In a still further aspect, the present invention relates to treatment of cellulose or cellulosic material with an enzyme preparation, which is enriched in an enzyme exhibiting endoglucanase activity as described above.
For example, the enzyme preparation of the present invention is useful for the degradation or modification of plant cell wall containing materials, said preparation being enriched in an enzyme with endoglucanase activity as described above.
The enzyme preparation having been enriched with an enzyme of WO 96/11262 PCTlDK95100400 the invention may e.g. be an enzyme preparation comprising multiple enzymatic activities, in particular an enzyme pre-paration comprising multiple plant cell wall degrading enzymes such as Pectinex~, Pectinex Ultra SP~, Celluclast* ox Celluzyme*(all available from Novo Nordisk A/S). In the present context, the term "enriched" is intended to indicate that the endoglucanase activity of the enzyme preparation has been increased, e.g. with an enrichment factor of at least 1.1, conveniently due to addition of an enzyme of the inven-tion prepared by the method described above.
Alternatively, the enzyme preparation enriched in an enzyme with cellulolytic (endoglucanase) activity may be one which comprises an enzyme of the invention as the major enzymatic component, e.g. a mono-component enzyme preparation.
The screening and expression cloning may be carried out using the following:
MATERIALS AND METHODS
Donor organism: mRNA was isolated from Acremonium sp., CBS
478.94, and Acremon3um sp., CBS 265.95, respectively, grown in a cellulose-containing fermentation medium with agitation to ensure sufficient aeration. Mycelia were harvested after 4-6 days' growth, immediately frozen in liquid nitrogen and stored at -80°C.
Yeast strains: The Saccharomyces cerevisiae strain used was yNG231 (MAT a, leu2, ura3-52, his4-539, pep4-delta 1, cir+) or JG169 (MATa; ura 3-52; leu 2-3, 112; his 3-D200; pep 4-1137; prcl::HIS3; prbl:: LEU2; cir+).
Flasmids: The expression plasmid pYHDl7 containing the yeast TPI promoter was prepared from the commercially available plasmid pYES*2.0 (Invitrogen). The plasmid and the construc-* = TM
tion thereof is further described in WO 93/11249.
- The Asperg~Ilus expression vector pHD414 is a derivative of the plasmid p775 (described in EP 238 023). The construction 5 of pHD414 is further described in WO 93/11249.
Extraction of total RNA was performed with guanidinium thiocyanate followed by ultracentrifugation through a 5.7 M
CsCl cushion, and isolation of poly(A)*RNA was carried out by oligo(dT)-cellulose affinity chromatography using the pro-10 cedures described in WO 94/14953.
aDNA synthesis and modification: Double-stranded cDNA was synthesized from 5 ~cg of poly(A)* RNA by the RNase H method (Gubler & Hoffman 1983, Sambrook et al., 1989) using the hair-pin modification. The procedure is further described in 15 WO 95/02043. After having been treated with mung bean nuclease (Bethesda Research Laboratories), the ds cDNA was blunt-ended with T4 DNA polymerase (Invitrogen) and the cDNA
was ligated to non-palindromic BstX I adaptors (Invitrogen) as described in WO 95/02043.
20 Construction of cDNA libraries: The adapted, ds cDNA was re-covered by centrifugation, washed in 70% EtOH and resuspended in 25 ml Hzo. Prior to large-scale library ligation, four test ligations were carried out in l0 ~C1 of ligation buffer (same as above) each containing 1 ~.1 ds cDNA (reaction tubes 25 #1 - #3), 2 units of T4 ligase (Invitrogen) and 50 ng (tube #1), 100 ng (tube #2) and 200 ng (tubes #3 and #4) Bst XI
cleaved yeast expression vector (either pYES 2.0 vector Invitrogen or pYHDl7).
Using the optimal conditions a large-scale ligation was set 30 up in 40 ~C1 of ligation buffer. One ~l aliquots were traps-formed into electrocompetent E. coli 1061 cells, and the transformed cells were titered and the library plated on LB +
ampicillin plates with 5000-7000 c.f.u./plate. To each plate was added 3 ml of medium. The bacteria were scraped off, 1 ml glycerol was added and stored at -80°C as pools. The remain-ing 2 ml were used for DNA isolation. For further details reference is made to WO 95/02043.
constructioa of yeast libraries: To ensure that all the bacterial clones were tested in yeast, a number of yeast transformants 5 times larger than the number of bacterial clones in the original pools was set as the limit.
One ~,1 aliquots of purified plasmid DNA (100 ng/~,1) from individual pools were electroporated (200 fl, 1.5 kV, 25 ~,F) into 40 ~C1 competent S. cerevisiae JG 169 cells (OD600 s 1.5 in 500 ml YPD, washed twice in cold DIW, once in cold 1 M
sorbitol, resuspended in 0.5 ml I M sorbitol, (Becker &
Guarante, 1991). After addition of 1 ml 1M cold sorbitol, 80 ~,1 aliquots were plated on SC + glucose - uracil agar plates to give 250-5oo c.f.u./plate and incubated at 30°C for 3-5 days.
Identification of positive colonies: After 3-5 days of growth, the agar plates were replica plated onto several sets of SC + galactose-uracil agar plates. One set of the replica plates contained 0.1% AZCL HE cellulose. These plates were incubated for 3-7 days at 30°C. Endoglucanase positive col-onies were identified as colonies surrounded by a~blue halo.
Cells from enzyme-positive colonies were spread for single colony isolation on agar, and an enzyme-producing single colony was selected for each of the endoglucanase-producing colonies identified.
Characterization of positive clones: The positive clones were obtained as single colonies, the cDNA inserts were amplified directly from the yeast colony using biotinylated polylinker primers, purified by magnetic beads (Dynabead M-280*,Dynal) * = TM
system and characterized individually by sequencing the 5'-end of each cDNA clone using the chain-termination method (Sanger et al., 29'77) and the Sequenase*system (United States Biochemical).
Isolation of a cDNA gene for expression in Aspergillus:
one or more endoglucanase-producing yeast colonies was inocu-lated into 20 ml YPD broth in a 50 ml glass test tube. The tube was shaken for Z days at 30°C. The cells were harvested by centrifugation for l0 min. at 3000 rpm.
DNA was isolated according to WO 94/14953 and dissolved in 50 ~.1 water. The DNA was transformed into E. coli by standard procedures. Plasmid DNA was isolated from E. coli using standard procedures, and analyzed by restriction enzyme analysis. The cDNA insert was excised using appropriate re-striction enzymes and ligated into an Aspergillus expression vector.
Transformation of Aspergfllus oryzae or ~lspergillus nigex Protoplasts may be prepared as described in WO 95/02043, p.
16, line 21 - page 17, line 12:~
100 gel of protoplast suspension is mixed with 5-25 ~.g of the appropriate DNA in 10 ~Cl of STC (1.2 M sorbitol, 1o mM Tris-HC1, pH = 7.5, 10 mM CaCl2). Protoplasts are mixed with p3SR2 . (an A. njduZans amdS gene carrying plasmid). The mixture is left at room temperature for 25 minutes. 0.2 ml of 60% PEG
4000 (BDH 29576), to mM CaClz and 10 mM Tris-HC1, pH 7.5 is . added and carefully mixed (twice) and finally 0.85 ml of the same solution is added and carefully mixed. The mixture is . left at room temperature for 25 minutes, spun a~ 7_500 g for 15 minutes and the pellet is resuspended in 2 ml of 1.2 M
sorbitol: After one more sedimentation the protoplasts are spread on minimal plates (Cove, Biochem. Biophys. Acta 113 (1966) 51-56) containing 1.0 M sucrose, pH 7.0, 10 mM
* = TM
WO 96/11262 ,, ~ PCT/DK95/00400 acetamide as nitrogen source and 20 mM CsCl to inhibit back-ground growth. After incubation for 4-7 days at 37°C spores are picked and spread for single colonies. This procedure is repeated and spores of a single colony after the second reisolation is stored as a defined transformant.
Test of A. oryzae transformants Each of the transformants were inoculated in 10 ml YPM and propagated. After 2-5 days of incubation at 37°C, 10 ml supernatant was removed. The endoglucanase activity was identified by AZCL HE cellulose or AZCL ~i-glucan as described above.
Hybridization conditions (to be used in evaluating property i) of the DNA construct of the invention):
Suitable conditions for determining hybridization between an oligonucleotide probe and an "analogous'° DNA sequence involves presoaking of the filter containing the DNA frag-ments to hybridize in 5xSSC and prehybridizing for 1 h at --50°C in a solution of SxSSC, SxDenhardt's solution, 50 mM
sodium phosphate, pH 6.8, and 50 ~g of denatured sonicated calf thymus DNA, followed by hybridization in the same sol-ution supplemented with 50 ~Ci 32-P-dCTP labelled probe for 18 h at ~50°C followed by washing three times in 2xSSC, 0.2~
SDS at 50°C for 30 minutes.
- A suitable oligonucleotide probe to be used in the hybridiza-tion may be prepared on the basis of the DNA sequence shown in SEQ ID No . 1 ( or 2 or 3 or 4 or ~ 5 or 6 or 7 ) .
Immunological cross-reactivity: Antibodies to be used in determining immunological cross-reactivity may be prepared by use of a purified endoglucanase. More specifically, antiserum against the endoglucanase of the invention may be raised by immunizing rabbits (or other rodents) according to the pro-cedure described by N. Axelsen et al. in: A Manual of Quanti-tative Immunoelectrophoresis,J, Blackwell Scientific Publica-R'O 96!11262 ~ PCT/DK95100400 tions, 1973, Chapter 23, or A. Johnstone and R. Thorpe, Immunochemistry in Practice, Blackwell Scientific Publica-tions, 1982 (more specifically pp. 27-31). Purified immunoglobulins may be obtained from the antisera, for example by salt precipitation ((NH4)2 S04), followed by dia-lysis and ion exchange chromatography, e.g. on DEAF-sephadex*.
Immunochemical characterization of proteins may be done either by outcherlony double-diffusion analysis (O.
Ouchterlony in: Handbook of Exberimental Immunology.(D.M.
l0 Weir, Ed.), Blackwell Scientific Publications, 1967, pp. 655 706), by crossed immunoelectroprcresis (N. Axelsen ,e~ al., su a, Chapters 3 and 4), or by rocket immunoelectrophoresis (N. Axelsen et al., Chapter 2).
Media YPD: 10 g yeast extract, 20 g peptone, Hz0 to 900 ml.
Autoclaved, 100 ml 20% glucose (sterile filtered) added.
YPM: 10 g yeast extract, 20 g peptone, HZO to 900 ml.
Autoclaved, 100 ml 20% maltodextrin (sterile filtered) added.
l0 x Basal salt: 75 g yeast nitrogen base, 113 g succinic acid, 68 g NaOH, H20 ad 1000 ml, sterile filtered.
SC-URA: 100 ml l0 x Basal salt, 28 ml 20% casaminv acids without vitamins, 10 ml 1% tryptophan, H20 ad 900 ml, autoclaved, 3.6 ml 5% threonine and 100 ml 20% glucose or 20%
galactose added.
SC-URA agar: SC-URA, 20 g/1 agar added.
AZCL ~B-glucan, AZCL xyloglucan, AZCL HE cellulose (Megazyme, Australia).
* = TM
WO 96!11262 ~ ~, 0 ~ ~ , , PCT/DK95/00400 Uses detergent Compositions According to the invention, the cellulase may typically be a component of a detergent composition. As such, it may be 5 included in the detergent composition in the form of a non-dusting granulate, a stabilized liquid, or a protected enzyme. Non-dusting granulates may be produced, e.g., as disclosed in US 4,106,991 and 4,661,452 (both to Novo Industri A/S) and may optionally be coated by methods known 10 in the art. Examples of waxy coating materials are polyethylene oxide) products (polyethyleneglycol, PEG) with mean molecular weights of 1000 to 20000; ethoxylated nonyl-phenols having from 16 to 50 ethylene oxide units;
ethoxylated fatty alcohols in which the alcohol contains from 15 12 to 20 carbon atoms and in which there are 15 to 80 ethylene oxide units; fatty alcohols; fatty acids; and mono-and di- and triglycerides of fatty acids. Examples of film-forming coating materials suitable for application by fluid bed techniques are given in patent GB 1483591. Liquid enzyme 20 preparations may, for instance, be stabilized by adding a polyol such as propylene glycol, a sugar or sugar alcohol, lactic acid or boric acid according to established methods.
Other enzyme stabilizers are well known in the art. Protected enzymes may be prepared according to the method disclosed in 25 EP 238,216.
The detergent composition of the invention may be in any convenient form, e.g. as powder, granules, paste or liquid. A
liquid detergent may be aqueous, typically containing up to 70~ water and 0-30~ organic solvent, or nonaqueous.
30 The detergent composition comprises one or more surfactants, each of which may be anionic, nonionic, cationic, or zwitterionic. The detergent will usually contain 0-50~ of anionic surfactant such as linear alkylbenzenesulfonate WO 96/1262 ~: ~ °~ ~ ~ °~ PCT/DK95/00400 (LAS), alpha-olefinsulfonate (AOS), alkyl sulfate (fatty alcohol sulfate) (AS), alcohol ethoxysulfate (AEOS or AES), secondary alkanesulfonates (SAS), alpha-sulfo fatty acid methyl esters, alkyl- or alkenylsuccinic acid, or soap. It may also contain 0-40% of nonionic surfactant such as alcohol ethoxylate (AEO or AE), carboxylated alcohol ethoxylates, nonylphenol ethoxylate, alkylpolyglycoside, alkyldimethylamine oxide, ethoxylated fatty acid monoethanol-amide, fatty acid monoethanolamide, or polyhydroxy alkyl fatty acid amide (e. g. as described in WO 92/06154).
The detergent composition may additionally comprise one or more other enzymes such as amylase, lipase, cutinase, protease, peroxidase, and oxidase, e.g. laccase).
The detergent may contain 1-65% of a detergent builder or complexing agent such as zeolite, diphosphate, triphosphate, phosphonate, citrate, nitrilotriacetic acid (NTA), ethylene-diaminetetraacetic acid (EDTA), diethylenetriaminepentaacetic acid (DTMPA), alkyl- or alkenylsuccinic acid, soluble sili-cates or layered silicates (e.g. SKS-6 from Hoechst). The detergent may also be unbuilt, i.e. essentially free of detergent builder.
The detergent may comprise one or more polymers. Examples are carboxymethylcellulose (CMC), poly(vinylpyrrolidone) (PVP), polyethyleneglycol (PEG), polyvinyl alcohol) (PVA), poly-carboxylates such as polyacrylates, maleic/acrylic acid copolymers and lauryl methacrylate/acrylic acid copolymers.
The detergent may contain a bleaching system which may com-prise a H~O~ source such as perborate or percarbonate which may be combined with a peracid-forming bleach activator such as tetraacetylethylenediamine (TAED) or nonanoyloxybenzene-sulfonate (HOBS). Alternatively, the bleaching system may comprise peroxyacids of, e.g., the amide, imide, or sulfone type.
WO 96!11262 ~ ~ ~ ~ PCT/DK95/00400 The enzymes of the detergent composition of the invention may be stabilized using conventional stabilizing~agents, e.g. a polyol such as propylene glycol or glycerol, a sugar or sugar alcohol, lactic acid, boric acid, or a boric acid derivative such as, e.g., an aromatic borate ester, and the composition may be formulated as described in, e.g., WO 92/19709 and WO
92/19708.
The detergent may also contain other conventional detergent ingredients such as, e.g., fabric conditioners including clays, foam boosters, suds suppressors, anti-corrosion agents, soil-suspending agents, anti-soil-redeposition agents, dyes, bactericides, optical brighteners, or perfume.
The pH (measured in aqueous solution at use concentration) will usually be neutral or alkaline, e.g. in the range of 7-11.
Particular forms of detergent compositions within the scope of the invention include:
1) A detergent composition formulated as a granulate having a bulk density of at least 600 g/1 comprising WO 96/11262 ~ ~ ~ ~ PCT/DK95/00400 r Linear alkylbenzenesulfonate (cal- 7, - 12~
culated as acid) Alcohol ethoxysulfate (e. g. C12_is alcohol, 1-2 EO) or alkyl sulfate 1 - 4~
(e. g. Cl~,is) Alcohol ethoxylate (e.g. Cl15 alco-hol, 7 EO) 5 - 9~
Sodium carbonate (as Na2C03) 14 - 20~
Soluble silicate (as Na20,2Si0~) 2 - 6~
Zeolite (as NaA1Si04) 15 - 220 Sodium sulfate (as NaZS04) 0 - 6~
Sodium citrate/citric acid ( a s C6HSNa30~ / C6H80~ ) 0 - 15 ~
Sodium perborate (as NaB03.H~0) il - 18%
TAED 2 - 6~
Carboxymethylcellulose 0 - 2~
Polymers (e. g. maleic/acrylic acid copolymer, PVP, PEG) 0 - 3~
Enzymes (calculated as pure enzyme 0.0001 - 0.1~
2o protein) Minor ingredients (e. g. suds suppressors, perfume, optical 0 - 5~
brightener, photobleach) WO 96/11262 ~ , PCT/DK95/00400 2) A detergent composition formulated as a granulate having a bulk density of at least 600 g/1 comprising Linear alkylbenzenesulfonate (cal-culated as acid) 6 - 11%
Alcohol ethoxysulfate (e.g. C12_is alcohol, 1-2 EO or alkyl sulfate I - 3%
(e.g. CI~.IS) Alcohol ethoxylate (e.g. Clls alco-hol, 7 EO) 5 - g%
Sodium carbonate (as NazC03) 15 - 21%
Soluble silicate (as Na20,2Si02) 1 - 4%
Zeolite (as NaAlSi04) 24 - 34%
Sodium sulfate (as Na2S04) 4 - 10%
Sodium citrate/citric acid ( a s C6HsNa30~ / C6Hg0~ ) 0 - 15 %
Carboxymethylcellulose 0 - 2%
Polymers (e. g. maleic/acrylic acid copolymer, PVP, PEG) 1 - 6%
Enzymes (calculated as pure enzyme 0.0001 - 0.1%
protein) Minor ingredients (e.g. suds 0 - 5%
suppressors, perfume) WD 96111262 ~ ~ ~ °~ ~ ~ '~ PCTlDK95/00400 3) A detergent composition formulated as a granulate having a bulk density of at least 600 g/1 comprising Linear alkylbenzenesulfonate (cal- 5 - 9%
culated as acid) 5 Alcohol ethoxylate (e.g. C12-is alco-hol, 7 EO) 7 - 14%
Soap as fatty acid (e.g. C,~,~ fatty 1 - 3%
acid) Sodium carbonate (as Na2C03) 10 -10 Soluble silicate (as Na~0,2Si02) 3 - g%
Zeolite (as NaA1Si04) 23 - 33%
Sodium sulfate (as NaZS04) 0 - 4%
Sodium perborate (as NaB03.H20) 8 - 16%
TAED 2 - 8%
15 Phosphonate (e.g. EDTMPA) 0 - 1%
Carboxymethylcellulose 0 - 2%
Polymers (e. g. maleic/acrylic acid copolymer, PVP, PEG) 0 - 3%
Enzymes (calculated as pure enzyme 0.0001 - 0.1%
20 protein) Minor ingredients (e. g. suds suppressors, perfume, optical p - 5%
bra.ghtener) WO 96/11262 ~ ~ . , PCT/DK95100400 4) A detergent composition formulated as a granulate having a bulk density of at least 600 g/1 comprising Linear alkylbenzenesulfonate (cal- 8 - 12%
culated as acid) Alcohol ethoxylate (e.g. Clz-is alco-hol, 7 EO) 10 - 25%
Sodium carbonate (as Na2C03) 14 - 22%
Soluble silicate (as Na20,2Si02) 1 - 5%
Zeolite (as NaA1Si04) 25 - 35%
Sodium sulfate (as Na2S04) 0 - 10%
Carboxymethylcellulose 0 - 2%
Polymers (e. g. maleic/acrylic acid copolymer, PVP, PEG) 1 - 3%
Enzymes (calculated as pure enzyme 0.0001 - 0.1%
protein) Minor ingredients (e.g. suds 0 - 5%
suppressors, perfume) WO 96/11262 '~ PCTlDK95/00400 4~
5) An aqueous liquid detergent composition comprising Linear alkylbenzenesulfonate (cal- 15 21%
culated as acid) Alcohol ethoxylate (e. g. Ciz-is alco-hol, 7 EO or C,z-is alcohol, 5 EO) 12 - 18%
Soap as fatty acid (e.g. oleic 3 13%
acid) -Alkenylsuccinic acid (Clz-ia) 0 - 13%
Aminoethanol 8 - 18%
l0 Citric acid 2 - 8%
Phosphonate o - 3%
Polymers (e.g. PVP, PEG) 0 - 3~
Borate ( as B40~) 0 - 2 %
Ethanol 0 - 3~
Propylene glycol 8 - 14%
Enzymes (calculated as pure enzyme o.oool - o.i%
protein) Minor ingredients (e. g.
dispersants, suds suppressors, 0 - 5%
perfume, optical brightener) R'U 96/11262 ~ j - ~ PCTIDK95/00400 6) An aqueous structured liquid detergent composition com-prising Linear alkylbenzenesulfonate (calculated as acid) 15 - 21%
Alcohol ethoxylate (e.g. C1z_is alcohol, 7 EO, or Cla-isalcohol, 5 3 - 9%
EO) Soap as fatty acid (e.g. oleic 3 - 10%
acid) Zeolite (as NaA1Si04) 14 - 22%
Potassium citrate 9 - 18%
Borate (as B40~) 0 - 2 %
Carboxymethylcellulose 0 - 2%
Polymers (e.g. PEG, PVP) 0 - 3%
Anchoring polymers such as, e.g., lauryl methacrylate/acrylic acid 0 - 3%
copolymer; molar ratio 25:1; MW
Glycerol 0 - 5%
Enzymes (calculated as pure 0.0001 - 0.1%
enzyme protein) Minor ingredients (e. g.
dispersants, suds suppressors, 0 - 5%
perfume, optical brighteners) R'O 96/11262 ~ ~ ~ PCT/DK95/00400 7) A detergent composition formulated as a granulate having a bulk density of at least f00 g/1 comprising Fatty alcohol sulfate 5 - 10%
Ethoxylated fatty acid monoethanol- 3 9%
amide -Soap as fatty acid 0 - 3%
Sodium carbonate (as NaZC03) 5 - io%
Soluble silicate (as Na20,2SiOz) 1 _ 4%
Zeolite (as NaA1Si04) 20 - 40%
1o Sodium sulfate (as Na2S04) 2 - 8%
Sodium perborate (as NaB03.Fi20) 12 - 1$%
TAED 2 - 7%
Polymers (e.g. maleic/acrylic acid 1 copolymer, PEG) 5%
Enzymes (calculated as pure enzyme 0.0001 0.1%
protein) -Minor ingredients (e. g. optical brightener, suds suppressors, per- 0 5%
fume) -WO 96!11262 ~ ~ °~ ~' PCT/DK95/00400 8) A detergent composition formulated as a granulate compris-ing Linear alkylbenzenesulfonate (calculated as acid) 8 - 14%
5 Ethoxylated fatty acid 5 - 11$
monoethanolamide Soap as fatty acid 0 - 3~
Sodium carbonate (as Na2C03) 4 - 10 Soluble silicate (as Na20,2Si02) 1 - 4~
10Zeolite (as NaA1Si04) 30 - 50~
Sodium sulfate (as NaZS04) 3 - 11~
Sodium citrate (as C6HSNa30~) 5 - 12~
Polymers (e.g. PVP, maleic/acrylic 1 - 5~
acid copolymer, PEG) 15Enzymes (calculated as pure enzyme 0.0001 - 0.1~
protein) Minor ingredients (e.g. suds 0 - 5~
suppressors, perfume) t~ WO 96/11262 ~ ~ PCT/DK95/00400 9) A detergent composition formulated as a granulate compris-ing ' Linear alkylbenzenesulfonate (calculated as acid) 6 - 12~
Nonionic surfactant 1 - 4~
Soap as fatty acid 2 - s Sodium carbonate (as NazC03) 14 Zeolite (as NaA1Si04) 18 -32~
Sodium sulfate (as Na2S04) 5 - 20~
Sodium citrate (as C6HSNa30~) 3 Sodium perborate (as NaB03.H20) 4 _ Bleach activator (e.g. NOBS or 1 - 50 TAED ) Carboxymethylcellulose 0 -2~
Polymers (e.g. polycarboxylate or 1 -PEG ) Enzymes (calculated as pure enzyme 0.0001 - o.
protein) Minor ingredients (e.g. optical 0 - 5%
brightener, perfume) WO 96!11262 PCT/DK95I00400 X20 1~' °~.
10) An aqueous liquid detergent composition comprising Linear alkylbenzenesulfonate (calculated as acid) 15 - 23%
Alcohol ethoxysulfate (e.g. Clz_ls alcohol, 2-3 EO) 8 - 15%
Alcohol ethoxylate (e.g. Clz-is al-cohol, 7 EO, or CIZ-isalcohol, 5 3 - 9%
EO) Soap as fatty acid (e.g. lauric 0 - 3%
acid) Aminoethanol 1 - 5%
Sodium citrate 5 - 10%
Hydrotrope (e.g. sodium 2 - 6%
toluensulfonate) Borate ( as B40~) 0 - 2 Carboxymethylcellulose 0 - 1%
Ethanol 1 - 3%
Propylene glycol 2 - 5%
Enzymes (calculated as pure 0.0001 - 0.1%
enzyme protein) Minor ingredients (e. g. polymers, dispersants, perfume, optical 0 - 5%
brighteners) WO 96/11262 '~ '~ PCT/DK95100400 11) An aqueous liquid detergent composition comprising Linear alkylbenzenesulfonate - (calculated as acid) 20 - 32~
Alcohol ethoxylate (e.g. Ciz-~s alco-hol, 7 EO, or Clz-is alcohol, 5 EO) 6 - 12~
Aminoethanol 2 - 6%
Citric acid 8 - 14~
Borate ( as B40z) 1 - 3 ~
Polymer (e. g. maleic/acrylic acid copolymer, anchoring polymer such as, e.g., lauryl methacrylate- o - 3~
/acrylic acid copolymer) Glycerol 3 - 8%
Enzymes (calculated as pure enzyme 0.0001 - 0.1~
protein) Minor ingredients (e. g. hydro-tropes, dispersants, perfume, 0 - 5$
optical brighteners) WO 96/11262 ~ ~ ~ ~ PCT/DK95100400 12) A detergent composition formulated as a granulate having a bulk density of at least 600 g/1 comprising Anionic surfactant (linear alkylbenzenesulfonate, alkyl sulfate, alpha-olefinsulfonate, 25 - 40~
alpha-sulfo fatty acid methyl esters, alkanesulfonates, soap) Nonionic surfactant (e.g. alcohol 1 - 10%
ethoxylate) Sodium carbonate (as NazC03) 8 - 25~
Soluble silicates (as Na20, 2Si0z) 5 - 15%
Sodium sulfate (as Na2S04) 0 - 5~
Zeolite (as NaA1Si04) 15 - 28%
Sodium perborate (as NaB03.4H20) 0 - 20~
Bleach activator (TAED or NOBS) 0 - 5~
Enzymes (calculated as pure enzyme 0.0001 - 0.1~
protein) Minor ingredients (e.g. perfume, 0 - 3~
optical brighteners) 13) Detergent formulations as described in 1) - 12) wherein all or part of the linear alkylbenzenesulfonate is replaced by (C,~-C18) alkyl sulfate.
WO 96/11262 ~ ~ ~ ~ PCT/DK95/00400 14) A detergent composition formulated as a granulate having a bulk density of at least 600 g/1 comprising - (C12-C,g) alkyl sulfate 9 - 15~
Alcohol ethoxylate 3 5 Polyhydroxy alkyl fatty acid amide 1 - 5~
Zeolite (as NaA1Si04) 10 -20~
Layered disilicate (e. g. SK56 from Hoechst) 10 - 20%
Sodium carbonate ( as Na2C03) 3 - 12 ~
10 Soluble silicate (as Na~0,2Si02) 0 Sodium citrate 4 - 80 Sodium percarbonate 13 - 22~
TAED 3 - 8~
Polymers (e.g. polycarboxylates and 0 -15 PVP=
Enzymes (calculated as pure enzyme 0.0001 - 0.1~
protein) Minor ingredients (e. g. optical 20 brightener, photo bleach, perfume, 0 - 5~
suds suppressors) WO 96/11262 ~ ~ ~ '~ ~ ~ PCTIDK95/00400 15) A detergent composition formulated as a granulate having a bulk density of at least 600 g/1 comprising , alkyl sulfate 4 - 8% -Alcohol ethoxylate 11 - 15%
Soap 1 - 4%
Zeolite MAP or zeolite A 35 - 45%
Sodium carbonate ( as Na2C03 ) 2 - 8 Soluble silicate (as Na20,2Si02) 0 - 4%
Sodium percarbonate 13 - 22%
TAED 1 - 8%
Carboxymethyl cellulose 0 - 3%
Polymers (e.g. polycarboxylates and 0 - 3%
PVP) Enzymes (calculated as pure enzyme 0.0001 - 0.1%
protein) Minor ingredients (e.g. optical 0 - 3%
brightener, phosphonate, perfume) 16) Detergent formulations as described in 1) - 15) which contain a stabilized or encapsulated peracid, either as an additional component or as a substitute for already specified bleach systems.
17) Detergent compositions as described in 1), 3), 7), 9) and 12) wherein perborate is replaced by percarbonate.
18) Detergent compositions as described in 1), 3), 7), 9), 12), 14) and 15) which additionally contain a manganese catalyst. The manganese catalyst may, e.g., be one of the compounds described in "Efficient manganese catalysts for low-temperature bleaching", Nature 369, 1994, pp. 637-639.
19) Detergent composition formulated as a nonaqueous deter-gent liquid comprising a liquid nonionic surfactant such as, WO 96111262 ~ ~ ~ 't PCT/DK95/00400 e.g., linear alkoxylated primary alcohol, a builder system (e. g. phosphate), enzyme and alkali. The detergent may also comprise anionic surfactant and/or a bleach system.
The cellulase of the invention may be incorporated in concen-trations conventionally employed in detergents. It is at present contemplated that, in the detergent composition of the invention, the cellulase may be added in an amount corre-sponding to 0.00001-1 mg (calculated as pure enzyme protein) of cellulase per liter of wash liquor.
l0 Pulp and paper applications In the papermaking pulp industry, the enzyme preparation according to the invention may be applied advantageously e.g.
as follows:
- For debarking: pretreatment with the enzyme preparation according to the invention may degrade the cambium layer prior to debarking in mechanical drums resulting in advan-tageous energy savings.
- For defibration: treatment of a material containing cellulosic fibers with the enzyme preparation of the inven-tion prior to refining or beating may result in reduction of the energy consumption due to the hydrolysing effect of the cellulase on the interfibre surfaces. Use of the enzyme preparation of the invention may result in improved energy savings as compared to the use of known enzymes, since it is believed that the enzyme composition of the invention may possess a higher ability to penetrate fibre walls.
- For fibre modification, i.e. improvement of fibre prop-erties where partial hydrolysis across the fibre wall is needed which requires deeper penetrating enzymes (e.g. in order to make coarse fibers more flexible). Deep treatment of 1120 ' PCT/DK95I00400 fibers has so far not been possible for high yield pulps e.g.
mechanical pulps or mixtures of recycled pulps. This has been ascribed to the nature of the fibre wall structure that prevents the passage of enzyme molecules due to physical restriction of the pore matrix of the fibre wall. It is contemplated that the enzyme composition of the invention is capable of penetrating into the fibre wall.
- For drainage improvement. The drainability of papermaking pulps may be improved by treatment of the pulp with hydrolysing enzymes, e.g. cellulases. Use of the enzyme preparation according to the invention may be more effective, e.g. result in a higher degree of loosening bundles of strongly hydrated micro-fibrils in the fines fraction (con-sisting of fibre debris) that limits the rate of drainage by blocking hollow spaces between fibers and in the wire mesh of the paper machine. The Canadian standard freeness (CSF) increases and the Schopper-Riegler drainage index decreases when pulp in subjected to cellulose treatment, see e.g. US
patent 4,923,565; TAPPI T227, SCAN C19:65..
- For inter fibre bonding. Hydrolytic enzymes are applied in the manufacture of papermaking pulps for improving the inter fibre bonding. The enzymes rinse the fibre surfaces for impurities e.g. cellulosic debris, thus enhancing the area of exposed cellulose with attachment to the fibre wall, thus improving the fibre-to-fibre hydrogen binding capacity. This process is also referred to as dehornification. Paper and board produced with a cellulose containing enzyme preparation according to the invention may have an improved strength or a reduced grammage, a smoother surface and an improved printability. These improvements are believed to be a result of ~" a improved penetrability of the modified/derivatised enzyme(s).
- For enzymatic deinking. Partial hydrolysis of recycled ._....-.~.r_. . __.."~",_, . ._~_~.._ . _ ____._._.._..__ WO 96/11262 ~ ~ '~ PCTlDK95/00400 paper during or upon pulping by use of hydrolysing enzymes such as cellulases are known to facilitate the removal and agglomeration of ink particles. Use of the enzyme preparation according to the invention may give a more effective loosen-s ing of ink from the surface structure due to a better pen-etration of the enzyme molecules into the fibrillar matrix of the fibre wall, thus softening the surface whereby ink par-ticles are effectively loosened. The agglomeration of loosened ink particles are also improved, due to a more efficient hydrolysis of cellulosic fragments found attached to ink particles originating from the fibres.
The treatment of lignocellulosic pulp may, e.g., be performed as described in WO 91/14819, WO 91/14822, WO 92/17573 and WO
92/18688.
Textile applications In another embodiment, the present invention relates to use of the enzyme preparation according to the invention in the bio-polishing process. Bio-Polishing is a specific treatment of the yarn surface which improves fabric quality w~.th respect to handle and appearance without loss of fabric wettability. The most important effects of Bio-Polishing can be characterized by less fuzz and pilling, increased gloss/luster, improved fabric handle, increased durable softness and altered water absorbency. Bio-Polishing usually takes place in the wet processing bf the manufacture of knitted and woven fabrics. Wet processing comprises such steps as e.g. desizing, scouring, bleaching, washing, dying/printing and finishing. During each of these steps, the fabric is more or less subjected to mechanical action. In general, after the textiles have been knitted or woven, the fabric proceeds to a desizing stage, followed by a scouring stage, etc. Desizing is the act of removing size from tex-tiles. Prior to weaving on mechanical looms, warp yarns are WO 9G/11262 ~ ~ ~ - PCT/DK95/00400 often coated with size starch or starch derivatives in order to increase their tensile strength. After weaving, the size coating must be removed before furt~er processing the fabric in order to ensure a homogeneous and wash-proof result. It is 5 known that in order to achieve the effects of Bio-Polishing, a combination of cellulolytic and mechanical action is required. It is also known that "super-softness" is achiev-able when the treatment with cellulase is combined with a conventional treatment with softening agents. It is contem-10 plated that use of the enzyme preparation of the invention for bio-polishing of cellulosic fabrics is advantageous, e.g.
a more thorough polishing can be achieved. Bio-polishing may be obtained by applying the method described e.g. in WO
93/20278.
15 Stone-washina .It is known to provide a "stone-washed" look (localized abrasion of the colour) in dyed fabric, especially in denim fabric or jeans, either by washing the denim or jeans made from. such fabric in the presence of pumice stones to provide 20 the desired localized lightening of the colour of the fabric or by treating the fabric enzymatically, in particular with cellulolytic enzymes. The enzyme treatment may be carried out either alone such as disclosed US 4,832,864, together with a smaller amount of pumice than required in the traditional 25 process, or together with perlite such as disclosed in WO
95/09225.
Determination of cellulolytic activity Cellulolytic enzymes hydrolyse CMC, thereby increasing the viscosity of the incubation mixture. The resulting reduction 30 in viscosity may be determined by a vibration viscosimeter (e.g. MIVI 3000 from Sofraser, France). Determination of the cellulolytic activity, measured in terms of S-CEViJ, may be determined according to the assay described below:
The s-CEw assay quantifies the amount of catalytic activity present in the sample by measuring the ability of the sample to reduce the viscosity of a solution of carboxy-methyleellu-lose (CMC). The assay is carried out at 40°C; pH 7.5; 0.1M
phosphate buffer; time 30 min; using a relative enzyme stan-dard for reducing the viscosity of the CMC substrate (carboxymethylcellulose Hercules 7 LFD); enzyme concentration approx. 0.15 S-CEW/ml.
Further, 1 Savi U (unit) is defined as the amount of enzyme capable of forming 1 ;cmole of glucose equivalents per minute.
The invention is further illustrated by the following non-limiting examples.
zdentifiaation of relationship with alkaline cellulases from Z5 BumiCOla insolens, DsM 1800 The ochterlony immunodiffusion test was used for identifica-tion of the relationship of the strains Acremonium sp., CBS
265.95, Acremonium sp., CBS 478.94, Acremonium persicinum, _ CBS 169.65, Acremonium acremonium, AHU 9519, and -- 20 Cephalosporium sp., CBS 535.71 with alkaline cellulases from Humicola insolens, DSM 1800.
Antisera were raised by the Applicant against the Humicola .n insolens, DSM 1800, strain and used~in dilutions from 1 to 1/16. Blocks of fungi grown on amorphous cellulose-agar 25 medium were inserted into the wells of 0.9% Bacto-agar-PEST
(Phosphate Buffer Saline) adjusted by NaOH to pH 7.4 contain-ing 0.5 ml of Tween*20 per litre of PEST. Around the blocks induced by cellulase fungi, other wells were filled with other dilutions of antisera (from 1 to 1/16). Small petri 30 dishes were inserted into larger dishes with wet wadding to protect against drying-out and were incubated at 37°C over-* = TM
WO 96/11262 ' ~ ~ ~ ~ - ~ PCT/DK95/00400 night.
None of the blocks containing Acremonium sp., CBS 265.95, Acremonium sp., CBS 478.94, Acremonium persicinum, CBS
169.65, Acremonium acremonium, AHU 9519, and Cephalosporium sp., CBS 535.71 formed precipitation arcs with the antisera.
Determination of alkaline cellulase activity on amorphous cellulose Materials and methods:
Substrate preparation: 20 gram acid-swollen AVICEL' stock solution (see below for a preparation which can be stored for one month) was centrifuged for 20 min. at 5000 rpm, the su-pernatant was poured off, and the sediment was resuspended in 30 ml of buffer. Then the suspension was centrifuged for 20 min. at 5000 rpm, the supernatant was poured off, and the sediment was resuspended in buffer to a total of 30 g. This corresponds to a substrate concentration of 10 g AVICEL/1.
duffer: 0.1 M Barbital at pH 8.5 or 0.1 M Glycine at pH 10.0 Enzyme solution:
The enzymes were diluted to an activity of 0.2-1 S-CEVU/ml at pH 8.5 or pH lo. o.
lea eC~ rits : ' 2 ~ NaOH, PHBAH-reagent: 1.5 g of p-hydroxy benzoic acid hy-drazide and 5.0 g sodium tartrate was dissolved in 100 ml of 2 ~ NaOH.
The substrate, the buffer and the enzyme solution were mixed to a final substrate concentration of 4.00 g/1.
W~ 96/11262 ~ ~ ~ ~ ~ ~ ~ PCT/DK95100400 Preparation of Acid swollen cellulose:
Materials:
g Avicel~ (Art. 2331 Merck) 150 ml 85% ortho-phosphoric acid (Art. 573 Merck) 5 400 ml acetone (Art. 14 Merck) 1.3 1 deionized water (Milli Q) 1 1 glass beaker 1 1 glass filter funnel 2 1 suction flask Ultra Turrax Homogenizer Procedure:
Acetone and phosphoric acid was cooled on ice.
5 g Avicel' was moistened with water, then 150 ml of ice cold 85% ortho-phosphoric acid was added, and the mixture was placed on ice bath with weak stirring for 1 h.
100 ml of ice cold acetone was added with stirring, followed by transfer of the mixture to a glass filter funnel, followed by washing with 3 x 100 ml ice cold acetone and dry suction after each washing.
The filter cake was washed with 2 x 500 ml water and sucked as dry as possible after each wash.
The filter cake was resuspended to a total volume of 300 ml and blended to homogeneity (using the Ultra Turrax Homogen-izes) .
The resulting product was stored in a refrigerator.
The substrate/buffer solution was preheated for 5 min at 40'C. Then the enzyme solution was added and the solution was whirlmixed for 5 sec., followed by incubation for 20 min. at 40 'C. The reaction was stopped by adding 500 ~cl 2% NaOH
solution, followed by whirlmixing for 5 sec. The samples were centrifuged for 20 min. at 5000 rpm. 1000 ,ul of supernatant was transferred from the test tubes to new test tubes, and 500 ~,1 PHI3AH-reagent was added, followed by boiling for 10 min. The test tubes were cooled in ice water.
Wm 96/11262 ~ ~ ~ ~ ~ ~ PCT/DK95/00400 The absorbance of the samples were measured on a spectro-photometer at 410 nm.
Standard q_lucose curve:
A stock solution containing 300 mg/1 was diluted to 5, 10, 15 and 25 mg/1, respectively. 1000 ~1 of the diluted standards were mixed with 500 ~C1 of PHBAH-reagent and were treated as the other samples, see above.
pefinition:
1 Savi U (unit) is defined as the amount of enzyme capable of forming 1 ~Cmole of glucose equivalents per minute.
petermination of activity: The release of reducing glucose equivalent was calculated using the standard curve.
The results are shown in the table below.
The strain mentioned in the table below were grown in shaking flasks in a substrate consisting of:
Rofec ( from Roquette) 10 g/ 1 NH4N03 10 g / 1 KHZPO4 10 g/ 1 Solcaf loc 4 0 g/ 1 MgS04,7H~0 0.75 g/1 Pluronic 100 0.1 ml Water ad 1000 ml The activity was measured in S-CEW/ml.
WD 96!11262 ~ ~ ~ ~ ~ '~ PCTlDK95100400 TABLE (Activity) Enzyme compositions S-CEVLT/ml Savi U/ml Savi U/ml (strain) pH 10 pH 8.5 Acremonium sp., 55 4.4 2.2 5 CBS 265.95 Acremonium sp., 22 2.5 1.9 CBS 478.94 cephalosporium sp., 116 3.8 2.3 CBS 535.71 10 Acremonium persicinum, 63 3.5 2.1 CBS 169.65 Acremonium acremonium, 23 15 Preparation of alkaline cellulase powder Cellulase powder preparations according to the invention was prepared by cultivation of the following Acremonium strains, respectively: A. brachypenium, CBS 866.73, A. dichromosporum, CBS 683.73 /ATCC 32181, A. obclavatum, CBS 311.74, A.
20 pinkertoniae, CBS 157.70, A. roseogriseum, CBS 134.56, A.
incoloratum, CBS 146.62 / ATCC 14613, and A. furatum, CBS
299.70H.
Each cellulase preparation was prepared as follows:
A YPG agarslant was used as seed culture medium. An agar 25 piece of spores grown on agar plate was inoculated to a 500 ml volume Erlenmeyer flask with 2 bafflers containing 100 ml culture medium. Cultivation for 48 hours at 27°C.
WO 9G/11262 ~ ~ , PCT/DK95/00400 r 3 ml of this seed culture were then inoculated to a main cul-ture medium consisting of 4 % wheat bran and 0.1% Tween 80, at pH 6.7, again in 100 ml total fluid in 500 ml Erlenmeyer shake flask. Cultivation for 5 days at 27°C on a shaking table. 25 shake flask was used and the broth filtrates was collected through sintered glass filter to avoid adsorption to cellulosic material.
The filtrate was concentrated on an Amicon ultrafiltration unit with a membrane with a cut off at 10 kD to 1/5 of the original volume and freeze dried.
The activity was measured in S-CEVLT/mg.
TABLE (Activity) Enzyme compositions (strain) S-CEVLT/mg Acremonium brachypenium, CBS 866.73 48 Acremonium dichromosporum, CBS 62 683.73 Acremonium obclavatum, CBS 311.74 693 Acremonium pinkertoniae, CBS 157.70 550 Acremonium roseogriseum, CBS 134.56 38 Acremonium incoloratum, CBS 146.62 132 Acremonium furatum, CBS 299.70H 82 WO 96/11262 ~ ~ ~ ~ ~ ~ PCT/DK95100400 Performance of cellulase from Acremonium strains in detergent compositions Materials and methods Apparatus . Terg-o-tometer Liquid volume . 100 ml Agitation . 150 movements/min with vertical stirrer Rinse time . l0 min in running tapwater Washing temp . 40'C
Washing liquor . 6.5 g/1 of powder detergent, European type (Ariel Color, commercial enzymes already in the detergent powder were inactivated by heating to 85C in a microwave oven and maintaining this temperature for 10 min.
pH . 10.0 Water hardness . 2 mM CaCl2 Washing time . 30 min Repetitions . 6 Textile . 2 swatches of aged black 1000 cotton 5x6 cm 2o Drying . Tumble dry Evaluation:
When the surface fibrils and fibers protruding from the yarn are removed by cellulase, the surface of the black fabric appears darker and free from fuzz. A test panel ranks the swatches relative to each other. They are given a number starting with 1 from the "ugliest~~ and up to 18 for the ' "nicest" swatch.. Swatches with values above 12 have a very improved surface appearance. Swatches with values above 6 have a clearly visible improved surface appearance.
Results:
For each tested strain, three different dosages of cellulase PCT/DK95l00400 WO 96!11262 were tested and compared with a blind sample:
Strain 0 50 100 250 Acremonium sp., CBS 478.94 2.0 12.3 14.0 15.0 Acremonium sp., CBS 265.95 2.0 3.0 9.7 9.0 The data show that especially Acremonium sp., CBS 478.94, but also Acremonium sp., CBS 265.95, give very good color clari-fication in the commercial detergent matrix.
Performance of cellulase from Acremonium strains measured as removal of surface fibrils and fibers protruding from the yarn of a textile containing cellulosic fibers Materials and methods Apparatus . Terg-o-tometer Liquid volume . 100 ml Agitation . 150 movements/min with vertical stirrer Rinse time . 5 min in tapwater Washing temp . 40' Washing liquor . 0.05 M phosphate buffer pH . 7.0 Washing time . 30 min Repetitions . 2 Textile . 2 swatches of aged black 1000 cotton 5x6 cm Drying . Tumble dry Evaluation:
When the surface fibrils and fibers protruding from the yarn are removed by cellulase, the surface of the black fabric appears darker and free from fuzz. A test panel ranks the swatches relative to each other. They are given a number starting with 1 from the "ugliest" and up to 18 for the "nicest" swatch. Swatches with values above 12 have a very improved surface appareance.
For each tested strain, two different dosages of Acremonium cellulase were tested and compared with a blind sample:
Strain 0 200 500 1000 2500 A. furatum, CBS 299.70H 5.5 13.0 n.t. 18.0 n.t.
A. incoloratum, CBS 146.62 5.5 n.t. 13.0 n.t. 16.0 The data show that especially cellulase from Acremonium furatum, CBS 299.70H, but also from Acremonium incoloratum, CBS 146.62 (ATCC 14613), gives very good colour clarification under the test conditions.
In further tests, also cellulases from Acremonium obclavatum~
CBS 311.?4, Acremonium brachypenium~ CBS 866.73, and Acremonium pinkertoniae, CBS 157.70, showed colour clarlflca-tion~under the test conditions.
Cloning and expression of a Family 5 cellulase from Acremonium sp., CBS 265.95 A library from Acremonium sp. CBS 265.95 consisting of approx. 106 individual clones in 50~pools was constructed in E. coli as described.
DNA was isolated from 100 individual clones from the library and subjected to analysis for cDNA insertion. The insertion frequency was found to be >99~. DNA from some of the pools was transformed into yeast, and 50-100 plates containing 250-500 yeast colonies were obtained from each pool.
WO 96/11262 ~ ~ ~~ v' PCT/DK95/00400 Endoglucanase-positive colonies were identified and isolated on agar plates with AZCL HE cellulose. cDNA~inserts were amplified directly from the yeast colonies and characterized as described in the Materials and Methods section above. The 5 N-terminal and C-terminal DNA sequences, respectively, of the cDNA encoding the endoglucanase is shown in SEQ ID No. 1 and 2.
The cDNA is obtainable from the plasmid in DSM 10076.
The isolated yeast clones were simultaneously tested on agar l0 plates containing AZCL ~i-glucan, AZCL xyloglucan or AZCL HE
cellulose, and found positive on AZCL HE cellulose and AZCL
~3-glucan.
Total DNA was isolated from a yeast colony and plasmid DNA
was rescued by transformation of E. coli as described above.
15 In order to express the endoglucanase in Aspergillus, the DNA
was digested with HindIII/XbaI, size fractionated on gel, and a fragment corresponding to the endoglucanase gene was purified. The gene was subsequently ligated to HindIII/XbaI
digested pHD414 resulting in the plasmid pA2C346.
20 After amplification of the DNA in E. coli the plasmid pA2C346 was transformed into Aspergillus oryzae as described above.
Test of A. oryzae transformants Each of the transformants were tested for endoglucanase activity as described above. Some'of the transformants had 25 endoglucanase activity which was significantly larger than the Aspergillus oryzae background. This demonstrates effi-cient expression of the endoglucanase in Aspergillus oryzae.
The endoglucanase was determined as being a Family 5 cellulase (determation of family based on the disclosure in 30 Henrissat, B. et al. in Biochem. J. Vol. 293, p. 781-788, (1993)) and having a fungal type CBD (cellulose binding domain)at the N-terminal. Fungal type CBD's are described by Gilkes, Henrissat, Kilburn, Miller and Warren 1.n Microbiological Reviews, Vol. 55, p. 303-315, (1991).
Cloning and expression of a Family 7 cellulase from Acremonium sp., CBS 265.95 A library from Acremonium sp. CBS 265.95 consisting of approx. 106 individual clones in 50 pools was constructed in E. coli as described.
Cloning and expression was carried out as described in example 6, the resulting plasmid being pA2C347.
The isolated yeast clones were simultaneously tested on agar plates containing AZCL (3-glucan, AZCL xyloglucan or AZCL HE
cellulose, and found positive on all substrates AZCL HE
cellulose, AZCL xyloglucan and AZCL ~i-glucan.
The DNA sequence of the cDNA encoding the endoglucanase is shown in SEQ ID No. 3.
The cDNA is obtainable from the plasmid in DSM 9969.
The endoglucanase was determined as being a Family 7 cellulase (determation of family~based on the disclosure in Henrissat, B. et al. in Biochem. J. Vol. 293, p. 781-788, (1993) ) .
The molecular weight (MW) of the endoglucanase.expressed in Aspergillus oryzae was determined to 58 kD in SDS-PAGE.
WO 96/11262 °~' ~ ~ ~ y ~ PCT/DK95l00400 Cloning and expression of a Family 7 cellulase from Acxemonium sp., CBS 478.94 A library from Acremonium sp. CBS 478.94 consisting of approx. 106 individual clones in 50 pools was constructed in E. coli as described.
Cloning and expression was carried out as described in - example 6, the resulting plasmid being pA2C349.
The isolated yeast clones were simultaneously tested on agar plates containing AZCL ~3-glucan, AZCL xyloglucan or AZCL HE
cellulose, and found positive on all substrates: AZCL HE
cellulose, AZCL xyloglucan and AZCL (3-glucan.
The DNA~sequence of the cDNA encoding the endoglucanase is shown in SEQ ID No. 4. This sequence showed about 66% ident-ity with the DNA coding for Fusarium oxysporum EG I for 945 bases, cf. Sheppard et al., 1994, Family C endoglucanase.
The cDNA is obtainable from the plasmid in DSM 9977.
The endoglucanase was determined as being a Family 7 cellulase (determation of family based on the disclosure in Henrissat, B. et al. in Biochem. J. Vol. 293, p. 781-788, (1993) ) .
The molecular weight (MW) of the endoglucanase expressed in Aspergillus oryzae was determined to 60 kD in SDS-PAGE.
WO 96/11262 ~ '~ PCT/DK95/00400 Cloning and expression of a new cellulase from Acremonivm sp., CB8 478.94 A library from Acremonium sp. CBs 478.94 consisting of approx. 106 individual clones in 50 pools was constructed in E. coli as described.
Cloning and expression was carried out as described in example 6, the resulting plasmid being pA2C359.
The isolated yeast clones were simultaneously tested on agar plates containing AZCL (3-glucan, AZCL xyloglucan or AZCL HE
cellulose, and found positive on only two substrates: AZCL HE
cellulose and AZCL xyloglucan.
The DNA sequence of the cDNA encoding the endoglucanase is shown in SEQ ID No. 5.
The cDNA is obtainable from the plasmid in DSM 10077.
The N-termnail showed homology to fungal type CBD's as described by Gilkes, Henrissat, Kilburn, Miller and Warren in Microbiological Reviews, Vol. 55, p. 303-315, (1991).
2o cloning and expression of a Family 5 cellulase from Acremonium sp., CBS 478.94 A library from Acremonium sp. CBS 478.94 consisting of approx. 106 individual clones in 50 pools was constructed in E. coli as described.
Cloning and expression was carried out as described in WO 96/11262 ~ ~ ~ ~ PCT/DK95/00400 example 6, the resulting plasmid being pA2C363.
The isolated yeast clones were simultaneously tested on agar plates containing AZCL ~i-glucan, AZCL xyloglucan or AZCL HE
cellulose, and found positive on 2 substrates: AZCL HE cellu-lose and AZCL ~3-glucan.
The DNA sequence of the cDNA encoding the endoglucanase is shown in SEQ ID No. 6.
The cDNA is obtainable from the plasmid in DSM 10079.
The endoglucanase was determined as being a Family 5 cellulase (determation of family based on the disclosure in Henrissat, B. et al. in Biochem. J. Vol. 293, p. 781-788, (1993)) and having a fungal type CBD (cellulose binding domain)at the N-terminal. Fungal type CBD~s are described by Gilkes, Henrissat, Kilburn, Miller and Warren in Microbiological Reviews, Vol. 55, p. 303-315, (1991).
The molecular weight (MW) of the endoglucanase expressed in Aspergillus oryzae was determined to 60 kD in SDS-PAGE.
More than 50~ relative activity was obtained in the pH range between pH 6.5 to 10 using CMC as substrate.
Cloning and expression of a cellulase from Acremonium sp., CBS 478.94 A library from Acremonium sp. CBS 478.94 consisting of approx. 106 individual clones in 50 pools was constructed in E. coli as described.
Cloning and expression was carried out as described in '~ WO 96/11262 ~ PCT/DK95/00400 example 6, the resulting plasmid being pA2C369.
The isolated yeast clones were simultaneously tested on agar plates containing AZCL (i-glucan, AZCL xyloglucan or AZCL HE
cellulose, and found positive on two substrates: AZCL HE
5 cellulose and AZCL xyloglucan.
The partial N-terminal DNA sequence of the cDNA encoding the endoglucanase is shown in SEQ ID No. 7.
The cDNA is obtainable from the plasmid in DSM 10084.
10 Performance of cloned cellulase from Acremonium sp. measured as removal of surface fibrils and fibers protruding from the yarn of a textile containing cellulosic fibers Enzyme: The endoglucanase described in example 10 Apparatus: Terg-o-tometer 15 Liquid volume: 100 ml Agitation: 150 movements/min with vertical stirrer Rinse time: 5 min in tapwater Washing temp: 40'C
Water hardness: I) 0 'dH
20 II) 1 mM CaCl2 = app. 6 'dH
Washing liquor: I) 0.05 M phosphate buffer, pH 7.0 II) 6.5 g/1 Ariel~Color, pH 10.0, commercial enzymes already in detergent were inactivated - by heating to 85'C in microwave oven, keeping 25 for 10-minutes at this temperature.
Washing time: I) 30 min II) 20 min Repetitions: I) 2 cycles II) 3 cycles 30 Textiles for WO 96/11262 ~ ~ j 1 PCT/DK95/00400 evaluation: 2 swatches of aged black 100 cotton 5x6 cm Drying: Tumble dry Evaluation:
When the surface fibrils and fibers protruding from the yarn are removed by cellulase, the surface of the black fabric appears darker and free from fuzz. A test panel ranks the swatches relative to each other. They are given a number starting with 1 from the "ugliest" and up to 18 for the "nicest" swatch.. Swatches with values above 11 have a very improved surface appearance. Swatches with values above 6 have a clearly visible improved surface appearance.
Two different dosages were tested and compared with a blind sample. Data as panel score units on pre-aged black cotton.
The data in-between buffer and detergent cannot be compared directly, as they refer to different experiments with differ-ent washing times and different number of repetitions.
S-CEVLT/1: 0 100 400 500 1000 2500 I) Phosphate buffer, pH 7 2.5 n.t. n.t. 14.3 n.t. 16.8 II) Ariel Color, pH 10 2.0 6.0 11.3 n.t. 11.7 n.t.
n.t. - not tested The data show that the tested endoglucanase (encoded by the DNA sequence obtainable from the plasmid in Saccharomyces cerevisiae, DSM 10079, give good color clarification in both buffer and detergent.
WO 96111262 ~ Q ~ ~ ~ ~ PCT/DK95/00400 REFERENCES
Ali, B.R.S. et al., "Cellulases and hemicellulases of the anaerobic fungus Piromyces constitute a multiprotein cellu-lose-binding complex and are encoded by multigene families", FEMS Microbiol. Lett. (1995), Vol. 125, No. 1, pp. 15-21.
Altshul et al., Bull. Math. Bio. Vol 48: 603-616, 1986.
Becker, D. M. & Guarante, L. 1991. Methods Enzymol. 194: 182-187.
Dalb~ge, H. and Heldt°Hansen, H.P., "A novel method for efficient expression cloning of fungal enzyme genes", Mol.
Gen. Genet. (1994), Vol. 243, pp. 253-260.
Gilkes, Henrissat, Kilburn, Miller and Warren in Microbiological Reviews, Vol. 55, p. 303-315, (1991).
Needleman, S.B. and Wunsch, C.D., Journal of Molecular Bio1-ogy, 48: 443-453, 1970.
Gonz~les, R., et al., "Cloning, sequence analysis and yeast expression of the egll gene from Trichoderma Iongibrachiatum", Appl. Microbiol. Biotechnol. (1992), Vol.
38, pp. 370-375.
Gubler, U. & Hoffman, B. J. 1983. Gene 25: 263-269.
Henikoff and Henikoff, Proc. Natl. Acad. Sci. USA vol 89:
10915-10919, 1992.
Henrissat, B. and Bairoch, A. in Biochem. J. Vol. 293, p.
781-788, (1993)).
Rev. Microbiol. (1990), Vol. 44, pp. 219-248.
WO 9GI11262 ~ ~ PCT/DK95/00400 Henrissat, B., "Cellulases and their interaction with cellu-lose", Cellulose (1994), Vol. 1, pp. 169-196.
Higuchi R., Krummel B. and Saiki R. K. (1988). A general method of in vitro preparation and specific mutagenesis of ' DNA fragments: study of protein and DNA interactions. Nucl.
Acids Res. 16: 7351-7367.
Kang, M.G., Park, H.M., Kim, Y.S, Lee, J.R., Kim, Y.K., Lee, Y.H.: Abstract from 94th General Meeting, American Society Microbiology, K-112, 1994. Purification and some proterties of carboxymethyl cellulase from alkalophilic Cephalosporium sp RYM 202.
Peberdy, J.F.: Penicillium and Acremonium, (1987), p. 2-4, Plenum Press, -New York,-Penttila, M. et al, (1986) Homology between cellulase gnees of Trichoderma reesei: complete nucleotide sequence of the endoglucanase I gene. Gene 45:253-263.
Saloheimo, M. et al, (1988) EGIII, a new endoglucanase from Trichoderma reesei: the characterization of both gene and enzyme. Gene 63:11-21.
Sambroolt, J., Fritsch, E. F. & Maniatis, T. 1989. Molecular Cloning: A Laboratory Manual. Cold Spring Harbor Lab., Cold Spring Harbor, NY.
Saloheimo, A., et al., "A novel, small endoglucnaase gene, eg5, from Trichoderma reesei isolated by expression in yeast", Molecular Microbiology (1994), Vol. 13(2), pp. 219-228.
Sanger, F., Nicklen, S. & Coulson, A. R. 1977. Proc. Natl.
Acad. Sci. U. S. A. 74: 5463-5467.
Sheppard, P.O., et al., "The use of conserved cellulase - family-specific sequences to clone Cellulase homologue cDNAs from Fusarium oxysporum, Gene, (1994), Vol. 15, pp. 163-167.
van Arsdell, J.N. et al, (1987) Cloning, characterization, and expression in Saccharomyces cerevisiae of endoglucanase I
from Trichoderma reesei, Bio/Technology 5: 60-64.
Xue, G. et al., "Cloning and expression of multiple cellulase cDNAs fromthe anaerobic rumen fungus Neocallimastix patriciarum in E. coli, J. Gen. Microbiol. (1992), Vol. 138, pp. 1413-1420.
Xue, G. et al., "A novel polysaccharide hydrolase cDNA (celD) from Neocallimastix patriciarum encoding three multifunc-tional catalytical domains with high endoglucanase, cellobiohydrolase and xylanase activities", J. Gen.
Microbiol. (1992), Vol. 138, pp. 2397-2403.
Zhou, L. et al., "Intronless celB from the anaerobic fungus Neocallimastix patriciarum encodes a modular family A
endoglucanase", Biochem. J. (1994), Vol. 297, pp. 359-364.
Methods in Enzymology, 1988, Vol. 160, p. 200-391 (edited by Wood, W.A. and Kellogg, S.T.).
T.-M. Enveri, "Microbial Cellulases" in W.M. Fogarty, Micro-bial Enzymes and Biotechnology, Applied Science Publishers, 183-224 (1983).
- Beguin, P. and Aubert, J-P., °'The biological degradation of cellulose", FEMS Microbiolagy Reviews 13 (1994) 25-58.
International Patent Publication WO 93/11249.
International Patent Publication WO 94/14953.
WO 96!11262 ~ '~ ~ PCT/DK95/00400 International Patent Publication WO 95/02043.
Ford et al., Protein Expression and Purification 2: 95-107, 1991.
Cunningham and Wells, Science 244, 1081-1085, 1989).
5 de Vos et al., Science 255: 306-312, 1992.
Smith et al., J. Mol. Biol. 224: 899-904, 1992.
Wlodaver et al., FEBS Lett. 309: 59-64, 1992.
N. Axelsen et al., A Manual of Quantitative Immunoelectrophoresis, Blackwell Scientific Publications, 10 1973, Chapters 2,3,4 and 23.
WO 96/11262 P ~ ~ ~ ~ ~ PCT/DK95100400 SEQUENCE LISTING
. (1) GENERAL INFORMATION:
(i) APPLICANT:
(A) NAME: Novo Nordisk A/S
(B) STREET: Novo Alle (C) CITY: DK-2880 Bagsvaerd (E) COUNTRY: Denmark (F) POSTAL CODE (ZIP): DK-2880 (G) TELEPHONE: +45 44 44 88 88 (H) TELEFAX: +45 44 49 32 56 (I) TELEX: 37304 (ii) TITLE OF INVENTION: TITLE
(iii) NUMBER OF SEQUENCES: 7 (iv) COMPUTER READABLE FORM:
(A) MEDIUM TYPE: Floppy disk (B) COMPUTER: IBM PC compatible (C) OPERATING SYSTEM: PC-DOS/MS-DOS
(D) SOFTWARE: PatentIn Release #1.0, Version #1.30 (EPO) (2) INFORMATION FOR SEQ ID NO: 1:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 590 base pairs (B) TYPE: nucleic acid ' 25 (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: cDNA
WO 96/11262 ~ ~ ~ ~ ~ PCT/DK95/00400 (v) FRAGMENT TYPE: N-terminal (vi) ORIGINAL SOURCE:
(A) ORGANISM: Acremonium sp.
(B) STRAIN: CBS 265.95 (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 1:
(2) INFORMATION FOR SEQ ID NO: 2:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 580 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: cDNA
(v) FRAGMENT TYPE: C-terminal WO 96/11262 ~ a ~ ~ ~ ~ PCTIDK95/00400 (vi) ORIGINAL SOURCE:
(A) ORGANISM: Acx~emonium sp.
(B) STRAIN: CBS 265.95 (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 2:
ACATATTCTA CCTTTCCAAA F03F~.A P~3A,AAAAAAA 580 (2) INFORMATION FOR SEQ ID NO: 3:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 1511 base pairs (B) TYPE: nucleic acid . (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: cDNA
(vi) ORIGINAL SOURCE:
(A) ORGANISM: Acremonium sp.
(B) STRAIN: CBS 265.95 W~ 96111262 ~ ~ ~ ~ ~ ~ . ~ PCT/DK95/00400 (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 3:
CGGCCAGGTCATCGAGTCGTACGTCGTCGACGCGCCGGGCCTGACCCGTGACCGACAGCA1020 ' i ..__ CA 02201871 2003-10-29 5 TTGATCTTGAAAA,AAAAAF~A AAAAAAAAAAAAAAAAAAAA AAAAAAATGCGCCGCTCGAG 1500 (2) INFORMATION FOR SEQ ID NO: 4:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 1461 base pairs 10 (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: cDNA
(Vi) ORIGINAL SOURCE:
15 (A) ORGANISM: Acremonium sp.
(B) STRAIN: CBS 478.94 (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 4:
WD 96!11262 ~ ~ ~ ~ ~ PCTIDK95/00400 ATCGACACCG AGGGCAACCCGTCGAATATCGTCAAGGGTG~AGCCCAACCCCGTCGTCACC1380 (2) INFORMATION FOR SEQ ID NO: 5:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 1965 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear i (ii) MOLECULE TYPE: CDNA
(vi) ORIGINAL SOURCE:
(A) ORGANISM: Acremonium sp.
(H) STRAIN: CBS 47$.94 (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 5:
GAGGACTCAG
CGGTGCCATC TGGGCTCAGATCGCCGACAAGCTCAAG.TGCAAGTCGTCTCTCCTTTCGTT780 Wm 96/11262 ~' ~ PCT/DK95/00400 ACCGTAGAAATACTAGTCCCTGATCTGATGF~~AAAAAAAAAAAAA 1965 (2) INFORMATION FOR SEQ ID NO: 6:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 1321 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: cDNA
(vi) ORIGINAL SOURCE:
(A) ORGANISM: Acremonium sp.
CA 02201871 2003-10-29 _ (B) STRAIN: CBS 48~94 (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 6:
CGACACAACAACGAGTACCACACGATGGACCAGAACTCGTGTTCAACCTCACCCAGACGA?20 2 GCACCGGCGGTTCAGGGGATACTGGACItW:WCGAGGCCAACGACGACGTGTGGAAGGGA1080 O
wo ~n m62 pc~Tmx9s~oo4o0 GCTGAGTCTG ATCAATAGCT ATCTACCTAA CTGACTCGAA AAAAAAAAAA P~AAAAAAAAA 1320 (2) INFORMATION FOR SEQ ID NO: 7:
5 (i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 105 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear 10 (ii) MOLECULE TYPE: cDNA
(v) FRAGMENT TYPE: N-terminal (vi) ORIGINAL SOURCE:
(A) ORGANISM: Acremonium sp.
(B) STRAIN: CHS 478.94 15 (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 7:
CTCCCGTGCG CCACGGTCCT CGCCGACAGC TGGAAGAATG TCAAG IOS
WO 961112Cn2 ~ ~ ~ ~ PCT/DK95/00400 INDICATIONS RELATING TO A DEPOSITED MICROORGANISM
(PCT Rule l3bis) A. The indications made below relate to the microorganism referred to in the description ' on page 13 , line 2 8 - 31 B. IDENTIFICATION OF DEPOSTT Further deposits are identified on an additional sheet Name of depositary institution DEUTSCHE SAMMLUNG VON MIKROORGANISMEN
UND ZELL-KULTUREN GmbH
Address of depositary institution (including postal code and country) Mascheroder Weg lb, D-38124 Braunschweig, Federal Re-public of Germany Date of deposit Accession Number 30 June 1995 DSM 10076 C. ADDITIONAL INDICATIONS (leave blankifnotapplicable) This information is continued on an additional sheet In respect of those designations in which a European and/or Australian patent is sought, during the pendency of the patent application a sample of the deposited microorganism is only to be provided to an independent expert nominated by the person requesting the sample (Rule 28(4) EPC / Regulation 3.25 of Australia Statutory Rules 1991 No D. DESIGNATED STATES FOR WHICIi INDICATIONS ARE MADE (if the indications are not for all designated States) E. SEPARATE FURNISHING OF INDICATIONS
(Irave blank if not applicable) The indications listed below will besubmitted to the International Bureau later (specifytfiegencalnatureoftheindicationrGg., Acccrsion Number of Deposit For receiving Office use only For International Bureau use only ~' This sheet was received with the international application Q This sheet was received by the International Bureau on:
Authorized ofFcer Authorized ofFcer ~'Gi~~:~~'~~~>~
Form PCT/RO/13~1 (July 1992) WO 96/11262 ~ ~ ~ PCT/DK95/00400 INDICATIONS RELATING TO A DEPOSITED MICROORGANISM
(PCT Rule l3bis) A. The indications made below relate to the microorganism referred to in the description on page 15 , line 3 - 7 B. IDENTIFICATION OF DEPOSIT Further deposits are identified on an additional sheet Name of depositary institution DEUTSCHE SAMMLUNG VON MIKROORGANISMEN
UND ZELL-KULTUREN GmbH
Address of depositary institution (including postal code and country) Mascheroder Weg lb, D-38124 Braunschweig, Federal Re-public of Germany Date of deposit Accession Number 11 May 1995 DSM 9969 C. ADDITIONAL INDICATIONS (leave blankifnot applicable) This information is continued on an additional sheet In respect of those designations in which a European and/or Australian patent is sought, during the pendency of the patent application a sample of the deposited microorganism is only to be provided to an independent expert nominated by the person requesting the sample (Rule 28(4) EPC / Regulation 3.25 of Australia Statutory Rules 1991 No D. DESIGNATED STATES FOR WHICH INDICATIONS
ARE MADE (iftbeindicationsarenot for all deaignatedStates) E. SEPARATE FURNISHING OF INDICATIONS
(leave blank if not applicable) The indications listed below will be submitted to the International Bureaulater(specifythegeneralnatureaftheindicationreg., Accession NumberofDeposit For receiving Office use only For International Bureau use only This sheet was received with the international application o This sheet was received by the International Bureau on:
Authorized officer , ~ ~ Authorized officer Form PCTIRO/134 (July 1992) WO 96/11262 ~ ~ PCT/DK95/00400 INDICATIONS RELATING TO A DEPOSITED MICROORGANISM
(PCT Rule l3bis) A. The indications made below relate to the microorganism referred to in the description on page 16 , line 9 -13 B. IDENTIFICATION OF DEPOSIT Further deposits are identified on an additional sheet Name of depositary institution DEUTSCHE SAMMLUNG VON MIKROORGANISMEN
UND ZELL-KULTUREN GmbH
Address of depositary institution (including postal code and country) Mascheroder Weg ib, D-38124 Braunschweig, Federal Re-public of Germany Date of deposit Accession Number 11 May 1995 DSM 9977 C. ADDITIONAL INDICATIONS (leave blank if not applicable) This information is continued on an additional sheet . In respect of those designations in which a European and/or Australian patent is sought, during the pendency of the patent application a sample of the deposited microorganism is only to be provided to an independent expert nominated by the person requesting the sample (Rule 28(4) EPC / Regulation 3.25 of Australia Statutory Rules 1991 No D. DESIGNATED STATES FOR WHICFI
INDICATIONS ARE MADE (iftheindicationsarenot for all designated States) E. SEPARATE FURNISHING OF INDICATIONS
(Ie:aveblankifnot applicable) The indications listed below will be submitted to the International Bureau later (specifythegenoalnatureoftheindicatio~crag., "Accession NumbrrofDeposit For receiving Office use only For International Bureau use only This sheet was received with the international application ~ 'This sheet was received by the International Bureau on:
Authorized ofFcer Authorized officer Form PCT/RO/134 (July 1992) WO 96111262 ~ ~ '~ ~_ , PCT/DK95/00400 INDICATIONS RELATING TO A DEPOSITED MICROORGANISM
(PCT Rule l3bis) A. The indications made below relate to the microorganism referred to in the description on page 17 , line 14-18 , B. IDENTIFICATION OF DEPOSIT Further deposits are identified on an additional sheet Name of depositary institution DEUTSCHE SAMMLUNG VON MIKROORGANISMEN UND ZELL-KULTUREN GmbH
Address of depositary institution (including postal code and counlry) Mascheroder Weg 1b, D-38124 Braunschweig, Federal Re-public of Germany Date of deposit Accession Number 30 June 1995 DSM 10077 C. ADDITIONAL INDICATIONS (leave blankifnor applicable) This information is continued on an additional sheet In respect of those designations in which a European and/or Australian patent is sought, during the pendency of the patent application a sample of the deposited microorganism is only to be provided to an independent expert nominated by the person requesting the sample (Rule 28(4) EPC / Regulation 3.25 of Australia Statutory Rules 1991 No 71 D. DESIGNATED STATES FOR WIiICH INDICATIONS ARE MADE (iftheindicationsarenot for all duignatedSeates) E. SEPARATE FURNISHING OF INDICATIONS (h:aveblankifnoe applicable) The indications listed below will be submitted to the International Bureau Later (specifythegencalnatureoftheindicationsag., Acussion NumberofDeposit For receiving Office use only For International Bureau use only ~ This sheet was received with the international application ~ 'Ibis sheet was received by the International Bureau on:
Authorized officer Authorized officer Form PGT/R'b/134 (July 1992) WO 96/11262 ~ ~ ~ ~ PCT/DK95I00400 INDICATIONS RELATING TO A DEPOSITED MICROORGANISM
(PCT Rule I3bis) A. The indications made below relate to the microorganism referred to in the description on page 18 , line 19-23 B. IDENTIFICATION OF DEPOSIT Further deposits are identified on an additional sheet Name of depository institution DEUTSCHE SAMMLUNG VON MIKROORGANISMEN
UND ZELL-KULTUREN GmbH
Address of depository institution (including postal code and country) Mascheroder Weg 1b, D-38124 Braunschweig, Federal Re-public of Germany Date of deposit Accession Number 30 June 1995 DSM 10079 C. ADDITIONAL INDICATIONS (leave blankifnotapplicable) This information is continued on an additional sheet In respect of those designations in.which a European and/or Australian patent is sought, during the pendency of the patent application a sample of the deposited microorganism is only to be provided to an independent expert nominated by the person requesting the sample (Rule 28(4) EPC / Regulation 3.25 of Australia Statutory Rules 1991 No 71).
D. DESIGNATED STATES FOR WHICH INDICATIONS
ARE MADE (iftheindicationsarenot for all designatedStater) E. SEPARATE FLTR1VISHING OF INDICATIONS
(leave blankifnot applicable) The indications listed below will besubmittedtotheInternationalBureaulater(specifythegeneralnatureofrheindication se.g.
Accession , Number of Deposit -- For receiving OfFce use only For International Bureau use only This sheet was received with the international application ~ This sheet was received by the International Bureau on:
Authorized ofFcer ~--- Authorized ofFcer Form PCT~D/134 (July 1990 W~ 96111262 PCTt'DK95/00400 INDICATIONS RELATING TO A DEPOSITED MICROORGANISM
(PCT Rule l3bis) A. The indications made below relate to the microorganism referred to in the description line 25-29 , e 1g a on .
, g p B. IDENTIFICATION OF DEPOSIT Further deposits are identified on an additional sheet Namc of depositary institution DEUTSCHE SAMMLUNG VON MIKROORGANISMEN
UND ZELL-KULTUREN GmbH
Address of depositary institution (including postal code and country) Mascheroder Weg lb, D-38124 Braunschweig, Federal Re-public of Germany Date of depos3 Accession Number 0 J U n a 19 9 5 0 S M 10 0 8 4 C. ADDITIONAL INDICATIONS (leave blank if not applicable) This information is continued on an additional sheet . In respect of those designations in which a European and/or Australian patent is sought, during the pendency of the patent application a sample of the deposited microorganism is only to be provided to an independent expert nominated by the person requesting the sample (Rule 28(4) EPC / Regulation 3.25 of Australia Statutory Rules 1991 No 71).
D. DESIGNATED STATES FOR WHICFI
INDICATIONS ARE MADE (if the indications are not for afl designated States) E. SEPARATE FURNISHING OF INDICATIONS
(Icavc blank if not applicable) The indications listed below will be submitted to the International Bureau later(specifythcgeneralnatureoftheindicationsag., Accession Number of Deposit For receiving Office use only For International Bureau use only This sheet was received with the international application ~ This sheet was received by the International Bureau on:
Authorized officer Authorized officer O/I34 (1 WO 96/11262 ~ ~ ~ ~ ~ ~ ~ PCT/DK95/00400 INDICATIONS RELATING TO A DEPOSITED MICROORGANISM
(PCT Rule l3bis) A. The indications made below relate to the microorganism referred to in the description ' on page 8 , line 15 -18 .
B. IDENTIFICATION OF DEPOSIT Further deposits are identiFed on an additional sheet Name of depositary institution CENTRAALBUREAU VOOR SCHIMMELCULTURES
Address of depositary institution (including postal code and country) Oosterstraat 1, Postbus 273, NL-3740 AG Barn, Nether-land Date of deposit Accession Number 28 September 2994 CBS 478.94 C. ADDITIONAL INDICATIONS (leave blank if not applicable) This information is continued on an additional sheet In respect of those designations in which a European and/or Australian patent is sought, during the pendency of the patent application a sample of the deposited microorganism is only to be provided to an independent expert nominated by the person requesting the sample (Rule 28(4) EPC / Regulation 3.25 of Australia Statutory Rules 1991 No 71).
D. DESIGNATED STATES FOR WHICIi INDICATIONS ARE MADE (iftheindicationsarenot for all designated States) E. SEPARATE FURIfISHING OF INDICATIONS
(Iravrblankifnot applicable) TbeindicationslistedbelowwillbesubmittedtothelnternationalBureaulater(specifyrh egeneralnatureofthcindicationse.g., Accession NumbrrofDepoait For receiving Office use only For International Bureau use only This sheet was received with the international application ~ This sheet was received by the International Bureau on:
Authorized officer Authorized officer Form PCT/RO/134 (July 1992) WO 96tii262 ~ ~ PCT/DK95/00400 INDICATIONS RELATING TO A DEPOSITED MICROORGANISM
(PCT Rule l3bis) A. The indications made below relate to the microorganism referred to in the description on page 8 , line 24-27 . , B. IDENTIFICATION OF DEPOSIT Further deposits are identified on an additional sheet Name of depositary institution CENTRAALBUREAU VOOR SCHIMMELCULTURES
Address of depositary institution (including postal code and country) Oosterstraat l, Postbus 273, NL-3740 AG Barn, Nether-land Date of deposit Accession Numbet 7 April 1995 CBS 265.95 C. ADDITIONAL INDICATIONS (Icavcblankifnot applicable) This information is continued on an additional sheet In respect of those designations in which a European and/or Australian patent is sought, during the pendency of the patent application a sample of the deposited microorganism is only to be provided to an independent expert nominated by the person requesting the sample (Rule 28(4) EPC / Regulation 3.25 of Australia Statutory Rules 1991 No 71).
D. DESIGNATED STATES FOR WHICH INDICATIONS
ARE MADE (iftheindicationsarenot for all daignatedStates) E. SEPARATE FURNISHING OF INDICATIONS
(leave blank if not applicable) The indications listed below will be submitted to theIntemationalBureaulater(specifythegeneralnatureoftheindicationsGg., Accession NumbcrofDeposit For receiving Office use only For International Bureau use only This sheet was received with the international application Q This sheet was received by the International Bureau on:
Authorized officer ~ ~ ~ ~ ~ Authorized officer Form PGT/RO/134 (July 1992)
The host cell into which the DNA construct or the recombinant vector of the invention is introduced may be any cell which is capable of producing the present enzyme and includes bacteria, yeast, fungi and higher eukaryotic cells.
Examples of bacterial host cells which, on cultivation, are capable of producing the enzyme of the invention are gram-positive bacteria such as strains of Bacillus, such as strains of B. subtilis, B. licheniformis, B. lentus, B.
brevis, B. stearothermophilus, B. alkalophilus, B.
amyloliquefaciens, B. coagulans, B. circulars, B. Zautus, B.
megatherium or B. thurangiez.~sis, or strains of Streptomyces, such as S. Iividans or S. murinus, or gram-negative bacteria such as ~cherichia coli. The transformation of the bacteria may be effected by protoplast transformation or by using competent cells in a manner known per se (cf. Sambrook et al., su ra).
When expressing the enzyme in bacteria such as E. coli, the enzyme may be retained in the cytoplasm, typically as insol-- 30 uble granules (known as inclusion bodies), or may be directed to the periplasmic space by a bacterial secretion sequence.
In the former case, the cells are lysed and the granules are recovered and denatured after which the enzyme is refolded by diluting the denaturing agent. In the latter case, the enzyme may be recovered from the periplasmic space by disrupting the cells, e.g. by sonication or osmotic shock, to release the contents of the periplasmic space and recovering the enzyme.
Examples of suitable yeasts cells include cells of Saccharomyces spp. or Schizosaccharomyces spp., in particular strains of saccharomyces cerevisiae or Saccharomyces kluyveri. Methods for transforming yeast cells with heterologous DNA and producing heterologous enzymes therefrom are described, e.g. in US 4,599,311, US 4,93,373, LAS
4,870,008, 5,037,743, and US 4,845,075. Transformed cells are selected by a phenotype determined by a selectable marker, commonly drug resistance or the abi,3,a~y to grow in the absence of a particular nutrient, e.g. leucine. A"preferred vector for use in yeast is the POT1 vector disclosed in US
4,931,373. The DNA sequence encoding the enzyme of the inven-tion may be preceded by a signal sequence and optionally a leader sequence , e.g. as described above. Further examples of suitable yeast cells are strains of Rluyveromyces, such as It. Iactis, Hansenula, e.g. H. polymorpha, or Pichia, e.g. P.
pastoris (cf. Gleeson et al., J. Gen. Microbial. 3.32, 7.986, pp. 3459-3465; US 4,882,279).
Examples of other fungal cells are cells of filamentous fungi, e.g. Aspergillus spp., Neurospora spp., Fusarium spp.
or Trichoderma spp., in particular strains of A. oryzae, A.
nidulans or A. niger. The use of Aspergillus spp. for the expression of proteins is described in, e.g., EP 272 277, EP
230 023. The transformation of F. oxysporum may, for instance, be carried out as described by Malardier et al., 1989, Gene 78: 147-156.
When a filamentous fungus is used as the host cell, it may be transformed with the DNA construct of the invention, conveni-ently by integrating the DNA construct in the host chromosome to obtain a recombinant host cell. This integration is . ... ~~. . ~,. _.__._ .~ _ T ..
___....
.~. _~ .__.... ..~ . _. ....
WO 96/11262 i ~ PCT/DK95/00400 generally considered to be an advantage as the DNA sequence is more likely to be stably maintained in the cell. Integra-tion of the DNA constructs into the host chromosome may be performed according to conventional methods, e.g. by homologous or heterologous recombination.
The transformed or transfected host cell described above is then cultured in a suitable nutrient medium under conditions permitting the expression of the present enzyme, after which the resulting enzyme is recovered from the culture.
The medium used to culture the cells may be any conventional medium suitable for growing the host cells, such as minimal or complex media containing appropriate supplements. Suitable media are available from commercial suppliers or may be prepared according to published recipes (e. g. in catalogues of the American Type Culture Collection). The enzyme produced by the cells may then be recovered from the culture medium by conventional procedures including separating the host cells from the medium by centrifugation or filtration, precipitat-ing the proteinaceous components of the supernatant or fil-trate by means of a salt, e.g. ammonium sulphate, purifica-tion by a variety of chromatographic procedures, e.g. ion exchange chromatography, gel filtration chromatography, affinity chromatography, or the like, dependent on the type of enzyme in question.
In a still further aspect, the present invention relates to treatment of cellulose or cellulosic material with an enzyme preparation, which is enriched in an enzyme exhibiting endoglucanase activity as described above.
For example, the enzyme preparation of the present invention is useful for the degradation or modification of plant cell wall containing materials, said preparation being enriched in an enzyme with endoglucanase activity as described above.
The enzyme preparation having been enriched with an enzyme of WO 96/11262 PCTlDK95100400 the invention may e.g. be an enzyme preparation comprising multiple enzymatic activities, in particular an enzyme pre-paration comprising multiple plant cell wall degrading enzymes such as Pectinex~, Pectinex Ultra SP~, Celluclast* ox Celluzyme*(all available from Novo Nordisk A/S). In the present context, the term "enriched" is intended to indicate that the endoglucanase activity of the enzyme preparation has been increased, e.g. with an enrichment factor of at least 1.1, conveniently due to addition of an enzyme of the inven-tion prepared by the method described above.
Alternatively, the enzyme preparation enriched in an enzyme with cellulolytic (endoglucanase) activity may be one which comprises an enzyme of the invention as the major enzymatic component, e.g. a mono-component enzyme preparation.
The screening and expression cloning may be carried out using the following:
MATERIALS AND METHODS
Donor organism: mRNA was isolated from Acremonium sp., CBS
478.94, and Acremon3um sp., CBS 265.95, respectively, grown in a cellulose-containing fermentation medium with agitation to ensure sufficient aeration. Mycelia were harvested after 4-6 days' growth, immediately frozen in liquid nitrogen and stored at -80°C.
Yeast strains: The Saccharomyces cerevisiae strain used was yNG231 (MAT a, leu2, ura3-52, his4-539, pep4-delta 1, cir+) or JG169 (MATa; ura 3-52; leu 2-3, 112; his 3-D200; pep 4-1137; prcl::HIS3; prbl:: LEU2; cir+).
Flasmids: The expression plasmid pYHDl7 containing the yeast TPI promoter was prepared from the commercially available plasmid pYES*2.0 (Invitrogen). The plasmid and the construc-* = TM
tion thereof is further described in WO 93/11249.
- The Asperg~Ilus expression vector pHD414 is a derivative of the plasmid p775 (described in EP 238 023). The construction 5 of pHD414 is further described in WO 93/11249.
Extraction of total RNA was performed with guanidinium thiocyanate followed by ultracentrifugation through a 5.7 M
CsCl cushion, and isolation of poly(A)*RNA was carried out by oligo(dT)-cellulose affinity chromatography using the pro-10 cedures described in WO 94/14953.
aDNA synthesis and modification: Double-stranded cDNA was synthesized from 5 ~cg of poly(A)* RNA by the RNase H method (Gubler & Hoffman 1983, Sambrook et al., 1989) using the hair-pin modification. The procedure is further described in 15 WO 95/02043. After having been treated with mung bean nuclease (Bethesda Research Laboratories), the ds cDNA was blunt-ended with T4 DNA polymerase (Invitrogen) and the cDNA
was ligated to non-palindromic BstX I adaptors (Invitrogen) as described in WO 95/02043.
20 Construction of cDNA libraries: The adapted, ds cDNA was re-covered by centrifugation, washed in 70% EtOH and resuspended in 25 ml Hzo. Prior to large-scale library ligation, four test ligations were carried out in l0 ~C1 of ligation buffer (same as above) each containing 1 ~.1 ds cDNA (reaction tubes 25 #1 - #3), 2 units of T4 ligase (Invitrogen) and 50 ng (tube #1), 100 ng (tube #2) and 200 ng (tubes #3 and #4) Bst XI
cleaved yeast expression vector (either pYES 2.0 vector Invitrogen or pYHDl7).
Using the optimal conditions a large-scale ligation was set 30 up in 40 ~C1 of ligation buffer. One ~l aliquots were traps-formed into electrocompetent E. coli 1061 cells, and the transformed cells were titered and the library plated on LB +
ampicillin plates with 5000-7000 c.f.u./plate. To each plate was added 3 ml of medium. The bacteria were scraped off, 1 ml glycerol was added and stored at -80°C as pools. The remain-ing 2 ml were used for DNA isolation. For further details reference is made to WO 95/02043.
constructioa of yeast libraries: To ensure that all the bacterial clones were tested in yeast, a number of yeast transformants 5 times larger than the number of bacterial clones in the original pools was set as the limit.
One ~,1 aliquots of purified plasmid DNA (100 ng/~,1) from individual pools were electroporated (200 fl, 1.5 kV, 25 ~,F) into 40 ~C1 competent S. cerevisiae JG 169 cells (OD600 s 1.5 in 500 ml YPD, washed twice in cold DIW, once in cold 1 M
sorbitol, resuspended in 0.5 ml I M sorbitol, (Becker &
Guarante, 1991). After addition of 1 ml 1M cold sorbitol, 80 ~,1 aliquots were plated on SC + glucose - uracil agar plates to give 250-5oo c.f.u./plate and incubated at 30°C for 3-5 days.
Identification of positive colonies: After 3-5 days of growth, the agar plates were replica plated onto several sets of SC + galactose-uracil agar plates. One set of the replica plates contained 0.1% AZCL HE cellulose. These plates were incubated for 3-7 days at 30°C. Endoglucanase positive col-onies were identified as colonies surrounded by a~blue halo.
Cells from enzyme-positive colonies were spread for single colony isolation on agar, and an enzyme-producing single colony was selected for each of the endoglucanase-producing colonies identified.
Characterization of positive clones: The positive clones were obtained as single colonies, the cDNA inserts were amplified directly from the yeast colony using biotinylated polylinker primers, purified by magnetic beads (Dynabead M-280*,Dynal) * = TM
system and characterized individually by sequencing the 5'-end of each cDNA clone using the chain-termination method (Sanger et al., 29'77) and the Sequenase*system (United States Biochemical).
Isolation of a cDNA gene for expression in Aspergillus:
one or more endoglucanase-producing yeast colonies was inocu-lated into 20 ml YPD broth in a 50 ml glass test tube. The tube was shaken for Z days at 30°C. The cells were harvested by centrifugation for l0 min. at 3000 rpm.
DNA was isolated according to WO 94/14953 and dissolved in 50 ~.1 water. The DNA was transformed into E. coli by standard procedures. Plasmid DNA was isolated from E. coli using standard procedures, and analyzed by restriction enzyme analysis. The cDNA insert was excised using appropriate re-striction enzymes and ligated into an Aspergillus expression vector.
Transformation of Aspergfllus oryzae or ~lspergillus nigex Protoplasts may be prepared as described in WO 95/02043, p.
16, line 21 - page 17, line 12:~
100 gel of protoplast suspension is mixed with 5-25 ~.g of the appropriate DNA in 10 ~Cl of STC (1.2 M sorbitol, 1o mM Tris-HC1, pH = 7.5, 10 mM CaCl2). Protoplasts are mixed with p3SR2 . (an A. njduZans amdS gene carrying plasmid). The mixture is left at room temperature for 25 minutes. 0.2 ml of 60% PEG
4000 (BDH 29576), to mM CaClz and 10 mM Tris-HC1, pH 7.5 is . added and carefully mixed (twice) and finally 0.85 ml of the same solution is added and carefully mixed. The mixture is . left at room temperature for 25 minutes, spun a~ 7_500 g for 15 minutes and the pellet is resuspended in 2 ml of 1.2 M
sorbitol: After one more sedimentation the protoplasts are spread on minimal plates (Cove, Biochem. Biophys. Acta 113 (1966) 51-56) containing 1.0 M sucrose, pH 7.0, 10 mM
* = TM
WO 96/11262 ,, ~ PCT/DK95/00400 acetamide as nitrogen source and 20 mM CsCl to inhibit back-ground growth. After incubation for 4-7 days at 37°C spores are picked and spread for single colonies. This procedure is repeated and spores of a single colony after the second reisolation is stored as a defined transformant.
Test of A. oryzae transformants Each of the transformants were inoculated in 10 ml YPM and propagated. After 2-5 days of incubation at 37°C, 10 ml supernatant was removed. The endoglucanase activity was identified by AZCL HE cellulose or AZCL ~i-glucan as described above.
Hybridization conditions (to be used in evaluating property i) of the DNA construct of the invention):
Suitable conditions for determining hybridization between an oligonucleotide probe and an "analogous'° DNA sequence involves presoaking of the filter containing the DNA frag-ments to hybridize in 5xSSC and prehybridizing for 1 h at --50°C in a solution of SxSSC, SxDenhardt's solution, 50 mM
sodium phosphate, pH 6.8, and 50 ~g of denatured sonicated calf thymus DNA, followed by hybridization in the same sol-ution supplemented with 50 ~Ci 32-P-dCTP labelled probe for 18 h at ~50°C followed by washing three times in 2xSSC, 0.2~
SDS at 50°C for 30 minutes.
- A suitable oligonucleotide probe to be used in the hybridiza-tion may be prepared on the basis of the DNA sequence shown in SEQ ID No . 1 ( or 2 or 3 or 4 or ~ 5 or 6 or 7 ) .
Immunological cross-reactivity: Antibodies to be used in determining immunological cross-reactivity may be prepared by use of a purified endoglucanase. More specifically, antiserum against the endoglucanase of the invention may be raised by immunizing rabbits (or other rodents) according to the pro-cedure described by N. Axelsen et al. in: A Manual of Quanti-tative Immunoelectrophoresis,J, Blackwell Scientific Publica-R'O 96!11262 ~ PCT/DK95100400 tions, 1973, Chapter 23, or A. Johnstone and R. Thorpe, Immunochemistry in Practice, Blackwell Scientific Publica-tions, 1982 (more specifically pp. 27-31). Purified immunoglobulins may be obtained from the antisera, for example by salt precipitation ((NH4)2 S04), followed by dia-lysis and ion exchange chromatography, e.g. on DEAF-sephadex*.
Immunochemical characterization of proteins may be done either by outcherlony double-diffusion analysis (O.
Ouchterlony in: Handbook of Exberimental Immunology.(D.M.
l0 Weir, Ed.), Blackwell Scientific Publications, 1967, pp. 655 706), by crossed immunoelectroprcresis (N. Axelsen ,e~ al., su a, Chapters 3 and 4), or by rocket immunoelectrophoresis (N. Axelsen et al., Chapter 2).
Media YPD: 10 g yeast extract, 20 g peptone, Hz0 to 900 ml.
Autoclaved, 100 ml 20% glucose (sterile filtered) added.
YPM: 10 g yeast extract, 20 g peptone, HZO to 900 ml.
Autoclaved, 100 ml 20% maltodextrin (sterile filtered) added.
l0 x Basal salt: 75 g yeast nitrogen base, 113 g succinic acid, 68 g NaOH, H20 ad 1000 ml, sterile filtered.
SC-URA: 100 ml l0 x Basal salt, 28 ml 20% casaminv acids without vitamins, 10 ml 1% tryptophan, H20 ad 900 ml, autoclaved, 3.6 ml 5% threonine and 100 ml 20% glucose or 20%
galactose added.
SC-URA agar: SC-URA, 20 g/1 agar added.
AZCL ~B-glucan, AZCL xyloglucan, AZCL HE cellulose (Megazyme, Australia).
* = TM
WO 96!11262 ~ ~, 0 ~ ~ , , PCT/DK95/00400 Uses detergent Compositions According to the invention, the cellulase may typically be a component of a detergent composition. As such, it may be 5 included in the detergent composition in the form of a non-dusting granulate, a stabilized liquid, or a protected enzyme. Non-dusting granulates may be produced, e.g., as disclosed in US 4,106,991 and 4,661,452 (both to Novo Industri A/S) and may optionally be coated by methods known 10 in the art. Examples of waxy coating materials are polyethylene oxide) products (polyethyleneglycol, PEG) with mean molecular weights of 1000 to 20000; ethoxylated nonyl-phenols having from 16 to 50 ethylene oxide units;
ethoxylated fatty alcohols in which the alcohol contains from 15 12 to 20 carbon atoms and in which there are 15 to 80 ethylene oxide units; fatty alcohols; fatty acids; and mono-and di- and triglycerides of fatty acids. Examples of film-forming coating materials suitable for application by fluid bed techniques are given in patent GB 1483591. Liquid enzyme 20 preparations may, for instance, be stabilized by adding a polyol such as propylene glycol, a sugar or sugar alcohol, lactic acid or boric acid according to established methods.
Other enzyme stabilizers are well known in the art. Protected enzymes may be prepared according to the method disclosed in 25 EP 238,216.
The detergent composition of the invention may be in any convenient form, e.g. as powder, granules, paste or liquid. A
liquid detergent may be aqueous, typically containing up to 70~ water and 0-30~ organic solvent, or nonaqueous.
30 The detergent composition comprises one or more surfactants, each of which may be anionic, nonionic, cationic, or zwitterionic. The detergent will usually contain 0-50~ of anionic surfactant such as linear alkylbenzenesulfonate WO 96/1262 ~: ~ °~ ~ ~ °~ PCT/DK95/00400 (LAS), alpha-olefinsulfonate (AOS), alkyl sulfate (fatty alcohol sulfate) (AS), alcohol ethoxysulfate (AEOS or AES), secondary alkanesulfonates (SAS), alpha-sulfo fatty acid methyl esters, alkyl- or alkenylsuccinic acid, or soap. It may also contain 0-40% of nonionic surfactant such as alcohol ethoxylate (AEO or AE), carboxylated alcohol ethoxylates, nonylphenol ethoxylate, alkylpolyglycoside, alkyldimethylamine oxide, ethoxylated fatty acid monoethanol-amide, fatty acid monoethanolamide, or polyhydroxy alkyl fatty acid amide (e. g. as described in WO 92/06154).
The detergent composition may additionally comprise one or more other enzymes such as amylase, lipase, cutinase, protease, peroxidase, and oxidase, e.g. laccase).
The detergent may contain 1-65% of a detergent builder or complexing agent such as zeolite, diphosphate, triphosphate, phosphonate, citrate, nitrilotriacetic acid (NTA), ethylene-diaminetetraacetic acid (EDTA), diethylenetriaminepentaacetic acid (DTMPA), alkyl- or alkenylsuccinic acid, soluble sili-cates or layered silicates (e.g. SKS-6 from Hoechst). The detergent may also be unbuilt, i.e. essentially free of detergent builder.
The detergent may comprise one or more polymers. Examples are carboxymethylcellulose (CMC), poly(vinylpyrrolidone) (PVP), polyethyleneglycol (PEG), polyvinyl alcohol) (PVA), poly-carboxylates such as polyacrylates, maleic/acrylic acid copolymers and lauryl methacrylate/acrylic acid copolymers.
The detergent may contain a bleaching system which may com-prise a H~O~ source such as perborate or percarbonate which may be combined with a peracid-forming bleach activator such as tetraacetylethylenediamine (TAED) or nonanoyloxybenzene-sulfonate (HOBS). Alternatively, the bleaching system may comprise peroxyacids of, e.g., the amide, imide, or sulfone type.
WO 96!11262 ~ ~ ~ ~ PCT/DK95/00400 The enzymes of the detergent composition of the invention may be stabilized using conventional stabilizing~agents, e.g. a polyol such as propylene glycol or glycerol, a sugar or sugar alcohol, lactic acid, boric acid, or a boric acid derivative such as, e.g., an aromatic borate ester, and the composition may be formulated as described in, e.g., WO 92/19709 and WO
92/19708.
The detergent may also contain other conventional detergent ingredients such as, e.g., fabric conditioners including clays, foam boosters, suds suppressors, anti-corrosion agents, soil-suspending agents, anti-soil-redeposition agents, dyes, bactericides, optical brighteners, or perfume.
The pH (measured in aqueous solution at use concentration) will usually be neutral or alkaline, e.g. in the range of 7-11.
Particular forms of detergent compositions within the scope of the invention include:
1) A detergent composition formulated as a granulate having a bulk density of at least 600 g/1 comprising WO 96/11262 ~ ~ ~ ~ PCT/DK95/00400 r Linear alkylbenzenesulfonate (cal- 7, - 12~
culated as acid) Alcohol ethoxysulfate (e. g. C12_is alcohol, 1-2 EO) or alkyl sulfate 1 - 4~
(e. g. Cl~,is) Alcohol ethoxylate (e.g. Cl15 alco-hol, 7 EO) 5 - 9~
Sodium carbonate (as Na2C03) 14 - 20~
Soluble silicate (as Na20,2Si0~) 2 - 6~
Zeolite (as NaA1Si04) 15 - 220 Sodium sulfate (as NaZS04) 0 - 6~
Sodium citrate/citric acid ( a s C6HSNa30~ / C6H80~ ) 0 - 15 ~
Sodium perborate (as NaB03.H~0) il - 18%
TAED 2 - 6~
Carboxymethylcellulose 0 - 2~
Polymers (e. g. maleic/acrylic acid copolymer, PVP, PEG) 0 - 3~
Enzymes (calculated as pure enzyme 0.0001 - 0.1~
2o protein) Minor ingredients (e. g. suds suppressors, perfume, optical 0 - 5~
brightener, photobleach) WO 96/11262 ~ , PCT/DK95/00400 2) A detergent composition formulated as a granulate having a bulk density of at least 600 g/1 comprising Linear alkylbenzenesulfonate (cal-culated as acid) 6 - 11%
Alcohol ethoxysulfate (e.g. C12_is alcohol, 1-2 EO or alkyl sulfate I - 3%
(e.g. CI~.IS) Alcohol ethoxylate (e.g. Clls alco-hol, 7 EO) 5 - g%
Sodium carbonate (as NazC03) 15 - 21%
Soluble silicate (as Na20,2Si02) 1 - 4%
Zeolite (as NaAlSi04) 24 - 34%
Sodium sulfate (as Na2S04) 4 - 10%
Sodium citrate/citric acid ( a s C6HsNa30~ / C6Hg0~ ) 0 - 15 %
Carboxymethylcellulose 0 - 2%
Polymers (e. g. maleic/acrylic acid copolymer, PVP, PEG) 1 - 6%
Enzymes (calculated as pure enzyme 0.0001 - 0.1%
protein) Minor ingredients (e.g. suds 0 - 5%
suppressors, perfume) WD 96111262 ~ ~ ~ °~ ~ ~ '~ PCTlDK95/00400 3) A detergent composition formulated as a granulate having a bulk density of at least 600 g/1 comprising Linear alkylbenzenesulfonate (cal- 5 - 9%
culated as acid) 5 Alcohol ethoxylate (e.g. C12-is alco-hol, 7 EO) 7 - 14%
Soap as fatty acid (e.g. C,~,~ fatty 1 - 3%
acid) Sodium carbonate (as Na2C03) 10 -10 Soluble silicate (as Na~0,2Si02) 3 - g%
Zeolite (as NaA1Si04) 23 - 33%
Sodium sulfate (as NaZS04) 0 - 4%
Sodium perborate (as NaB03.H20) 8 - 16%
TAED 2 - 8%
15 Phosphonate (e.g. EDTMPA) 0 - 1%
Carboxymethylcellulose 0 - 2%
Polymers (e. g. maleic/acrylic acid copolymer, PVP, PEG) 0 - 3%
Enzymes (calculated as pure enzyme 0.0001 - 0.1%
20 protein) Minor ingredients (e. g. suds suppressors, perfume, optical p - 5%
bra.ghtener) WO 96/11262 ~ ~ . , PCT/DK95100400 4) A detergent composition formulated as a granulate having a bulk density of at least 600 g/1 comprising Linear alkylbenzenesulfonate (cal- 8 - 12%
culated as acid) Alcohol ethoxylate (e.g. Clz-is alco-hol, 7 EO) 10 - 25%
Sodium carbonate (as Na2C03) 14 - 22%
Soluble silicate (as Na20,2Si02) 1 - 5%
Zeolite (as NaA1Si04) 25 - 35%
Sodium sulfate (as Na2S04) 0 - 10%
Carboxymethylcellulose 0 - 2%
Polymers (e. g. maleic/acrylic acid copolymer, PVP, PEG) 1 - 3%
Enzymes (calculated as pure enzyme 0.0001 - 0.1%
protein) Minor ingredients (e.g. suds 0 - 5%
suppressors, perfume) WO 96/11262 '~ PCTlDK95/00400 4~
5) An aqueous liquid detergent composition comprising Linear alkylbenzenesulfonate (cal- 15 21%
culated as acid) Alcohol ethoxylate (e. g. Ciz-is alco-hol, 7 EO or C,z-is alcohol, 5 EO) 12 - 18%
Soap as fatty acid (e.g. oleic 3 13%
acid) -Alkenylsuccinic acid (Clz-ia) 0 - 13%
Aminoethanol 8 - 18%
l0 Citric acid 2 - 8%
Phosphonate o - 3%
Polymers (e.g. PVP, PEG) 0 - 3~
Borate ( as B40~) 0 - 2 %
Ethanol 0 - 3~
Propylene glycol 8 - 14%
Enzymes (calculated as pure enzyme o.oool - o.i%
protein) Minor ingredients (e. g.
dispersants, suds suppressors, 0 - 5%
perfume, optical brightener) R'U 96/11262 ~ j - ~ PCTIDK95/00400 6) An aqueous structured liquid detergent composition com-prising Linear alkylbenzenesulfonate (calculated as acid) 15 - 21%
Alcohol ethoxylate (e.g. C1z_is alcohol, 7 EO, or Cla-isalcohol, 5 3 - 9%
EO) Soap as fatty acid (e.g. oleic 3 - 10%
acid) Zeolite (as NaA1Si04) 14 - 22%
Potassium citrate 9 - 18%
Borate (as B40~) 0 - 2 %
Carboxymethylcellulose 0 - 2%
Polymers (e.g. PEG, PVP) 0 - 3%
Anchoring polymers such as, e.g., lauryl methacrylate/acrylic acid 0 - 3%
copolymer; molar ratio 25:1; MW
Glycerol 0 - 5%
Enzymes (calculated as pure 0.0001 - 0.1%
enzyme protein) Minor ingredients (e. g.
dispersants, suds suppressors, 0 - 5%
perfume, optical brighteners) R'O 96/11262 ~ ~ ~ PCT/DK95/00400 7) A detergent composition formulated as a granulate having a bulk density of at least f00 g/1 comprising Fatty alcohol sulfate 5 - 10%
Ethoxylated fatty acid monoethanol- 3 9%
amide -Soap as fatty acid 0 - 3%
Sodium carbonate (as NaZC03) 5 - io%
Soluble silicate (as Na20,2SiOz) 1 _ 4%
Zeolite (as NaA1Si04) 20 - 40%
1o Sodium sulfate (as Na2S04) 2 - 8%
Sodium perborate (as NaB03.Fi20) 12 - 1$%
TAED 2 - 7%
Polymers (e.g. maleic/acrylic acid 1 copolymer, PEG) 5%
Enzymes (calculated as pure enzyme 0.0001 0.1%
protein) -Minor ingredients (e. g. optical brightener, suds suppressors, per- 0 5%
fume) -WO 96!11262 ~ ~ °~ ~' PCT/DK95/00400 8) A detergent composition formulated as a granulate compris-ing Linear alkylbenzenesulfonate (calculated as acid) 8 - 14%
5 Ethoxylated fatty acid 5 - 11$
monoethanolamide Soap as fatty acid 0 - 3~
Sodium carbonate (as Na2C03) 4 - 10 Soluble silicate (as Na20,2Si02) 1 - 4~
10Zeolite (as NaA1Si04) 30 - 50~
Sodium sulfate (as NaZS04) 3 - 11~
Sodium citrate (as C6HSNa30~) 5 - 12~
Polymers (e.g. PVP, maleic/acrylic 1 - 5~
acid copolymer, PEG) 15Enzymes (calculated as pure enzyme 0.0001 - 0.1~
protein) Minor ingredients (e.g. suds 0 - 5~
suppressors, perfume) t~ WO 96/11262 ~ ~ PCT/DK95/00400 9) A detergent composition formulated as a granulate compris-ing ' Linear alkylbenzenesulfonate (calculated as acid) 6 - 12~
Nonionic surfactant 1 - 4~
Soap as fatty acid 2 - s Sodium carbonate (as NazC03) 14 Zeolite (as NaA1Si04) 18 -32~
Sodium sulfate (as Na2S04) 5 - 20~
Sodium citrate (as C6HSNa30~) 3 Sodium perborate (as NaB03.H20) 4 _ Bleach activator (e.g. NOBS or 1 - 50 TAED ) Carboxymethylcellulose 0 -2~
Polymers (e.g. polycarboxylate or 1 -PEG ) Enzymes (calculated as pure enzyme 0.0001 - o.
protein) Minor ingredients (e.g. optical 0 - 5%
brightener, perfume) WO 96!11262 PCT/DK95I00400 X20 1~' °~.
10) An aqueous liquid detergent composition comprising Linear alkylbenzenesulfonate (calculated as acid) 15 - 23%
Alcohol ethoxysulfate (e.g. Clz_ls alcohol, 2-3 EO) 8 - 15%
Alcohol ethoxylate (e.g. Clz-is al-cohol, 7 EO, or CIZ-isalcohol, 5 3 - 9%
EO) Soap as fatty acid (e.g. lauric 0 - 3%
acid) Aminoethanol 1 - 5%
Sodium citrate 5 - 10%
Hydrotrope (e.g. sodium 2 - 6%
toluensulfonate) Borate ( as B40~) 0 - 2 Carboxymethylcellulose 0 - 1%
Ethanol 1 - 3%
Propylene glycol 2 - 5%
Enzymes (calculated as pure 0.0001 - 0.1%
enzyme protein) Minor ingredients (e. g. polymers, dispersants, perfume, optical 0 - 5%
brighteners) WO 96/11262 '~ '~ PCT/DK95100400 11) An aqueous liquid detergent composition comprising Linear alkylbenzenesulfonate - (calculated as acid) 20 - 32~
Alcohol ethoxylate (e.g. Ciz-~s alco-hol, 7 EO, or Clz-is alcohol, 5 EO) 6 - 12~
Aminoethanol 2 - 6%
Citric acid 8 - 14~
Borate ( as B40z) 1 - 3 ~
Polymer (e. g. maleic/acrylic acid copolymer, anchoring polymer such as, e.g., lauryl methacrylate- o - 3~
/acrylic acid copolymer) Glycerol 3 - 8%
Enzymes (calculated as pure enzyme 0.0001 - 0.1~
protein) Minor ingredients (e. g. hydro-tropes, dispersants, perfume, 0 - 5$
optical brighteners) WO 96/11262 ~ ~ ~ ~ PCT/DK95100400 12) A detergent composition formulated as a granulate having a bulk density of at least 600 g/1 comprising Anionic surfactant (linear alkylbenzenesulfonate, alkyl sulfate, alpha-olefinsulfonate, 25 - 40~
alpha-sulfo fatty acid methyl esters, alkanesulfonates, soap) Nonionic surfactant (e.g. alcohol 1 - 10%
ethoxylate) Sodium carbonate (as NazC03) 8 - 25~
Soluble silicates (as Na20, 2Si0z) 5 - 15%
Sodium sulfate (as Na2S04) 0 - 5~
Zeolite (as NaA1Si04) 15 - 28%
Sodium perborate (as NaB03.4H20) 0 - 20~
Bleach activator (TAED or NOBS) 0 - 5~
Enzymes (calculated as pure enzyme 0.0001 - 0.1~
protein) Minor ingredients (e.g. perfume, 0 - 3~
optical brighteners) 13) Detergent formulations as described in 1) - 12) wherein all or part of the linear alkylbenzenesulfonate is replaced by (C,~-C18) alkyl sulfate.
WO 96/11262 ~ ~ ~ ~ PCT/DK95/00400 14) A detergent composition formulated as a granulate having a bulk density of at least 600 g/1 comprising - (C12-C,g) alkyl sulfate 9 - 15~
Alcohol ethoxylate 3 5 Polyhydroxy alkyl fatty acid amide 1 - 5~
Zeolite (as NaA1Si04) 10 -20~
Layered disilicate (e. g. SK56 from Hoechst) 10 - 20%
Sodium carbonate ( as Na2C03) 3 - 12 ~
10 Soluble silicate (as Na~0,2Si02) 0 Sodium citrate 4 - 80 Sodium percarbonate 13 - 22~
TAED 3 - 8~
Polymers (e.g. polycarboxylates and 0 -15 PVP=
Enzymes (calculated as pure enzyme 0.0001 - 0.1~
protein) Minor ingredients (e. g. optical 20 brightener, photo bleach, perfume, 0 - 5~
suds suppressors) WO 96/11262 ~ ~ ~ '~ ~ ~ PCTIDK95/00400 15) A detergent composition formulated as a granulate having a bulk density of at least 600 g/1 comprising , alkyl sulfate 4 - 8% -Alcohol ethoxylate 11 - 15%
Soap 1 - 4%
Zeolite MAP or zeolite A 35 - 45%
Sodium carbonate ( as Na2C03 ) 2 - 8 Soluble silicate (as Na20,2Si02) 0 - 4%
Sodium percarbonate 13 - 22%
TAED 1 - 8%
Carboxymethyl cellulose 0 - 3%
Polymers (e.g. polycarboxylates and 0 - 3%
PVP) Enzymes (calculated as pure enzyme 0.0001 - 0.1%
protein) Minor ingredients (e.g. optical 0 - 3%
brightener, phosphonate, perfume) 16) Detergent formulations as described in 1) - 15) which contain a stabilized or encapsulated peracid, either as an additional component or as a substitute for already specified bleach systems.
17) Detergent compositions as described in 1), 3), 7), 9) and 12) wherein perborate is replaced by percarbonate.
18) Detergent compositions as described in 1), 3), 7), 9), 12), 14) and 15) which additionally contain a manganese catalyst. The manganese catalyst may, e.g., be one of the compounds described in "Efficient manganese catalysts for low-temperature bleaching", Nature 369, 1994, pp. 637-639.
19) Detergent composition formulated as a nonaqueous deter-gent liquid comprising a liquid nonionic surfactant such as, WO 96111262 ~ ~ ~ 't PCT/DK95/00400 e.g., linear alkoxylated primary alcohol, a builder system (e. g. phosphate), enzyme and alkali. The detergent may also comprise anionic surfactant and/or a bleach system.
The cellulase of the invention may be incorporated in concen-trations conventionally employed in detergents. It is at present contemplated that, in the detergent composition of the invention, the cellulase may be added in an amount corre-sponding to 0.00001-1 mg (calculated as pure enzyme protein) of cellulase per liter of wash liquor.
l0 Pulp and paper applications In the papermaking pulp industry, the enzyme preparation according to the invention may be applied advantageously e.g.
as follows:
- For debarking: pretreatment with the enzyme preparation according to the invention may degrade the cambium layer prior to debarking in mechanical drums resulting in advan-tageous energy savings.
- For defibration: treatment of a material containing cellulosic fibers with the enzyme preparation of the inven-tion prior to refining or beating may result in reduction of the energy consumption due to the hydrolysing effect of the cellulase on the interfibre surfaces. Use of the enzyme preparation of the invention may result in improved energy savings as compared to the use of known enzymes, since it is believed that the enzyme composition of the invention may possess a higher ability to penetrate fibre walls.
- For fibre modification, i.e. improvement of fibre prop-erties where partial hydrolysis across the fibre wall is needed which requires deeper penetrating enzymes (e.g. in order to make coarse fibers more flexible). Deep treatment of 1120 ' PCT/DK95I00400 fibers has so far not been possible for high yield pulps e.g.
mechanical pulps or mixtures of recycled pulps. This has been ascribed to the nature of the fibre wall structure that prevents the passage of enzyme molecules due to physical restriction of the pore matrix of the fibre wall. It is contemplated that the enzyme composition of the invention is capable of penetrating into the fibre wall.
- For drainage improvement. The drainability of papermaking pulps may be improved by treatment of the pulp with hydrolysing enzymes, e.g. cellulases. Use of the enzyme preparation according to the invention may be more effective, e.g. result in a higher degree of loosening bundles of strongly hydrated micro-fibrils in the fines fraction (con-sisting of fibre debris) that limits the rate of drainage by blocking hollow spaces between fibers and in the wire mesh of the paper machine. The Canadian standard freeness (CSF) increases and the Schopper-Riegler drainage index decreases when pulp in subjected to cellulose treatment, see e.g. US
patent 4,923,565; TAPPI T227, SCAN C19:65..
- For inter fibre bonding. Hydrolytic enzymes are applied in the manufacture of papermaking pulps for improving the inter fibre bonding. The enzymes rinse the fibre surfaces for impurities e.g. cellulosic debris, thus enhancing the area of exposed cellulose with attachment to the fibre wall, thus improving the fibre-to-fibre hydrogen binding capacity. This process is also referred to as dehornification. Paper and board produced with a cellulose containing enzyme preparation according to the invention may have an improved strength or a reduced grammage, a smoother surface and an improved printability. These improvements are believed to be a result of ~" a improved penetrability of the modified/derivatised enzyme(s).
- For enzymatic deinking. Partial hydrolysis of recycled ._....-.~.r_. . __.."~",_, . ._~_~.._ . _ ____._._.._..__ WO 96/11262 ~ ~ '~ PCTlDK95/00400 paper during or upon pulping by use of hydrolysing enzymes such as cellulases are known to facilitate the removal and agglomeration of ink particles. Use of the enzyme preparation according to the invention may give a more effective loosen-s ing of ink from the surface structure due to a better pen-etration of the enzyme molecules into the fibrillar matrix of the fibre wall, thus softening the surface whereby ink par-ticles are effectively loosened. The agglomeration of loosened ink particles are also improved, due to a more efficient hydrolysis of cellulosic fragments found attached to ink particles originating from the fibres.
The treatment of lignocellulosic pulp may, e.g., be performed as described in WO 91/14819, WO 91/14822, WO 92/17573 and WO
92/18688.
Textile applications In another embodiment, the present invention relates to use of the enzyme preparation according to the invention in the bio-polishing process. Bio-Polishing is a specific treatment of the yarn surface which improves fabric quality w~.th respect to handle and appearance without loss of fabric wettability. The most important effects of Bio-Polishing can be characterized by less fuzz and pilling, increased gloss/luster, improved fabric handle, increased durable softness and altered water absorbency. Bio-Polishing usually takes place in the wet processing bf the manufacture of knitted and woven fabrics. Wet processing comprises such steps as e.g. desizing, scouring, bleaching, washing, dying/printing and finishing. During each of these steps, the fabric is more or less subjected to mechanical action. In general, after the textiles have been knitted or woven, the fabric proceeds to a desizing stage, followed by a scouring stage, etc. Desizing is the act of removing size from tex-tiles. Prior to weaving on mechanical looms, warp yarns are WO 9G/11262 ~ ~ ~ - PCT/DK95/00400 often coated with size starch or starch derivatives in order to increase their tensile strength. After weaving, the size coating must be removed before furt~er processing the fabric in order to ensure a homogeneous and wash-proof result. It is 5 known that in order to achieve the effects of Bio-Polishing, a combination of cellulolytic and mechanical action is required. It is also known that "super-softness" is achiev-able when the treatment with cellulase is combined with a conventional treatment with softening agents. It is contem-10 plated that use of the enzyme preparation of the invention for bio-polishing of cellulosic fabrics is advantageous, e.g.
a more thorough polishing can be achieved. Bio-polishing may be obtained by applying the method described e.g. in WO
93/20278.
15 Stone-washina .It is known to provide a "stone-washed" look (localized abrasion of the colour) in dyed fabric, especially in denim fabric or jeans, either by washing the denim or jeans made from. such fabric in the presence of pumice stones to provide 20 the desired localized lightening of the colour of the fabric or by treating the fabric enzymatically, in particular with cellulolytic enzymes. The enzyme treatment may be carried out either alone such as disclosed US 4,832,864, together with a smaller amount of pumice than required in the traditional 25 process, or together with perlite such as disclosed in WO
95/09225.
Determination of cellulolytic activity Cellulolytic enzymes hydrolyse CMC, thereby increasing the viscosity of the incubation mixture. The resulting reduction 30 in viscosity may be determined by a vibration viscosimeter (e.g. MIVI 3000 from Sofraser, France). Determination of the cellulolytic activity, measured in terms of S-CEViJ, may be determined according to the assay described below:
The s-CEw assay quantifies the amount of catalytic activity present in the sample by measuring the ability of the sample to reduce the viscosity of a solution of carboxy-methyleellu-lose (CMC). The assay is carried out at 40°C; pH 7.5; 0.1M
phosphate buffer; time 30 min; using a relative enzyme stan-dard for reducing the viscosity of the CMC substrate (carboxymethylcellulose Hercules 7 LFD); enzyme concentration approx. 0.15 S-CEW/ml.
Further, 1 Savi U (unit) is defined as the amount of enzyme capable of forming 1 ;cmole of glucose equivalents per minute.
The invention is further illustrated by the following non-limiting examples.
zdentifiaation of relationship with alkaline cellulases from Z5 BumiCOla insolens, DsM 1800 The ochterlony immunodiffusion test was used for identifica-tion of the relationship of the strains Acremonium sp., CBS
265.95, Acremonium sp., CBS 478.94, Acremonium persicinum, _ CBS 169.65, Acremonium acremonium, AHU 9519, and -- 20 Cephalosporium sp., CBS 535.71 with alkaline cellulases from Humicola insolens, DSM 1800.
Antisera were raised by the Applicant against the Humicola .n insolens, DSM 1800, strain and used~in dilutions from 1 to 1/16. Blocks of fungi grown on amorphous cellulose-agar 25 medium were inserted into the wells of 0.9% Bacto-agar-PEST
(Phosphate Buffer Saline) adjusted by NaOH to pH 7.4 contain-ing 0.5 ml of Tween*20 per litre of PEST. Around the blocks induced by cellulase fungi, other wells were filled with other dilutions of antisera (from 1 to 1/16). Small petri 30 dishes were inserted into larger dishes with wet wadding to protect against drying-out and were incubated at 37°C over-* = TM
WO 96/11262 ' ~ ~ ~ ~ - ~ PCT/DK95/00400 night.
None of the blocks containing Acremonium sp., CBS 265.95, Acremonium sp., CBS 478.94, Acremonium persicinum, CBS
169.65, Acremonium acremonium, AHU 9519, and Cephalosporium sp., CBS 535.71 formed precipitation arcs with the antisera.
Determination of alkaline cellulase activity on amorphous cellulose Materials and methods:
Substrate preparation: 20 gram acid-swollen AVICEL' stock solution (see below for a preparation which can be stored for one month) was centrifuged for 20 min. at 5000 rpm, the su-pernatant was poured off, and the sediment was resuspended in 30 ml of buffer. Then the suspension was centrifuged for 20 min. at 5000 rpm, the supernatant was poured off, and the sediment was resuspended in buffer to a total of 30 g. This corresponds to a substrate concentration of 10 g AVICEL/1.
duffer: 0.1 M Barbital at pH 8.5 or 0.1 M Glycine at pH 10.0 Enzyme solution:
The enzymes were diluted to an activity of 0.2-1 S-CEVU/ml at pH 8.5 or pH lo. o.
lea eC~ rits : ' 2 ~ NaOH, PHBAH-reagent: 1.5 g of p-hydroxy benzoic acid hy-drazide and 5.0 g sodium tartrate was dissolved in 100 ml of 2 ~ NaOH.
The substrate, the buffer and the enzyme solution were mixed to a final substrate concentration of 4.00 g/1.
W~ 96/11262 ~ ~ ~ ~ ~ ~ ~ PCT/DK95100400 Preparation of Acid swollen cellulose:
Materials:
g Avicel~ (Art. 2331 Merck) 150 ml 85% ortho-phosphoric acid (Art. 573 Merck) 5 400 ml acetone (Art. 14 Merck) 1.3 1 deionized water (Milli Q) 1 1 glass beaker 1 1 glass filter funnel 2 1 suction flask Ultra Turrax Homogenizer Procedure:
Acetone and phosphoric acid was cooled on ice.
5 g Avicel' was moistened with water, then 150 ml of ice cold 85% ortho-phosphoric acid was added, and the mixture was placed on ice bath with weak stirring for 1 h.
100 ml of ice cold acetone was added with stirring, followed by transfer of the mixture to a glass filter funnel, followed by washing with 3 x 100 ml ice cold acetone and dry suction after each washing.
The filter cake was washed with 2 x 500 ml water and sucked as dry as possible after each wash.
The filter cake was resuspended to a total volume of 300 ml and blended to homogeneity (using the Ultra Turrax Homogen-izes) .
The resulting product was stored in a refrigerator.
The substrate/buffer solution was preheated for 5 min at 40'C. Then the enzyme solution was added and the solution was whirlmixed for 5 sec., followed by incubation for 20 min. at 40 'C. The reaction was stopped by adding 500 ~cl 2% NaOH
solution, followed by whirlmixing for 5 sec. The samples were centrifuged for 20 min. at 5000 rpm. 1000 ,ul of supernatant was transferred from the test tubes to new test tubes, and 500 ~,1 PHI3AH-reagent was added, followed by boiling for 10 min. The test tubes were cooled in ice water.
Wm 96/11262 ~ ~ ~ ~ ~ ~ PCT/DK95/00400 The absorbance of the samples were measured on a spectro-photometer at 410 nm.
Standard q_lucose curve:
A stock solution containing 300 mg/1 was diluted to 5, 10, 15 and 25 mg/1, respectively. 1000 ~1 of the diluted standards were mixed with 500 ~C1 of PHBAH-reagent and were treated as the other samples, see above.
pefinition:
1 Savi U (unit) is defined as the amount of enzyme capable of forming 1 ~Cmole of glucose equivalents per minute.
petermination of activity: The release of reducing glucose equivalent was calculated using the standard curve.
The results are shown in the table below.
The strain mentioned in the table below were grown in shaking flasks in a substrate consisting of:
Rofec ( from Roquette) 10 g/ 1 NH4N03 10 g / 1 KHZPO4 10 g/ 1 Solcaf loc 4 0 g/ 1 MgS04,7H~0 0.75 g/1 Pluronic 100 0.1 ml Water ad 1000 ml The activity was measured in S-CEW/ml.
WD 96!11262 ~ ~ ~ ~ ~ '~ PCTlDK95100400 TABLE (Activity) Enzyme compositions S-CEVLT/ml Savi U/ml Savi U/ml (strain) pH 10 pH 8.5 Acremonium sp., 55 4.4 2.2 5 CBS 265.95 Acremonium sp., 22 2.5 1.9 CBS 478.94 cephalosporium sp., 116 3.8 2.3 CBS 535.71 10 Acremonium persicinum, 63 3.5 2.1 CBS 169.65 Acremonium acremonium, 23 15 Preparation of alkaline cellulase powder Cellulase powder preparations according to the invention was prepared by cultivation of the following Acremonium strains, respectively: A. brachypenium, CBS 866.73, A. dichromosporum, CBS 683.73 /ATCC 32181, A. obclavatum, CBS 311.74, A.
20 pinkertoniae, CBS 157.70, A. roseogriseum, CBS 134.56, A.
incoloratum, CBS 146.62 / ATCC 14613, and A. furatum, CBS
299.70H.
Each cellulase preparation was prepared as follows:
A YPG agarslant was used as seed culture medium. An agar 25 piece of spores grown on agar plate was inoculated to a 500 ml volume Erlenmeyer flask with 2 bafflers containing 100 ml culture medium. Cultivation for 48 hours at 27°C.
WO 9G/11262 ~ ~ , PCT/DK95/00400 r 3 ml of this seed culture were then inoculated to a main cul-ture medium consisting of 4 % wheat bran and 0.1% Tween 80, at pH 6.7, again in 100 ml total fluid in 500 ml Erlenmeyer shake flask. Cultivation for 5 days at 27°C on a shaking table. 25 shake flask was used and the broth filtrates was collected through sintered glass filter to avoid adsorption to cellulosic material.
The filtrate was concentrated on an Amicon ultrafiltration unit with a membrane with a cut off at 10 kD to 1/5 of the original volume and freeze dried.
The activity was measured in S-CEVLT/mg.
TABLE (Activity) Enzyme compositions (strain) S-CEVLT/mg Acremonium brachypenium, CBS 866.73 48 Acremonium dichromosporum, CBS 62 683.73 Acremonium obclavatum, CBS 311.74 693 Acremonium pinkertoniae, CBS 157.70 550 Acremonium roseogriseum, CBS 134.56 38 Acremonium incoloratum, CBS 146.62 132 Acremonium furatum, CBS 299.70H 82 WO 96/11262 ~ ~ ~ ~ ~ ~ PCT/DK95100400 Performance of cellulase from Acremonium strains in detergent compositions Materials and methods Apparatus . Terg-o-tometer Liquid volume . 100 ml Agitation . 150 movements/min with vertical stirrer Rinse time . l0 min in running tapwater Washing temp . 40'C
Washing liquor . 6.5 g/1 of powder detergent, European type (Ariel Color, commercial enzymes already in the detergent powder were inactivated by heating to 85C in a microwave oven and maintaining this temperature for 10 min.
pH . 10.0 Water hardness . 2 mM CaCl2 Washing time . 30 min Repetitions . 6 Textile . 2 swatches of aged black 1000 cotton 5x6 cm 2o Drying . Tumble dry Evaluation:
When the surface fibrils and fibers protruding from the yarn are removed by cellulase, the surface of the black fabric appears darker and free from fuzz. A test panel ranks the swatches relative to each other. They are given a number starting with 1 from the "ugliest~~ and up to 18 for the ' "nicest" swatch.. Swatches with values above 12 have a very improved surface appearance. Swatches with values above 6 have a clearly visible improved surface appearance.
Results:
For each tested strain, three different dosages of cellulase PCT/DK95l00400 WO 96!11262 were tested and compared with a blind sample:
Strain 0 50 100 250 Acremonium sp., CBS 478.94 2.0 12.3 14.0 15.0 Acremonium sp., CBS 265.95 2.0 3.0 9.7 9.0 The data show that especially Acremonium sp., CBS 478.94, but also Acremonium sp., CBS 265.95, give very good color clari-fication in the commercial detergent matrix.
Performance of cellulase from Acremonium strains measured as removal of surface fibrils and fibers protruding from the yarn of a textile containing cellulosic fibers Materials and methods Apparatus . Terg-o-tometer Liquid volume . 100 ml Agitation . 150 movements/min with vertical stirrer Rinse time . 5 min in tapwater Washing temp . 40' Washing liquor . 0.05 M phosphate buffer pH . 7.0 Washing time . 30 min Repetitions . 2 Textile . 2 swatches of aged black 1000 cotton 5x6 cm Drying . Tumble dry Evaluation:
When the surface fibrils and fibers protruding from the yarn are removed by cellulase, the surface of the black fabric appears darker and free from fuzz. A test panel ranks the swatches relative to each other. They are given a number starting with 1 from the "ugliest" and up to 18 for the "nicest" swatch. Swatches with values above 12 have a very improved surface appareance.
For each tested strain, two different dosages of Acremonium cellulase were tested and compared with a blind sample:
Strain 0 200 500 1000 2500 A. furatum, CBS 299.70H 5.5 13.0 n.t. 18.0 n.t.
A. incoloratum, CBS 146.62 5.5 n.t. 13.0 n.t. 16.0 The data show that especially cellulase from Acremonium furatum, CBS 299.70H, but also from Acremonium incoloratum, CBS 146.62 (ATCC 14613), gives very good colour clarification under the test conditions.
In further tests, also cellulases from Acremonium obclavatum~
CBS 311.?4, Acremonium brachypenium~ CBS 866.73, and Acremonium pinkertoniae, CBS 157.70, showed colour clarlflca-tion~under the test conditions.
Cloning and expression of a Family 5 cellulase from Acremonium sp., CBS 265.95 A library from Acremonium sp. CBS 265.95 consisting of approx. 106 individual clones in 50~pools was constructed in E. coli as described.
DNA was isolated from 100 individual clones from the library and subjected to analysis for cDNA insertion. The insertion frequency was found to be >99~. DNA from some of the pools was transformed into yeast, and 50-100 plates containing 250-500 yeast colonies were obtained from each pool.
WO 96/11262 ~ ~ ~~ v' PCT/DK95/00400 Endoglucanase-positive colonies were identified and isolated on agar plates with AZCL HE cellulose. cDNA~inserts were amplified directly from the yeast colonies and characterized as described in the Materials and Methods section above. The 5 N-terminal and C-terminal DNA sequences, respectively, of the cDNA encoding the endoglucanase is shown in SEQ ID No. 1 and 2.
The cDNA is obtainable from the plasmid in DSM 10076.
The isolated yeast clones were simultaneously tested on agar l0 plates containing AZCL ~i-glucan, AZCL xyloglucan or AZCL HE
cellulose, and found positive on AZCL HE cellulose and AZCL
~3-glucan.
Total DNA was isolated from a yeast colony and plasmid DNA
was rescued by transformation of E. coli as described above.
15 In order to express the endoglucanase in Aspergillus, the DNA
was digested with HindIII/XbaI, size fractionated on gel, and a fragment corresponding to the endoglucanase gene was purified. The gene was subsequently ligated to HindIII/XbaI
digested pHD414 resulting in the plasmid pA2C346.
20 After amplification of the DNA in E. coli the plasmid pA2C346 was transformed into Aspergillus oryzae as described above.
Test of A. oryzae transformants Each of the transformants were tested for endoglucanase activity as described above. Some'of the transformants had 25 endoglucanase activity which was significantly larger than the Aspergillus oryzae background. This demonstrates effi-cient expression of the endoglucanase in Aspergillus oryzae.
The endoglucanase was determined as being a Family 5 cellulase (determation of family based on the disclosure in 30 Henrissat, B. et al. in Biochem. J. Vol. 293, p. 781-788, (1993)) and having a fungal type CBD (cellulose binding domain)at the N-terminal. Fungal type CBD's are described by Gilkes, Henrissat, Kilburn, Miller and Warren 1.n Microbiological Reviews, Vol. 55, p. 303-315, (1991).
Cloning and expression of a Family 7 cellulase from Acremonium sp., CBS 265.95 A library from Acremonium sp. CBS 265.95 consisting of approx. 106 individual clones in 50 pools was constructed in E. coli as described.
Cloning and expression was carried out as described in example 6, the resulting plasmid being pA2C347.
The isolated yeast clones were simultaneously tested on agar plates containing AZCL (3-glucan, AZCL xyloglucan or AZCL HE
cellulose, and found positive on all substrates AZCL HE
cellulose, AZCL xyloglucan and AZCL ~i-glucan.
The DNA sequence of the cDNA encoding the endoglucanase is shown in SEQ ID No. 3.
The cDNA is obtainable from the plasmid in DSM 9969.
The endoglucanase was determined as being a Family 7 cellulase (determation of family~based on the disclosure in Henrissat, B. et al. in Biochem. J. Vol. 293, p. 781-788, (1993) ) .
The molecular weight (MW) of the endoglucanase.expressed in Aspergillus oryzae was determined to 58 kD in SDS-PAGE.
WO 96/11262 °~' ~ ~ ~ y ~ PCT/DK95l00400 Cloning and expression of a Family 7 cellulase from Acxemonium sp., CBS 478.94 A library from Acremonium sp. CBS 478.94 consisting of approx. 106 individual clones in 50 pools was constructed in E. coli as described.
Cloning and expression was carried out as described in - example 6, the resulting plasmid being pA2C349.
The isolated yeast clones were simultaneously tested on agar plates containing AZCL ~3-glucan, AZCL xyloglucan or AZCL HE
cellulose, and found positive on all substrates: AZCL HE
cellulose, AZCL xyloglucan and AZCL (3-glucan.
The DNA~sequence of the cDNA encoding the endoglucanase is shown in SEQ ID No. 4. This sequence showed about 66% ident-ity with the DNA coding for Fusarium oxysporum EG I for 945 bases, cf. Sheppard et al., 1994, Family C endoglucanase.
The cDNA is obtainable from the plasmid in DSM 9977.
The endoglucanase was determined as being a Family 7 cellulase (determation of family based on the disclosure in Henrissat, B. et al. in Biochem. J. Vol. 293, p. 781-788, (1993) ) .
The molecular weight (MW) of the endoglucanase expressed in Aspergillus oryzae was determined to 60 kD in SDS-PAGE.
WO 96/11262 ~ '~ PCT/DK95/00400 Cloning and expression of a new cellulase from Acremonivm sp., CB8 478.94 A library from Acremonium sp. CBs 478.94 consisting of approx. 106 individual clones in 50 pools was constructed in E. coli as described.
Cloning and expression was carried out as described in example 6, the resulting plasmid being pA2C359.
The isolated yeast clones were simultaneously tested on agar plates containing AZCL (3-glucan, AZCL xyloglucan or AZCL HE
cellulose, and found positive on only two substrates: AZCL HE
cellulose and AZCL xyloglucan.
The DNA sequence of the cDNA encoding the endoglucanase is shown in SEQ ID No. 5.
The cDNA is obtainable from the plasmid in DSM 10077.
The N-termnail showed homology to fungal type CBD's as described by Gilkes, Henrissat, Kilburn, Miller and Warren in Microbiological Reviews, Vol. 55, p. 303-315, (1991).
2o cloning and expression of a Family 5 cellulase from Acremonium sp., CBS 478.94 A library from Acremonium sp. CBS 478.94 consisting of approx. 106 individual clones in 50 pools was constructed in E. coli as described.
Cloning and expression was carried out as described in WO 96/11262 ~ ~ ~ ~ PCT/DK95/00400 example 6, the resulting plasmid being pA2C363.
The isolated yeast clones were simultaneously tested on agar plates containing AZCL ~i-glucan, AZCL xyloglucan or AZCL HE
cellulose, and found positive on 2 substrates: AZCL HE cellu-lose and AZCL ~3-glucan.
The DNA sequence of the cDNA encoding the endoglucanase is shown in SEQ ID No. 6.
The cDNA is obtainable from the plasmid in DSM 10079.
The endoglucanase was determined as being a Family 5 cellulase (determation of family based on the disclosure in Henrissat, B. et al. in Biochem. J. Vol. 293, p. 781-788, (1993)) and having a fungal type CBD (cellulose binding domain)at the N-terminal. Fungal type CBD~s are described by Gilkes, Henrissat, Kilburn, Miller and Warren in Microbiological Reviews, Vol. 55, p. 303-315, (1991).
The molecular weight (MW) of the endoglucanase expressed in Aspergillus oryzae was determined to 60 kD in SDS-PAGE.
More than 50~ relative activity was obtained in the pH range between pH 6.5 to 10 using CMC as substrate.
Cloning and expression of a cellulase from Acremonium sp., CBS 478.94 A library from Acremonium sp. CBS 478.94 consisting of approx. 106 individual clones in 50 pools was constructed in E. coli as described.
Cloning and expression was carried out as described in '~ WO 96/11262 ~ PCT/DK95/00400 example 6, the resulting plasmid being pA2C369.
The isolated yeast clones were simultaneously tested on agar plates containing AZCL (i-glucan, AZCL xyloglucan or AZCL HE
cellulose, and found positive on two substrates: AZCL HE
5 cellulose and AZCL xyloglucan.
The partial N-terminal DNA sequence of the cDNA encoding the endoglucanase is shown in SEQ ID No. 7.
The cDNA is obtainable from the plasmid in DSM 10084.
10 Performance of cloned cellulase from Acremonium sp. measured as removal of surface fibrils and fibers protruding from the yarn of a textile containing cellulosic fibers Enzyme: The endoglucanase described in example 10 Apparatus: Terg-o-tometer 15 Liquid volume: 100 ml Agitation: 150 movements/min with vertical stirrer Rinse time: 5 min in tapwater Washing temp: 40'C
Water hardness: I) 0 'dH
20 II) 1 mM CaCl2 = app. 6 'dH
Washing liquor: I) 0.05 M phosphate buffer, pH 7.0 II) 6.5 g/1 Ariel~Color, pH 10.0, commercial enzymes already in detergent were inactivated - by heating to 85'C in microwave oven, keeping 25 for 10-minutes at this temperature.
Washing time: I) 30 min II) 20 min Repetitions: I) 2 cycles II) 3 cycles 30 Textiles for WO 96/11262 ~ ~ j 1 PCT/DK95/00400 evaluation: 2 swatches of aged black 100 cotton 5x6 cm Drying: Tumble dry Evaluation:
When the surface fibrils and fibers protruding from the yarn are removed by cellulase, the surface of the black fabric appears darker and free from fuzz. A test panel ranks the swatches relative to each other. They are given a number starting with 1 from the "ugliest" and up to 18 for the "nicest" swatch.. Swatches with values above 11 have a very improved surface appearance. Swatches with values above 6 have a clearly visible improved surface appearance.
Two different dosages were tested and compared with a blind sample. Data as panel score units on pre-aged black cotton.
The data in-between buffer and detergent cannot be compared directly, as they refer to different experiments with differ-ent washing times and different number of repetitions.
S-CEVLT/1: 0 100 400 500 1000 2500 I) Phosphate buffer, pH 7 2.5 n.t. n.t. 14.3 n.t. 16.8 II) Ariel Color, pH 10 2.0 6.0 11.3 n.t. 11.7 n.t.
n.t. - not tested The data show that the tested endoglucanase (encoded by the DNA sequence obtainable from the plasmid in Saccharomyces cerevisiae, DSM 10079, give good color clarification in both buffer and detergent.
WO 96111262 ~ Q ~ ~ ~ ~ PCT/DK95/00400 REFERENCES
Ali, B.R.S. et al., "Cellulases and hemicellulases of the anaerobic fungus Piromyces constitute a multiprotein cellu-lose-binding complex and are encoded by multigene families", FEMS Microbiol. Lett. (1995), Vol. 125, No. 1, pp. 15-21.
Altshul et al., Bull. Math. Bio. Vol 48: 603-616, 1986.
Becker, D. M. & Guarante, L. 1991. Methods Enzymol. 194: 182-187.
Dalb~ge, H. and Heldt°Hansen, H.P., "A novel method for efficient expression cloning of fungal enzyme genes", Mol.
Gen. Genet. (1994), Vol. 243, pp. 253-260.
Gilkes, Henrissat, Kilburn, Miller and Warren in Microbiological Reviews, Vol. 55, p. 303-315, (1991).
Needleman, S.B. and Wunsch, C.D., Journal of Molecular Bio1-ogy, 48: 443-453, 1970.
Gonz~les, R., et al., "Cloning, sequence analysis and yeast expression of the egll gene from Trichoderma Iongibrachiatum", Appl. Microbiol. Biotechnol. (1992), Vol.
38, pp. 370-375.
Gubler, U. & Hoffman, B. J. 1983. Gene 25: 263-269.
Henikoff and Henikoff, Proc. Natl. Acad. Sci. USA vol 89:
10915-10919, 1992.
Henrissat, B. and Bairoch, A. in Biochem. J. Vol. 293, p.
781-788, (1993)).
Rev. Microbiol. (1990), Vol. 44, pp. 219-248.
WO 9GI11262 ~ ~ PCT/DK95/00400 Henrissat, B., "Cellulases and their interaction with cellu-lose", Cellulose (1994), Vol. 1, pp. 169-196.
Higuchi R., Krummel B. and Saiki R. K. (1988). A general method of in vitro preparation and specific mutagenesis of ' DNA fragments: study of protein and DNA interactions. Nucl.
Acids Res. 16: 7351-7367.
Kang, M.G., Park, H.M., Kim, Y.S, Lee, J.R., Kim, Y.K., Lee, Y.H.: Abstract from 94th General Meeting, American Society Microbiology, K-112, 1994. Purification and some proterties of carboxymethyl cellulase from alkalophilic Cephalosporium sp RYM 202.
Peberdy, J.F.: Penicillium and Acremonium, (1987), p. 2-4, Plenum Press, -New York,-Penttila, M. et al, (1986) Homology between cellulase gnees of Trichoderma reesei: complete nucleotide sequence of the endoglucanase I gene. Gene 45:253-263.
Saloheimo, M. et al, (1988) EGIII, a new endoglucanase from Trichoderma reesei: the characterization of both gene and enzyme. Gene 63:11-21.
Sambroolt, J., Fritsch, E. F. & Maniatis, T. 1989. Molecular Cloning: A Laboratory Manual. Cold Spring Harbor Lab., Cold Spring Harbor, NY.
Saloheimo, A., et al., "A novel, small endoglucnaase gene, eg5, from Trichoderma reesei isolated by expression in yeast", Molecular Microbiology (1994), Vol. 13(2), pp. 219-228.
Sanger, F., Nicklen, S. & Coulson, A. R. 1977. Proc. Natl.
Acad. Sci. U. S. A. 74: 5463-5467.
Sheppard, P.O., et al., "The use of conserved cellulase - family-specific sequences to clone Cellulase homologue cDNAs from Fusarium oxysporum, Gene, (1994), Vol. 15, pp. 163-167.
van Arsdell, J.N. et al, (1987) Cloning, characterization, and expression in Saccharomyces cerevisiae of endoglucanase I
from Trichoderma reesei, Bio/Technology 5: 60-64.
Xue, G. et al., "Cloning and expression of multiple cellulase cDNAs fromthe anaerobic rumen fungus Neocallimastix patriciarum in E. coli, J. Gen. Microbiol. (1992), Vol. 138, pp. 1413-1420.
Xue, G. et al., "A novel polysaccharide hydrolase cDNA (celD) from Neocallimastix patriciarum encoding three multifunc-tional catalytical domains with high endoglucanase, cellobiohydrolase and xylanase activities", J. Gen.
Microbiol. (1992), Vol. 138, pp. 2397-2403.
Zhou, L. et al., "Intronless celB from the anaerobic fungus Neocallimastix patriciarum encodes a modular family A
endoglucanase", Biochem. J. (1994), Vol. 297, pp. 359-364.
Methods in Enzymology, 1988, Vol. 160, p. 200-391 (edited by Wood, W.A. and Kellogg, S.T.).
T.-M. Enveri, "Microbial Cellulases" in W.M. Fogarty, Micro-bial Enzymes and Biotechnology, Applied Science Publishers, 183-224 (1983).
- Beguin, P. and Aubert, J-P., °'The biological degradation of cellulose", FEMS Microbiolagy Reviews 13 (1994) 25-58.
International Patent Publication WO 93/11249.
International Patent Publication WO 94/14953.
WO 96!11262 ~ '~ ~ PCT/DK95/00400 International Patent Publication WO 95/02043.
Ford et al., Protein Expression and Purification 2: 95-107, 1991.
Cunningham and Wells, Science 244, 1081-1085, 1989).
5 de Vos et al., Science 255: 306-312, 1992.
Smith et al., J. Mol. Biol. 224: 899-904, 1992.
Wlodaver et al., FEBS Lett. 309: 59-64, 1992.
N. Axelsen et al., A Manual of Quantitative Immunoelectrophoresis, Blackwell Scientific Publications, 10 1973, Chapters 2,3,4 and 23.
WO 96/11262 P ~ ~ ~ ~ ~ PCT/DK95100400 SEQUENCE LISTING
. (1) GENERAL INFORMATION:
(i) APPLICANT:
(A) NAME: Novo Nordisk A/S
(B) STREET: Novo Alle (C) CITY: DK-2880 Bagsvaerd (E) COUNTRY: Denmark (F) POSTAL CODE (ZIP): DK-2880 (G) TELEPHONE: +45 44 44 88 88 (H) TELEFAX: +45 44 49 32 56 (I) TELEX: 37304 (ii) TITLE OF INVENTION: TITLE
(iii) NUMBER OF SEQUENCES: 7 (iv) COMPUTER READABLE FORM:
(A) MEDIUM TYPE: Floppy disk (B) COMPUTER: IBM PC compatible (C) OPERATING SYSTEM: PC-DOS/MS-DOS
(D) SOFTWARE: PatentIn Release #1.0, Version #1.30 (EPO) (2) INFORMATION FOR SEQ ID NO: 1:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 590 base pairs (B) TYPE: nucleic acid ' 25 (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: cDNA
WO 96/11262 ~ ~ ~ ~ ~ PCT/DK95/00400 (v) FRAGMENT TYPE: N-terminal (vi) ORIGINAL SOURCE:
(A) ORGANISM: Acremonium sp.
(B) STRAIN: CBS 265.95 (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 1:
(2) INFORMATION FOR SEQ ID NO: 2:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 580 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: cDNA
(v) FRAGMENT TYPE: C-terminal WO 96/11262 ~ a ~ ~ ~ ~ PCTIDK95/00400 (vi) ORIGINAL SOURCE:
(A) ORGANISM: Acx~emonium sp.
(B) STRAIN: CBS 265.95 (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 2:
ACATATTCTA CCTTTCCAAA F03F~.A P~3A,AAAAAAA 580 (2) INFORMATION FOR SEQ ID NO: 3:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 1511 base pairs (B) TYPE: nucleic acid . (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: cDNA
(vi) ORIGINAL SOURCE:
(A) ORGANISM: Acremonium sp.
(B) STRAIN: CBS 265.95 W~ 96111262 ~ ~ ~ ~ ~ ~ . ~ PCT/DK95/00400 (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 3:
CGGCCAGGTCATCGAGTCGTACGTCGTCGACGCGCCGGGCCTGACCCGTGACCGACAGCA1020 ' i ..__ CA 02201871 2003-10-29 5 TTGATCTTGAAAA,AAAAAF~A AAAAAAAAAAAAAAAAAAAA AAAAAAATGCGCCGCTCGAG 1500 (2) INFORMATION FOR SEQ ID NO: 4:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 1461 base pairs 10 (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: cDNA
(Vi) ORIGINAL SOURCE:
15 (A) ORGANISM: Acremonium sp.
(B) STRAIN: CBS 478.94 (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 4:
WD 96!11262 ~ ~ ~ ~ ~ PCTIDK95/00400 ATCGACACCG AGGGCAACCCGTCGAATATCGTCAAGGGTG~AGCCCAACCCCGTCGTCACC1380 (2) INFORMATION FOR SEQ ID NO: 5:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 1965 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear i (ii) MOLECULE TYPE: CDNA
(vi) ORIGINAL SOURCE:
(A) ORGANISM: Acremonium sp.
(H) STRAIN: CBS 47$.94 (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 5:
GAGGACTCAG
CGGTGCCATC TGGGCTCAGATCGCCGACAAGCTCAAG.TGCAAGTCGTCTCTCCTTTCGTT780 Wm 96/11262 ~' ~ PCT/DK95/00400 ACCGTAGAAATACTAGTCCCTGATCTGATGF~~AAAAAAAAAAAAA 1965 (2) INFORMATION FOR SEQ ID NO: 6:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 1321 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: cDNA
(vi) ORIGINAL SOURCE:
(A) ORGANISM: Acremonium sp.
CA 02201871 2003-10-29 _ (B) STRAIN: CBS 48~94 (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 6:
CGACACAACAACGAGTACCACACGATGGACCAGAACTCGTGTTCAACCTCACCCAGACGA?20 2 GCACCGGCGGTTCAGGGGATACTGGACItW:WCGAGGCCAACGACGACGTGTGGAAGGGA1080 O
wo ~n m62 pc~Tmx9s~oo4o0 GCTGAGTCTG ATCAATAGCT ATCTACCTAA CTGACTCGAA AAAAAAAAAA P~AAAAAAAAA 1320 (2) INFORMATION FOR SEQ ID NO: 7:
5 (i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 105 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear 10 (ii) MOLECULE TYPE: cDNA
(v) FRAGMENT TYPE: N-terminal (vi) ORIGINAL SOURCE:
(A) ORGANISM: Acremonium sp.
(B) STRAIN: CHS 478.94 15 (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 7:
CTCCCGTGCG CCACGGTCCT CGCCGACAGC TGGAAGAATG TCAAG IOS
WO 961112Cn2 ~ ~ ~ ~ PCT/DK95/00400 INDICATIONS RELATING TO A DEPOSITED MICROORGANISM
(PCT Rule l3bis) A. The indications made below relate to the microorganism referred to in the description ' on page 13 , line 2 8 - 31 B. IDENTIFICATION OF DEPOSTT Further deposits are identified on an additional sheet Name of depositary institution DEUTSCHE SAMMLUNG VON MIKROORGANISMEN
UND ZELL-KULTUREN GmbH
Address of depositary institution (including postal code and country) Mascheroder Weg lb, D-38124 Braunschweig, Federal Re-public of Germany Date of deposit Accession Number 30 June 1995 DSM 10076 C. ADDITIONAL INDICATIONS (leave blankifnotapplicable) This information is continued on an additional sheet In respect of those designations in which a European and/or Australian patent is sought, during the pendency of the patent application a sample of the deposited microorganism is only to be provided to an independent expert nominated by the person requesting the sample (Rule 28(4) EPC / Regulation 3.25 of Australia Statutory Rules 1991 No D. DESIGNATED STATES FOR WHICIi INDICATIONS ARE MADE (if the indications are not for all designated States) E. SEPARATE FURNISHING OF INDICATIONS
(Irave blank if not applicable) The indications listed below will besubmitted to the International Bureau later (specifytfiegencalnatureoftheindicationrGg., Acccrsion Number of Deposit For receiving Office use only For International Bureau use only ~' This sheet was received with the international application Q This sheet was received by the International Bureau on:
Authorized ofFcer Authorized ofFcer ~'Gi~~:~~'~~~>~
Form PCT/RO/13~1 (July 1992) WO 96/11262 ~ ~ ~ PCT/DK95/00400 INDICATIONS RELATING TO A DEPOSITED MICROORGANISM
(PCT Rule l3bis) A. The indications made below relate to the microorganism referred to in the description on page 15 , line 3 - 7 B. IDENTIFICATION OF DEPOSIT Further deposits are identified on an additional sheet Name of depositary institution DEUTSCHE SAMMLUNG VON MIKROORGANISMEN
UND ZELL-KULTUREN GmbH
Address of depositary institution (including postal code and country) Mascheroder Weg lb, D-38124 Braunschweig, Federal Re-public of Germany Date of deposit Accession Number 11 May 1995 DSM 9969 C. ADDITIONAL INDICATIONS (leave blankifnot applicable) This information is continued on an additional sheet In respect of those designations in which a European and/or Australian patent is sought, during the pendency of the patent application a sample of the deposited microorganism is only to be provided to an independent expert nominated by the person requesting the sample (Rule 28(4) EPC / Regulation 3.25 of Australia Statutory Rules 1991 No D. DESIGNATED STATES FOR WHICH INDICATIONS
ARE MADE (iftbeindicationsarenot for all deaignatedStates) E. SEPARATE FURNISHING OF INDICATIONS
(leave blank if not applicable) The indications listed below will be submitted to the International Bureaulater(specifythegeneralnatureaftheindicationreg., Accession NumberofDeposit For receiving Office use only For International Bureau use only This sheet was received with the international application o This sheet was received by the International Bureau on:
Authorized officer , ~ ~ Authorized officer Form PCTIRO/134 (July 1992) WO 96/11262 ~ ~ PCT/DK95/00400 INDICATIONS RELATING TO A DEPOSITED MICROORGANISM
(PCT Rule l3bis) A. The indications made below relate to the microorganism referred to in the description on page 16 , line 9 -13 B. IDENTIFICATION OF DEPOSIT Further deposits are identified on an additional sheet Name of depositary institution DEUTSCHE SAMMLUNG VON MIKROORGANISMEN
UND ZELL-KULTUREN GmbH
Address of depositary institution (including postal code and country) Mascheroder Weg ib, D-38124 Braunschweig, Federal Re-public of Germany Date of deposit Accession Number 11 May 1995 DSM 9977 C. ADDITIONAL INDICATIONS (leave blank if not applicable) This information is continued on an additional sheet . In respect of those designations in which a European and/or Australian patent is sought, during the pendency of the patent application a sample of the deposited microorganism is only to be provided to an independent expert nominated by the person requesting the sample (Rule 28(4) EPC / Regulation 3.25 of Australia Statutory Rules 1991 No D. DESIGNATED STATES FOR WHICFI
INDICATIONS ARE MADE (iftheindicationsarenot for all designated States) E. SEPARATE FURNISHING OF INDICATIONS
(Ie:aveblankifnot applicable) The indications listed below will be submitted to the International Bureau later (specifythegenoalnatureoftheindicatio~crag., "Accession NumbrrofDeposit For receiving Office use only For International Bureau use only This sheet was received with the international application ~ 'This sheet was received by the International Bureau on:
Authorized ofFcer Authorized officer Form PCT/RO/134 (July 1992) WO 96111262 ~ ~ '~ ~_ , PCT/DK95/00400 INDICATIONS RELATING TO A DEPOSITED MICROORGANISM
(PCT Rule l3bis) A. The indications made below relate to the microorganism referred to in the description on page 17 , line 14-18 , B. IDENTIFICATION OF DEPOSIT Further deposits are identified on an additional sheet Name of depositary institution DEUTSCHE SAMMLUNG VON MIKROORGANISMEN UND ZELL-KULTUREN GmbH
Address of depositary institution (including postal code and counlry) Mascheroder Weg 1b, D-38124 Braunschweig, Federal Re-public of Germany Date of deposit Accession Number 30 June 1995 DSM 10077 C. ADDITIONAL INDICATIONS (leave blankifnor applicable) This information is continued on an additional sheet In respect of those designations in which a European and/or Australian patent is sought, during the pendency of the patent application a sample of the deposited microorganism is only to be provided to an independent expert nominated by the person requesting the sample (Rule 28(4) EPC / Regulation 3.25 of Australia Statutory Rules 1991 No 71 D. DESIGNATED STATES FOR WIiICH INDICATIONS ARE MADE (iftheindicationsarenot for all duignatedSeates) E. SEPARATE FURNISHING OF INDICATIONS (h:aveblankifnoe applicable) The indications listed below will be submitted to the International Bureau Later (specifythegencalnatureoftheindicationsag., Acussion NumberofDeposit For receiving Office use only For International Bureau use only ~ This sheet was received with the international application ~ 'Ibis sheet was received by the International Bureau on:
Authorized officer Authorized officer Form PGT/R'b/134 (July 1992) WO 96/11262 ~ ~ ~ ~ PCT/DK95I00400 INDICATIONS RELATING TO A DEPOSITED MICROORGANISM
(PCT Rule I3bis) A. The indications made below relate to the microorganism referred to in the description on page 18 , line 19-23 B. IDENTIFICATION OF DEPOSIT Further deposits are identified on an additional sheet Name of depository institution DEUTSCHE SAMMLUNG VON MIKROORGANISMEN
UND ZELL-KULTUREN GmbH
Address of depository institution (including postal code and country) Mascheroder Weg 1b, D-38124 Braunschweig, Federal Re-public of Germany Date of deposit Accession Number 30 June 1995 DSM 10079 C. ADDITIONAL INDICATIONS (leave blankifnotapplicable) This information is continued on an additional sheet In respect of those designations in.which a European and/or Australian patent is sought, during the pendency of the patent application a sample of the deposited microorganism is only to be provided to an independent expert nominated by the person requesting the sample (Rule 28(4) EPC / Regulation 3.25 of Australia Statutory Rules 1991 No 71).
D. DESIGNATED STATES FOR WHICH INDICATIONS
ARE MADE (iftheindicationsarenot for all designatedStater) E. SEPARATE FLTR1VISHING OF INDICATIONS
(leave blankifnot applicable) The indications listed below will besubmittedtotheInternationalBureaulater(specifythegeneralnatureofrheindication se.g.
Accession , Number of Deposit -- For receiving OfFce use only For International Bureau use only This sheet was received with the international application ~ This sheet was received by the International Bureau on:
Authorized ofFcer ~--- Authorized ofFcer Form PCT~D/134 (July 1990 W~ 96111262 PCTt'DK95/00400 INDICATIONS RELATING TO A DEPOSITED MICROORGANISM
(PCT Rule l3bis) A. The indications made below relate to the microorganism referred to in the description line 25-29 , e 1g a on .
, g p B. IDENTIFICATION OF DEPOSIT Further deposits are identified on an additional sheet Namc of depositary institution DEUTSCHE SAMMLUNG VON MIKROORGANISMEN
UND ZELL-KULTUREN GmbH
Address of depositary institution (including postal code and country) Mascheroder Weg lb, D-38124 Braunschweig, Federal Re-public of Germany Date of depos3 Accession Number 0 J U n a 19 9 5 0 S M 10 0 8 4 C. ADDITIONAL INDICATIONS (leave blank if not applicable) This information is continued on an additional sheet . In respect of those designations in which a European and/or Australian patent is sought, during the pendency of the patent application a sample of the deposited microorganism is only to be provided to an independent expert nominated by the person requesting the sample (Rule 28(4) EPC / Regulation 3.25 of Australia Statutory Rules 1991 No 71).
D. DESIGNATED STATES FOR WHICFI
INDICATIONS ARE MADE (if the indications are not for afl designated States) E. SEPARATE FURNISHING OF INDICATIONS
(Icavc blank if not applicable) The indications listed below will be submitted to the International Bureau later(specifythcgeneralnatureoftheindicationsag., Accession Number of Deposit For receiving Office use only For International Bureau use only This sheet was received with the international application ~ This sheet was received by the International Bureau on:
Authorized officer Authorized officer O/I34 (1 WO 96/11262 ~ ~ ~ ~ ~ ~ ~ PCT/DK95/00400 INDICATIONS RELATING TO A DEPOSITED MICROORGANISM
(PCT Rule l3bis) A. The indications made below relate to the microorganism referred to in the description ' on page 8 , line 15 -18 .
B. IDENTIFICATION OF DEPOSIT Further deposits are identiFed on an additional sheet Name of depositary institution CENTRAALBUREAU VOOR SCHIMMELCULTURES
Address of depositary institution (including postal code and country) Oosterstraat 1, Postbus 273, NL-3740 AG Barn, Nether-land Date of deposit Accession Number 28 September 2994 CBS 478.94 C. ADDITIONAL INDICATIONS (leave blank if not applicable) This information is continued on an additional sheet In respect of those designations in which a European and/or Australian patent is sought, during the pendency of the patent application a sample of the deposited microorganism is only to be provided to an independent expert nominated by the person requesting the sample (Rule 28(4) EPC / Regulation 3.25 of Australia Statutory Rules 1991 No 71).
D. DESIGNATED STATES FOR WHICIi INDICATIONS ARE MADE (iftheindicationsarenot for all designated States) E. SEPARATE FURIfISHING OF INDICATIONS
(Iravrblankifnot applicable) TbeindicationslistedbelowwillbesubmittedtothelnternationalBureaulater(specifyrh egeneralnatureofthcindicationse.g., Accession NumbrrofDepoait For receiving Office use only For International Bureau use only This sheet was received with the international application ~ This sheet was received by the International Bureau on:
Authorized officer Authorized officer Form PCT/RO/134 (July 1992) WO 96tii262 ~ ~ PCT/DK95/00400 INDICATIONS RELATING TO A DEPOSITED MICROORGANISM
(PCT Rule l3bis) A. The indications made below relate to the microorganism referred to in the description on page 8 , line 24-27 . , B. IDENTIFICATION OF DEPOSIT Further deposits are identified on an additional sheet Name of depositary institution CENTRAALBUREAU VOOR SCHIMMELCULTURES
Address of depositary institution (including postal code and country) Oosterstraat l, Postbus 273, NL-3740 AG Barn, Nether-land Date of deposit Accession Numbet 7 April 1995 CBS 265.95 C. ADDITIONAL INDICATIONS (Icavcblankifnot applicable) This information is continued on an additional sheet In respect of those designations in which a European and/or Australian patent is sought, during the pendency of the patent application a sample of the deposited microorganism is only to be provided to an independent expert nominated by the person requesting the sample (Rule 28(4) EPC / Regulation 3.25 of Australia Statutory Rules 1991 No 71).
D. DESIGNATED STATES FOR WHICH INDICATIONS
ARE MADE (iftheindicationsarenot for all daignatedStates) E. SEPARATE FURNISHING OF INDICATIONS
(leave blank if not applicable) The indications listed below will be submitted to theIntemationalBureaulater(specifythegeneralnatureoftheindicationsGg., Accession NumbcrofDeposit For receiving Office use only For International Bureau use only This sheet was received with the international application Q This sheet was received by the International Bureau on:
Authorized officer ~ ~ ~ ~ ~ Authorized officer Form PGT/RO/134 (July 1992)
Claims (14)
1. A DNA sequence encoding an enzyme exhibiting endoglucanase activity, selected from the group consisting of a) a DNA sequence comprising the N-terminal DNA sequence shown in SEQ ID No.
1 and the C-terminal DNA sequence shown in SEQ ID No. 2;
b) the DNA sequence shown in SEQ ID No. 3;
c) the DNA sequence shown in SEQ ID No. 4;
d) the DNA sequence shown in SEQ ID No. 5;
e) the DNA sequence shown in SEQ ID No. 6; and f) a DNA sequence having at least 80% identity to the DNA sequences of a)-e).
1 and the C-terminal DNA sequence shown in SEQ ID No. 2;
b) the DNA sequence shown in SEQ ID No. 3;
c) the DNA sequence shown in SEQ ID No. 4;
d) the DNA sequence shown in SEQ ID No. 5;
e) the DNA sequence shown in SEQ ID No. 6; and f) a DNA sequence having at least 80% identity to the DNA sequences of a)-e).
2. An enzyme exhibiting endoglucanase activity, which enzyme is encoded by the DNA sequence according to claim 1.
3. A detergent composition comprising the enzyme encoded by the DNA sequence according to claim 1 and at least one component selected from the group consisting of surfactants, sequestering agents, inorganic salts, additional enzymes, enzyme ac-tivators or accelerators, chlorine capturing or reducing agents, bleaching agents, bleach activators, solubilising agents, perfumes, antioxidants, pigments, and water.
4. A method of providing localised variation in the colour density of dyed fabric, wherein the fabric is treated with the enzyme encoded by the DNA sequence accord-ing to claim 1.
5. A method of draining an aqueous suspension of paper pulp, wherein the paper pulp is treated with the enzyme encoded by the DNA sequence acCOrding to claim 1.
6. A method for the de-inking of recycled paper, wherein the paper is treated with the enzyme encoded by the DNA sequence according to claim 1.
7. The DNA sequence according to claim 1, which DNA sequence is isolated from a strain of Acremonium.
8. A recombinant expression vector comprising the DNA sequence according to claim 1.
9. A cell comprising the DNA sequence according to claim 1 or a recombinant ex-pression vector according to claim 8.
10. The cell according to claim 9, which is a eukaryotic cell selected from the group consisting of fungal cells and yeast cells.
11. The cell according to claim 14, wherein the cell belongs to a strain of Aspergillus or Trichoderma.
12. The cell according to claim 11, wherein the cell belongs to a strain of Aspergillus niger or Aspergillus oryzae.
13. A method for producing an enzyme exhibiting endoglucanase activity, the method comprising culturing the cell according to any one of claims 9-12 under conditions permitting the production of the enzyme, and recovering the enzyme from the culture.
14. An enzyme preparation which is enriched in the enzyme exhibiting endogluca-nase activity according to claim 2, which enzyme preparation additionally comprises one or more enzymes selected from the group consisting of galactanases, xy-lanases, arabinanases, pectin acetyl esterases, polygalacturonases, rhamnogalacturonases, pectin lyases, pectate lyases, endo-glucanases, pectin methylesterases, proteases, lipases, amylases, cutinases, peroxidases, laccases, cellobiohydrolases and transglutaminases.
Applications Claiming Priority (5)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| DK116094 | 1994-10-06 | ||
| DK1160/94 | 1994-10-06 | ||
| DK1296/94 | 1994-11-11 | ||
| DK129694 | 1994-11-11 | ||
| PCT/DK1995/000400 WO1996011262A1 (en) | 1994-10-06 | 1995-10-06 | An enzyme and enzyme preparation with endoglucanase activity |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CA2201871A1 CA2201871A1 (en) | 1996-04-18 |
| CA2201871C true CA2201871C (en) | 2005-12-06 |
Family
ID=29407223
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CA 2201871 Expired - Fee Related CA2201871C (en) | 1994-10-06 | 1995-10-06 | An enzyme and enzyme preparation with endoglucanase activity |
Country Status (1)
| Country | Link |
|---|---|
| CA (1) | CA2201871C (en) |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111057694B (en) * | 2019-12-17 | 2022-05-03 | 云南农业大学 | A highly active cellulase derived from the rumen of large bovine and its gene |
-
1995
- 1995-10-06 CA CA 2201871 patent/CA2201871C/en not_active Expired - Fee Related
Also Published As
| Publication number | Publication date |
|---|---|
| CA2201871A1 (en) | 1996-04-18 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| EP0788541B1 (en) | Enzyme preparation with endoglucanase activity | |
| EP0815209B2 (en) | Novel endoglucanases | |
| EP1632557B1 (en) | Novel alkaline cellulases | |
| US5912157A (en) | Alkaline cellulases | |
| JP5357514B2 (en) | Chrysosporium cellulase and method of use | |
| US5972872A (en) | Enzyme preparation with cellulytic activity | |
| CA2201871C (en) | An enzyme and enzyme preparation with endoglucanase activity |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| EEER | Examination request | ||
| MKLA | Lapsed |
Effective date: 20131009 |
|
| MKLA | Lapsed |
Effective date: 20131009 |