CA2198863A1 - Marker for individuals susceptible to alcoholism - Google Patents

Marker for individuals susceptible to alcoholism

Info

Publication number
CA2198863A1
CA2198863A1 CA 2198863 CA2198863A CA2198863A1 CA 2198863 A1 CA2198863 A1 CA 2198863A1 CA 2198863 CA2198863 CA 2198863 CA 2198863 A CA2198863 A CA 2198863A CA 2198863 A1 CA2198863 A1 CA 2198863A1
Authority
CA
Canada
Prior art keywords
asa
seq
mutation
primer
sequence
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Abandoned
Application number
CA 2198863
Other languages
French (fr)
Inventor
Paul Manowitz
Ronald D. Poretz
David Park
Michael Ricketts
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Algene LLC
Original Assignee
Individual
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority claimed from US08/299,187 external-priority patent/US5736325A/en
Application filed by Individual filed Critical Individual
Publication of CA2198863A1 publication Critical patent/CA2198863A1/en
Abandoned legal-status Critical Current

Links

Landscapes

  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

The present invention relates to methods for diagnosis of susceptibility to alcoholism or the pathological effects of alcoholism based on detection of a genetic marker in an individual. The present invention is directed generally to methods and associated compositions and kits for detecting the presence of arylsulfatase A (ASA) pseudodeficiency (PD) mutations in humans. Detection of these mutations has been surprisingly found to be a strong indicator for susceptibility to alcoholism and/or susceptibility to alcohol's pathological effects, as well as an important marker in evaluating the likelihood of metachromatic leukodystrophy (MLD).

Description

Wo 96/07098 ~ 'I 9 8 8 6 3 PCT/USg5/~ 4 MARKER FOR INDIVIDUALS SUS~'~;l'll~LE TO ALCOHOLISM

The research leading to the present invention was supported in part with funds from National Institute on Alcoholism and Alcohol Abuse Grant No. ROI-AA-07799. The Government may have certain rights in the invention.

FIELD OF THE INVENTION

The present invention relates to methods for diagnosis of susceptibility to alcoholism or the pathological effects of alcoholism based on detection of a genetic marker in an individual.

BACKGROUND OF THE INVENTION

10 A large number of adoption and twin studies indicate that there is a genetic factor or factors to at least some forrns of alcoholism (Goodwin, 1979, Arch. Gen. Psychiatry 36:57-61). However, to date, the only genetic factor that has been clearly identified in alcoholism is a deficiency in aldehyde dehydrogenase activity. This deficiency leads to a reduction, not an increase, in the rate of alcoholism.

15 Earlier studies showed that arylsulfatase A (ASA) electrophoresed in native polyacrylamide gels and stained for enzymatic activity exhibited a variety of electrophoretic patterns, some of which were more likely to be found in alcoholic patients than ir. non-alcoholic psychiatric and normal control subjects (Hulyalkar et al., 1984, Alcoh.: Clin. Exp. Res. 8:337-341). However, lacking any biochemical explanation for 20 these observations, no correlation with a genetic basis or marker for alcoholism was possible.

A more severe neuropathological disease associated with a deficiency of ASA is metach~ ic leukodystrophy (MLD). MLD is a debilitating genetic disease characterized by neuropsychological deficits. In late-onset MLD, the initial symptoms 25 include attentional difficulties, hyperactivity, impulsivity, poor judgement, and emotional lability (Shapiro et al., 1994, Neurology 44:662-665). MLD patients display a characteristic demyelination pathology resulting from increased levels of s-llf~ti~l~c. This WO 96/07098 ~ 3 PCT/US95/11114 glycolipid comprises a significant proportion of the myelin sheath and ~ccnm~ tes in oligodendrocytes and Schwann cells of individuals with MLD.

MLD is caused by the lack of the enzyme activity of aryl~ulf~t~ce A (ASA, EC 3.1.6.8), a Iysosomal glycoprotein which catalyzes the desulfation of slllfatidçs, the first step in sulfatide catabolism.

Some individuals exhibit much reduced levels of ASA activity, but appear to catabolize slllf~ti(lçs adequately and lack apl)arc"l MLD-related neurological symptoms (Kolodny, E.H., 1989, The Metabolic Basis of Inherited Disease, eds., pp. 1721-1750). These people are pseudodeficient for ASA (PD-ASA) and possess an ASA gene which has two A-G transitions. One of these mutations results in an Asn350 to Ser conversion, causing a loss of a potential N-glycosylation site, and the other in a polyadenylation signal consensus sequence alteration, resulting in a reduction of a 2.1 Kb message (Gieselmann et al., 1989, Proc. Natl. Acad. Sci. USA. 86:9436-9440). The PD-ASA gene frequency, at approximately 10%, is quite common (Nelson et al., 1991, Hum. Genet. 87:87-88). A
number of multiband electrophoretic variants of ASA are found in the general population (Poretz, et al., 1992, Biochem. J. 287:979-983). Some of the inventors herein have previously demonstrated that the electrophoretic (non-denaturing) pattern is due to a heterogeneous mixture of ASA isoforms with variable degrees of phosphorylation of the N-glycan moieties, and hypothesized that the variant forms may reflect differences in both the structure of the carbohydrate units and polypeptide of the enzyme ((Poretz, et al., 1992, Biochem. J. 287:979-983; Park et al., 1993, FASEB J. 7:744 (abstract)).

The pseudodeficiency mutations do not cause MLD but reduce the enzyme activity of ASA
sufficiently to complicate the diagnosis of MLD and MLD carrier status in families where they occur (Gieselmann et al., 1991, Dev. Neurosci., 86:9436-9440; Wenger & Louie, 1991, Dev. Neurosci., 13:215-221). While the polyadenylation signal sequçn~e mutation has been proposed to be the cause of the reduced ASA activity in pseudodeficiency (Giesçlm~nn et al.~ 1989, Proc. Natl. Acad. Sci. USA, 86:9436-9440) there is evidence that the N-glycosylation site mutation also reduces ASA enzyme activity (Shen et al., 1993, Am. J. Med. Genet., 45:631-637). This is significant as the N-glycosylation site mutation can occur in the absence of the polyadenylation signal site mutation (Nelson et al., 1991, Hum. Genet., 87:87-88; Shen et al., 1993, Am. J. Med. Genet., 45:631-637).

Wo 96/07098 2 ~ g 8 8 ~ 3 PCT/US95/11114 The ability to distinguish this mutation is therefore important in diagnosis and risk determination in families with MLD (Shen et al., 1993, Am. J. Med. Genet., 45:631-637).

Previously, allele specific tests have been described (Gieselmann et al., 1989, Proc. Natl.
5 Acad. Sci. USA 86:9436; Gieselmann et al., 1991, Human Gen. 86:251). However, no clear relationship between neurologic disease and enzyme deficiency has been conclusively established (Kolodny, 1989, in Metabolic Basis of Inherited Disease, Vol. II, C.R. Scriber et al. (Eds.), McGraw-Hill: new York, pp. 1721-1740). In particular, homozygosity for the PD-ASA allele has been reported to bear no clinical consequence, and that 10 homozygosity for the PD-ASA allele is no more frequent among neuropsychiatric patients than normal controls (Hoh~n.cçhnt7 et al., 1988, Am. J. Med. Genet. 31:169-175).Individuals who present with an ASAnel!a'iVe/PD-ASA genotype (i.e., heterozygous MLD) may have a greater incidence of clinical abnormalities (Hoh~n.crlnlt7 et al., 1989, Human Genet. 82:4548). A more recent publication disputes this hypothesis (Penzien et al., 1993, Am. J. Hum. Genet. 52:557-564).

SUMMARY OF THE INVENTION

The present invention is directed generally to methods and associated compositions and kits for detecting the presence of arylsulfatase A (ASA) pseudodeficiency (PD) mutations in humans. Detection of these mutations has been surprisingly found to be a strong 20 indicator for susceptibility to alcoholism and/or susceptibility to alcohol's pathological effects, as well as an important marker in evaluating the likelihood of metacl,ro",alic leukodystrophy (MLD).

Accordingly, in a first aspect, the invention is directed to a method for identifying an individual who may be susceptible to alcoholism or to the pathological effects of alcohol 25 comprising identifying whether an individual is homozygous, heterozygous, or normal for a pseudodeficiency (PD) mutation in the aryl.~llf~t~ce A (ASA) gene, wherein homozygosity for a PD mutation in each allele of the ASA gene infli~tec that theindividual may be susceptible to alcoholism. In particular, the invention relates to detecting a mutation in a residue 350 N-glycosylation site of ASA, or to ietecting a Wo 96/07098 PCT/US9~/11114 8 ~ ~

mutation in a polyadenylation signal sequence of at least one allele of ASA, or to detecting both mutations in an ASA allele.

The methods of the invention are advantageously carried out using polymerase chain amplification (PCR) analysis. Preferably, the PCR product of the mutant and normal 5 ASA can be differentiated by specific restriction endonucleases. In a specificembodiment, the PCR analysis for the mutation in the residue 350 N-glycosylation site can be performed by amplifying an approximately 200-base pair segment of genomic DNAwith a 5' primer TGATGGCGAACTGAGTGACT (SEQ ID NO:9) and a 3' primer AAGGATCTGGGATCAGGGGT (SEQ ID NO:10); and letecting the presence of a BsrI
10 restriction endonuclease site; wherein the BsrI endonuclease site is present in the PD
mutant ASA allele. More preferably. a 5' primer CACCCCAACCTTGATGGCGAACTGGGTGAC (SEQ ID NO:14) and a 3' primer AAGGATCTGGGATCAGGGGT (SEQ ID NO:10) are used. The 5'-primer generates a 211 base pair fragment spanning the third potential N-glycosylation site at amino acid 15 residue 350, but has been modified by substitution of a G for A to as to introduce a BsrI
site 25 nucleotides from the 5' end, which acts as a control for BsrI activity. The presence of two BsrI restriction endonn~le~ce sites is indicative of the mutation; the presence of only one site is indicative of wild type; and the presence of no BsrI site in~ teS that the experiment has not yielded a mP~ningful result.

20 In another specific embodiment, the analysis for the mutation in the polyadenylation signal seqllenre can be performed by amplifying about an approximately 182-base pair segment of genomic DNA with a 5' primer AGCTTGCTGCCATTGCCCA (SEQ ID NO:11) and a 3' primer CATTACCCCAGGATTGGTCGAA (SEQ ID NO:12); and ~et~cting the presence of two MaeIII restriction endonuclease sites; wherein two MaeIII endonuclease 25 sites are present in the PD mutant ASA allele.

Alternatively, the PCR product can be probed with probes specific for the wild type (norrnal) and mutated seql-enres of ASA gene. In a specific embodiment, a segment of genomic DNA or mRNA containing the N-glycosylation site is amplified by PCR, andanalyzed by hybridization of an oligonucleotide probe selected from the group consisting 30 of AAGGTGACATTGGGCAGTGG (SEQ ID NO:5) and AAGGTGACACTGGGCAGTGG (SEQ ID NO:6) to the amplified sequenre~ wherein WO 96/07098 ~ ~ g 8 8 6 3 PCT/US95/11114 hybridization of the former probe at 55C with washing at 62C is indicative of a normal ASA allele, and hybridization of the latter probe at 55C with washing at 60C is indicative of a PD allele. In another specific embodiment, a segment of genomic DNA
containing the polyadenylation signal site is amplified by PCR, and analyzed by 5 hybridization of an oligonucleotide probe selected from the group consisting of CTGGTGTTATTACGTTATC (SEQ ID NO:7) and CTGGTGTTACTACGTTATC (SEQ
ID NO:8) to the amplified sequence, wherein hybridization of the former probe at 48C
with washing at 52C is indicative of a normal ASA allele, and hybridization of the latter probe at 48C with washing at 52C is indicative of a PD allele.

10 A particular advantage of the present invention is that the PCR analysis can be performed on DNA obtained from buccal cells. Preferably, the analysis involves identification of restriction endonuclease sites unique to either the mutant ASA or native (wild type) ASA, or both.

The invention further provides for detecting mutant ASA lacking an N-glycan moiety by 15 biochemical analysis. In a specific embodiment, the biochemical analysis comprises detecting a difference in the relative electrophoretic mobility of an ASA protein from an individual posse~sing the mutant ASA enzyme as compared to a normal ASA protein.
In a pre~elled aspect, the mutation in the N-glycosylation site is detected by immunochemical analysis. For example, the immunochrmir~l analysis can comprise 20 detecting binding of an antibody specific for an epitope containing residue 350 of ASA
lacking an N-glycosylation site, wherein the antibody does not bind to normal ASA. In a preferred embodiment, the antibody is a monoclonal antibody; in a specific Example, preparation of such an antibody against the peptide Ac-CAPLPSVTLDGFD-NH2 (SEQ IDNO:13) is described.

25 To characterize whether an individual is homozygous for the PD alleles of ASA, heterozygous, or homozygous for normal ASA, an antibody assay of the invention contemplates comparing the amount of ASA bound by an antibody specific for the PD
mutant ASA to the amount of ASA bound by an antibody that binds to all forms of ASA.
If the quantity of ASA bound by the antibody specific for the mutant ASA is about the 30 same as the quantity bound by the antibody reactive with all ASA, then the individual is WO 96/07098 ~ i 3 PCT/US95/11114 homozygous for the PD alleles; if the amount of ASA bound by the mutant-specificantibody is about half the amount bound by the antibody reactive with all forms of ASA, then the individual is heterozygous; and if the amount of ASA bound by the mutant-specific antibody is much less than the amount bound by the antibody reactive with all 5 forms of ASA, then the individual is homozygous normal.

Accordingly, the invention relates to an antibody specific for an epitope containing residue 350 of ASA lacking an N-glycosylation site, wherein the antibody does not bind to normal ASA containing the N-glycosylation site. Preferably, the antibody of is a monoclonal antibody, e.g., a murine monoclonal antibody generated against the peptide 10 Ac-CAPLPSVTLDGFD-NH2 (SEQ ID NO:13).

The invention further provides kits for identifying an individual who is susceptible to alcoholism or to the pathological effects of alcohol. One such kit comprises the antibody described above, an antibody specific for all forms of ASA; and means for qll~"~ li.,g binding of the antibody specific for an epitope of mutant ASA and the antibody specific 15 for all forms of ASA to ASA in a sample from an individual.

In another embodiment, the invention relates to a method for identifying an individual carrying a pseudodeficiency (PD) mutation of an allele of an arylsulfatase A (ASA) gene, comprising detecting a mutation in a residue 350 N-glycosylation site of at least one allele of ASA by polymerase chain amplification (PCR) analysis, wherein the PCR product of 20 the mutant and normal N-glycosylation site can be dirr~le.,liated by specific restriction endonucleases. In a further aspect, the invention also relates to a method for identifying an individual carrying a PD mutation of an allele of an ASA gene, C()III~ g det~cting a mutation in a polyadenylation signal sequence of at least one allele of ASA by PCR
analysis, wherein the PCR product of the mutant and normal polyadenylation signal 25 sequence can be dirrelellLiated by specific restriction endonucleases. In a yet another aspect, the a method for identifying an individual carrying a PD mutation of an allele of an ASA gene comprises detecting a mutation in a residue 350 N-glycosylation site of at least one allele of ASA by polymerase chain amplification (PCR) analysis, wherein the PCR product of the mutant and normal N-glycosylation site can be dirr~,ellLiated by 30 specific restriction endonucleases; and ~l~r~cring a mutation in a polyadenylation signal sequence of at least one allele of ASA by polymerase chain amplification (PCR) analysis, W096t07098 ;~ 8 B 3 PCT/US95/11114 wherein the PCR product of the mutant and normal polyadenylation signal sequence can be dirr~lcllliated by specific restriction endonucleases. In a preferred embodiment, the specific probes and endonucleases described above are used.

A kit for identifying an individual who is susceptible to alcoholism or to the pathological 5 effects of alcohol, or for evaluating whether the individual has a PD allele of ASA, comprises a 5' primer having the sequence TGATGGCGAACTGAGTGACT (SEQ ID
N0:9) or, more preferably, a 5' primer CACCCCAACCTTGATGGCGAACTGGGTGAC
(SEQ ID N0:14) and a 3' primer having the sequence AAGGATCTGGGATCAGGGGT
(SEQ ID N0:10) and a BsrI restriction endonuclease; or a 5' primer having the sequence 10 AGCTTGCTGCCATTGCCCA (SEQ ID N0:11) and a 3' primer having the sequence CATTACCCCAGGATTGGTCGAA (SEQ ID N0: 12) and a MaeIII restriction endonuclease, or both.

Accordingly, the invention provides an oligonucleotide selected from the group consisting of TGATGGCGAACTGAGTGACT (SEQ ID NO:9); AAGGATCTGGGATCAGGGGT
15 (SEQ ID N0:10); AGCTTGCTGCCATTGCCCA (SEQ ID N0:11);
CATTACCCCAGGATTGGTCGAA (SEQ ID N0:12); and CACCCCAACCTTGATGGCGAACTGGGTGAC (SEQ ID N0:14).

Thus, it is an object of the invention to provide convenient methods and reagents for identifying individuals who are carry one or two PD alleles of the ASA gene.

20 A particular object of the invention is to identify individuals who may have a greater susceptibility to alcoholism, or to the pathological effects of alcohol, or both.

Another object of the invention is to provide m~th()(lc and reagents to more easily detect the mutations characteristic of the PD alleles of ASA, which can be used for genetic councelling .

2S These and other objects of the present invention will be made more clear by r~r~lence to the following drawings and detailed description of the invention.

WO 96/07098 ~ 3 PCT/US95tl l l l4 BRIEF DESCRIPTION OF THE DRAWINGS

FIGURE 1. Catabolic loss of 35S-methionine-labeled ASA. Fibroblasts from individuals exhibiting IVa and IIIa ASA were grown in culture media containing 35S-methionine for 18 hours. The radiolabeled proteins were chased with media containing non-radioactive 5 methionine for 0, 6, and 12 days, and the cells were harvested. ASA was immunopurified, identified by SDS-PAGE, and the resulting autoradiograms were quantified by densitometry. Each curve represents data from a single subject with either IIIa or IVa ASA. Each data point was derived from two or three separate experiments.

FIGURE 2. Detection of the pseudodeficiency mutations of ASA. (A) DNA from blood10 leukocytes of three individuals (a, b and c) was amplified across the polyadenylation site of ASA (nucleotide 1620 of the cDNA) and treated with MaeIII or amplified across the position 350 N-glycosylation site of ASA (position 1049 of the cDNA) and cut with BsrI, as indicated. The lanes in~ ted (-) represent the amplified DNA product not treated with restriction enzyme. M, DNA size markers, in base pairs (1 kb ladder, Gibco-BRL). nt 15 = nucleotide position in the ASA cDNA (Stein et al., 1989, J. Biol. Chem., 264: 1252-1259. . The DNA products and size markers are separated by electrophoresis through 7.5% polyacrylamide gels. (B) DNA from buccal cells of three other individuals (d, e and fl, amplified and treated with restriction enzymes and analyzed as in A. (C)Summary of the DNA analysis of the pseudodeficiency mutations of ASA from subjects 20 analyzed in A and B. The presence (+) or absence (-) of the mutation at each site is indicated for the two alleles.

FIGURE 3. Detection of the pseudodeficiency mutations of ASA. DNA from leukocytes or buccal cells (or in the case of a, both) of five subjects was amplified and analyzed for the presence of specific restriction endonuclease sites. In lanes marked (-), the amplified 25 DNA was not treated with the endonuclease. The size of some bands in the DNA marker lanes is indicate in base pairs. (A) Amplification of leukocyte DNA across the N-glycosylation site (nucleotide 1049) and cut with BsrI. (B) Amplification of leukocyte DNA across the polyadenylation signal site (nucleotide 1620) and cut with MaeIII. (C) Amplification of buccal cell DNA across the N-glycosylation site. (D) Amplification of 30 buccal cell DNA across the polyadenylation signal site. (E) ASA genotypes of the subjects analyzed.

WO 96/07098 ~ 8 6 3 PCTtUS95/11114 DETAILED DESCRIPTION OF THE INVENTION

In its broadest aspect, the present invention is based on the discovery that mutations characteristic of pseudodeficiency (PD) of the arylsulfatase A (ASA) gene are indicative of susceptibility to alcoholism or to the pathological effects of alcohol, or both. In 5 particular, the occurrence of homozygosity for this abnormality resulting in expression of ASA lacking the N-glycosylation site at residue 350 is strongly correlated with alcoholism.
The data presented herein demonstrate that humans who are homozygous for a genetic mutation of ASA that results in absence of an N-linked glycan at amino acid residue 350 of ASA are approximately 8 to approximately 18 times more likely to be found with 10 alcoholics than non-alcoholic individuals.

In addition to the mutation resulting in absence of an N-linked glycan in ASA, a second mutation in the polyadenylation signal site of ASA results in greatly decreased expression of the enzyme. This mutation has been found to occur in tight linkage with the mutation that results in absence of the N-linked glycan. However, the N-glycoyslation site mutation 15 may occur in the absence of the polyadenylation signal sequ~n~e mutation.

Population studies in Australia, Germany, and Israel indicate that at least 1% of the population carries this mutation. These figures correspond to 2.5 million individuals in the United States, and over 45 million individuals throughout the world. Thus, the present discovery of a correlation between incidence of this genotype and susceptibility to 20 alcoholism, or to the pathological effects of alcohol, is an important advance in health.

Iclçntific~tion and counselling of these individuals would be valuable in order to limit the incidence of alcoholism. The present invention advantageously addresses a long~t~n-ling need to identify the genetic components of alcoholism, both to provide for testing that may help to prevent the onset of this insidious disease or characterize the basis of alcoholism in 25 an individual.

As used herein, a mutation in a residue 350 N-glycosylation site of at least one allele of ASA refers to an adenosine to guanosine transition at the nucleotide corresponding to position 1049 of the ~SA cDNA. This mutation creates a new BsrI restriction endon--rle~e site in the mutant ASA gene.

WO 96/07098 ~ 6 3, PCTIUS95/11114 As used herein, a mutation in a polyadenylation signal sequence of at least one allele of ASA refers to an adenosine to guanosine transition at the nucleotide corresponding to position 1620 of the ASA cDNA. This mutation creates a new MaeIII restriction endonuclease site in the mutant ASA gene.

S As used herein, the term "alcoholism" refers to an addictive disease or disorder characterized by an inability to control the intake of alcohol, i.e., a continued excessive or compulsive use of alcoholic drinks. Alcoholism may involve changes in the individuals ability to metabolize alcohol as well. Diagnosis of alcoholism presently can be made by psychiatric ex~min~tion according to the criteria of DSM-III, axis 1 diagnosis of alcohol 10 dependence, abuse, deterioration, or amnestic disorder (see Hulyalkar et al., 1984, Alcoh.: Clin. Exp. Res. 8:337-341).

In addition to clinical alcoholics, the invention relates to identifying individuals who are more susceptible to the pathological effects of alcohol. Although not intçn(ling to be limited to any particular theory or hypothesis, it is presently believed that the PD mutation 15 of ASA may contribute to adverse effects of alcohol in some individuals.

Substantial evidence exists for the genetic predisposition of individuals to alcoholism (Devor & Cloninger, 1989, Annu. Rev. Genet., 23:19-36). The underlying genetic and biochemical factors collLlib~llillg to the neuropathology and addiction pathway of this condition, however, are not understood. Post-mortem analysis of the brains of alcoholics 20 show dysmyelination and a disproportionate loss of cerebral white matter as compared to those of non-alcoholic individuals (Harper et al., 1985, Brit. Med. J. 290:50-504; de la Monte, 1993, Arch. Neurol. 45:990-992; Jensen & Pakkenberg, 1993, Lancet 342:1201-1204). Furthermore, some alcoholic subjects show neurosymptomatology strikingly similar to metachromatic leukodystrophy (MLD) patients. These include 25 neuropsychological deficits in spatial abilities (Manowitz, et al., 1978, J. Nerv. Ment.
Dis. 166:500-506) and enlarged cerebral ventricles (Skomer et al., 1983, Arch. Neurol.
40:354-355; Wilkinson and Carlen, 1980, The Biological Effects of Alcoholism, 126:683-699). In late-onset MLD, the initial symptoms include attentional difficulties, hyperactivity, impulsivity, poor judgement, and emotional lability (Shapiro et al., 1994, 30 Neurology 44:662-665), symptoms which often have been associated with alcoholism.
MLD patients display a characteristic demyelination pathology resulting from increased WO 96/07098 ~ 3 8 ~ ~ 3 PCT/US95/11114 -levels of sulfatides. This glycolipid comprises a significant proportion of the myelin sheath and a(~cumnl:~tçs in oligodendrocytes and Schwann cells of individuals with MLD.
Since ethanol is known to affect numerous cellular processes and structures (Stibler and Borg, 1991, Scand. J. Clin. Lab. Invest. 51:43-51; Tuma and Sorrell, 1988, Semin. Liver 5 Dis. 8:69-80; Preedy et al., 1990, Alcohol.: Clin. Exp. Res. 14:165-168), including the glycolipid composition of membranes (Rawat, A. K., 1974, Res. Commun. Chem. Pathol.
Pharm. 8:461-469; Beauge et al., 1985, Alcohol: Clin. Exp. Res. 9:322-326), a relationship between abnormal sulfatide metabolism and alcoholism may exist.

As used herein, the term "susceptible to alcoholism" refers to an increased likelihood of 10 alcoholism relative to the general population; the term "susceptible to the pathological effects of alcohol" refers to an increased inability to properly metabolize alcohol, or to increased damage, in particular to the nervous system, from ingestion of alcohol. The marker of the present invention is not all inclusive; some individuals diagnosed with alcoholism lack the marker. Also, the marker is highly indicative, but not absolute: a 15 few (about 0.5%) individuals are homozygous for the PD ASA allele but are notdiagnosed as alcoholic. (This observation, however, does not exclude the possibility that these "false-positive" individuals have a predisposition toward alcoholism, but simply have not yet developed the disease.) The present invention provides methods and kits for detecting the presence of the 20 mutations that are indicative of a predisposition to alcoholism or the pathological effects of alcoholism. The immunochPmir:~l analyrical tççhniq-~es of the invention are particularly useful for ~letectin~ ASA mutants that lack the N-linked glycosylation site at residue 350.

The invention further provides molecular biological techniques that can be used to detect the presence of both the N-glycosy!ation site mutation and the polyadenylation signal 25 sequence mutation, and disc~ lindle between individuals who may be homozygous or heterozygous for these mutations. These techniques are much simpler and more sensitive than the biochemical techniques previously used to characterize the phenotype of the PD
mutation of ASA.

Finally, traditional biochemical te~hniques indicative of differences between the natively 30 glycosylated and mutant forms of ASA, e.g., dendlulillg polyacrylamide gel W096107098 ~ 8 ~ 3 PCT/US9~/11114 electrophoresis with detection by immunoblotting, can also be used to identify those individuals who carry the PD mutation that results in absence of an N-linked glycan.

The invention advantageously provides kits for detec~ing the PD mutation in ASA based on the immunochemical analytic techniques and molecular biological analytical techniques 5 of the invention.

Immunochemical Analysis An epitope characteristic of an N-glycosylation mutation. As discussed above, one of the mutations characteristic of pseudodeficiency of ASA results in substitution of a serine residue for an N-glycosylated asparagine residue in residue 350 of ASA. Consequently, 10 the mutant ASA lacks one of the N-linked glycans characteristic of the native ASA
protein.

According to the invention, mutant ASA lacking an N-linked glycan at position 350 has a unique antibody epitope that is not present on the native (norrnal) ASA molecule. An antibody specific for this epitope can be blocked from binding to native ASA by steric 15 hindrance: the large glycan group present at this position of ASA in the native protein can prevent or significantly inhibit binding of an antibody specific for the non-glycosylated site.

Accordingly, the present invention advantageously provides antibodies specific for the non-glycosylated epitope, that do not cross react with the native ASA protein. Such antibodies are particularly advantageous, as immunoch~mir~l screening assays are fast and relatively easy to perform. As discussed in greater detail infra, the antibodies of the invention are particularly useful for preparing diagnostic test kits, that can be used in physician's offices as well as sophisticated diagnostic laboratory settings.

Methods for obt~ining antibodies. According to the invention, a peptide having an amino acid sequence corresponding to ASA in the region of amino acid residue 350, in which amino acid residue 350 is serine (rather than an N-glycosylated asparagine as in the native molecule) may be used as an immunogen to generate antibodies that recognize ASA
lacking this N-glycosylation site, i.e., the product of the mutant ASA PD allele. An antibody reactive with the non-glycosylated form of ASA, and not reactive with the WO 96/07098 ~ 8 ~ 3 PCT/US95/11114 glycosylated form of ASA, is termed herein an antibody specific for the ASA mutant epitope. Such antibodies include but are not limited to polyclonal, monoclonal, chimeric, single chain, Fab fragments, and an Fab expression library.

Various procedures known in the art may be used for the production of polyclonal5 antibodies to the mutant ASA epitope. For the production of antibody, various host animals can be immllni7Pd by injection with the peptide corresponding to the mutant ASA
epitope including but not limited to rabbits, mice, rats, sheep, goats, etc. In a preferred embodiment, the peptide is conjugated to an immunogenic carrier, e.g., diphtheria toxoid, bovine serum albumin (BSA), or keyhole limpet hemocyanin (KLH). Various adjuvants 10 may be used to increase the immunological response, depending on the host species, including but not limited to Freund's (complete and incomplete), mineral gels such as alllminllm hydroxide, surface active substances such as Iysolecithin, pluronic polyols, polyanions, peptides, oil emulsions, keyhole limpet hemocyanins, dinitrophenol, and potentially useful human adjuvants such as BCG (bacille Calmette-Guerin) and 15 Corynebacterium parvum.

For ple~drdlion of monoclonal antibodies directed toward the mutant ASA epitope, any technique that provides for the production of antibody molecules by continuous cell lines in culture may be used (see, e.g., Harlow and Lane~ Antibodies: A Laboratory Manual, Cold Spring Harbor Laboratory Press: Cold Spring Harbor, New York). These include 20 but are not limited to the hybridoma technique originally developed by Kohler and Milstein (1975, Nature 256:495-497), as well as the trioma techniquc, the human B-cell hybridoma technique (Kozbor et al., 1983, Immunology Today 4:72), and the EBV-hybridoma technique to produce human monoclonal antibodies (Cole et al., 1985, in Monoclonal Antibodies and Cancer Therapy, Alan R. Liss, Inc., pp. 77-96). In an 25 additional embodiment of the invention, monoclonal antibodies can be produced in germ-free animals utilizing recent technology (PCT/US90/02545). Acc~rding to the invention, human antibodies may be used and can be obtained by using human hybridomas (Cote et al., 1983, Proc. Natl. Acad. Sci. U.S.A. 80:2026-2030) or by ~ ,r~lll.hlg human B cells with EBV virus in vitro (Cole et al., 1985, in Monoclonal Antibodies and Cancer 30 Therapy, Alan R. Liss, pp. 77-96).

Wo 96/07098 PCT/US95/11114 ,~ 3 According to the invention, techniques described for the production of single chain antibodies (U.S. Patent 4,946,778) can be adapted to produce ASA mutant epitope-specific single chain antibodies. An additional embodiment of the invention utilizes the techniques described for the construction of Fab expression libraries (Huse et al., 1989, Science 5 246: 1275-1281) to allow rapid and easy identification of monoclonal Fab fragments with the desired specificity for an ASA mutant peptide or mutant ASA itself.

Antibody fragments which contain the idiotype (antigen binding region) of the antibody molecule can be generated by known techniques. For example, such fragments include but are not limited to: the F(ab')z fragment which can be produced by pepsin digestion of the 10 antibody molecule; the Fab' fragments which can be generated by reducing the disulfide bridges of the F(ab')~ fragment, and the Fab fragments which can be generated by treating the antibody molecule with papain and a reducing agent.

In the production of antibodies, screening for the desired antibody can be accomplished by techniques known in the art, e.g., radioimmunoassay, ELISA (enzyme-linked 15 immlmosorbant assay), "sandwich" immunoassays, immunoradiometric assays, gel diffusion precipitin reactions, immunodiffusion assays, in situ immlmoac.~ys (using colloidal gold, enzyme or radioisotope labels, for example), western blots, precipitation reactions, agglutination assays (e.g., gel agglutination assays, hemagglutination assays), complement fixation assays, immunofluorescence assays, protein A assays, and 20 immunoelectrophoresis assays, etc. In one embodiment, antibody binding is detected by etecting a label on the primary antibody. In another embodiment, the primary antibody is detected by detecting binding of a secondary antibody or reagent to the primary antibody. In a further embodiment, the secondary antibody is labeled. Many means are known in the art for ~le~ecting binding in an immunoassay and are within the scope of the 25 present invention. For example, to select antibodies which recognize the non-glycosylated form of ASA (mutant ASA), one may assay generated hybridomas for a product whichbinds to the immunogenic peptide corresponding to such epitope. (As is well known in the art, the immunogenic peptide should be provided free of the carrier molecule used in any i""",.~ tion protocol. For example, if the peptide was conjugated to KLH, it may 30 be conjugated to BSA, or used directly, in a screening assay.) Wo 9GtO7098 ~ 8 ~ ~ PCr/US95/11114 A polyclonal or monoclonal antibody that reacts with the mutant ASA, or with the peptide corresponding to the mutant ASA epitope, should be tested for cross reactivity with normal (N-glycosylated at residue 350) ASA. Preferably, an antibody of the invention will demonstrate at least 10-fold, more preferably 100-fold, and most preferably greater 5 than 1000-fold, lower binding to the native ASA than mutant ASA, i.e. an antibody of the invention should not cross react significantly with wild type ASA. The difference in binding of antibody to a protein can be evaluated by comparing antibody binding titer, relative affinity, or calculated affinity constants. Preferably, the evaluation is based on antibody binding titer. which is an easily determined empirical value.

10 The foregoing antibodies can be used in methods known in the art relating to the localization and structure of ASA, e.g., for Western blotting, measuring levels thereof in appropriate biological samples, etc The antibodies can be used to detect mutant ASA in a biological sample from an individual. The biological sample can be a biological fluid, such as but not limited to, 15 blood, serum, plasma, interstitial fluid, urine, ceiebro~l~inal fluid, and the like.
Preferably, ASA is detected in serum or urine, which are both readily obtained.
Alternatively, ASA can be detected from cellular sources, such as, but not limited to, platelets and fibroblasts. For example, platelets or fibroblasts can be obtained from an individual and Iysed, e.g.. by freeze-thaw cycling, or treatment with a mild cytolytic 20 detergent such as, but not limited to, TRITON X-lOO~, digitonin, NONIDET P (NP)-40~, saponin, and the like, or colllbillalions thereof (see, e.g., Tntern~tional Patent Publication WO 92/08981, published May 29, 1992). In yet another embodiment, samples containing cells and body fluids can be used.

The biological samples can then be tested directly for the presence of mutant ASA using 25 an applopliate strategy (e.g., ELISA or radioimmllno~c.s~y) and format (e.g., microwells, dipstick [e.g., as described in International Patent Publication WO 93/03367, published February 18, 1993], etc.). Alternatively, proteins in the sample can be size separated, e.g., by polyacrylamide gel electrophoresis (PAGE), in the presellce or not of sodium dodecyl sulfate, and the presence of mutant ASA detected by immunoblotting (Western 30 blotting). Immunoblotting techni~lues are generally more effective with antib )dies WO 96/07098 ~ 6 ~ PCT/US95/11114 generated against a peptide corresponding to an epitope of a protein, and hence, are particularly suited to the present invention.

Tmmlln~chen~ical assays. To characterize whether an individual is homozygous for the PD alleles of ASA, heterozygous, or homozygous for normal ASA, an antibody assay of 5 the invention contemplates comparing the amount of ASA bound by an antibody specific for the PD mutant ASA to the amount of ASA bound by an antibody that binds to all forms of ASA, such as a rabbit anti-ASA polyclonal antibody (e.g., rabbit anti-human liver ASA, available from Calbiochem). If the quantity of ASA bound by the antibody specific for the mutant ASA is about the same as the quantity bound by the antibody 10 reactive with all ASA, then the individual is homozygous for the PD alleles. If the amount of ASA bound by the mutant-specific antibody is about half the amount bound b the antibody reactive with all forms of ASA, then the individual is heterozygous. Finally, if the amount of ASA bound by the mutant-specific antibody is much less than the amount bound by the antibody reactive with all forms of ASA, then the individual is homozygous 15 normal.

In a preferred embodiment, the immlln-l~cc~y of the invention comprises d~t~cting the amount of ASA bound by an antibody by detecting the enzyme activity of ASA itself.
Since mutant ASA demonstrates about the same amount of enzyme activity as native ASA, the total amount of enzyme activity directly relates to the quantity of ASA bound by 20 antibody. For example, the mutant-specific antibody and the antibody specific for all forms of ASA can be separately affixed to solid phase supports, e.g., wells of a microtiter plate, or a solid adsorbent. A biological sample can be contacted with the boundantibody. The amount of ASA that binds to the antibody can be directly detected using an assay for ASA enzymatic activity. In a specific embodiment, the colorimetric substrate p-25 nitrocatachol sulfate can be used to indicate the presence of ASA (see Manowitz et al.,1981, Biol. Psychiat. 16:1107-13).

In another embodiment, a sandwich immlltlo~cs~y format using ELISA detection can be used. Accordingly, a first antibody can be attached to a solid phase support, e.g., the wells of a microtiter plate. This first antibody can bind to (capture) ASA in the sample.
30 A second labeled antibody can be used to detect the presence of ASA captured by the first antibody. Either of the first or second antibody (but not both) can be an antibody of the WO 96/07098 ~ PCT/US95/11114 -invention, i.e., specific for mutant ASA. The other antibody should bind both forms of ASA.

Alternatively, an competitive assay format can be used. Inhibition of binding of a labeled antibody specific for the mutant epitope of ASA to a peptide corresponding to the ASA
5 mutant epitope (or vice versa) by sample is indicative of the presence of mutant ASA in the sample.

For example, a solid phase assay system may comprise the solid substrate with either bound antibody and labeled mutant ASA peptide or bound mutant ASA peptide and labeled antibody, in which the antibody is specific for the mutant ASA epitope. A sample 10 to be assayed is then placed in contact with the bound and unbound reagents. A
competitive reaction between the labeled material and any unlabeled mutant ASA in the sample will prevent the retention of a concentration dependent quantity of the former on the solid substrate, whereupon it can be precisely quantitatively identified, either by dPtecting an increase in the amount of the label in the liquid phase (unbound to the solid 15 phase), or tletçctin~ a reduction in the amount of labeled reagent bound to the solid phase.

The foregoing explanations of particular assay systems are presented herein for purposes of illustration only, in fillfillmPnt of the duty to present an enabling disclosure of the invention. It is to be understood that the present invention contemplates a variety of immunochemical assay protocols within its spirit and scope.

Molecular Biolo~ical Anal~sis The mutations characteristic of ASA pseudodeficiency can be idPntifiPd using molecular biological techniques. In particular, the mutation of adçnosinP to guanosine at the nucleotide corresponding to position 1049 in the cDNA sequPnre and the mutation of adenosine to guanosine at the nucleotide corresponding to position 1620 of the cDNA
sequence can be detected using highly specific oligonucleotide probes, creation of unique restriction endonuclease sites. or combinations thereof. Any of the standard techniques in molecular biology for fi~Ptçcting such mutations, including Southern analysis, Northern analysis, and dot hybridization with specific oligonucleotide probes under conditions of relatively high temperature and hybridization stringency, and the powclrul pol~ .el~se chain reaction-based analytical techniques, can be used according to the invention.

Wo 96/07098 PCTfUS95/11114 fi 3 In accordance with the present invention there may be employed conventional molecular biology, microbiology, and recombinant DNA techniques within the skill of the art. Such techniques are explained fully in the literature. See, e.g., Sambrook, Fritsch & Maniatis, Molecular Cloning. A Laboratory Manual, Second Edition (1989) Cold Spring Harbor5 Laboratory Press, Cold Spring Harbor, New York (herein "Sambrook et al., 1989"); DNA
Cloning: A Practical Approach, Volumes I and II (D.N. Glover ed. 1985);
Oligonucleotide Synt~esis (M.J. Gait ed. 1984); Nucleic Acid Hybridization [B.D. Hames & S.J. Higgins eds. (1985)]; TranscriptionAnd Translation [B.D. Hames & S.J. Higgins, eds. (1984)]; Animal Cell Culture [R.I. Freshney, ed. (1986)]; Immobilized Cells And 10 En~ymes [IRL Press, (1986)]; B. Perbal, A Practical Guide To Molecular Cloning (1984).

If appearing herein, the following terms shall have the definitions set out below.

A "nucleic acid molecule" refers to the phosphate ester polymeric form of ribonucleosides (adenosine, guanosine, uridine or cytidine; "RNA molecules") or deoxyribonucleosides (deoxyadenosine, deoxygu~nosin~, deoxythymidine, or deoxycytidine; "DNA molecules") 15 in either single stranded form, or a double-stranded helix. Double stranded DNA-DNA, DNA-RNA and RNA-RNA helices are possible. The term nucleic acid molecule, and inparticular DNA or RNA molecule, refers only to the primary and secondary structure of the molecule, and does not limit it to any particular tertiary forms. Thus, this term includes double-stranded DNA found, inter alia, in linear or circular DNA molecules 20 (e.g., restriction fragments), plasmids, and chromosomes. In (li~cncsing the structure of particular double-stranded DNA molecules, sequenres may be described herein according to the normal convention of giving only the sequence in the 5' to 3' direction along one of the strands. A "recombinant DNA molecule" is a DNA molecule that has undergone amolecular biological manipulation.

25 A nucleic acid molecule is "hybridizable" to another nucleic acid molecule, such as a cDNA, genomic DNA, or RNA, when a single stranded form of the nucleic acid molecule can anneal to the other nucleic acid molecule under the app,ul,liate conditions of temperature and solution ionic strength (see Sambrook et al., supra). The conditions of temperature and ionic strength determine the "stringency" of the hybridization. According 30 to the present invention, the highest stringency hybridization for the length of the WO 96/07098 ~ 6 3 PCT/US95/11114 oligonucleotide probe to be used is required since hybridization of the probes must differentially detect sequences with a single base mutation.

A DNA "coding sequence" is a double-stranded DNA sequence which is transcribed and translated into a polypeptide in a cell in vitro or in vivo when placed under the control of 5 appropriate regulatory sequences. The boundaries of the coding seqll~n~e are determined by a start codon at the 5' (amino) terminus and a translation stop codon at the 3' (carboxyl) tçrmiml~. A coding sequence can include, but is not limited to, prokaryotic sequences, cDNA from eukaryotic mRNA, genomic DNA sequences from eukaryotic (e.g., m~mm~ n) DNA, and even synthetic DNA sequences. If the coding sequence is10 intended for expression in a eukaryotic cell, a polyadenylation signal and transcription termination sequence will usually be located 3' to the coding sequence.

A particular advantage of the present invention is that it can be performed with buccal cells, which are easily obtained using a non-invasive procedure. This greatly reduces the level of discomfort that an individual may suffer and avoids the need for phlebotomy, as 15 well as elimin~tes the likelihood of infection that accompanies more invasive procedures.

In preferred aspects, genomic DNA or mRNA is amplified by PCR, and the amplifiedDNA is tested for the presence of the mutation. PCR amplification is well known in the art (Cameron et al., 1992, Science 257:383-387; Saksela et al., 1994, Proc. Natl. Acad.
Sci. USA 91:1104-1108). For example, mRNA can be detected by reverse transcriptase-20 initiated PCR (see, e.g., Saksela et al., 1993, J. Virol. 67:7423-27). PCR can be carried out, e.g., by use of a Perkin-Elmer Cetus therrnal cycler and Taq polymerase (Gene Ampn', Boehringer M~nnh~im). The amplified PCR products can be analyzed by immobilization on m~ dnes and hybridization with specific oligonucleotide probes, or by treatment with specific endonucleases and analysis of the products by gel 25 electrophoresis. Labeling of the cleaved PCR products can be accomplished by incorporation of radiolabeled nucleotides, endlabeling, e.g., with ~32P-ATP, or by staining with ethidium bromide. The present invention provides specific pl~felled examples of PCR-based analysis of ASA mutations: one, in which genomic DNA (or mRNA) is amplified, and the presence of a restriction site unique to the mutant gene is determined;
30 and a second~ in which the genomic DNA (or mRNA) is amplified and the mutation detected by binding of specific oligonucleotide probes. DNA from any available source can be used for the PCR-based analysis. Sufficient DNA can be obtained from a finger-prick or from saliva-born buccal cells.

PCR amplification and detection of unique restriction rn~ m~ ce sites. The present invention provides primers for PCR amplification of a segment (preferably about 200 5 nucleotides in length) of genomic DNA corresponding to the ASA gene or a portion thereof containing the mutated nucleotide; or primers for reverse transcriptase-PCR of mRNA encoding the ASA gene; and a restriction endonuclease specific for a restriction site that is unique to either the mutant ASA gene (and is not found in the native ASA
gene), or a restriction site that is unique to the native ASA gene (and is not found in the 10 mutant ASA gene). Preferably, the primers for use according to the present invention are engineered or selected to incorporate an internal control endonuclease site corresponding to the site produced by the mutation. This way, amplified DNA will always contain an endonuclease site, so endonuclease enzyme activity can be detected even if the mutation that creates the endonuclease site of interest is not present.

15 It has been discovered that the mutation leading to repl~t~emrn~ of Asn3s0 with Ser results from an A to G transition, which creates a new BsrI restriction endonuclease site in the ASA gene. It has also been discovered that the mutation in the polyadenylation site resulting from an A to G transition creates a new MaeIII restriction endonuclease site in the ASA gene. By amplifying a portion of the ASA gene containing the mutated 20 nucleotide, and subsequently treating the amplified product with the restriction endomlcle~e, the presence of the mutation can be ~letennin~d by cleavage of the amplified DNA into new fragments that are not formed upon endonuclease treatment of DNA from the native ASA gene. These fragments can be detected readily simply by size on an agarose or polyacrylamide gel. The fragments can be labeled with radionucleotides during 25 PCR amplification, or alternatively detected by ethit1inm bromide or silver staining. The presence of fr~gmPnted DNA indicates that the individual from whom the DNA was originally obtained is homozygous for the PD mutation of ASA; presence of fr~gmentrd DNA and unfr~gmrnted DNA in~lir~tes that the individual from whom the DNA was originally obtained is heterozygous for the PD mutation of ASA; and the presence of on~y 30 unfr~gmenttqd DNA indicates that individual from whom the DNA was originally obtained is homozygous for the normal ASA allele.

W096/07098 ~ ~ ~ 8 8 ~ 3 PCTIUS95/11114 In a specific example, infra, the invention provides a 5' primer having the sequence TGATGGCGAACTGAGTGACT (SEQ ID NO:9) and a 3' primer having the sequence AAGGATCTGGGATCAGGGGT (SEQ ID NO:10), to amplify about a 200 nucleotide region of the ASA gene in proximity to the mutation at the nucleotide corresponding to 5 number 1049 of the cDNA sequence. As note above, the mutation at this site results in introduction of a BsrI endonuclease restriction site.

More preferably, a 5' primer CACCCCAACCTTGATGGCGAACTGGGTGAC (SEQ ID
NO:14) and a 3' primer AAGGATCTGGGATCAGGGGT (SEQ ID NO:10) are used.
The 5' primer generates a 211 base pair fragment spanning the third potential N-10 glycosylation site at amino acid residue 350, but has been modified by substitution of a Gfor A to as to introduce a Bsrl site 25 nucleotides from the 5' end, which acts as an internal positive control for Bsrl enzyme activity. The presence of two Bsrl restriction endonuclease sites is indicative of the mutation; the presence of only one site is indicative of wild type; and the presence of no BsrI site indicates that the experiment has not yielded 15 a m~ningful result.

Alternatively, the invention provides a 5' primer having the sequence AGCTTGCTGCCATTGCCCA (SEQ ID NO:11) and a 3' primer having the seql~ellre CATTACCCCAGGATTGGTCGAA (SEQ ID NO: 12), which primers amplify an approximately 182 nucleotide fragment that contains the polyadenylation signal mutation at 20 the nucleotide corresponding to number 1620 of the cDNA sequence. As noted above, the mutatioII at this site results in introduction of a MaeIII restriction site. Advantageously, this primer set incorporates a naturally occurring MaeIII site 29 nucleotides from the 3' end of the PCR product. This site serves as an internal positive control for restriction endonuclease activity.

25 Most preferably, both sets of primers and restriction endonucleases are used to detect either or both mutations in an ASA allele.

PCR Pmrlifi~ ion and hybridization of specifc probes. In another embodiment, theinvention provides primers for amplifying a segment of genomic DNA corresponding to the ASA gene or a portion thereof co~ illillg the mutated nucleotide; or primers for 30 reverse transcriptase-PCR of mRNA encoding the ASA gene; and a labeled -Wo 96/07098 PCT/US95/11114 oligonucleotide probe for hybridizing to arnplified DNA and detecting the presence of a mutation in the ASA gene at a position corresponding to nucleotide 1049 of the cDNA, or nucleotide 1620 of the cDNA, or both. In a specific embodiment, infra, the oligonucleotide probes AAGGTGACATTGGGCAGTGG (SEQ ID NO:5) (specific for the 5 native ASA gene around the nucleotide corresponding to position 1049 of the cDNA) and AAGGTGACACTGGGCAGTGG (SEQ ID NO:6) (specific for the mutant ASA gene around the nucleotide corresponding to position 1049 of the cDNA) can be hybridized to the amplified sequence, wherein hybridization of the former probe at 55C with washing at 62C is indicative of a normal ASA allele, and hybridization of the latter probe at 55C
10 with washing at 60C is indicative of a PD allele. Alternatively, the oligonucleotide probes CTGGTGTTATTACGTTATC (SEQ ID NO:7) (specific for the native ASA gene around the nucleotide corresponding to position 1620 of the cDNA) and CTGGTGTTACTACGTTATC (SEQ ID NO:8) (specific for the mutant ASA gene around the nucleotide corresponding to position 1620 of the cDNA) can be hybridized to the 15 amplified sequen~e, wherein hybridization of the former probe at 48C with washing at 52C is indicative of a normal ASA allele, and hybridization of the latter probe at 48C
with washing at 52C is indicative of a PD allele. These probes are full described in a reference by Gieselmann et al. (1989, Proc. Natl. Acad. Sci. USA 86:9436-9440) In another aspect, the invention provides for detection of the mutated nucleotides in PCR-20 amplified fragments of the ASA gene by immobilization of the amplified DNA onnitrocellulose or Nylon melllbl~1es, and hybridization with labeled oligonucleotide probes comple"lellt~,y to the normal or mutated sequPnre~ a technique known as dot-hybridization analysis. The oligonucleotide probes could be radio-labeled (e.g., with 32p nucleotides) or non-radioactively labeled (e.g., with digoxygenin), in which case detection 25 of hybridization is by an enzyme-linked color reaction, or, preferably, by chemiluminPscen~e detection.

Biochemical Analysis As noted above, absence of an N-linked glycan from mutant ASA results in detectable dirrele"ces in biochemical characteristics related to the extent of glycosylation of the 30 mutant ASA compared to native ASA. The most obvious difference is in electrophoretic mobility. In particular, PD mutant ASA has an ~pparellL molecular weight of about 59 kD

W096/07098 ~ B ~ PCT/US9S/11114 by PAGE, whereas normal ASA has an appa~ molecular weight of 62 kD under identical electrophoretic conditions.

In another aspect, greater mobility difference is observed upon PAGE analysis between - endo-N-acetlyglucosaminidase H (endo-H) treated mutant ASA and normal ASA. For S example, a greater loss of mass is detected with ASA from a normal subject upon endo-H
treatment (4 kD) than from ASA from a PD subject (1 kD). Such a difference in mass would not be expected in the absence of a difference in the extent of glycosylation between the mutant and normal forms of ASA.

Generally, any assay that can distinguish between native ASA, which contains two N-10 linked glycan moieties, and mutant ASA, which lacks one of the N-linked glycan moieties, can be used to identify individuals who are homozygous for PD mutant ASA. For example, an assay that directly measures the presence or quantity of N-linked glycans on a protein can be used to detect mutant ASA.

As with the imm~lnoacsays described above, the presence of normal ASA should be 15 evaluated in the biochemical assays. If no normal ASA is detecte~l, but only mutant ASA, then the individual is homozygous for the PD mutation. However, if both normal and mutant ASA are present in a sample, the individual is heterozygous, and if only normal ASA is detecte(l, the individual is homozygous normal.

As with the immunoassays, biochemical assays can be used to detect mutant ASA in a 20 biological sarnple from an individual. The biological sample can be a biological fluid, such as but n~t limited to, blood, serum, plasma, interstitial fluid, urine, cerebrospinal fluid, and the like. Preferably, ASA is detected in serum or urine, which are both readily obtained. Alternatively, ASA can be detected from cellular sources, such as, but not limited to, platel~ts and fibroblasts. Platelets or fibroblasts can be obtained from an 25 individual and Iysed, e.g., by freeze-thaw cycling, or Ill aLlllelll with a mild cytolytic detergent such as, but not limited to, TRITON X-lOO~, digitonin, NP-40, saponin, and the like, or combinations thereof (see, e.g., International Patent Publication WO
92/08981, published May 29, 1992). The cellular Iysates can then be assayed directly, with detectio I of ASA bands by an ASA-specific colorimetric enzyme assay on native 30 (non-denaturing) PAGE, or by Western analysis of proteins separated by SDS-PAGE.

Alternatively, ASA in the sample can be enriched by affinity purification or imm~-noa~orpttion of ASA present in the sample, followed by PAGE with detection of total protein, ASA enzyme activity, or immunoblotting. Chemical analysis for thepresence of N-linked glycans can also be used to determine the biochemical characteristics 5 of ASA in the sample after affinity purification or immnnoa~lo~orption~

Kits The present invention advantageously provides specific kits for use in locations ranging from a physician's office to a sophisticated medical laboratory. The kits of the invention provide reagents necessary to determine whether an individual is homozygous for the PD
10 mutation of ASA, and thus, to evaluate whether the person may be susceptible to alcoholism.

The kits of the invention fall into two categories: kits for immllnoac.cays to detect the presence of mutant ASA; and kits to detect mutations in the genomic DNA or mRNA
encoding ASA.

15 l.~ oqy test kits. An immnnoa~s~y test kit may be prepared for the demonstration of mutant ASA in a sample, comprising:
(a) an antibody specific for the mutant epitope of ASA, as described above;
(b) an antibody specific for all forms of ASA; and (c) means for qu~ g binding of the antibody specific for the mutant 20 epitope and the antibody specific for all forms of ASA to ASA in a sample from an individual.

The means for ~letecting binding of the antibody to mutant ASA in a sample from an individual can COl~" lise any of the immllno~csay strategies and formats described above.

In a preferred aspect of the invention, the antibody specific for the ASA mutant epitope is 25 a monoclonal antibody ~en~ted in mice against the peptide Ac-Cys-Ala-Pro-Leu-Pro-Ser-Val-Thr-Leu-Asp-Gly-Phe-Asp-NH2 (SEQ ID NO:13).

WO 96/07098 ~ 8 8 ~ 3 PCT/US95/11114 In addition to an antibody and means for detecting binding of antibody to mutant ASA in a sample, an immunoassay kit of the invention may further comprise other reagents and.
optionally, directions for use of said kit.

Kits to detect mutations in the genomic DNA or mRNA f~nro-ling ASA. In another S embodiment, the invention provides test kits for ~letecting the presence of a PD mutation in the ASA alleles in an individual. In one embodiment, the kit provides for detecting the mutation in the codon encoding asparagine, which after an A to G mutation encodes serine in the mutant ASA. In another embodiment, the kit provides for detecting the mutation in the polyadenylation signal of the ASA gene. In a preferred embodiment, a test kit of the 10 invention provides for detecting both mutations.

Accordingly, a test kit of the invention may comprise:
(a) primers for amplifying a segment of genomic DNA corresponding to the ASA gene or a portion thereof containing the mutated nucleotide; or primers for reverse transcriptase-PCR of mRNA encoding the ASA gene;
(b) a labeled oligonucleotide probe for hybridizing to amplified DNA and ciesec~ing the presence of a mutation in the ASA gene at a position corresponding to nucleotide 1049 of the cDNA, or nucleotide 1620 of the cDNA, or both.
Such a kit may further comprise instructions relating to the a~plupliate hybridization conditions and temperature; hybridization solution (in Iyophilized, concentrated, or correct strength) for use in hybridizations; a membrane for blotting the amplified DNA; reagents for labeling the oligonucleotide probes (e.g. 32P-labeled nucleotides or digoxygenin); and other reagents.

In another embodiment, a kit of the invention comprises (a) primers for PCR amplification of a segment (preferably about 200 nucleotides in length) of genomic DNA corresponding to the ASA gene or a portion thereof containing the mutated nucleotide; or primers for reverse transcriptase-PCR of rnRNA encvding the ASA gene;
(b) a restriction endonuclease specific for a restriction site that is unique toeither the mutant ASA gene (and is not found in the native ASA gene), or a restriction site that is unique t~) the native ASA gene (and is not found in themutant ASA gene).

WO 96107098 ~ PCTIUS95/11114 In a preferred embodiment, primers are engineered or selected to incorporate a second endonuclease site corresponding to the endonuclease site created by the mutation, which second endonuclease site acts as a positive control for endonuclease enzyme activity.
Preferably, such a kit incorporates the primers and restriction endonucleases specifically 5 disclosed above, and exemplified in Examples 2 and, more preferably, 3, infra. Such a kit may further comprise instructions relating to the applo~liate amplification conditions and endonuclease cleavage conditions; gels for electrophoresis of the PCR products; and other reagents. Optionally, the kit may provide reagents for detecting the amplified DNA, e.g., ethidium bromide, or a labelled nucleotide triphosphate (e.g., 32P-thymidine, 10 adenosine, or cytosine) for incorporation in the amplified DNA.

The invention may be more completely understood by reference to the following non-limiting example, which is provided solely as an example of a specific embodiment of the invention.

EXAMPLE 1: The Association of Alcoholism with the N-Glycosylation Polymorphism of Pseudodeficiency Human Arylsulfatase A
This Example concerns the discovery that the IIIa and IIIb electrophoretic variants of arylsulfatase A (EC 3.1.6.8) are twelve-times more prevalent in alcoholic than in non-alcoholic populations. These variant enzymes, found in almost exclusively a subset of 20 alcoholics, possess the pseudodeficient Asn350-Ser mutation of aryl.clllfat~ce A and, consequently, lack an N-linked glycan unit. Individuals ~ essillg these genetically determined variants of arylc~llf~t~ce A show reduced enzymic activity and intracellular half-life. We hypothesize that ethanol causes an increase in the pools of sulfati-les, the substrate for arylsulfatase A, and that individuals who have greatly reduced levels of 25 arylsulfatase A are less capable of ~ ,g acceptable steady-state levels of this glycolipid. The consequence of this interaction would be to cause neuropathological symptoms common to metachioll-dlic leukodystrophy patients and some alcoholic individuals, and/or influence the addiction pathway of alcoholism by impacting on sulfatide-associated neuloll~ ",i~ler systems.

Wo 96/07098 ~ PCT/US95/11114 Materials And Methods Enzyme assays. ASA (Manowitz et al., 1981, Biol. Psychiat., 16:1107)"~-galactosidase (Gorman & Poretz, 1987 J. Cell. Physiol. 131:158-164), and ~-hexos~minid~ce activities (Gorman and Poretz, supra) and total protein (Manowitz et al., 1981, supra) were5 measured as described previously.

Analysis of variant banding pattern. Platelet ASA isoform patterns from each individual was determined by non-denaturing PAGE according to Hulyalkar et al. (1984, Alcoh.:
Clin. Exp. Res. 8:337-341).

Genetic analysis for PD ASA polymorphisms. Genotyping was performed as described10 previously (Gieselmann et al., 1989, Proc. Natl. Acad. Sci. USA. 86:9436-9440) with modifications. Two polymerase chain reaction (PCR) products were amplified usingprimers, 5'-TTGATGGCGAACTGAGTGAC-3' (SEQ ID NO:l) and 5'-CGAAGCACTGCACATACCTGG-3' (SEQ ID NO:2), for the N-glycosylation site, and primers, 5'-GCTCTATGACCTGTCCAAGGACC-3' (SEQ ID NO:3) and 5'-15 TTCCTCATTCGTACCACAGG-3' (SEQ ID NO:4). for the polyadenylation signal consensus sequence site. One ~g of DNA, isolated from fibroblasts was amplified in the PCR buffer containing 1.5 mM MgCI2 (Perkin Elmer Cetus). After an initial denalul~lion period of 5 min at 95 C, forty amplification cycles were performed with the following conditions: ~nne~ling period of 1 min at 55- C, an elongation period of 1 min at 20 72- C, and a d~nalul~lion period of 30 sec at 94 C. Final extension was performed for 4 min.

Determination of rates of degradation. Monolayers of fibroblasts, grown to confluency in 75 cm2 flasks or round petri plates (9.6 cm2), were exposed to Dulbecco's Modified Eagle Medium (DMEM) lacking methionine (Gibco BRL) for 1 hour, followed by 18 hours in25 the same medium c~ g Trans 35S label ( > 1000 Ci/mmol, ICN Biomedical). The media for fibroblasts from IIIa individuals cont~in~d 300 ,~Ci 35S, and for cells from IVa individuals, 150 ,uCi 35S in 4 ml of DMEM lacking methionine supplemented with 2 mM
glutamine, penicillin (50 IU/ml), streptomycin (50 ~g/ml) and 5 % dialyzed fetal calf serum. Four ml (75 cm2 flask) or 1.0 ml (round petri plate) of this solution was added to 30 the cells. Following 18 hours, the radioactive mediurl was replaced with Eagle's Modified Essential Media (Mediatech Inc.) lacking radiolabeled methionine. Fresh Wo ~6/~,709~ PCTIUS95/11114 medium was applied every three days. Cells of each sample were washed twice with a 0.25 M sucrose containing 5 mM HEPES, buffered at pH 7.1. The cells were Iysed with 220 ~1 of 10 mM Tris/HCI, pH 7.5 buffer containing 0.15 M NaCI and 0.8% Triton X-100. Alternatively, the cells were harvested as described previously (20). All 5 preparations were clarif1ed by centrifugation at 20,000 xg for 25 min, pre-adsorbed twice with 30 ~I Gamma bind G agarose (Pharmacia) coated with control rabbit serum, and immunoadsorbed with 15 ,ul Gamma Bind G beads coated with IgG from rabbit anti-human liver ASA or rabbi~ anti-human cathepsin serum (Calbiochem). The antigen was extracted from the immunoadsorbant as per the m~nllf~rtnrer's instructions and subjected 10 to SDS-PAGE (8% acrylamide for ASA or 10% acrylamide for cathepsin D).

Determination of rates of synthesis. Rates of synthesis of enzymes were determined in a manner similar to the rates of degradation except for the following: 300 ~Ci of Trans-35S-methionine in 2 ml of labeling solution supplemented with 10 mM NH4CI was added to each 25 cm2 flask and the cells were grown in labeling medium for 2-10 hours; medium 15 containing the radiolabeled protein was dialyzed in 10 mM Tris/HCI, pH 7.5 buffer containing 0.15 M NaCI before immunopurification of the ASA and cathepsin D.

Res~lts And Discussion Distribution of ASA Variants in Alcoholic, Psychiatric, and Normal Populations.
Alcoholic individuals and non-alcoholic, psychiatric patients, both of whom were20 inpatients at the Lyons Veterans Admini~tration Medical Center, as well as healthy subjects, without any present medical illness or past/present psychiatric illness, were screened for the presence of electrophoretic ASA variants. As shown in Table 1, 6.6% of the alcoholic patients presented IIIa or IIIb electrophoretic variants of the enzyme, whereas only one individual in the healthy population (0.6%) and one psychiatric subject (0.5%) 25 were detected with such variants. The alcoholic population of 151 patients included 10 individuals with IIIa or IIIb variant ASA, but only one of the 164 healthy subjects had one of these variants (Fisher's Exact Test, two tail method, p=0.004). No significant difference was found in the prevalence of these variants in the psychiatric population as compared to the healthy group. The inridenre of the IIIa variant in the alcoholic 30 population (4.6%) is eight-fold that found in the healthy (0.6%) and nine-fold the level in the psychiatric (0.5%) populations. Individuals with the IIIb variant ASA were found only in the alcoholic population. The psychiatric patients served as a control group who were WO 96/07098 ~ 0~ PCT/US95/11114 hospitalized, but were not alcoholic. Accordingly, differences which distinguish the alcoholic population from the normal and psychiatric groups would be expected to relate to conditions associated with alcoholism.

Table 1. Distribution of ASA variants in alcoholic, psychiatric, and healthy populations Percent of population Number of individuals ~ essillg with IIIa or IIIh each ASA isoform pattern variant ASA
IIIa IIIb other Alcoholic patients 7 3 141 6.6% (10/151) Psychiatric patients 1 0 217 0.5% (1/218) Normal subjects 1 0 163 0.6% (1/164) Notes To Table 1. Variant isoform patterns for each subject was determined by PAGE
analysis of platelet ASA. Diagnoses were made by the independent examination of individuals by two psychiatrists according to the criteria of DSM-III, axis 1. The patients of the alcoholic population were diagnosed with alcohol dependence n= 139), alcohol 5 abuse (7), dementia associated with alcoholism (3), and alcohol amnestic disorder (2).
The subjects of the non-alcoholic psychiatric population were diagnosed with schizophrenia (169), bipolar disorder (12), dysthymic disorder (9), substance (excluding alcohol) abuse (7), personality disorders (5), major depressive episode (5), anxiety state (3), paranoid disorders (2), dissociative disorder (1), primary degenerative ~lem~-nti~
10 epilepsy (1), Huntington's chorea (1), tuberous sclerosis (1), and brief reactive psychosis (1). The results presented in this table include data from a previous study (21). The mean averages of the ages (+/- S.D.) of the alcoholic, psychiatric, and normal control populations were: 43.1 (+/- 11.8), 39.0 (+/- 12.4), 33.4 (+/- 11.6). The sex distributions of the same groups were: 149 males, 2 females; 202, 16; 150, 14. The race 15 distributions of the same groups were: 119 white, 32 black, 0 oriental; 177, 41, 0; 132, 31, 1. Informed consent was obtained from each subject after the nature and pos;ible consequences of the study was explained.

Relationship of variant ASA with PD-ASA. We recently reported that the expression of a variant form of ASA in fibroblasts parallels that in platelets for an individual (Park et al., 1993, FASEB J. 7:744 (abstract)). In addition, the IIIa enzyme lacks one of the two N-glycan moieties present in the IVa form of ASA which predominates in the general25 population (Park et al., supra). In view of these results, studies were undertaken to determine if the electrophoretic variants are related to PD-ASA. The enzymic a tivity of ASA in fibroblasts of IIIa individuals is generally reduced when compared to that WO 96/07098 ~ ~ PCT/US95/11114 expressed by the cells of IVa subjects (Table 2). In addition, this reduction is specific for ASA since a comparable reduction in other Iysosomal enzymes, ,~-galactosidase and ~-hexo~mini(l~ce, was not observed. The relative levels of ASA activity in the IIIa and PD-ASA subjects are similar to those previously reported for PD-ASA individuals (Kolodny, 5 E.H., 1989, The Metabolic Basis of Inherited Disease, ed., pp. 1721-1750).

WO 96/07098 ~ ~ ~ PCT/US95/11114 l ô~ ~
o -- ~ o E " z c z a + ~ +
~ ~ O
O

l-- ,,, ~ o _ '~ + + ~ Z + + ~ o ~ Z

c ~ ~ 00 O~ --E ~ E ~

O 00 00 ~-- O ~ ~ ~ ~ z o ~ ~ O ~ ~ ~ 00 ~ ~
~ Z 3 o t-- 1-- ~ ~ -- ~ _ C

c E ~ ~ a ~

z z z z z a a a z z ~0 c _ ~ E a a a a a a a 0 z z z z a a a a Z a c~
.c~ z x u~
m D Z ~ Z ~ ' C~ +
,_ C ~ ~ D E

W O 96/07098 PCT~US95/11114 Notes To Table 2. The normalized cellular ASA activity is the enzymic activity relative to the average of the ,~-galactosidase and ,~-hexosaminidase activities in a given preparation. The normalized rate of intracellular ASA degradation is the daily rate of loss of 35S-methionine labeled ASA relative to that rate for cathepsin D. The norm~li7Pd rate 5 of ASA synthesis is the amount of 35S-labelled ASA synthesized hourly, relative to that rate for cathepsin D. The values are nonn~li7Pd such that the highest of each set is set at 100. "PD" indicates the presence of the PD polymorphism and "N" the presence of the normal sequence for either the N-glycosylation coding site or polyadenylation signal consensus sequence of the ASA gene determined by PCR and Southern blot analysis. The 10 nature of each allele for both sites are indicated. ND denotes that values were not determined.

To determine whether the IIIa phenotype is equivalent to the PD-ASA genotype, Southern 15 blot analysis of PCR amplified segments of the ASA gene from IIIa and IVa individuals was performed according to Gieselm~nn et al. (1989, Proc. Natl. Acad. Sci. USA.
86:9436-9440). Probes capable of distinguishing the PD-ASA, A-G transition at the N-glycosylation site, demonstrated that such a mutation exists in both alleles of individuals with the IIIa variant but not in those of persons with the IVa enzyme (Table 2). In 20 addition, the ASA gene from a type IIIb individual also possesses the identical PD
polymorphism. The consequence of the A-G transition is the loss of a potential N-glycosylation site. Since this site is utilized in the normal allele (Gieselmann et al., supra), it may be concluded that IIIa and IIIh ASA differ from IVa by the lack of the Asn350-linked glycan. One subject (NH) with a IIIa pattern is N/PD at both polymorphic sites. This individual, however, is a brother of an MLD patient and is probably MLD/PD
for ASA. Since the product of the MLD allele lacks enzyme activity, the IIIa isoform pattern is observed.

As shown in Table 2, most IIIa subjects also carried the PD-ASA, A-G transition at the 30 polyadenylation signal consensus sequence of the ASA gene. This mutation, however, does not affect the structure of the polypeptide product. The ASA of subject KE, who lacks this polymorphism, yields a IIIa electrophoretic pattern idPntic.~l to that observed for ASA from subjects who carry the polyadenylation sigr.al mutation.

35 The biochpmic~l characteristics of PD-ASA have been extensively Pl~minPd (see Kolodny, 1989, in The Metabolic Basis Of Inherited Disease, Scriver et al. (eds.), McGraw Hill, New York, pp. 1721-50 for review). In light of this, the basis for the reduced cellular ASA activity in IIIa individuals was investigatPd to confirm the PD nature of IIIa ASA.

WO 96.07098 ~ PCT/US95/11114 Consideration was given to 1) intracellular stability, 2) rate of synthesis, 3) cellular localization, and 4) specific enzyme activity of the enzyme. As shown in Figure 1 and Table 2, the enzyme for IIIa individuals, who are homozygous for the PD N-glycosylation site polymorphism, is at least four times more susceptible to intracellular degradation than 5 is ASA from the IVa subjects. This includes the IIIa subject KE, who is normal at the polyadenylation signal site sequence. The finding that the loss of the Asn350-linked glycan is a destabilizing factor for the enzyme is consistent with the conclusions of Ameen and Chang (1987, FEBS Lett. 219:130-134)) on PD-ASA. In contrast, Gieselmann et al.
(supra) reported no contribution of the PD N-glycosylation polymorphism to the reduced 10 cellular activity of PD-ASA. The reason for this discrepancy may be related to the use of a hd~ cled BHK expression system (Gieselmann et al., supra) as opposed to human fibroblasts (Ameen and Change, supra).

Studies on the rate of synthesis of ASA in fibroblasts from IIIa and IVa subjects 15 demonstrated that the presence of the polyadenylation signal site consensus sequence polymorphism also has an impact on the steady-state levels of ASA. These studies were performed by quantifying the amount of newly synthesized ASA secreted into the media by cells exposed to NH4CI. This approach allows for the measu~ llL of the rates of synthesis of Iysosomal enzymes under conditions which lllirl;llli~ the concomitant effect of 20 intr~cçllul~r degradation. As shown in Table 2, the fibroblasts of the IIIa subject KE, normal at the polyadenylation signal site, exhibit relative levels of ASA synthesis identical to that of fibroblasts from a homozygous normal IVa individual, SQ. Cells from the IIIa subject DH who possesses the PD-polyadenylation site polymorphism, however, showed only one-half this rate. The impact of the PD polymorphism on the rate of ASA
25 synthesis, as reported here, is more moderate than the ten-fold decrease noted by Gieselm~nn et al. (supra) but is greater than that observed by Ameen and Chang (supra).
Comi.ct.ont with the conclusion that both PD-ASA polymorphisms affect the steady-state levels of IIIa and IIIb ASA, fibroblasts of subject KE showed twice the total cellular ASA
activity of fibroblasts from subjects who are homozygous for both PD-ASA
30 polymorphisms, and approximately 50% the activity levels of the cells from IVa subjects.

Since ASA does exhibit, in part, mannose-6-phosphate receptor mPdi~ted targeting to Iysosomes (Ameen et al., 1990, Mol. Cell. Biochem., 92:117-127), the absence of the N-glycan at ~minr ~cyl residue 350 may potentially affect this process. Subcellular Wo 96/07098 PCTNS95/11114 localization of variant ASA was studied employing the double Percoll density fraction approach of Gorman and Poretz (1987, J. Cell. Physiol. 131:158-164). Consistent with the findings of Ameen et al. (supra) on PD-ASA, we detected no significant difference between fibroblasts from IIIa and IVa subjects in regard to the relative distribution of the 5 enzyme in the dense Iysosome, light Iysosome, endosome, or smooth membrane subcellular fraction of the cells (data not shown). Furthermore, the Asn350-Ser conversion and the absence of the associated N-glycan did not affect the enzyme's specific activity (activity of ASA/amount of ASA protein) toward a synthetic substrate (data not shown).
ASA activity was quantified using thep-nitrocatechol method of Manowitz et al. (1981 10 Biol. Psychiat. 16:1107-1113) and the quantity of ASA protein was determined by SDS-PAGE followed by quantitative immunoblot analysis. Accordingly, the decreased cellular level of ASA in fibroblasts of IIIa individuals is not due to a change in specific enzymic activity or mi~L~IgcLillg of the enzyme.

15 Implications for alcoholism. We have shown that there is a greater prevalence of individuals possessing the IIIa and IIIb electrophoretic variants of ASA in alcoholics than in psychiatric and healthy controls. As with PD-ASA, these variants exhibit reduced ASA
activity, and carry the PD-ASA polymorphism at the N-glycosylation site. Consequently, our population study evidences a strong association of the PD-ASA N-glycosylation 20 polymorphism of ASA and alcoholism. From the work of Nelson et al. (1991, Hum.
Genet. 87:87-88) and Hohenshutz et al. (1989, Hum. Genet. 82:4548), it can be inferred that approximately 2% of the Australian population and 0.5% of the German population, respectively, are homozygous for the N-glycosylation site polymorphism and express the IIIa or IIIb form of ASA. Based upon the genoLy~e expected for the IIIa and IIIb variant 25 phenotypes, we estimate that the frequency of individuals homozygous for the PD-ASA N-glycosylation polymorphism is 0.6% in the normal, 0.5% in the psychiatric, and 6.6% in alcoholic populations. This suggests that world-wide, the approximately 25-110 million individuals who exhibit the homozygous N-glycosylation site polymorphism of PD-ASA
have a twelve fold greater propensity of being alcoholic, co~ ,aled to individuals with 30 normal ASA.

The ~tt~nn~ted levels of ASA in individuals ~ ,ressillg the IIIa or IIIb ASA variant as a result of the PD-ASA genotype is a possible explanation for the observed association of this condition with alcoholic patients. MLD patients who possess 0-5 % the ASA activity W096/07098 ~ 3 8 B 3 PCT/US95111114 of normal subjects exhibit 2-50% the normal ability to degrade sulfatides (Kappler et al., 1991, Hum. Genet. 86:463-470). Individuals who are homozygous for PD-ASA show anASA activity of 10-30% of normal, but demonstrate a normal slllfatide loading profile (Kappler et al., supra). Those persons who are heterozygous for MLD and PD-ASA, 5 however, show levels of enzymic activity 5-10% that of normal and exhibit a reduced sulfatide catabolism equivalent to 15-75% of that by homozygous normal subjects tKappler et al., supra). Evidently, the level of ASA activity in homozygous PD-ASA individuals is at a minim:~l threshhold level which still allows normal sulfatide metabolism. A reduction of ASA activity below this level appears to result in reduced sulfatide catabolism as 10 denoted by the sulfatide loading test. This concept of a critical threshhold level of enzyme was presented by Conzelmann and Sandhoff (1984, Dev. Neurosci. 6:58-71) in theirtheoretical discussion on the correlation between residual enzyme activities in inherited enzyme deficiencies and the development of neurological disorders. Accordingly, factors which have a negative impact on cellular ASA levels or which through an ASA-15 independent pathway increase sulfatide production, may result in elevated sulfati(le poolssimilar to that observed in MLD patients.

An exciting hypothesis is that exogenous ethanol and/or its metabolites causes increased sulfatide levels by either lowering ASA activity below the critical threshhold level 20 nPcess~ry for normal sulfatide catabolism and/or increasing sulfatide production. It is known that alcohol causes abnormal glycosylation (Stipler and Borg, 1991, Scand. J. Clin.
Lab. Invest. 51 :43-51) and glycoprotein trafficking (Tuma and Sorrell, 1988, Semin.
Liver Dis. 8:69-80), and decreased protein synthesis (Preedy et al., 1990, Alcohol.: Clin.
Exp. Res. 14:165-168). In addition, chronic ingestion of alcohol by mice results in 25 increased levels of brain s~llfatides (Rawat, A.K., 1974, Res. Commun. Chem. Pathol.
Pharm. 8:461-469). We suggest that ethanol would cause increased int~ ilL~llL steady-state levels of sulfati~1es, potentially reaching pathological levels in IIIa or IIIb (PD) individuals who possess critical threshhold levels of the enzyme. It is envisioned that varying levels of ethanol in subjects with variants of ASA will result in a cyclical pattern 30 of high and normal levels of sl-lfatides, eventually resulting in dysmyelination, a form of white matter disease. A con~equen~e of this may be the late-onset MLD-like symptoms observed in some alcoholics.

WO 96/07098 ~ PCT/US95/11114 Interestingly, slllf~ti-les are an integral component of the ~-endorphin receptor and appear to be required for receptor activity (Craves et al., 1980, Science 207:75-76). They also are capable of binding both ,B-endorphin and dynorphin (Wu et al., 1986, J. Biol. Chem.
261:3687-3691). It is intriguing to postulate that ethanol-induced increases in steady-state 5 sulfatide pools may impact upon specific neuloL~ ",iller receptors involved in an ethanol addiction pathway. The conceqllenre of this would be a cyclical ethanol-reinforced addiction which would be more prominent in individuals who have a reduced capacity to buffer levels of sulfatide pools, as may be the case with those who are PD in ASA.
Verification of these hypotheses requires the demonstration of the biochemical nature of 10 the impact of ethanol on sulfatide pools.

EXAMPLE 2: A METHOD FOR RAPID DETECTION OF
ARYLSULFATASE A PSEUDODEFICIENCY
MUTATIONS
Pseudodeficiency of arylsulfatase A is a complicating factor in the determination of metachromatic leukodystrophy risk and carrier status. A method using PCR and restriction enzyme digestion to detect the presence of both the mutations that contribute to arylsulfatase A pseudodeficiency is described using DNA from blood or buccal cells.
20 Application of this technique should facilitate determination of metachlulllaLic leukodystrophy status and counseling in families where the pseudodeficiency allele is present.

Materials and Methods 25 DNA isolation. Genomic DNA was isolated from white blood cells by proteinase K
digestion and phenol extraction as described (Ausubel et al., 1994, in Current Protocols in Molecular Biology, John Wiley and Sons: New York). Buccal cells were collected on a cytology brush and DNA was prepared by heating in 50 mM sodium hydroxide and neutralization with Tris as described (Richards et al., 1993, Hum. Molec. Genet. 2:159-30 163).

PCR amplification. Oligonucleotide primers for PCR amplification were designed withthe aid of the MacVector program (Eastman Kodak) and obtained from National Biosciences (Plymouth, Minnesota). A 200 base pair fragment spanning the third potential 35 N-glycosylation site at amino acid residue 350 (nucleotide 1049) was arnplified with the WO 96/07098 ~ PCT/US95/11114 primers ASA2c (5'-TGAT5GCGAACTGAGTGACT) (SEQ ID NO:9) and ASA4nc (5'-AAGGATCTGGGATCAGGGGT) (SEQ ID NO: 10) using about 0.5 ~g of blood DNA (or 10 ~1 of the buccal DNA) in 50 mM KCI, 10 mM Tris (pH 8.3), 1.5 mM MgCl2, 200 ~Meach of dATP, dTTP, dCTP and dGTP and 1.25 units of Taq DNA polymerase.
5 Following an initial denaturation at 95C for 3 minutes, amplification was carried out for 35 cycles by delldlul~Lion at 95C for 30 seconds, ~nnP~ling at 56C for 1 minute and extension at 72C for 30 seconds in a 50 ~I volume using an MJ Research PTC100 thermal cycler.

10 A 182 base pair fragment ~p~nning the polyadenylation signal site at cDNA nucleotide 1620 was amplified with primers ASA3c (5'-AGCTTGCTGCCATTGCCCA) (SEQ. ID.
NO:11) and ASA5nc (5'-CATTACCCCAGGATTGGTCGAA) (SEQ ID NO:12) using the same conditions described above for the ASA2c/ASA4nc primer pair. However, efficient amplification of the 182 base pair fragment with primers ASA3c and ASA5nc was also achieved using a rapid 2-step cycling program (94C for 20 seconds, and 56C for 30 seconds for 35 cycles).

Restriction endonuclease treatment and gel electrophoresis. The 200 base pair fragment is cleaved by the restriction endonuclease BsrI when the N-glycosylation site is mnt~re-l, resulting in two fragments of 112 and 88 base pairs. Following PCR amplification the reaction was sequeMially extracted with an equal volume of phenol and chloroform and the DNA was ethanol precipitated in the presence of 0.3 M sodium acetate. Following a 70% ethanol wash, the pellet was dried and dissolved in 20 ~1 of 0.1 mM EDTA, 1 mM
Tris (pH 8.0). An aliquot (6~1) of the DNA was digested in a final volume of 25 ~I with 10 units BsrI in the buffer provided by the supplier (New F.ngl~n-l Biolabs) at 65C for 3 hours.

The 182 base pair fragment Sp~nning the polyadenylation signal site is efficiently cleaved with MaeIII (Boehringer ~f~,."h~i",) without the need for organic extraction or ethanol precipitation. A volume of 9.8 ~I was digested with 2 units MaeIII in a final volume of 12 ~1 at 55C for 3 hours. In the absence of a mutation the 182 base pair fragment is cleaved to fragments of 153 and 29 nucleotides. When the polyadenylation signal sequenre is mutated the 153 base pair fragment is further cleaved to 129 and 24 base pair fragments. All PCR and restriction enzyme digestion products were separated by Yi d t~
WO 96/07098 ~ u ~ PCTtUSs~/1111 electrophoresis through 7.5% polyacrylamide gels run in TBE buffer (Ausubel et al., supra) and photographed after staining with ethidium bromide.

Results 5 Analysis of the ASA genotype using DNA isolated from leukocytes of three individuals is presented in Figure 2A. Subject 'a' is homozygous normal at both the polyadenylation signal site (nucleotide 1620) and the N-glycosylation site (nucleotide 1049), as the 182 base pair PCR product is reduced to 153 base pairs after treatment with MaeIII, and the 200 base pair fragment spanning the N-glycosylation site is unaffected by treatment with 10 the BsrI. Subject 'b' is homozygous for the presence of the pseudodeficiency mutations at both the polyadenylation signal and N-glycosylation sites, as the 182 base pair product is cleaved to 129 base pairs by MaeIII and the 200 base pair product spanning the mutated N-glycosylation site is completely cleaved to bands of 112 and 88 base pairs by BsrI.
Subject 'c' is heterozygous for both sites, having two bands visible in the MaeIII digest 15 (153 and 129 base pairs) and three bands visible in the BsrI digest (200, 112 and 88 base pairs).

Figure 2B shows an analysis of the ASA genotype using buccal cells from three other individuals as a source of DNA. Subject 'd' is homozygous normal at both sites, subject 20 'e' heterozygous at both sites and subject 'f is heterozygous at only the N-glycosylation site. Being able to genotype ASA with DNA from buccal cells means that the sample for analysis can be provided by the subject without discomfort or the need for a phlebotomist, and the entire process of obtaining the sample, DNA isolation, PCR
amplification, restriction enzyme digestion and analysis of results can easily be completed 25 in a single day. The genotypes of the subjects analyzed in Figure 2A and 2B are su~ d,i~ed in Figure 2C.

Discussion In the di~gn~-si~ of susceptibility to alcoholism and of MLD, and ~ccec~m~nt of risk for 30 potential siblings or offspring of individuals carrying these traits, it is important to be able to detect both the pse-ldo~Pficiency mutations of ASA in family members of affected persons (Shen et al., 1993, Am. J. Med. Genet., 45:631-637). The method presented in this Exarnple is rapid and provides direct vi.cu~li7~tion of the ASA genotype at both the pseudodeficiency sites. This is particularly important as the N-glycosylation site mutation can occur in the absence of the polyadenylation signal site mutation (Nelson et al., 1991, Hum. Genet., 87:87-88; HohPns~hllt7 et al., 1989, Hum. Genet., 82:45-48), and the N-glycosylation site mutation does appear to influence the enzyme activity (Shen et al., supra). Furthermore, in some populations the polyadenylation site mutation is not found 5 while the N-glycosylation site mutation is encountered at a gene frequency of more than 0.4.

An alternative method that has been used for the detection of the pseudodeficiency mutations of ASA include immobilization of PCR products on a membrane and sequential 10 hybridization to the products with allele specific radiolabelled oligonucleotide probes (Gieselmann et al., 1989, Proc. Natl. Acad. Sci. USA, 86:9436-9440; Shen et al., supra).
This approach is suited to analysis of very large numbers of samples, but is both expensive and time consuming when applied to smaller numbers of individuals, as is typical in family diagnostic studies.
Two methods to determine the presence of polyadenylation signal site of ASA at nucleotide 1620 of the cDNA, but not the nucleotide 1049 mutation, have also been described (Gieselmann et al., 1991, Hum. Genet. 86:251-255; Chabas et al., 1993, Clin.
Genet. 44:320-323). One is an allele-specific amplification assay requiring the use of 20 three pairs of primers for each analysis (Gi~selm~nn et al., 1991, supra), and the second uses a micm~tched primer to produce a RsaI restriction site when the polyadenylation signal mutation is present (Chabas et al., supra). This latter report has overlooked the MaeIII restriction site produced by the polyadenylation signal site mutation.

25 In summary, the methodology described in this Example enables the rapid and accurate detection of the status of both sites known to contribute to pseudodeficiency of ASA in DNA of individuals. This should facilitate the identification and distinction of MLD and ASA pseudodeficiency alleles in f~nily studies, which is important in order to provide genetic counseling to such families in connection with both susceptibility to alcoholism and 30 the possibility of developing MLl). Furthermore, the techniques described are applicable to larger investigations designed to determine the relative frequency of the pseudodeficiency mutations in different populations.

W O 96/07098 ~ 9 ~ ~ C~ U ~ PCTAUS95/11114 EXAMPLE 3: AN IMMUNOASSAY FOR
PSEUDODEFICIENT ASA

The immunoassay is an enzyme-linked assay to detect the aberrant enzyme in cellular 5 extracts and/or body fluids of individuals. The basis of the assay is to employ an antibody which can react with ASA lacking the glycan at residue 350 and binds with specificity to only ASA possessing this structural abnormality. The reagent is prepared as a monoclonal antibody elicited to a synthetic antigen possessing the oligopeptide structure analogous to the amino acid sequence surrounding residue 350 of ASA containing a serine residue 10 rather than the normal asparagine residue at this location. Hybridomas secreting such an antibody are identified in screening assays by detecting those which exhibit reactivity toward the mutant ASA but lack reactivity towards the normal enzyme.

An oligopeptide, Ac-CAPLPSVTLDGFD-NH2 (SEQ ID NO: 13) has been prepared15 synthetically (Chiron Mimotopes, San Diego, CA). This peptide is covalently coupled via the -SH group of the amino terminal cysteine to diphtheria toxoid and to bovine serum albumin. The serine residue underlined is the amino acid which differs from the asparagine 350 of normal ASA.

20 Tmmllni7:~tion of mice and hybridoma ple~ldlion is performed by conventional methods employing the oligopeptide-diphtheria toxoid conjugate and the immunogen (see E.Harlow and D. Lane, in Antibodies: A Laboratory Manual, Cold Spring Harbor Laboratory Press: Cold Spring Harbor, NY).

25 An antigen capture ELISA assay is employed es~er~ lly as described by Harlow and Lane, supra. The detection antigens employed are pseudodeficient ASA (prepared as a partially purified extract from fibroblasts of an individual who is homozygous for the mutant enzyme) or normal ASA (prepared as a partially purified extract from fibroblasts of an individual who is homozygous for the normal enzyme). The presence of bound30 enzyme in the ELISA is detected employing a colorimetric assay for ASA utilizing p-nitrocatachol sulfate by a method similar to that described by Manowitz et al. (1981, Biol.
Psychiat. 16:1107-1113). Alternatively, hybridomas secreting antibody which reacts with the antigenic oligopeptide are detected by an antibody capture ELISA utilizing the oligopeptide conjugated to bovine serum albumin similar to the procedure described by 35 Harlow and Lane, supra. Positive hybridomas identifled in this assay are then screened WO 96/07098 ~ ~ ~ 8 8 ~ 3 PCT/US95/11114 by the antigen capture assay with mutant and normal ASA as described above.
Hybridomas which exhibit reactivity with the mutant enzyme but not the normal enzyme are expanded in either tissue culture (see Harlow and Lane) or in vivo (in ascites) as described by Lee and Poretz (1991, Immunol. Cell Biol. 69:151-157) EXAMPLE 4: ENDONUCLEASE DETECTION OF ARYLSULFATASE A
PSEUDODEFICIENCY MUTATIONS WITH AN INTERNAL
CONTROL

10 A method of using PCR and restriction enzyme digestion to detect the presence of both mutations that contribute to arylsulfatase A pseudodeficiency is described using DNA from blood or buccal cells. This method employs internal controls for the enzyme activity of both endonucleases.

15 This Example further describes a method for detecting the presence of both mutations that contribute to arylsulfatase A pseudodeficiency by using PCR and restriction endonuclease digestion of the gene. The primer of the present invention generates a new BsrI site within the PCR product, which is common to both the normal and Pd ASA PCR
fragments. Since the Pd sequence, but not the normal, exhibits a second BsrI site, an 20 internal control for restriction enzyme activity is created and allows for a more accurate detection of pseudodeficiency and MLD.

Materials and Methods DNA isolation. Genomic DNA was isolated from white blood cells, and buccal cells were 25 collected, as described in Example 2, sllpra.

PCR amplification. Oligonucleotide primers for PCR amplification were designed with the aid of the MacVector program (F.~ctm~n Kodak) and obtained from National Biosciences (Plymouth, Minnesota). A 211 base pair fragment spanning the third potential 30 N-glycosylation site at amino acid residue 350 (nucleotide 1049) was amplified with the primers ASA17c (5'-CACCCCAACCTTGATGGCGAACTC;GGTGAC) (SEQ ID NO:14) and ASA4nc (5'-AAGGATCTGGGATCAGGGGT) (SEQ ID NO:10) using about 0.5 ~g of blood DNA (or 10 ~1 of the buccal DNA preparation) in 50 mM KCl, 10 mM Tris (pH
8.3), 1.5 rnM MgCl2, 200 ~M each of dATP, dTTP, dC~P and dGTP and 1.25 units of 35 Taq DNA polymerase. Following an initial denaturation at 95C for 3 minutes, WO 96/07098 ~ 6 ~ PCT/US95/11114 amplification was carried out for 35 cycles by denaturation at 95C for 30 seconds, ~nnP~ling at 56C for 1 minute and extension at 72C for 30 seconds in a 50 ~I volume using an MJ Research PTC100 thermal cycler. The oligonucleotide primer ASA17c has a single nucleotide mi~m~tch 6 nucleotides from the 3' terminus (bold). This introduces a 5 BsrI restriction endonuclease recognition sequence (ACTGGN) twenty-five nucleotides from the endo of the amplified product.

A 182 base pair fragment spanning the polyadenylation signal site at cDNA nucleotide 1620 was amplified with primers ASA3c (5'-AGCTTGCTGCCATTGCCCA) (SEQ ID
10 NO:11) and ASASnc (5'-CATTACCCCAGGATTGGTCGAA) (SEQ ID NO:12) using the same conditions described above for the ASA2c/ASA4nc primer pair. However, efficient amplification of the 182 base pair fragment with primers ASA3c and ASA5nc was also achieved using a rapid 2-step cycling program (94C for 20 seconds, and 56C
for 30 seconds for 35 cycles).
Restriction endonuclease treatment and gel electrophoresis. The 211 base pair fragment is cleaved by the restriction endonuclease BsrI at the engineered site within the primer ASA17c to produce fragments of 186 and 25 base pairs when the N-glycosylation coding site is not mutated. This serves as an internal positive control for BsrI activity. When the 20 N-glycosylation site coding site at nucleotide 1049 is m~lt~tçd, the 186 base pair fragment is further cut to fragments of 98 and 88 base pairs. Following PCR amplification the reaction was sequentially extracted with an equal volume of phenol and chloroform and the DNA was ethanol p~ ,iLaLed in the presence of 0.3 M sodium acetate. Following a 70% ethanol wash, the pellet was dried and dissolved in 20 ~1 of 0.1 mM EDTA, 1 mM
25 Tris (pH 8.0). An aliquot (6~1) of the DNA was digested in a final volume of 25 ~I with 10 units BsrI in the buffer provided by the supplier (New Fngl~nfl Biolabs) at 65C for 3 hours.

Cleavage conditions with for the 182 base pair fragment `~ lhlg the polyadenylation 30 signal site are described in Example 2, supra.

Results The oligonucleotide primer pairs for this Example were design~d to amplify genomic DNA fragments ~p~nning each of the two pseudodeficiency mutation sites and to include Wo 96/07098 PCT/US95/11114 internal positive controls for endonuclease activity. Thus, in addition to the potential BsrI
site at nucleotide 1049 in the mutant ASA gene, the 211 base pair product spanning this region has an engineered BsrI site 25 nucleotides from the 5' end. Similarly, the 182 nucleotide product spanning the polyadenylation signal site has, in addition to the potential 5 MaeIII site at nucleotide 1620, a naturally occurring MaeIII site 29 nucleotides from the 3' end of the PCR product. These constant cutting sites serve as internal controls of the restriction enzyme activity.

Analysis of the ASA genotype using DNA isolated from leukocytes of three individuals is 10 presented in Figures 3A and 3B. Figure 3A shows the PCR amplified product spanning the N-glycosylation site without enzyme digestion(-) or after digestion with BsrI in subjects a, b, and c. The 211 base pari band is cleaved into 186 base pairs in the absence of the N-glycosylation site mutation (as for subject c), and to fragments of 98 and 88 base pairs in the subject homozygous for the mutation at this position (b). Subject a has bands 15 of 186, 98, and 88 base pairs, and is therefore heterozygous for the N-glycosylation site mutation.

Similarly, the genotype at the polyadenylation signal site can be easily detected by digestion of the 182 base pair PCR product with MaeIII. This produces a band of 153 20 base pairs in the absence of the mutation and 129 base pairs when the mutation is present.
Subject a has both the 153 and 129 base pair bands after MaeIII digestion (Figure 3B), and is therefore heterozygous for the polyadenylation signal site pseudodeficiency mutation.

25 Note that the smaller products of the restriction enzyme digestions are less than 30 base pairs in size and cannot be seen on the gels.

A crude DNA preparation can be rapidly prepared from buccal epithelial cells obtained in a noninvasive manner with a cytology brush (Richards et al., 1993, Hum. Mol. Genet.
30 2:159-163). Figures 3C and 3D show that such DNA can be efficiently arnplified and analyzed using the PCR-restriction enzyme assay described in this paper. S~lbject d is heterozygous for the N-glycosylation site mutation but homozygous normal at the polyadenylation signal site. T he ASA genotypes of the five subjects anal~ zed are w096~07098~ ~ 8 ~ 3 PCT/US95/11114 summarized in Figure 3E. The platelet ASA activity of subjects a and b were 75 % and 14.5% of normal, respectively.

Discussion 5 As noted above, in the diagnosis of susceptibility to alcoholism, as well as MLD and asses~mPnt of risk for potential siblings, it is important to be able to accurately detect both the pseudodeficiency mutations of ASA in family members of affected persons. Themethod presented in this Example is rapid and provides direct visualization of the ASA
genotype at both ASA pseudodeficiency sites. Moreover, use of a PCR primer with a 10 single mi.~m~t~h (ASA17c) to create a control BsrI site provides a positive control for the restriction enzyme activity. It was found that a 10 nucleotide shorter oligonucleotide primer with the same mi~m~tch did not cut with BsrI, indicating that this restriction enzyme requires more than 10 nucleotides flanking its recognition site in order to efficiently cleave the DNA.
In summary, the methodology described herein enables the rapid and accurate detection of the status of both sites known to contribute to pseudodeficiency of ASA in DNA of individuals, with internal positive controls for endonuclease activity for both sites. This should facilitate the identification and distinction of MLD and ASA pseudodeficiency 20 alleles in family studies, which is important in order to provide genetic counseling to such families.

The foregoing examples have been provided for a better underst~nAing of the invention 25 and as an illustrative description presenting the details of the constructs and procedures that were followed in its development and validation. The invention is not intenAPd to be limited to the examples. This invention may be embodied in other forms or carried out in other ways without departing from the spirit or essenti~l characteristics thereof. The present disclosure is therefore to be considered as in all respects illustrative and not 30 restrictive, the scope of the invention being indicated by the appended Claims, and all changes which come within the mP~ning and range of equivalency are intenAed to be embraced therein. It is also to be understood that all base pair sizes given for nucleotides r ~- r WO 96/07038 ~ PCT/US95/11114 mlrnr~P r~f APcrrir~ti,~n ~ ri~

WO 96/07098 ~ 3 PCT/US95/11114 purpose of description. Various references are cited throughout this specification, each of which is incorporated herein by reference in its entirety.

W 096/07098 ~ 8 ~ ~ 4~ PCTrUS95/llll4 SEQUENCE LISTING

(1) GENERAL INFORMATION:
(i) APPLICANT: Manowitz, Paul Poretz, Ronald D.
Park, David Ricketts, Michael H.
(ii) TITLE OF INVENTION: MARKER FOR INDIVIDUALS SUSCEPTIBLE TO
ALCOHOLISM
(iii) NUMBER OF SEQUENCES: 14 (iv) CORRESPONDENCE ADDRESS:
(A) ADDRESSEE: Klauber & Jackson (B) STREET: 411 Hackensack Avenue (C) CITY: Hackensack (D) STATE: New Jersey (E) COUNTRY: USA
(F) ZIP: 07601 (v) COMPUTER READABLE FORM:
(A) MEDIUM TYPE: Floppy disk (B) COMPUTER: IBM PC compatible (C) OPERATING SYSTEM: PC-DOS/MS-DOS
(D) SOFTWARE: PatentIn Release #1.0, Verslon #1.25 (vi) CURRENT APPLICATION DATA:
(A) APPLICATION NUMBER: WO
(B) FILING DATE: 30-AUG-1995 (C) CLASSIFICATION:
(vi) PRIOR APPLICATION DATA:
(A) APPLICATION NUMBER: US 60/
(B) FILING DATE: 21-JUN-1995 (C) CLASSIFICATION:
(vi) PRIOR APPLICATION DATA:
(A) APPLICATION NUMBER: US 08/299,187 (B) FILING DATE: 31-AUG-1994 (C) CLASSIFICATION:
(viii) ATTORNEY/AGENT INFORMATION:
(A) NAME: Jackson Esq., David A.
(B) REGISTRATION NUMBER: 26,742 (C) REFERENCE/DOCKET NUMBER: 1158-1-OOlPCT
(ix) TELECOMMUNICATION INFORMATION:
(A) TELEPHONE: 201 487-5800 (B) TELEFAX: 201 343-1684 (C) TELEX: 133521 (2) INFORMATION FOR SEQ ID NO:1:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 20 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: cDNA
(iii) HYPOTHETICAL: NO
(iv) ANTI-SENSE: NO

-W 096/07098 47 PCTrUS95/11114 (vi) ORIGINAL SOURCE:
(A) ORGANISM: Homo sapiens (x) PUBLICATION INFORMATION:
(A) AUTHORS: Gieselmann, Volkmar Polten, Andreas Kreysing, Joachim von Figura Kurt (B) TITLE: Arylsulfatasé A pseudodeficiency: Loss of a polyadenylation signal and N-glycosylation site (C) JOURNAL: Proc. Natl. Acad. Sci. U.S.A.
(D) VOLUME: 86 (F) PAGES: 9436-9440 (G) DATE: December-1989 (xi) SEQUENCE DESCRIPTION: SEQ ID NO:l:

(2) INFORMATION FOR SEQ ID NO:2:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 2l base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: cDNA
(iii) HYPOTHETICAL: NO
(iv) ANTI-SENSE: NO
(vi) ORIGINAL SOURCE:
(A) ORGANISM: Homo sapiens CGAAGCACTG CACATACCTG G 2l (2) INFORMATION FOR SEQ ID NO:3:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 23 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: cDNA
(iii) HYPOTHETICAL: NO
(iv) ANTI-SENSE: NO
(vi) ORIGINAL SOURCE:
(A) ORGANISM: Homo sapiens (2) INFORMATION FOR SEQ ID NO:4:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 20 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: cDNA
(iii) HYPOTHETICAL: NO

W 096/07098 2 ~ ~ 8 8 B 3 48 PCT~US95/11114 (iv) ANTI-SENSE: NO
(vi) ORIGINAL SOURCE:
(A) ORGANISM: Homo sapiens (x) PUBLICATION INFORMATION:
(A) AUTHORS: Gieselmann, Volkmar Polten, Andreas Kreysing, Joachim von Figura, Kurt (B) TITLE: Arylsulfatase A pseudodeficiency: Loss of a polyadenylation signal and N-glycosylation site (C) JOURNAL: Proc. Natl. Acad. Sci. U.S.A.
(D) VOLUME: 86 (F) PAGES: 9436-9440 (G) DATE: December-1989 (xi) SEQUENCE DESCRIPTION: SEQ ID NO:4:

(2) INFORMATION FOR SEQ ID NO:5:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 20 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: cDNA
(iii) HYPOTHETICAL: NO
(iv) ANTI-SENSE: NO
(vi) ORIGINAL SOURCE:
(A) ORGANISM: Homo sapiens (x) PUBLICATION INFORMATION:
(A) AUTHORS: Gieselmann, Volkmar Polten, Andreas Kreysing, Joachim von Figura, Kurt (B) TITLE: Arylsulfatase A pseudodeficiency: Loss of a polyadenylation signal and N-glycosylation site (C) JOURNAL: Proc. Natl. Acad. Sci. U.S.A.
(D) VOLUME: 86 (F) PAGES: 9436-9440 (G) DATE: December-1989 (xi) SEQUENCE DESCRIPTION: SEQ ID NO:5:

(2) INFORMATION FOR SEQ ID NO:6:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 20 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: cDNA
(iii) HYPOTHETICAL: NO
(iv) ANTI-SENSE: NO
(vi) ORIGINAL SOURCE:

W O 96/07098 49 2 ~ 3 PCTrUS95/11114 (A) ORGANISM: Homo sapiens (x) PUBLICATION INFORMATION:
(A) AUTHORS: Gieselmann, Volkmar Polten, Andreas Kreysing, Joachim von Figura, Kurt (B) TITLE: Arylsulfatase A pseudodeficiency: Loss of a polyadenylation signal and N-glycosylation site (C) JOURNAL: Proc. Natl. Acad. Sci. U.S.A.
(D) VOLUME: 86 (F) PAGES: 9436-9440 (G) DATE: December-1989 (xi) SEQUENCE DESCRIPTION: SEQ ID NO:6:

(2) INFORMATION FOR SEQ ID NO:7:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: l9 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: cDNA
(iii) HYPOTHETICAL: NO
(iv) ANTI-SENSE: NO
(vi) ORIGINAL SOURCE:
(A) ORGANISM: Homo sapiens (x) PUBLICATION INFORMATION:
(A) AUTHORS: Gieselmann, Volkmar Polten, Andreas Kreysing, Joachim von Figura, Kurt (B) TITLE: Arylsulfatase A pseudodeficiency: Loss of a polyadenylation signal and N-glycosylation site (C) JOURNAL: Proc. Natl. Acad. Sci. U.S.A.
(D) VOLUME: 86 (F) PAGES: 9436-9440 (G) DATE: December-1989 (xi) SEQUENCE DESCRIPTION: SEQ ID NO:7:
CTGGTGTTAT TACGTTATC l9 (2) INFORMATION FOR SEQ ID NO:8:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: l9 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: cDNA

(iii) HYPOTHETICAL: NO
(iv) ANTI-SENSE: NO
(vi) ORIGINAL SOURCE:
(A) ORGANISM: Homo sapiens (x) PUBLICATION INFORMATION:

W 096/0709~ , 7 ~ 9 8 ~ ~ 3 PCTAUS95/11114 (A) AUTHORS: Gieselmann, Volkmar Polten, Andreas Kreysing, Joachim von Figura, Kurt (B) TITLE: Arylsulfatase A pseudodeficiency: Loss of a polyadenylation signal and N-glycosylation site (C) JOURNAL: Proc. Natl. Acad. Sci. U.S.A.
(D) VOLUME: 86 (F) PAGES: 9436-9440 (G) DATE: December-1989 (xi) SEQUENCE DESCRIPTION: SEQ ID NO:8:
CTGGTGTTAC TACGTTATC l9 (2) INFORMATION FOR SEQ ID NO:9:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 20 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: cDNA
(iii) HYPOTHETICAL: NO
(iv) ANTI-SENSE: NO
(vi) ORIGINAL SOURCE:
(A) ORGANISM: Homo sapiens (xi) SEQUENCE DESCRIPTION: SEQ ID NO:9:

(2) INFORMATION FOR SEQ ID NO:l0:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 20 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: cDNA
(iii) HYPOTHETICAL: NO
(iv) ANTI-SENSE: NO
(vi) ORIGINAL SOURCE:
(A) ORGANISM: Homo sapiens (xi) SEQUENCE DESCRIPTION: SEQ ID NO:l0:

(2) INFORMATION FOR SEQ ID NO:ll:

(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: l9 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: cDNA

W 095/'~70~8 ~ ~ ~ % ~ ~ ~ PCTrUS95/11114 (iii) HYPOTHETICAL: NO
(iv) ANTI-SENSE: NO
(vi) ORIGINAL SOURCE:
(A) ORGANISM: Homo sapiens (xi) SEQUENCE DESCRIPTION: SEQ ID NO:ll:
AGCTTGCTGC CATTGCCCA l9 (2) INFORMATION FOR SEQ ID NO:12:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 22 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: cDNA
(iii) HYPOTHETICAL: NO
(iv) ANTI-SENSE: NO
(vi) ORIGINAL SOURCE:
(A) ORGANISM: Homo sapiens (xi) SEQUENCE DESCRIPTION: SEQ ID NO:12:

(2) INFORMATION FOR SEQ ID NO:13:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 13 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: peptide (iii) HYPOTHETICAL: NO
(iv~ ANTI-SENSE: NO
/v) FRAGMENT TYPE: internal ( Vl ) ORIGINAL SOURCE:
(A) ORGANISM: Homo sapiens (C) INDIVIDUAL ISOLATE: peptide from mutant arylsulfatase A

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:13:
Cys Ala Pro Leu Pro Ser Val Thr Leu Asp Gly Phe Asp l 5 lO

(2) INFORMATION FOR SEQ ID NO:14:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 30 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear W O 96/07098 2 ~ ~ 8 % 6 3 PCTtUS95tllll4 (ii) MOLECULE TYPE: cDNA
(iii) HYPOTHETICAL: NO
(iv) ANTI-SENSE: NO
(vi) ORIGINAL SOURCE:
(A) ORGANISM: Homo sapiens (xi) SEQUENCE DESCRIPTION: SEQ ID NO:ll:

Claims (39)

WHAT IS CLAIMED IS:
1. A method for identifying an individual who may be susceptible to alcoholism or to the pathological effects of alcohol comprising identifying whether an individual is homozygous, heterozygous, or normal for a pseudodeficiency (PD) mutation of the arylsulfatase A (ASA) gene, wherein homozygosity for the PD mutation of the ASA gene indicates that the individual may be susceptible to alcoholism or to the pathological effects of alcohol.
2. The method according to Claim 1, wherein the method of identifying an individual who is homozygous for a PD mutation comprises detecting a mutation in a residue 350 N-glycosylation site of ASA.
3. The method according to Claim 1, wherein the method of identifying an individual who is homozygous for a PD mutation comprises detecting a mutation in a polyadenylation signal sequence of at least one allele of ASA.
4. The method according to Claim 1, wherein the method of identifying an individual who is homozygous for a PD mutation comprises detecting a mutation in the residue 350 N-glycosylation site of ASA and detecting a mutation in the polyadenylation signal sequence of the allele of ASA.
5. The method according to Claim 2, wherein the mutation in the N-glycosylation site is detected by polymerase chain amplification (PCR) analysis.
6. The method according to Claim 5, wherein the PCR product of the mutant and normal N-glycosylation site can be differentiated by specific restriction endonucleases.
7. The method according to Claim 6, wherein the PCR analysis is performed by:
a) amplifying an approximately 211-base pair segment of genomic DNA with a 5' primer CACCCCAACCTTGATGGCGAACTGGGTGAC (SEQ ID NO:14), which is engineered to introduce a control Bsrl restriction endonuclease site, and a 3' primer AAGGATCTGGGATCAGGGGT (SEQ ID NO:10); and b) detecting the presence of a BsrI restriction endonuclease site in addition tothe control BsrI restriction endonuclease site;
wherein the BsrI endonuclease site is present in the PD mutant ASA allele.
8. The method according to Claim 6, wherein the PCR analysis is performed by:
a) amplifying an approximately 200-base pair segment of genomic DNA with a 5' primer TGATGGCGAACTGAGTGACT (SEQ ID NO:9) and a 3' primer AAGGATCTGGGATCAGGGGT (SEQ ID NO:10); and b) detecting the presence of a BsrI restriction endonuclease site;
wherein the BsrI endonuclease site is present in the PD mutant ASA allele.
9. The method according to Claim 5, wherein the PCR analysis is performed by amplifying a segment of genomic DNA containing the N-glycosylation site, and detecting hybridization of an oligonucleotide probe selected from the group consisting of AAGGTGACATTGGGCAGTGG (SEQ ID NO:5) and AAGGTGACACTGGGCAGTGG
(SEQ ID NO:6) to the amplified sequence, wherein hybridization of the former probe at 55°C with washing at 62°C is indicative of a normal ASA allele, and hybridization of the latter probe at 55°C with washing at 60°C is indicative of a PD allele.
10. The method according to Claim 5, wherein the PCR analysis is performed on DNA obtained from buccal cells.
11. The method according to Claim 5, wherein the mutation comprises substitution of guanine for adenine at nucleotide position 1049 of cDNA for ASA.
12. The method according to Claim 2, wherein the mutation in the N-glycosylationsite is detected by biochemical analysis.
13. The method according to Claim 12, wherein the biochemical analysis comprisesdetecting a difference in the relative electrophoretic mobility of an ASA protein from an individual possessing the mutant ASA enzyme as compared to a normal ASA protein.
14. The method according to Claim 2, wherein the mutation in the N-glycosylationsite is detected by immunochemical analysis.
15. The method according to Claim 14, wherein the immunochemical analysis comprises detecting binding of an antibody specific for an epitope containing residue 350 of ASA lacking an N-glycosylation site, wherein the antibody does not bind to normal ASA.
16. The method according to Claim 15, wherein the antibody is a monoclonal antibody.
17. The method according to Claim 15, wherein the antibody is generated against the peptide Ac-CAPLPSVTLDGFD-NH2 (SEQ ID NO:13).
18. The method according to Claim 3, wherein the mutation in the polyadenylationsignal sequence is detected by polymerase chain amplification (PCR) analysis.
19. The method according to Claim 18, wherein the PCR product of the mutant and normal polyadenylation signal sequence site can be differentiated by specific restriction endonucleases.
20. The method according to Claim 19, wherein the PCR analysis is performed by:
a) amplifying about an approximately 182-base pair segment of genomic DNA with a 5' primer AGCTTGCTGCCATTGCCCA (SEQ ID NO:11) and a 3' primer CATTACCCCAGGATTGGTCGAA (SEQ ID NO:12); and b) detecting the presence of two MaeIII restriction endonuclease sites;
wherein two MaeIII endonuclease sites are present in the PD mutant ASA allele.
21. The method according to Claim 19, wherein the PCR analysis is performed by amplifying a segment of genomic DNA containing the polyadenylation signal site, and detecting hybridization of an oligonucleotide probe selected from the group consisting of CTGGTGTTATTACGTTATC (SEQ ID NO:7) and CTGGTGTTACTACGTTATC (SEQ
ID NO:8) to the amplified sequence, wherein hybridization of the former probe at 48°C
with washing at 52°C is indicative of a normal ASA allele, and hybridization of the latter probe at 48°C with washing at 52°C is indicative of a PD allele.
22. The method according to Claim 19, wherein the PCR analysis is performed on DNA obtained from buccal cells.
23. The method according to Claim 19, wherein the mutation comprises substitution of guanine for adenine at nucleotide position 1620 of cDNA for ASA.
24. An antibody specific for an epitope containing residue 350 of ASA lacking an N-glycosylation site, wherein the antibody does not bind to normal ASA containing the N-glycosylation site.
25. The antibody of Claim 24, which antibody is a monoclonal antibody.
26. The antibody of Claim 24, wherein the antibody is generated against the peptide (SEQ ID NO:13).
27. A kit for identifying an individual who is susceptible to alcoholism comprising:
a) the antibody specific for an epitope containing residue 350 of ASA lacking the N-glycosylation site of Claim 24;
b) an antibody specific for all forms of ASA; and c) means for quantitating binding of the antibody specific for an epitope and the antibody specific for all forms of ASA to ASA in a sample from an individual.
28. A kit for identifying an individual who is susceptible to alcoholism comprising:
a) a 5' primer having the sequence (SEQ
ID NO:9) and a 3' primer having the sequence (SEQ ID NO:10);
b) a Bsrl restriction endonuclease;
c) a 5' primer having the sequence (SEQ ID
NO:11) and a 3' primer having the sequence (SEQ ID NO:12); and d) a MaeIII restriction endonuclease.
29. A kit for identifying an individual who is susceptible to alcoholism comprising:

a) a 5' primer having the sequence (SEQ ID NO:14) and a 3' primer having the sequence (SEQ ID NO:10);
b) a BsrI restriction endonuclease;
c) a 5' primer having the sequence (SEQ ID
NO:11) and a 3' primer having the sequence (SEQ ID NO:12); and d) a MaeIII restriction endonuclease.
30. A kit for identifying an individual who is susceptible to alcoholism comprising:
a) a 5' primer having the sequence (SEQ ID NO:14) and a 3' primer having the sequence (SEQ ID NO:10);
and b) a BsrI restriction endonuclease.
31. A kit for identifying an individual who is susceptible to alcoholism comprising:
a) a 5' primer having the sequence (SEQ
ID NO:9) and a 3' primer having the sequence (SEQ ID NO:10); and b) a BsrI restriction endonuclease.
32. A kit for identifying an individual who is susceptible to alcoholism comprising:
a) a 5' primer having the sequence (SEQ ID
NO:11) and a 3' primer having the sequence (SEQ ID NO: 12); and b) a MaeIII restriction endonuclease.
33. An oligonucleotide selected from the group consisting of (SEQ ID NO:9); (SEQ ID NO:10); (SEQ ID NO:11);
(SEQ ID NO:12); and (SEQ ID NO:14).
34. A method for identifying an individual carrying a pseudodeficiency (PD) mutation of an allele of an arylsulfatase A (ASA) gene, comprising detecting a mutation in a residue 350 N-glycosylation site of at least one allele of ASA by polymerase chain amplification (PCR) analysis, wherein the PCR product of the mutant and normal N-glycosylation site can be differentiated by specific restriction endonucleases.
35. The method according to Claim 34, wherein the PCR analysis is performed by:
a) amplifying an approximately 211-base pair segment of genomic DNA with a 5' primer CACCCCAACCTTGATGGCGAACTGGGTGAC (SEQ ID NO:14) and a 3' primer AAGGATCTGGGATCAGGGGT (SEQ ID NO:10); and b) detecting the presence of two BsrI restriction endonuclease sites;
wherein both BsrI endonuclease sites are present in the PD mutant ASA allele.
36. The method according to Claim 34, wherein the PCR analysis is performed by:
a) amplifying an approximately 200-base pair segment of genomic DNA with a 5' primer TGATGGCGAACTGAGTGACT (SEQ ID NO:9) and a 3' primer AAGGATCTGGGATCAGGGGT (SEQ ID NO:10); and b) detecting the presence of a BsrI restriction endonuclease site;
wherein the BsrI endonuclease site is present in the PD mutant ASA allele.
37. A method for identifying an individual carrying a pseudodeficiency (PD) mutation of an allele of an arylsulfatase A (ASA) gene, comprising detecting a mutation in a polyadenylation signal sequence of at least one allele of ASA by polymerase chain amplification (PCR) analysis, wherein the PCR product of the mutant and normal polyadenylation signal sequence can be differentiated by specific restriction endonucleases.
38. The method according to Claim 37, wherein the PCR analysis is performed by:
a) amplifying about an approximately 182-base pair segment of genomic DNA with a 5' primer AGCTTGCTGCCATTGCCCA (SEQ ID NO:11) and a 3' primer CATTACCCCAGGATTGGTCGAA (SEQ ID NO:12); and b) detecting the presence of two MaeIII restriction endonuclease sites;
wherein two MaeIII endonuclease sites are present in the PD mutant ASA allele.
39. A method for identifying an individual carrying a pseudodeficiency (PD) mutation of an allele of an arylsulfatase A (ASA) gene, comprising a) detecting a mutation in a residue 350 N-glycosylation site of at least one allele of ASA by polymerase chain amplification (PCR) analysis, wherein the PCR
product of the mutant and normal N-glycosylation site can be differentiated by specific restriction endonucleases; and b) detecting a mutation in a polyadenylation signal sequence of at least one allele of ASA by polymerase chain amplification (PCR) analysis, wherein the PCR
product of the mutant and normal polyadenylation signal sequence can be differentiated by specific restriction endonucleases.
CA 2198863 1994-08-31 1995-08-31 Marker for individuals susceptible to alcoholism Abandoned CA2198863A1 (en)

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
US08/299,187 US5736325A (en) 1994-08-31 1994-08-31 Marker for individuals susceptible to alcoholism
US08/299,187 1994-08-31
US130095P 1995-06-21 1995-06-21
US60/001,300 1995-06-21

Publications (1)

Publication Number Publication Date
CA2198863A1 true CA2198863A1 (en) 1996-03-07

Family

ID=26668828

Family Applications (1)

Application Number Title Priority Date Filing Date
CA 2198863 Abandoned CA2198863A1 (en) 1994-08-31 1995-08-31 Marker for individuals susceptible to alcoholism

Country Status (1)

Country Link
CA (1) CA2198863A1 (en)

Similar Documents

Publication Publication Date Title
Shah et al. Identification and analysis of mutations in the Wilson disease gene (ATP7B): population frequencies, genotype-phenotype correlation, and functional analyses
JP3265577B2 (en) Method for measuring type 4 isoform of apolipoprotein E
US8669351B2 (en) Antibodies to polypeptides encoded by aspartoacylase polynucleotides
JP2008086313A (en) Therapeutic and diagnostic application of perlecan domain i splicing variant
EP0396594A1 (en) Probes for and methods of diagnosis for muscular dystrophy
US20060003356A1 (en) Compositions and methods for the diagnosis and treatment of kidney disease
US7531314B2 (en) Therapeutic and diagnostic applications of perlecan domain I splice variants
US20060166264A1 (en) Effect of COMT genotype on frontal lobe function
JP2001514904A (en) Mutations in the connexin 26 gene involved in asymptomatic deafness before language acquisition and detection method
US20160177393A1 (en) Lafora's disease gene
WO1998008381A9 (en) Therapeutic and diagnostic applications of perlecan domain i splice variants
US7329497B2 (en) Gene causative of Rothmund-Thomson syndrome and its gene product
US20040053265A1 (en) Diagnostic and therapeutic use of a caveolae-associated integral membrane protein for alzheimer's disease and related neurodegenerative disorders
US5736325A (en) Marker for individuals susceptible to alcoholism
US5935790A (en) Method for detecting a predisposition to susceptibility to toxic effects of drugs and poisons
US5882868A (en) Method of diagnosing spinal muscular atrophy
CA2198863A1 (en) Marker for individuals susceptible to alcoholism
CA2226658A1 (en) Early onset alzheimer's disease gene and gene products
JP2008537486A (en) Human autism susceptibility genes encoding transmembrane proteins and uses thereof
US20050177881A1 (en) Methods of identifying genetic risk for and evaluating treatment of alzheimer's disease by determining single nucleotide polymorphisms
KR101866484B1 (en) OPA1 as a causative gene of optic atrophy or sensorimotor neuropathy and method for diagnosing the disease using the same
CA2501606A1 (en) Method for diagnosing renal diseases or predispositions
CA2528692C (en) Mutations in the slc40a1 gene associated to impaired iron homeostasis
KR20160036684A (en) DDX58 as A Causative Gene Responsible for Congenital Glaucoma, Hereditary Vascular Calcification or Skeletal Abnormalities and Diagnosis Method and Composition for the Disease

Legal Events

Date Code Title Description
EEER Examination request
FZDE Dead