CA2194350A1 - Purification of oligodeoxynucleotide phosphorothioates using deae 5pw anion ion-exchange chromatography and hydrophobic interaction chromatography - Google Patents
Purification of oligodeoxynucleotide phosphorothioates using deae 5pw anion ion-exchange chromatography and hydrophobic interaction chromatographyInfo
- Publication number
- CA2194350A1 CA2194350A1 CA 2194350 CA2194350A CA2194350A1 CA 2194350 A1 CA2194350 A1 CA 2194350A1 CA 2194350 CA2194350 CA 2194350 CA 2194350 A CA2194350 A CA 2194350A CA 2194350 A1 CA2194350 A1 CA 2194350A1
- Authority
- CA
- Canada
- Prior art keywords
- oligonucleotide
- dmt
- column
- phenyl
- deae
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Abandoned
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07H—SUGARS; DERIVATIVES THEREOF; NUCLEOSIDES; NUCLEOTIDES; NUCLEIC ACIDS
- C07H1/00—Processes for the preparation of sugar derivatives
- C07H1/06—Separation; Purification
Landscapes
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Engineering & Computer Science (AREA)
- Biochemistry (AREA)
- Biotechnology (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Molecular Biology (AREA)
- Saccharide Compounds (AREA)
Abstract
The present invention provides improved methods for separating and purifying oligonucleotide phosphorothioates. In certain aspects of the invention, oligonucleotide phosphorothioates are purified by a method comprising applying a mixture of the oligonucleotide to a column containing a DEAE-5PW anion ion-exchange chromatography resin and eluting with an elution buffer having a concentration of sodium chloride of from about 0-2M. In other aspects of the invention, oligonucleotide phosphorothioates are purified by a method comprising applying a mixture of the oligonucleotide to a column containing a phenyl-sepharose fast flow chromatography resin or a phenyl-5PW chromatography resin and eluting with an elution buffer substantially free of salts. The methods of the present invention provide the ability to purify ammoniacal solutions of oligonucleotides cheaply, quickly, and on a large, process scale.
Description
t ~ j O
O 96/01268 . ~ '( /a PURIFICATION OF OLIGODEOXYNIJCLEOTIDE PHOSPHOROTHIOATES
HYDROPHOBIC INTERACTION CHROMATOGRAPHY
~ACKGROUNn OF TH~ IIWEI~TION
5 Field of the lnvenrinn This invention relates to the field of purification of oligode~ yL~_lc~Lides, and in particular, the purification of oligodco~.ucle~,Lidc phoD~hJluLlliodlf s.
Dec~r~ption of the Prior Art The use of modified phosphate backbone oligodeoxynucleotides as antisense 10 oli~v...,clcvlides in the field of selective gene regulation for i' , purposes has received increasing attention over the }ast several years. There are numerous types of modified phosphate linkages, e.g., u~lllyl~ ' , phoD~,llo~ulllioate, laulidulc, that have been i..cu.~,ol~ d into antisense oli~ f s and studied.
E.g., Erickson and Izant (Eds.), Gene Regulation: Biology of Antisense RNA and DNA
15 (Raven Press, New York, 1992). Oligodeo~y,il,uuu,,l_otidc pho~hololllioat~, for example, have been found to inhibit ~ y virus (Agrawal et al., Proc. Narl.
Acad. Sci. Usa 8!;, 7079 (1988); Agrawal et al., Proc. Natl. Acad. Sci. USA 86, 7790 (1989); Agrawal et al., in Advanced Dr~lg Deliver~ Reviews 6, 251 (R. Juliano, Ed., Elsevier, A ~hl.l, 1991); Agrawal et al. in Prospects for Amisense Nucleic Acid 20 Thef-apy of Cancer and AlDS, 143 (E. Wickstrom, Ed., WileylLiss, New York, 1991); and Zamecnik and Agrawal in Annual Review of AIDS Research, 301 (Koff et al., Eds., Dekker, New York, 1991)), and influenza virus (Leiter et al., Proc. Natl. Acad. Sci. USA
87, 3420-3434 (1990)) in tissue culture. In addition, oli6~,dco~y.il,u -leotidei ' , ' uihioates have been the focus of a wide variety of basic research (e.g., Agrawal 25 et al., Proc. Natl. Acad. Sci. USA 87, 1401 (1990) and Eckstein and Gish, Trends Biochem. Sci. 14, 97 (1989)), enzyme inhibition studies (Mujumdar et al., Biocf~emistry 28, 1340 (1989)), regulation of oncogene expression (Reed et a]., Cancer Res. 50, fi565 (1990~) and IL-1 e~ Di~u (Manson et al., L~.. r.'~!f~;re Res. 9, 35 (1990)) in tissue culture.
Automated syllth~ have proven an invaluable tool for obtaining oliyo. ~If c~ - c Oligo ~ 1f ol;Af~s are produced stepwise, with the addition of one monomer at a time to the nascent olign ~ IP~.l;'l' chain. 2-3f~ of the reactions fail during each cycle in which a nucleotide monomer is to be added however. COnDC~l ly, the wos6/0126s 2 1 9 ~ 3 ~ . /a resulting products are generally a ' u~, . - mixture of oli~n~ oti~ of varying length. For example, in a typical 20mer synthesis, the 20mer product represents only 50-60% of the recovered oligJ '~ product.
~ i' c, I~l.tJ4l.~iiU.. of oligvdcvAy -lecti~lPc on a solid phase support 5 requires that the oligvdcoAy ' '- be cleaved from the support. Cleavage of the oligo from the support is typically accomplished by treating the solid phase with conc.,LIllaled nliu~ll hydroxide. The a~.lll.o hydroxide is cv..~. 71y removed under reduced pressure using, for example, a rotary .,~4lJu.4tOl . This method for removing the ammonium hydroxide, however, is not ideal for use in large scale isolation of 10 olig;)dcvAy '- " ' For most purposes ~e.g., th~ r~pell~ir or diagnostic) the purity of the ~ ,v~n~ is extremely important. Consc~ ly, there has been an interest in developing 4~.'dc i ' . for purifying olig.. koti~1~ s Because of their ~
potential, much of the focus has been on purifying olig~ P pL(,D~,l.b.u~hioates.
I5 Conventional methods for purifying oligodeu~y ~ Ps employ reverse-phaseliquid chromatography. Such methods require explosion-proof el . because acetonitrile is typically used in the elution buffer.
Methods of oligodeoxynucleotide phJD~holvLLiv~lle ~ r~ n have been published. Agrawal et al., J. Chroma~ograpky 509, 396 (I990), reported the analysis of 20 o1ic. lrv~ JLuD,uhulvLllio~t~D using high-p~,.ru.lll~-l.c liquid cL.~ a~hy with a reverse-phase column. In that study, Agrawal et al. converted the olig '-~ ' phoD~,h~,.ulL.o4t~ to its phoi, ' ~ ~41L and then carried vut HPLC analysis.
Using this method they were able to analyze nlignmlrlPoti~P !)hOD~hJ~ containing 10 or fewer ~-alid.,s on a strong anion-exchange column (P~IL;"~}.~.~; SAX column).
25 01il,.,.- 1~ol;-1~r' ,' uLhiu&t~Dhavingmorethanlo ' :' couldnotbeanalyzed, however, because of the strong interaction with the SAX medium.
Metelev and Agrawal, Anal. Biochem. 200, 342 (1992), reported the ion-exchange HPLC analysis of oligodeoxy-l jl .. .~ l, v~ r' . ' utLio.lt.,D on a weak anion-exchange column (Pa. ,' ~ WAX) in which the weak anion exchanger ntilizes a 30 di-~.~,.Lyl4~lhlv~u~yl functional group bonded to P4-liD~,hele silica. This medium, with an ion-exchange capacity of 0.l8 meqlg, exhibits an h..~,l4~1ioll with anions weaker than those observed with strong anion-exchange media. The authors of this study found that ~WO96/01268 21 ~ 50 r~ "
s~lJaldlioll was length dependent for oligu,. koti.~F phoD~JhuluLllhJdt~a up to 25 :id in length. ru.Lll~.l..u.~, n-l peaks were well separated from the parent peak.
They also found that 30-mer and 35-mer ~ r~ ulhiOat~,O were separable with the same gradient, although better separation could be obtained with a shallower 5 gradient.
Metelev et al., Ann. N.Y. Acad. Sci. 660, 321-323 (1992), reported the analysis of oli~,~,-il,, '- :' andchimericoligoribo-oli6ud~ y~ ro~ ,usingion-exchange HPLC. They found that the retention time of the oli~ s studied depended on the number of . il" '~otide moieties in the oligonucleotide . In addition, the retention time 10 of oligo.il o-lu-leotides was found to be length ~F ' . The authors noted that oliG~,Hl,ul-u~lc~,~idcs of length up to 25 r ~rl~oti~ C could be purified and analyzed.
Bigelow et al., J Chromarography 533, 131 (1900), reported the use of ion-pair HPLC to analyze nliG~ f oLide r~ . ' uLIliuat a. Stec. et al., J. Chromarography 326, 263 (1985), and Agrawal and 7.: ~ ' Nuclefc Acids Res. 19, 5419 (1990), reported15 HPLC analysis of oligodeo~ylil,o-lu"h,uLidcs ~ ;,.e one or two phoD~ o,uLllioàt~
of i~ linkages using a reversed-phase column.
These methods of olig. ' : h phoa~slJluLllioDle p. ~ use HPLC. While this technique is useful for small scale operations, it is unsuitable for large, cuu....~.~idl scale use. COua~ , improved methods of oli~u~u~lcoLidc IJ~-ir~dtion suitable for 20 use in large scale oliE,~ preparations is desirable.
~UMMARY OF T~F. ~NV~,NTION
The present invention provides improved methods for purifying oli odc~,Ay - ' . :- ' pl.oD~hu. vi' . In particular, the invention p}ovides p. ., i r;. -f ion suitable for large scale separation of oligonucleotide phoaf,holuLl.ioates~ The 25 ~n i r;, -~ ;nn methods of the invention do not require the use of reduced pressure to remove a.. .oniuul hydroxide or the use of conventional C-18 silica gel reverse-phase liquid clllullldtc~ld~S~y. The inventive methods replace these procedures with Lydll,' ,hic d~Lion cL., -~,ld~Ly or DEAE-5PW anion ion-exchange chromatography.
In one aspect of the present invention, the oligodeoAy . ~ D are purified using 30 hydluphOhiC t~ r~ tinn Chrulllàt(~ hy~ .UI hydroxide is used to cleave oligonuc-leotides from the solid support on which they were ayllLL~Di~ Typically, roto-SlleSTlTUTE SHEET (RULE 26) W0~6/01268 2 ~ q ~ 3 5 ~ P~I/L~
(.v~l~u~aliOII under reduced pressure has been used to remove most of the _hydroxide. This is then typically followed with reversed phase .,LI~ ~ a~hy to separate the DMT-on oliboll__lc.JLidcs from the DMT-off olig.~ I~o~ c~ These n ~ c, however, are unsuitable for large scale use. In this aspect of the invention, 5 hydlu~ obic h.t.la.~ ch.. O ph~ is used in place of roto-cvalJulaLio.l alone or both roto-evaporation and reversed phase cl~ ty. HIC is preferable to roto evaporation because it simplifies and acccll.ldt~,s ~1,.. ll.;ll.. hydroxide removal and can be used for large scale purification. If it is to be followed by RPLC, HIC increases the purity of the olig~l.,_clcvlide relative to roto-e~a~JolaLion, resulting in less potential for 10 fouling the RPLC column and reducing the purification challenge presented to the RPLC
column.
When used in place of roto-cval,or.ltion and RPLC, HIC provides the benefit of accomplishing two tasks (removal of A~ l hydroxide and separation of DMT-onoligos from DMT-off oligos) at once. S bstihltinn of RPLC with HIC also reduces the 15 resin cost, eliminates the need for organic solvents (which require more stringent handling, including special disposal, explosion-proof euvi., t, and ~vap(JIalivec~ ), provides for more rapid elimination of co..~ a~ (e.g., unreacted monomers and failure sequences), and increases ~hll ,h~ This increase in ~hlUI ~h~ ' is made possible by use of short columns and high linear velocities.
HIC also reduces both the expense (in terms of column packing and equipment) andpotential problems that can arise with HPLC, e.g., dirri~ul,;~ in pack.ing and mRirn.ining HPLC columns. Suitable HIC colurrms that can be used in the present invention include, but are not limited to, phenyl-sepharose fast flow (high ~ ' ) and TSK-gel phenyl-5PW.
JlL~ iLIo]y~ although HIC and DEAE-5PW cLIu~ LGolaplly are m~c~4nic~ir.4.11y quite different, they can be used h~ cllànO~,ably to serve the same purpose. They both can be used to purify DMT-off oligo- ~rl~oti~l~c~ although, as dCI~lOll~Llatud below, DEAE-5PW results in better yields when purifying 25mers. Olig. '-~tidc mixtures having purities of about 98~o can regularly be obtained using these LL I ~ , The use of DEAE-5PW column to purify DMT-off ol gc ~'-: ' , like HIC
columns, does not require HPLC and, therefore, offers the same advantages âS described SUBSTiTUTE SHEET (RULE 26) 2 1 '~ 4 3 f) O r~.,.,... /a '~
on a relatively short column, which increases lhl., h, . and eases packing, and requires simple step gradients for elution, which simplifies t~ c~hu~ ;5 and the chance for error.
In yet another aspect of the present invention, ion-e~change is ~rc~lmpli~h~d with ~ 5 a DEAE-5PW column. When oli ull.. ~ Wes intended for i' ~ ~ _ - use, it is essential that all allll~lOIliulll cations be replaced with, for example sodium cations. This can be accomplished with a Dowex cation ion exchange column followed by desalting with sephadex gel filtration. In this aspect of the invention, standard ion-exchange methods are replaced by the DEAE-SPW column. The resin is relatively cheap compared to the more 10 recently introduced anion ion-exchange styrene divinylbenzene polymer supports (e.g., PerSeptive Biosytems, Polymer Labs), yet is sturdy enough (in terms of particle size and resistance to currcntly used cleaning l"u~,c.ll".,s) for production use.
When the oligodeu~y.,u.,l~utides a}e purified using a DEAE-5PW resin, the eluategenerally has a very high salt ~ullu~l.L.~tion, rendering typical sephadex gel filtration 15 desalting inpractical or h."l,ci~iblc. [n place of sephadex gel filtration, other salt removal techniques, e.g., RPLC and tangential flow filtration (TFF), should be used. In the preferred ernho~l , the DEAE-5PW oli~,u..u~lcotidc mixture is desalted using tangential flow filtration.
The foregoing merely ~u~ a~ certain aspects of the present invention and is not 20 intended, nor should it be construed to limit the invention in any way.
All patents and publication cited in this ~l,ccir~ ,n are hereby iu~o.~,ul~.tud by reference in their entirety.
DFTAlT F.l) DE.CCRlPTION OF l'T~F INVFNTION
The present invention provides improved methods for purifying 25 oligodeoAy '- ' phc,~l,l.ulùLllioates Inparticular,theinventionprovides~,u,iri,,~Lju, ~r~ 1 r5 suitable for large scale separation of oli~u..ucl~otide r~ ' -,I.,tl.ioat,,s. The purification methods of the invention do not require the use of reduced pressure to remove Ulil,~lU hydroxide or the use of cu..~ .iul.~l C-18 silica gel reverse-phase liquid cLl~",latot.~,l,y. The inventive methods replace these plucclulcs with h.ydlu~ ic 30 interaction chromatography or DEAE-5PW anion ion-exchange chl~,,,latocl~t.y.
SUBSTITUTE ~HEET ~RULE 26) W0 96~01268 P~ l.,9!' /a 2~ 943~
Following solid phase synthesis, oligon ~l~oti~iPs are cleaved from the solid support by incubating the support in: hydroxide. Not only are the desired oligonucleo-tides cleaved from the support, but so too are failure seq~n~ 5, i.e., olj~ cleolidc sequences being fewer than the desired number of ~' ,lid~,s in length. Such failure 5 sequences arise from less than complete coupling of ~ .. h oC;~I~ s to the growing oligo. r~Ul;~ir chain and less than complete capping of unreacted functional sites. The desired oligonucleotide must be separated from failure sequences if it is to be used effectively for IL.la~ tic or other purposes.
Cu~ lh~ lly, the bulk of the ~ .. hydroxide is driven off by roto-10 e~ olatiull This is then followed by separating the desired DMT-on oligos (i.e., oligo l~leo~i~lf s having a 5' dimethoxytrityl protecting group) from undesired DMT-off oligos (i.e., olig. -'~fi~C not having a 5' protecting group) by reversed phase liquid ~Llulllaluola~Jlly~ The I~IT-on oligos, being more Lydlu,ullOlJ;c, bind to the reverse phase column more tightly than DMT-off oligos.
If the desired oligonllrlpoti~ll is to be used for Ll ~ purposes, any ,.. -cations complexed with the oliO~ 5~ ~Lide must be exchanged with, for example, sodium cations. This is generally accomplished by ion exchange chromatography followed by desalting using sephadex gel.
The present invention comprises improved methods for separating or purifying 20 oligomlrleoti~ pho~l,ho.u~hioates. As used herein, the terms "separatingN and"purifyingR are intended to be used h~ lldl~o-ably and mean a process by which oligu _t _" 1~ having a particular molecular structure are physically segregated from olig~ . c have a different molecular structure and by which .u.. ~.. ;..... hydroxide and/orothersaltsareremovedfromtheoliL...~ 1~oli~l~mixture. Inparticular,thepresent Z5 invention comprises the use of hydlu~ Ob;c h.t.,l~-,,i Chl~ o a~lly (HIC) and DEAE-5PW ion exchange l,Llulllatc~Ola~/lly to separate and purify oligonucleotide phJsl~huluiLioatu~
In a first: bodill,.,.,l of the present invention, the desired oliOu ~lrul;l1r is separated from excess amml hydroxide and prepared for treatment by reverse phase30 liquid cL.. -- -:u~ by subjecting the niig.,.. l~u~ containing ,.. ~ .... hydroxide solution to h~.llu~llobic interaction chromatography. Preferably, the EIIC comprises SURSTITUTE SHEET (RUL~ 26) W0 96/01268 J ~
. ~ 2~9'~5~
passing the oli~,u l-u~ containing ~u~uu~ ' hydroxide through a phenyl s~La.usc fast flow chr~,matogr~phy resin or a phemyl-5PW chromatography resin.
In a second e.l.bodi~ ..l of the present invention, the desired oli~c ~ is separated from excess a,ul.mlliu,.l hydroxide and DMT-off oligos by ~uh;cclil~,5 the ~ 5 olig. -'- ~ c~ aining . hydroxide solution to hydluullol;ic i,..u.~uliuu clllulllAlo~;ldph~. Preferably the HIC comprises passing the oligonculcotide-contAining a""..o"iu"- hydroxide through a phenyl-sepharose fast flow chromatography resin or a phenyl-SPW chromatography resin.
In a third ~l.lbodh.lcl.; of the present invention, ion exchange (wherein a~ uolliu-l-10 ions are eYrhangPd for sodium ions) and ~ iri~alioll are arComrlichpd with a DEAE-5PW
column. In this (..llbC ' it is found that salt . Alions of the eluant are generally too high for desalting with sephadex-gel, as is traditionally done after standard ~~tl i~gl.... I< ~llid~ ion-exchange is con~l ~t~ ~1 In this c...l,c " t, desalting is accomplished by any suitable technique capable of effectively handling high salt collc~llll~liu,.~.
15 Desalting is preferably conducted by tangential flow filtration (TFF). TFF provides the advantage of being able to a~co~ t~. and desalt large volumes of solutions having very high salt cùuc. ullAAliul~ (e.g., 2 M NaCI).
The invention also encoll",dsscs a process for preparing purified mixtures of olig~ l.~oti~Ps~ This aspect of the invention comprises:
(a) HIC to remove - .l.. :.. hydroxide and to remove oligos not having DMT
protecting groups;
(b~ detritylation to remove the DMT protecting groups;
(c) anion exchange on DEAE-5PW;
(d) tangential flow filtration; and (e) Iyophilization.
The methods of the invention may be used to purify crude mixtures COlllailli olig.,.- Iro~i~lr pho~,hu,ulhio~;~i, that have just been cleaved from a solid phase synlhesis support using Al~l~l..lll;..lll hydroxide or mixtures that have been previously subJected to a l,ulifiuaLioll procedure but that are not of acceptable purity.
We have found that oli~ull.,~lcolidc pho~Jllolulllioates can be purified on DEAE-5PW ion-exchange columns, phenyl-5PW and phenyl s ~ u~e columns using aqueous SUBSTITUTE SHEET (RULE 26) WOg6f01268 21 ~435~ r~
SPW results in effective separation of oli~u.. I uli<l< phor~ ulutl~iu~t~.D fromrl~n~ in high yields. The protocols presented herein can be employed in large scale purification of oligo~ lcvLide ph~l.lloLutl.ioates to replace the COll~
IUIU~,~a~JVldliUII and C~8 silica gel protocols required during the p,J. iri ~ n process. This S results in fewer steps in the II~AI' r~- u h~e process and allows for better purity and recovery of product.
According to the methods oF the present invention, oligonucleotide phoDI,hulu-thioates from about 10 to about 35, 1l ,"i.1. c in length can be separated on a DEAE-SPW
ion exchange column, a phenyl sepharose column or phenyl-5PW column. In a preferred 10 .,lllb- ~ ~, ol ;~ .. . rlr o~ pLu~f~hu~ùlllioates having a length of from about 20 to about 3'i and more preferably 25-30. can be separated using the present methods.
According to the invention, the olig~,. Ir "J _ separable by the present method may have as few as one ~nd as many as all ph- 1 ~ ollliùat~ eoli~lP linkages. As used herein, the term "oligonucleotide pho~ uluLllioate~ is used to describe such an 15 oligonucleotide. Oligonucleotide pho~haln~l;(l.i(. ~, of the same size as theoligu ' :' phosphorothioates described can also be separated by the inventive methods .
The oli~o., r 1~ c are placed on the column and eluted at or near ambient (room)t~ f/~,~alul~i with either a gradient or a non-gradient buffer. For purificationlpreparation of ammoniacal solutions by HIC, A.l.l.l.~l.;.. acetate is used in - . IihrAlion buffers at cv~lc~ t~a~ions ranging from about 0.5 to about 2.0 M, preferably 0.75 M. Although addition of A~...._ ~I~;IIn~ acetate may reduce the pH somewhat, the pH should typically be high to minimize the loss of the trityl group. pH values of 7.5 - ll.0 have been used s~ ~ceccfi-lly. A typical value of 10.0 is preferred since this more alkaline pH minimizes 25 loss of the trityl group from the olitJI~ Ir vl ;~1 . Elution is most effectively ~ Ch~d with water, although other schemes employing buffers may prove useful in particular Aprlir~firn~ Organic solvents are not required for separation, although their inclusion may be desirable when preparing oligon~r!P<!til1f~s by HIC for ~b~ ..1 RPLC
separation. While taller columns can be used (see the height diameter ratios in the 30 Examples, infra), shorter columns work very well and are preferred for large-scale work.
Colurnn loads can go as high as 650 OD unitslml packing, depending on elution conditions SUBSTITUTE SHEET (RULE 26) W0 96~01268 1~ l /a ~ ) 5 0 and column geometry. Preferably the column load is about 200 OD units/ml packing.
Linear velocities can range as high as 300 cm/hr, but are preferably about 150 cm/hr.
When HIC is used to purify DMT-off oliL.... lrori~ , a variety of buffers can beused at a pH ranging from about 7.2 to about 8.5. In the preferred c..lbr '- Tris-HCI
5 is used at a pH of about 7.5. Salts such as sodium chloride must be added to the load and to the equilibration and wash buffers in concentrations rapging from about 1 M to about 3 M, preferably about 3 M. Elution is Prcn~plich~d by either linear or step gradients via salt reduction. Phenyl sepharose columns are preferably loaded at high flow rates. Rates exceeding about 250 cm/hr are found to work eYrel~ingly well. Elution at a rate of about 10 150-200 cmlhr is desirable.
When DEAE-SPW is used to purify DMT-off oli~;~ '- lc , buffers such as Tris-HCI (preferably in a ~ - dLiu.l of about 10 to about 50 mM) are to be used. Salts such as sodium chloride are used for equilibration and elution. Preferably, sodium chloride gradients of 0 to 2 M are used. For shorter columns a range of sodium chloride 15 collcl .1 between 0.85 and 2 M are preferred. The pH of the oligi ' ' solution that is loadel may be between about 7.0 and about 10.5~ preferably about 7.2. The pH of eq~ilihr~tion, wash and elution buffers can range from about 7.2 to about 8.5, and is preferably about 7.2. Chelating agents such as 1 mM EDTA and organic solvents such as acetonitrile or ethanol can be added to the buffers in some applications. While linear 20 gradients can be run, excellent reco~eries and purities are obtained using simple step gradients. In many cases, better recoveries can be obtained using step gradients -- linear gradients appear to cause a slow "bleed-off" of bound product from the column that often works against effective sepa~ation and high recovery. While taller columns can be used, relatively short columns provide excellent results and are preferable for large-scale work.
25 Column capacity for olig ~'~ ' is somewhat lower that that seen for the HIC resins, with optimum column loads ranging up to about 200 OD units/ml resin, preferably about - 150 OD units/ml packing. Optimum linear velocities range between about 50 and about 150 cm/hr and are preferably about 70 cm/hr.
Column geometry has a cigniFi~ rt effect on the l,, tuil.,.l..,ut~ for equilibration 3û buffer salt condiliuns -- taller columns (larger height:diameter ratio) require higher salt as compared to shorter columns (lower height:diameter ratio). When a mixture of SUSSTITUTE S! IEET ~RULE 26) W096/01268 .~,IIU~
2' ~'~3~0 the rel~r~ hir between the column height:diameter ratio and sodium chloride c~ . ~ . . ,.1;.... is relevant to product yield. As the I - i~,' di~ ~t~,l ratio of the DEAE-5PW
columm is increased, the sodium chloridc ~ ~ion of the eq~ilihr:ltinn buffer should preferably be increased to obtain a greater recovery of purified product.
The separation method of the present invention is essentially i, l ~ . a of column particle size. Sizes ranging from 25 to 90 ~m can be used s~l~~cescfnlly. In preferred emhorii~nt~, the particle size is 25 ~m - 40 llm or 45 llm - 165 ~m. A particularly preferred hylllvpllobh, interaction chromatography resin has a particle size of about 90 llm.
One skilled in the art will recognize that ~ ~lifir~inns may be made in the present invention without deviating from the spirit or scope of the invention. The invention is illustrated further by the following examples which are not to be construed as limiting the invention or scope of the specific p-v.c.lu-~,s described herein.
EXAMPLES
In each of the following Examples, equipment and materials were obtained as indicated from Tosollaas (Mv..l~ ville, PA). Amicon (Beverly, MA) Waters (Milford, MA), Hewlett-Packard (HP) (Palo Alto, CA), Perkin-Elmer (Norwalk, CT~,ISCO (I.incoln NB), Rainin (Woburn, MA), Filtron (Nollihl,(,.~ ll, MA), Pharmacia (Piscll~dw~y, NJ). and Biorad (Hercules, CA).
1~. '~ 1 Purification witi2 DEAE-SPW
A 25-mer oligonucleotide having the sequence CTCTCGCACCCATCTCTCTCCTTCT ~GEM 91) was purified using a 0.51 column of 30 ~um TSK DEAE SPW (~vll....~l.,i~lly available from TosoHaas). ï'he resin was pacl~ed 25 into a Pharmacia 5.0 cm diameter glass colurnn. Purification was monitored using an ISCO UA-5 detector equipped with a 254 nm filter and a Rainin rabbit pump.
Two sources of GEM 91 were used in this e~ample:
(1) GEM 91 fractions from a Sephadex G-15 column, subsr ~ '~/ desalted and ~,oncc~ .tcd on Filtron tangential flow filtration (TFF) ~ al~s prior to cl.. , 'b~'llJ~I~Y;
SUBSTITUTE Sl EET (RULE 26) WO 96/01268 ~ I /a 21 ~35~
(2) two lots of Iyophilized GEM 91 powder: one having low ion exchange-HPLC
purity, the other having low CGE (capillary gel elc~ u~,ho.~i.is) purity.
The GEM 91 olib~ was loaded onto the column aL 150 A76~ O~D~ (optica]
density) units/ml packing~
25 mM Tris-HCI, pH 7.2 room t~ cldlult having from 0.85 to 1.0 M NaCI was used as the buffer with, in some t~ liUI.,I..~ mM EDTA~ Elution was p~lrullllcd with 25 mM Tris-HCI, pH 7~2 (RT) containing 2 M NaCI and, in certain ~ .Hlll~,l,L~, 1 mM
EDTA~ The column was washed with 6 column volumes (4 column volumes in run no~ 4) of the appropriate equilibration buffer after application of sample~ Fractions were 10 collected, O~D~ recoveries rlPtl-rmil~rrl and aliquots analyzed for purity by ion exchange HPLC (IEX) and, in some cases, by CGE analysis~
ln addition, to runs done on the 0~5 I column, three e~ ,.hl.t.ll~ were done at a 9 ml column-scale in order to evaluate the effect of column collri~sulalioll on p.~l rol.~ ce Results are shown in Table I Percent purity was analyzed by ion exchange (IEX) HPLC (% purity = % of phc,~l o-ull.ioate, including N and N-1 sequences); CGE data is also presented for run #5 (% purity = % of N oligonucleotide, including both pho~pl.o.ù~l~io~ and ph~ ~p~o~ ster oligos)~
Three ~ i" ~ - ~ were conducted on a 9 ml (2.2 cm diam~ x 2.4 cm ht ) column The results are shown in Table 2~
The results rh.n~m 11~ that crude olig~ -I-.t ' can be purified with DEAE
5PW with high purity and excellent yield~
SUBSTITUTE SHEET (RULE 26 WOg6~01268 2 ~ r:~ 12 Table 1 Pllrifi~fi pool Run % recovery% purity% recovery No. Conditions O.D. I product~
1 ~411: 0.85M NaCI + EDTA 54.1 99.6 59.7 15~: 90% IEX purity3 2 ~lU: 1.0M NaCI/+ EDTA 85.8 98.6 94.0 l~ai: 89~o IEX purity 3 _41U: l.OM NaCI 86.0 99.2 96.2 lQla 89 % IEX purity 4 _41U: l.OM NaCI 58.7 98.0 64.7 ~lai: 89% IEX purity ~4lU: l.OM NaCl 87.0 97.8 84.94 Llal: 89% IEX purity, 77% CE 84.7 purity on retests 6 ~4lU: 1.0M NaCI 78.3 98.2 90.1 15laLl: 877~o IEX purity on retest 7 e~uil: 1.0M NaCI 78.7 98.6 89.3 1~1: 87% IEX purity on retest 8 _41U: 1.0M NaCI 83.5 98.4 93.4 ll~i: 88~o IEX purity on retest ' percent recovery based on total O.D. (optional density) units initially loaded on column.
2 percent recovery of product in terms of "purity units" initially loaded on column.
3 IEX purity units = (total O.D. units) x ~percent purity by IEX-HPLC analysis); CEi 15 purity units = (total O.D. units) x (percent purity by CE analysis). CE purity units indicate the recovery efflciency of the column.
4 based on CE data.
SUBSTITUTE SHEET (RULE 2 WO9~i/01268 ~ ~ 9 '11 3 ~ ~ r ~ /a Table 2 Purified Pool percent [NaCI] irl recovery Y0 recovery % purity (IEX- % recovery of equil. buffer O.D. ~total~ O.D. HPLC) product 90.85 M 109.0 87.0 97.0 94.0 100.85 M 101.0 80.0 97.0 86.0 111.0 M 113.0 67.0 99.0 73.0 r ~-2 Purificafion by HydropholJic Inreraction Chromatography A GEM 91 sample was subjected to hydrophobic interaction ~hl. .~ phy. This sample had the composition shown in Table 3.
Table 3 percent percent PO oli~ulluclcuLides by CGE analysis DMT-on n n- ] n-2 n-3 62 0.4 55.2 11.4 2.8 3.5 This olign~ Poti~P was purified on Phenyl-sepharose fast flow (high sllhslitl-tinn~ using an Amicon 2.2 cm glass column, a Waters 650 solvent delivery system, an HP integrator, 15 a Rainin Dynama~ UV-C absulballue detector and a Perkin-Elmer s~ lu~hui : .
Theresinwaspackedintooneoftwocolumncù--riL,.--,'iu~~c ahPigh~ pterratio of 2.2:1 or 2.5:1.
The following elution protocols were employed:
(A) the sample load was adjusted to 1.7 M .IUIIIIU ' acetate, pH 10.7; the 20 column was equilibrated and washed with 2.5 M ~l...,.ù~ ... acetate; sample was eluted using 0.1 M acetate, pH 8.5, followed by water;
(B~ the sample load was adjusted to 1.0 M ammonium acetate, pH 10.7; the column was equilibrated and washed with 1.0 M i~ acetate, pH 8.5; the sample was eluted with water;
SUBSTITUTE SHEEI ~RULE 26) WO96101268 21 ~35~
(C) the sample load was adjusted to 1.0 M .,, ~'~'!';""' aceLate, pH 10.7; the column was equilibrated and washed with 1.0 M: acetate, pH 8.S; the sample was eluted using 0.01 M NaOH, pH 11.5, followed by water;
(D) the sample load was adjusted to 0.75 M .tllllllOlliUIII acetate pH, 11.0: the S column was e.~ aL~d and washed with 0.75 M: acetate, pH 8.5; the sample was eluted using 0.01 N NaOH, pH 11.5, followed by water.
Ali4uots of wash and elution fractions were analyzed by ;on exchange and reversephase (RP) HPLC. The results are shown in Table 4.
Table 4 10 Sample Height: Load' Velocity Elution Percent Percent recovery Elution diameter (cm/hr)2 protocol recovery OD3 product4 purity5 ratio Elution Total Elution Total 2.2:1 252 316 A 53.3 99.2 64.0 86.4 97.8 2 2.2:1 252 316 B 66.1 101.7 96.0 102.0 80.5 3 2.2:1 252316/158 C 50.9 98.8 80.8 93.8 88.0 4 2.5:1 2003161158 C 55.8 100.8 80.5 85.7 89.8 2.5:1 200316/158 C 62.7 99.2 84.8 91.1 83.8 6 2.5:1 200316/158 C 63.9 100.0 79.7 88.2 77.3 7 2.5:1 200316/158 D 59.1 98.3 82.3 86.3 86.3 8 2.5:1 1783161158 D 66.1 95.3 83.9 85.9 87.7 9 2.5:1 1783161158 D 57.9 89.8 76.6 80.1 91.1 20 ' Total OD units loaded/ml packing.
2 Samples 3-9 were loaded at 316 cm/hr and eluted at 158 cm/hour.
3 % Recovery OD = % recovery of oligon-lcl~oo~ s loaded on column Elution = % recovery in elution pool Total = % recovery in all f}actions 25 4 ~a Recovery product = % recovery of "DMT-on' product loaded on column Elution = % recovery "DMT-on" product in elution pool Total = % recovery ~DMT-on" product in ull fractions SUBSTITUTE SHEET (RUL~ 26) WO96/01268 2 l ~ ~ ~ 5 0 r~L~ 11 .
O 96/01268 . ~ '( /a PURIFICATION OF OLIGODEOXYNIJCLEOTIDE PHOSPHOROTHIOATES
HYDROPHOBIC INTERACTION CHROMATOGRAPHY
~ACKGROUNn OF TH~ IIWEI~TION
5 Field of the lnvenrinn This invention relates to the field of purification of oligode~ yL~_lc~Lides, and in particular, the purification of oligodco~.ucle~,Lidc phoD~hJluLlliodlf s.
Dec~r~ption of the Prior Art The use of modified phosphate backbone oligodeoxynucleotides as antisense 10 oli~v...,clcvlides in the field of selective gene regulation for i' , purposes has received increasing attention over the }ast several years. There are numerous types of modified phosphate linkages, e.g., u~lllyl~ ' , phoD~,llo~ulllioate, laulidulc, that have been i..cu.~,ol~ d into antisense oli~ f s and studied.
E.g., Erickson and Izant (Eds.), Gene Regulation: Biology of Antisense RNA and DNA
15 (Raven Press, New York, 1992). Oligodeo~y,il,uuu,,l_otidc pho~hololllioat~, for example, have been found to inhibit ~ y virus (Agrawal et al., Proc. Narl.
Acad. Sci. Usa 8!;, 7079 (1988); Agrawal et al., Proc. Natl. Acad. Sci. USA 86, 7790 (1989); Agrawal et al., in Advanced Dr~lg Deliver~ Reviews 6, 251 (R. Juliano, Ed., Elsevier, A ~hl.l, 1991); Agrawal et al. in Prospects for Amisense Nucleic Acid 20 Thef-apy of Cancer and AlDS, 143 (E. Wickstrom, Ed., WileylLiss, New York, 1991); and Zamecnik and Agrawal in Annual Review of AIDS Research, 301 (Koff et al., Eds., Dekker, New York, 1991)), and influenza virus (Leiter et al., Proc. Natl. Acad. Sci. USA
87, 3420-3434 (1990)) in tissue culture. In addition, oli6~,dco~y.il,u -leotidei ' , ' uihioates have been the focus of a wide variety of basic research (e.g., Agrawal 25 et al., Proc. Natl. Acad. Sci. USA 87, 1401 (1990) and Eckstein and Gish, Trends Biochem. Sci. 14, 97 (1989)), enzyme inhibition studies (Mujumdar et al., Biocf~emistry 28, 1340 (1989)), regulation of oncogene expression (Reed et a]., Cancer Res. 50, fi565 (1990~) and IL-1 e~ Di~u (Manson et al., L~.. r.'~!f~;re Res. 9, 35 (1990)) in tissue culture.
Automated syllth~ have proven an invaluable tool for obtaining oliyo. ~If c~ - c Oligo ~ 1f ol;Af~s are produced stepwise, with the addition of one monomer at a time to the nascent olign ~ IP~.l;'l' chain. 2-3f~ of the reactions fail during each cycle in which a nucleotide monomer is to be added however. COnDC~l ly, the wos6/0126s 2 1 9 ~ 3 ~ . /a resulting products are generally a ' u~, . - mixture of oli~n~ oti~ of varying length. For example, in a typical 20mer synthesis, the 20mer product represents only 50-60% of the recovered oligJ '~ product.
~ i' c, I~l.tJ4l.~iiU.. of oligvdcvAy -lecti~lPc on a solid phase support 5 requires that the oligvdcoAy ' '- be cleaved from the support. Cleavage of the oligo from the support is typically accomplished by treating the solid phase with conc.,LIllaled nliu~ll hydroxide. The a~.lll.o hydroxide is cv..~. 71y removed under reduced pressure using, for example, a rotary .,~4lJu.4tOl . This method for removing the ammonium hydroxide, however, is not ideal for use in large scale isolation of 10 olig;)dcvAy '- " ' For most purposes ~e.g., th~ r~pell~ir or diagnostic) the purity of the ~ ,v~n~ is extremely important. Consc~ ly, there has been an interest in developing 4~.'dc i ' . for purifying olig.. koti~1~ s Because of their ~
potential, much of the focus has been on purifying olig~ P pL(,D~,l.b.u~hioates.
I5 Conventional methods for purifying oligodeu~y ~ Ps employ reverse-phaseliquid chromatography. Such methods require explosion-proof el . because acetonitrile is typically used in the elution buffer.
Methods of oligodeoxynucleotide phJD~holvLLiv~lle ~ r~ n have been published. Agrawal et al., J. Chroma~ograpky 509, 396 (I990), reported the analysis of 20 o1ic. lrv~ JLuD,uhulvLllio~t~D using high-p~,.ru.lll~-l.c liquid cL.~ a~hy with a reverse-phase column. In that study, Agrawal et al. converted the olig '-~ ' phoD~,h~,.ulL.o4t~ to its phoi, ' ~ ~41L and then carried vut HPLC analysis.
Using this method they were able to analyze nlignmlrlPoti~P !)hOD~hJ~ containing 10 or fewer ~-alid.,s on a strong anion-exchange column (P~IL;"~}.~.~; SAX column).
25 01il,.,.- 1~ol;-1~r' ,' uLhiu&t~Dhavingmorethanlo ' :' couldnotbeanalyzed, however, because of the strong interaction with the SAX medium.
Metelev and Agrawal, Anal. Biochem. 200, 342 (1992), reported the ion-exchange HPLC analysis of oligodeoxy-l jl .. .~ l, v~ r' . ' utLio.lt.,D on a weak anion-exchange column (Pa. ,' ~ WAX) in which the weak anion exchanger ntilizes a 30 di-~.~,.Lyl4~lhlv~u~yl functional group bonded to P4-liD~,hele silica. This medium, with an ion-exchange capacity of 0.l8 meqlg, exhibits an h..~,l4~1ioll with anions weaker than those observed with strong anion-exchange media. The authors of this study found that ~WO96/01268 21 ~ 50 r~ "
s~lJaldlioll was length dependent for oligu,. koti.~F phoD~JhuluLllhJdt~a up to 25 :id in length. ru.Lll~.l..u.~, n-l peaks were well separated from the parent peak.
They also found that 30-mer and 35-mer ~ r~ ulhiOat~,O were separable with the same gradient, although better separation could be obtained with a shallower 5 gradient.
Metelev et al., Ann. N.Y. Acad. Sci. 660, 321-323 (1992), reported the analysis of oli~,~,-il,, '- :' andchimericoligoribo-oli6ud~ y~ ro~ ,usingion-exchange HPLC. They found that the retention time of the oli~ s studied depended on the number of . il" '~otide moieties in the oligonucleotide . In addition, the retention time 10 of oligo.il o-lu-leotides was found to be length ~F ' . The authors noted that oliG~,Hl,ul-u~lc~,~idcs of length up to 25 r ~rl~oti~ C could be purified and analyzed.
Bigelow et al., J Chromarography 533, 131 (1900), reported the use of ion-pair HPLC to analyze nliG~ f oLide r~ . ' uLIliuat a. Stec. et al., J. Chromarography 326, 263 (1985), and Agrawal and 7.: ~ ' Nuclefc Acids Res. 19, 5419 (1990), reported15 HPLC analysis of oligodeo~ylil,o-lu"h,uLidcs ~ ;,.e one or two phoD~ o,uLllioàt~
of i~ linkages using a reversed-phase column.
These methods of olig. ' : h phoa~slJluLllioDle p. ~ use HPLC. While this technique is useful for small scale operations, it is unsuitable for large, cuu....~.~idl scale use. COua~ , improved methods of oli~u~u~lcoLidc IJ~-ir~dtion suitable for 20 use in large scale oliE,~ preparations is desirable.
~UMMARY OF T~F. ~NV~,NTION
The present invention provides improved methods for purifying oli odc~,Ay - ' . :- ' pl.oD~hu. vi' . In particular, the invention p}ovides p. ., i r;. -f ion suitable for large scale separation of oligonucleotide phoaf,holuLl.ioates~ The 25 ~n i r;, -~ ;nn methods of the invention do not require the use of reduced pressure to remove a.. .oniuul hydroxide or the use of conventional C-18 silica gel reverse-phase liquid clllullldtc~ld~S~y. The inventive methods replace these procedures with Lydll,' ,hic d~Lion cL., -~,ld~Ly or DEAE-5PW anion ion-exchange chromatography.
In one aspect of the present invention, the oligodeoAy . ~ D are purified using 30 hydluphOhiC t~ r~ tinn Chrulllàt(~ hy~ .UI hydroxide is used to cleave oligonuc-leotides from the solid support on which they were ayllLL~Di~ Typically, roto-SlleSTlTUTE SHEET (RULE 26) W0~6/01268 2 ~ q ~ 3 5 ~ P~I/L~
(.v~l~u~aliOII under reduced pressure has been used to remove most of the _hydroxide. This is then typically followed with reversed phase .,LI~ ~ a~hy to separate the DMT-on oliboll__lc.JLidcs from the DMT-off olig.~ I~o~ c~ These n ~ c, however, are unsuitable for large scale use. In this aspect of the invention, 5 hydlu~ obic h.t.la.~ ch.. O ph~ is used in place of roto-cvalJulaLio.l alone or both roto-evaporation and reversed phase cl~ ty. HIC is preferable to roto evaporation because it simplifies and acccll.ldt~,s ~1,.. ll.;ll.. hydroxide removal and can be used for large scale purification. If it is to be followed by RPLC, HIC increases the purity of the olig~l.,_clcvlide relative to roto-e~a~JolaLion, resulting in less potential for 10 fouling the RPLC column and reducing the purification challenge presented to the RPLC
column.
When used in place of roto-cval,or.ltion and RPLC, HIC provides the benefit of accomplishing two tasks (removal of A~ l hydroxide and separation of DMT-onoligos from DMT-off oligos) at once. S bstihltinn of RPLC with HIC also reduces the 15 resin cost, eliminates the need for organic solvents (which require more stringent handling, including special disposal, explosion-proof euvi., t, and ~vap(JIalivec~ ), provides for more rapid elimination of co..~ a~ (e.g., unreacted monomers and failure sequences), and increases ~hll ,h~ This increase in ~hlUI ~h~ ' is made possible by use of short columns and high linear velocities.
HIC also reduces both the expense (in terms of column packing and equipment) andpotential problems that can arise with HPLC, e.g., dirri~ul,;~ in pack.ing and mRirn.ining HPLC columns. Suitable HIC colurrms that can be used in the present invention include, but are not limited to, phenyl-sepharose fast flow (high ~ ' ) and TSK-gel phenyl-5PW.
JlL~ iLIo]y~ although HIC and DEAE-5PW cLIu~ LGolaplly are m~c~4nic~ir.4.11y quite different, they can be used h~ cllànO~,ably to serve the same purpose. They both can be used to purify DMT-off oligo- ~rl~oti~l~c~ although, as dCI~lOll~Llatud below, DEAE-5PW results in better yields when purifying 25mers. Olig. '-~tidc mixtures having purities of about 98~o can regularly be obtained using these LL I ~ , The use of DEAE-5PW column to purify DMT-off ol gc ~'-: ' , like HIC
columns, does not require HPLC and, therefore, offers the same advantages âS described SUBSTiTUTE SHEET (RULE 26) 2 1 '~ 4 3 f) O r~.,.,... /a '~
on a relatively short column, which increases lhl., h, . and eases packing, and requires simple step gradients for elution, which simplifies t~ c~hu~ ;5 and the chance for error.
In yet another aspect of the present invention, ion-e~change is ~rc~lmpli~h~d with ~ 5 a DEAE-5PW column. When oli ull.. ~ Wes intended for i' ~ ~ _ - use, it is essential that all allll~lOIliulll cations be replaced with, for example sodium cations. This can be accomplished with a Dowex cation ion exchange column followed by desalting with sephadex gel filtration. In this aspect of the invention, standard ion-exchange methods are replaced by the DEAE-SPW column. The resin is relatively cheap compared to the more 10 recently introduced anion ion-exchange styrene divinylbenzene polymer supports (e.g., PerSeptive Biosytems, Polymer Labs), yet is sturdy enough (in terms of particle size and resistance to currcntly used cleaning l"u~,c.ll".,s) for production use.
When the oligodeu~y.,u.,l~utides a}e purified using a DEAE-5PW resin, the eluategenerally has a very high salt ~ullu~l.L.~tion, rendering typical sephadex gel filtration 15 desalting inpractical or h."l,ci~iblc. [n place of sephadex gel filtration, other salt removal techniques, e.g., RPLC and tangential flow filtration (TFF), should be used. In the preferred ernho~l , the DEAE-5PW oli~,u..u~lcotidc mixture is desalted using tangential flow filtration.
The foregoing merely ~u~ a~ certain aspects of the present invention and is not 20 intended, nor should it be construed to limit the invention in any way.
All patents and publication cited in this ~l,ccir~ ,n are hereby iu~o.~,ul~.tud by reference in their entirety.
DFTAlT F.l) DE.CCRlPTION OF l'T~F INVFNTION
The present invention provides improved methods for purifying 25 oligodeoAy '- ' phc,~l,l.ulùLllioates Inparticular,theinventionprovides~,u,iri,,~Lju, ~r~ 1 r5 suitable for large scale separation of oli~u..ucl~otide r~ ' -,I.,tl.ioat,,s. The purification methods of the invention do not require the use of reduced pressure to remove Ulil,~lU hydroxide or the use of cu..~ .iul.~l C-18 silica gel reverse-phase liquid cLl~",latot.~,l,y. The inventive methods replace these plucclulcs with h.ydlu~ ic 30 interaction chromatography or DEAE-5PW anion ion-exchange chl~,,,latocl~t.y.
SUBSTITUTE ~HEET ~RULE 26) W0 96~01268 P~ l.,9!' /a 2~ 943~
Following solid phase synthesis, oligon ~l~oti~iPs are cleaved from the solid support by incubating the support in: hydroxide. Not only are the desired oligonucleo-tides cleaved from the support, but so too are failure seq~n~ 5, i.e., olj~ cleolidc sequences being fewer than the desired number of ~' ,lid~,s in length. Such failure 5 sequences arise from less than complete coupling of ~ .. h oC;~I~ s to the growing oligo. r~Ul;~ir chain and less than complete capping of unreacted functional sites. The desired oligonucleotide must be separated from failure sequences if it is to be used effectively for IL.la~ tic or other purposes.
Cu~ lh~ lly, the bulk of the ~ .. hydroxide is driven off by roto-10 e~ olatiull This is then followed by separating the desired DMT-on oligos (i.e., oligo l~leo~i~lf s having a 5' dimethoxytrityl protecting group) from undesired DMT-off oligos (i.e., olig. -'~fi~C not having a 5' protecting group) by reversed phase liquid ~Llulllaluola~Jlly~ The I~IT-on oligos, being more Lydlu,ullOlJ;c, bind to the reverse phase column more tightly than DMT-off oligos.
If the desired oligonllrlpoti~ll is to be used for Ll ~ purposes, any ,.. -cations complexed with the oliO~ 5~ ~Lide must be exchanged with, for example, sodium cations. This is generally accomplished by ion exchange chromatography followed by desalting using sephadex gel.
The present invention comprises improved methods for separating or purifying 20 oligomlrleoti~ pho~l,ho.u~hioates. As used herein, the terms "separatingN and"purifyingR are intended to be used h~ lldl~o-ably and mean a process by which oligu _t _" 1~ having a particular molecular structure are physically segregated from olig~ . c have a different molecular structure and by which .u.. ~.. ;..... hydroxide and/orothersaltsareremovedfromtheoliL...~ 1~oli~l~mixture. Inparticular,thepresent Z5 invention comprises the use of hydlu~ Ob;c h.t.,l~-,,i Chl~ o a~lly (HIC) and DEAE-5PW ion exchange l,Llulllatc~Ola~/lly to separate and purify oligonucleotide phJsl~huluiLioatu~
In a first: bodill,.,.,l of the present invention, the desired oliOu ~lrul;l1r is separated from excess amml hydroxide and prepared for treatment by reverse phase30 liquid cL.. -- -:u~ by subjecting the niig.,.. l~u~ containing ,.. ~ .... hydroxide solution to h~.llu~llobic interaction chromatography. Preferably, the EIIC comprises SURSTITUTE SHEET (RUL~ 26) W0 96/01268 J ~
. ~ 2~9'~5~
passing the oli~,u l-u~ containing ~u~uu~ ' hydroxide through a phenyl s~La.usc fast flow chr~,matogr~phy resin or a phemyl-5PW chromatography resin.
In a second e.l.bodi~ ..l of the present invention, the desired oli~c ~ is separated from excess a,ul.mlliu,.l hydroxide and DMT-off oligos by ~uh;cclil~,5 the ~ 5 olig. -'- ~ c~ aining . hydroxide solution to hydluullol;ic i,..u.~uliuu clllulllAlo~;ldph~. Preferably the HIC comprises passing the oligonculcotide-contAining a""..o"iu"- hydroxide through a phenyl-sepharose fast flow chromatography resin or a phenyl-SPW chromatography resin.
In a third ~l.lbodh.lcl.; of the present invention, ion exchange (wherein a~ uolliu-l-10 ions are eYrhangPd for sodium ions) and ~ iri~alioll are arComrlichpd with a DEAE-5PW
column. In this (..llbC ' it is found that salt . Alions of the eluant are generally too high for desalting with sephadex-gel, as is traditionally done after standard ~~tl i~gl.... I< ~llid~ ion-exchange is con~l ~t~ ~1 In this c...l,c " t, desalting is accomplished by any suitable technique capable of effectively handling high salt collc~llll~liu,.~.
15 Desalting is preferably conducted by tangential flow filtration (TFF). TFF provides the advantage of being able to a~co~ t~. and desalt large volumes of solutions having very high salt cùuc. ullAAliul~ (e.g., 2 M NaCI).
The invention also encoll",dsscs a process for preparing purified mixtures of olig~ l.~oti~Ps~ This aspect of the invention comprises:
(a) HIC to remove - .l.. :.. hydroxide and to remove oligos not having DMT
protecting groups;
(b~ detritylation to remove the DMT protecting groups;
(c) anion exchange on DEAE-5PW;
(d) tangential flow filtration; and (e) Iyophilization.
The methods of the invention may be used to purify crude mixtures COlllailli olig.,.- Iro~i~lr pho~,hu,ulhio~;~i, that have just been cleaved from a solid phase synlhesis support using Al~l~l..lll;..lll hydroxide or mixtures that have been previously subJected to a l,ulifiuaLioll procedure but that are not of acceptable purity.
We have found that oli~ull.,~lcolidc pho~Jllolulllioates can be purified on DEAE-5PW ion-exchange columns, phenyl-5PW and phenyl s ~ u~e columns using aqueous SUBSTITUTE SHEET (RULE 26) WOg6f01268 21 ~435~ r~
SPW results in effective separation of oli~u.. I uli<l< phor~ ulutl~iu~t~.D fromrl~n~ in high yields. The protocols presented herein can be employed in large scale purification of oligo~ lcvLide ph~l.lloLutl.ioates to replace the COll~
IUIU~,~a~JVldliUII and C~8 silica gel protocols required during the p,J. iri ~ n process. This S results in fewer steps in the II~AI' r~- u h~e process and allows for better purity and recovery of product.
According to the methods oF the present invention, oligonucleotide phoDI,hulu-thioates from about 10 to about 35, 1l ,"i.1. c in length can be separated on a DEAE-SPW
ion exchange column, a phenyl sepharose column or phenyl-5PW column. In a preferred 10 .,lllb- ~ ~, ol ;~ .. . rlr o~ pLu~f~hu~ùlllioates having a length of from about 20 to about 3'i and more preferably 25-30. can be separated using the present methods.
According to the invention, the olig~,. Ir "J _ separable by the present method may have as few as one ~nd as many as all ph- 1 ~ ollliùat~ eoli~lP linkages. As used herein, the term "oligonucleotide pho~ uluLllioate~ is used to describe such an 15 oligonucleotide. Oligonucleotide pho~haln~l;(l.i(. ~, of the same size as theoligu ' :' phosphorothioates described can also be separated by the inventive methods .
The oli~o., r 1~ c are placed on the column and eluted at or near ambient (room)t~ f/~,~alul~i with either a gradient or a non-gradient buffer. For purificationlpreparation of ammoniacal solutions by HIC, A.l.l.l.~l.;.. acetate is used in - . IihrAlion buffers at cv~lc~ t~a~ions ranging from about 0.5 to about 2.0 M, preferably 0.75 M. Although addition of A~...._ ~I~;IIn~ acetate may reduce the pH somewhat, the pH should typically be high to minimize the loss of the trityl group. pH values of 7.5 - ll.0 have been used s~ ~ceccfi-lly. A typical value of 10.0 is preferred since this more alkaline pH minimizes 25 loss of the trityl group from the olitJI~ Ir vl ;~1 . Elution is most effectively ~ Ch~d with water, although other schemes employing buffers may prove useful in particular Aprlir~firn~ Organic solvents are not required for separation, although their inclusion may be desirable when preparing oligon~r!P<!til1f~s by HIC for ~b~ ..1 RPLC
separation. While taller columns can be used (see the height diameter ratios in the 30 Examples, infra), shorter columns work very well and are preferred for large-scale work.
Colurnn loads can go as high as 650 OD unitslml packing, depending on elution conditions SUBSTITUTE SHEET (RULE 26) W0 96~01268 1~ l /a ~ ) 5 0 and column geometry. Preferably the column load is about 200 OD units/ml packing.
Linear velocities can range as high as 300 cm/hr, but are preferably about 150 cm/hr.
When HIC is used to purify DMT-off oliL.... lrori~ , a variety of buffers can beused at a pH ranging from about 7.2 to about 8.5. In the preferred c..lbr '- Tris-HCI
5 is used at a pH of about 7.5. Salts such as sodium chloride must be added to the load and to the equilibration and wash buffers in concentrations rapging from about 1 M to about 3 M, preferably about 3 M. Elution is Prcn~plich~d by either linear or step gradients via salt reduction. Phenyl sepharose columns are preferably loaded at high flow rates. Rates exceeding about 250 cm/hr are found to work eYrel~ingly well. Elution at a rate of about 10 150-200 cmlhr is desirable.
When DEAE-SPW is used to purify DMT-off oli~;~ '- lc , buffers such as Tris-HCI (preferably in a ~ - dLiu.l of about 10 to about 50 mM) are to be used. Salts such as sodium chloride are used for equilibration and elution. Preferably, sodium chloride gradients of 0 to 2 M are used. For shorter columns a range of sodium chloride 15 collcl .1 between 0.85 and 2 M are preferred. The pH of the oligi ' ' solution that is loadel may be between about 7.0 and about 10.5~ preferably about 7.2. The pH of eq~ilihr~tion, wash and elution buffers can range from about 7.2 to about 8.5, and is preferably about 7.2. Chelating agents such as 1 mM EDTA and organic solvents such as acetonitrile or ethanol can be added to the buffers in some applications. While linear 20 gradients can be run, excellent reco~eries and purities are obtained using simple step gradients. In many cases, better recoveries can be obtained using step gradients -- linear gradients appear to cause a slow "bleed-off" of bound product from the column that often works against effective sepa~ation and high recovery. While taller columns can be used, relatively short columns provide excellent results and are preferable for large-scale work.
25 Column capacity for olig ~'~ ' is somewhat lower that that seen for the HIC resins, with optimum column loads ranging up to about 200 OD units/ml resin, preferably about - 150 OD units/ml packing. Optimum linear velocities range between about 50 and about 150 cm/hr and are preferably about 70 cm/hr.
Column geometry has a cigniFi~ rt effect on the l,, tuil.,.l..,ut~ for equilibration 3û buffer salt condiliuns -- taller columns (larger height:diameter ratio) require higher salt as compared to shorter columns (lower height:diameter ratio). When a mixture of SUSSTITUTE S! IEET ~RULE 26) W096/01268 .~,IIU~
2' ~'~3~0 the rel~r~ hir between the column height:diameter ratio and sodium chloride c~ . ~ . . ,.1;.... is relevant to product yield. As the I - i~,' di~ ~t~,l ratio of the DEAE-5PW
columm is increased, the sodium chloridc ~ ~ion of the eq~ilihr:ltinn buffer should preferably be increased to obtain a greater recovery of purified product.
The separation method of the present invention is essentially i, l ~ . a of column particle size. Sizes ranging from 25 to 90 ~m can be used s~l~~cescfnlly. In preferred emhorii~nt~, the particle size is 25 ~m - 40 llm or 45 llm - 165 ~m. A particularly preferred hylllvpllobh, interaction chromatography resin has a particle size of about 90 llm.
One skilled in the art will recognize that ~ ~lifir~inns may be made in the present invention without deviating from the spirit or scope of the invention. The invention is illustrated further by the following examples which are not to be construed as limiting the invention or scope of the specific p-v.c.lu-~,s described herein.
EXAMPLES
In each of the following Examples, equipment and materials were obtained as indicated from Tosollaas (Mv..l~ ville, PA). Amicon (Beverly, MA) Waters (Milford, MA), Hewlett-Packard (HP) (Palo Alto, CA), Perkin-Elmer (Norwalk, CT~,ISCO (I.incoln NB), Rainin (Woburn, MA), Filtron (Nollihl,(,.~ ll, MA), Pharmacia (Piscll~dw~y, NJ). and Biorad (Hercules, CA).
1~. '~ 1 Purification witi2 DEAE-SPW
A 25-mer oligonucleotide having the sequence CTCTCGCACCCATCTCTCTCCTTCT ~GEM 91) was purified using a 0.51 column of 30 ~um TSK DEAE SPW (~vll....~l.,i~lly available from TosoHaas). ï'he resin was pacl~ed 25 into a Pharmacia 5.0 cm diameter glass colurnn. Purification was monitored using an ISCO UA-5 detector equipped with a 254 nm filter and a Rainin rabbit pump.
Two sources of GEM 91 were used in this e~ample:
(1) GEM 91 fractions from a Sephadex G-15 column, subsr ~ '~/ desalted and ~,oncc~ .tcd on Filtron tangential flow filtration (TFF) ~ al~s prior to cl.. , 'b~'llJ~I~Y;
SUBSTITUTE Sl EET (RULE 26) WO 96/01268 ~ I /a 21 ~35~
(2) two lots of Iyophilized GEM 91 powder: one having low ion exchange-HPLC
purity, the other having low CGE (capillary gel elc~ u~,ho.~i.is) purity.
The GEM 91 olib~ was loaded onto the column aL 150 A76~ O~D~ (optica]
density) units/ml packing~
25 mM Tris-HCI, pH 7.2 room t~ cldlult having from 0.85 to 1.0 M NaCI was used as the buffer with, in some t~ liUI.,I..~ mM EDTA~ Elution was p~lrullllcd with 25 mM Tris-HCI, pH 7~2 (RT) containing 2 M NaCI and, in certain ~ .Hlll~,l,L~, 1 mM
EDTA~ The column was washed with 6 column volumes (4 column volumes in run no~ 4) of the appropriate equilibration buffer after application of sample~ Fractions were 10 collected, O~D~ recoveries rlPtl-rmil~rrl and aliquots analyzed for purity by ion exchange HPLC (IEX) and, in some cases, by CGE analysis~
ln addition, to runs done on the 0~5 I column, three e~ ,.hl.t.ll~ were done at a 9 ml column-scale in order to evaluate the effect of column collri~sulalioll on p.~l rol.~ ce Results are shown in Table I Percent purity was analyzed by ion exchange (IEX) HPLC (% purity = % of phc,~l o-ull.ioate, including N and N-1 sequences); CGE data is also presented for run #5 (% purity = % of N oligonucleotide, including both pho~pl.o.ù~l~io~ and ph~ ~p~o~ ster oligos)~
Three ~ i" ~ - ~ were conducted on a 9 ml (2.2 cm diam~ x 2.4 cm ht ) column The results are shown in Table 2~
The results rh.n~m 11~ that crude olig~ -I-.t ' can be purified with DEAE
5PW with high purity and excellent yield~
SUBSTITUTE SHEET (RULE 26 WOg6~01268 2 ~ r:~ 12 Table 1 Pllrifi~fi pool Run % recovery% purity% recovery No. Conditions O.D. I product~
1 ~411: 0.85M NaCI + EDTA 54.1 99.6 59.7 15~: 90% IEX purity3 2 ~lU: 1.0M NaCI/+ EDTA 85.8 98.6 94.0 l~ai: 89~o IEX purity 3 _41U: l.OM NaCI 86.0 99.2 96.2 lQla 89 % IEX purity 4 _41U: l.OM NaCI 58.7 98.0 64.7 ~lai: 89% IEX purity ~4lU: l.OM NaCl 87.0 97.8 84.94 Llal: 89% IEX purity, 77% CE 84.7 purity on retests 6 ~4lU: 1.0M NaCI 78.3 98.2 90.1 15laLl: 877~o IEX purity on retest 7 e~uil: 1.0M NaCI 78.7 98.6 89.3 1~1: 87% IEX purity on retest 8 _41U: 1.0M NaCI 83.5 98.4 93.4 ll~i: 88~o IEX purity on retest ' percent recovery based on total O.D. (optional density) units initially loaded on column.
2 percent recovery of product in terms of "purity units" initially loaded on column.
3 IEX purity units = (total O.D. units) x ~percent purity by IEX-HPLC analysis); CEi 15 purity units = (total O.D. units) x (percent purity by CE analysis). CE purity units indicate the recovery efflciency of the column.
4 based on CE data.
SUBSTITUTE SHEET (RULE 2 WO9~i/01268 ~ ~ 9 '11 3 ~ ~ r ~ /a Table 2 Purified Pool percent [NaCI] irl recovery Y0 recovery % purity (IEX- % recovery of equil. buffer O.D. ~total~ O.D. HPLC) product 90.85 M 109.0 87.0 97.0 94.0 100.85 M 101.0 80.0 97.0 86.0 111.0 M 113.0 67.0 99.0 73.0 r ~-2 Purificafion by HydropholJic Inreraction Chromatography A GEM 91 sample was subjected to hydrophobic interaction ~hl. .~ phy. This sample had the composition shown in Table 3.
Table 3 percent percent PO oli~ulluclcuLides by CGE analysis DMT-on n n- ] n-2 n-3 62 0.4 55.2 11.4 2.8 3.5 This olign~ Poti~P was purified on Phenyl-sepharose fast flow (high sllhslitl-tinn~ using an Amicon 2.2 cm glass column, a Waters 650 solvent delivery system, an HP integrator, 15 a Rainin Dynama~ UV-C absulballue detector and a Perkin-Elmer s~ lu~hui : .
Theresinwaspackedintooneoftwocolumncù--riL,.--,'iu~~c ahPigh~ pterratio of 2.2:1 or 2.5:1.
The following elution protocols were employed:
(A) the sample load was adjusted to 1.7 M .IUIIIIU ' acetate, pH 10.7; the 20 column was equilibrated and washed with 2.5 M ~l...,.ù~ ... acetate; sample was eluted using 0.1 M acetate, pH 8.5, followed by water;
(B~ the sample load was adjusted to 1.0 M ammonium acetate, pH 10.7; the column was equilibrated and washed with 1.0 M i~ acetate, pH 8.5; the sample was eluted with water;
SUBSTITUTE SHEEI ~RULE 26) WO96101268 21 ~35~
(C) the sample load was adjusted to 1.0 M .,, ~'~'!';""' aceLate, pH 10.7; the column was equilibrated and washed with 1.0 M: acetate, pH 8.S; the sample was eluted using 0.01 M NaOH, pH 11.5, followed by water;
(D) the sample load was adjusted to 0.75 M .tllllllOlliUIII acetate pH, 11.0: the S column was e.~ aL~d and washed with 0.75 M: acetate, pH 8.5; the sample was eluted using 0.01 N NaOH, pH 11.5, followed by water.
Ali4uots of wash and elution fractions were analyzed by ;on exchange and reversephase (RP) HPLC. The results are shown in Table 4.
Table 4 10 Sample Height: Load' Velocity Elution Percent Percent recovery Elution diameter (cm/hr)2 protocol recovery OD3 product4 purity5 ratio Elution Total Elution Total 2.2:1 252 316 A 53.3 99.2 64.0 86.4 97.8 2 2.2:1 252 316 B 66.1 101.7 96.0 102.0 80.5 3 2.2:1 252316/158 C 50.9 98.8 80.8 93.8 88.0 4 2.5:1 2003161158 C 55.8 100.8 80.5 85.7 89.8 2.5:1 200316/158 C 62.7 99.2 84.8 91.1 83.8 6 2.5:1 200316/158 C 63.9 100.0 79.7 88.2 77.3 7 2.5:1 200316/158 D 59.1 98.3 82.3 86.3 86.3 8 2.5:1 1783161158 D 66.1 95.3 83.9 85.9 87.7 9 2.5:1 1783161158 D 57.9 89.8 76.6 80.1 91.1 20 ' Total OD units loaded/ml packing.
2 Samples 3-9 were loaded at 316 cm/hr and eluted at 158 cm/hour.
3 % Recovery OD = % recovery of oligon-lcl~oo~ s loaded on column Elution = % recovery in elution pool Total = % recovery in all f}actions 25 4 ~a Recovery product = % recovery of "DMT-on' product loaded on column Elution = % recovery "DMT-on" product in elution pool Total = % recovery ~DMT-on" product in ull fractions SUBSTITUTE SHEET (RUL~ 26) WO96/01268 2 l ~ ~ ~ 5 0 r~L~ 11 .
5 Indicated in terms of percentage of DMT contAining material (5fo DMT-on); calculated as (% DMT-on by ion exchange HPLC + % DMT-on by reverse phase HPLC)/2.
An i~ ,onis Al solution of GEM 91 having an avarage of 62% DMT-on was purified on phenyl sepharose fast flow (high ~llbs~hl~tion) using a Waters 650 solvent delivery system, a HP integrator, a Rainin Dynamax UV-C absoll,al.~c detector, 1 cm (Biorad) and 2.2 cm (Amicon) diameter glass columns and a Perkin-Elmer spectrophotometer The deblock solutions were adjusted to 1.7 M~ ~m. acetate pH 10 3 before loading onto phenyl sepharose The phenyl sepharose was previously equilibrated with 0 _UllllVlliUIll acetate. Elution of the ol4,u..uclcvtide was accomplished with reverse gradients of Allm~ll;lllll acetate, pH 7.35, followed by water The following runce~itinnq were used:
(A~ the column was equilibrated and washed with 2.5 M al~lnlui~u acetate, pH
8.5; oligonucleotide eluted with step gradient of8% ACN in 0.1 M Al l l~.ni acetate pH7.85, followed by water;
(B) the column was equilibrated and washed in 1 7 M A~ niul~l acetate, pH8.5;
oligonucleotide was eluted with consecutive linear gradients of1.5 M-1.0 M and 1 0 M-0 M al..l..vniu u acetate, followed by water;
(C) the column was equilibrated and washed with 7 M A~ acetate, p~ 8.5;
olig,~ otiAf was eluted with step gradient of 0.5 M al~, .nl,; ", acetate, followed by linear gradient of 0.5-0 M Ammrlnillm acetate, followed by water (D) the column was eqnilihratP(l and washed with 2.6 M a""~n; " acetate, pH
8.5; oligonucleotide was eluted with step gradient of 0.5 M a,.. oniu.. acetate, followed by a linear gradient of 0 5-0 M ..iu... acetate, followed by water Aliquots of wash and elution fractions were analyzed by ion exchange and reversephase HPLC. The results are shown in Table 5.
SUBS~ITUTE SHEET (R~!LE 26) ~ 9435~ 16 r~
Table 5 height: Load' linear elution recovery of OD recoYery of elution diameter velocity protocol (~c) pr~ purity2 ratio (cm/hr) (%) Elution Total Elution Total S.4:1 192 462 A 46.9 106.4 75.4 78.1 9g.7 2.2:1 385 315 B 42.4 97.7 66.7 83.6 97.8 2.2:1 385 315 C 18.9 101.5 30.2 93.1 99.0 2.2:1 252 315 D 32.3 96.6 52.5 85.3 97.5 ' OD units/ml packing.
10 ~ percent DMT-on: (% DMT-on by ion exchange by ion exchange HPLC + % DMT-on by reverse phase HPLC)/2.
These results d~ ..D~ DMT-on oligon~cll otifl~os can be purified from ammoniacal solutions and DMT-off oli~ k~ os.
Example 3 HIC as a Su'ostitutefor Rotoe~!aporation and RPLC
Two GEM 91 samples were subjected to L,ydluyLOb;~, interaction ~,Llullld~o~l~yh ~ .
These samples had the ~v~yv~;lioll shown in Table 6. Sample 3-1 had been stored at 4~C
as an ammoniacal solution; sample 3-2 had been recently prepared.
Table 6 CGE
Sample %DMT- %PO
on n n- 1 n-2 n-3 63 0.4 56.5 10.3 2.~ 2.9 2 69 0.4 57.6 6.5 2.0 3.7 These oligom~rl~ oii~es were purified on Phenyl sepL.~.u3c fast flow (high ~ ) using Amicon 2.2 cm glass columns, a Waters 650 solvent delivery systcm, 25 an HP integrator, a Rainin Dynamax UV-C abbo~ cc detector, and a Perkin-Elmer ., ' tVIII~t~..
SUBSTITUTE SHEET IRULE ~6 wos6/~l26s ~ 1 9 -1 3 5 0 P~
,~mmo~:or:ll solutions of GEM 91 were adjusted to 0.75 M a acetate and loaded at 75 cmlhr onto the column which was previously equilibrated with 0.75 Mall~ OIliull~ acetate, pH 10.2. After loading, the column was washed at 317 cm/hr with (0.75 M) a7nn oni~ acetate and DMT-on product was eluted by washing the column at 5 159 cmlhr with water.
Aliquots of wash and elution fractions were analyzed using ion exchange and reverse phase HPLC. The results are shown in Table 7. The purity and yield of the eluted product is equivalent to that achieved using reverse phase liquid ~hlul~ 6~h2hy. This dcl..u.~ , that by proper ~dj~lc~m~nt of load and elution conditions, high purity DMT-10 on product can be obtained with excellent yield on a relatively short (low height:diameter ratio) chl~ u~ hy columns with HIC.
Table 7 Crude GEM 91 % recovery of OD% recovery of purity of product elution oligo Loadl Elution Total Elution Total % D
sample 200 55.8 102.1 85.0 85.3 97.5 300 48.5 104.1 73.5 88.8 98.5 200 56.6 96.1 83.5 88.9 96.0 2 200 64.0 1~0.4 89.0 94.3 96.0 20 I total OD units loadedlml packing.
2 Purity calculated as: (% DMT-on by IEX-HPLC + % DMT-on by RP-HPLC)12.
Example 4 Olig~ o~ Purification by ~IC
GEM 91 was purified on TSK-gel phenyl-SPW (TosoHaas) and an agarose based 25 phenyl sepharose fast flow (high ,~I,s~ ioll) (Pharmacia) using a Biorad glass column (1.5 cm diam.), an ISCO UA-5 detector equipped with a 254 nm filter, a Rainin rabbit pump, and a Perkin-Elmer ~ tlu~ uLulll,,ter.
The GEM 91 (sodium salt form) was recovered from desalt column (gel filtration) side fractions from production lots via tangential flow filtration (TFF) on 2,000 MWCO
30 modified polyether sulfone filters (Filtron. Inc.l. The oli~odeoxvnucleotide s~ tionc SUBSTITUTE SHEET (RULE 26~
W096/01268 ~ F~ a J _J
were adjusted to 3M NaCI in 25 mM Tris-HCI, pH 7.4-7.5, prior to oppliro~inn to the columns.
E~,.. I Conditions:
A. Phenyl 5PW; oli~ ~ loaded in 3M NaCI/25 mh~ Tris-HCI pH 7.5, 5 oligo eluted using linear gradient of 3M - OM NaCI.
B. Phenyl sepharose; same oli~ l Ioading and elution conditions as in A.
C. Phenyl sepharose; olig. ' :ide loaded in 3M NaC1125 mM Tris-HCI, pH
7.4; oligolluclc~lidc eluted using step gradient of 2M and lM NaCI followed by linear 10 gradient of lM - OM NaCI.
D. Phenyl sepharose; oli~5~,. -' '- loaded in 3M NaCl/25 mM Tris-HCI pH
7.4; olig ~ eluted using step gradient of lM NaCI foliowed by linear gradient of lM - 0.7M NaCI, followed by step gradients of 0.7M and OM NaCI;
The results for each column are shown in Table 8. These results dc.l.ol.~ e that15 the sodium salt form of an olig~ ti~iP can be purified using either phenyl sepharose fast fiow resin or phenyl 5PW resin.
Table 8 OD units Prodl~r~ Rrr.-very. IF.X (%)1 Product Rec.overy. C&E (%)2 elution recovery: elution elution recovery: elution elution recovery:
recovery combincd recovery purity combined recovery purity combined (%)fractions (%) (%)fractions (%) (%)fractions (%) (%) (%) A 53.694.5 59.2 95.991.7 nd nd nd B 74.8100.8 77.0 95.695.8 77.3 91.8 96.3 C 62.5g3.0 65.2 94.990.1 63.9 91.7 96.7 D 66.0113.9 68.3 96.1112.2 67.1 92.0 110.1 ' [(number of CGE units in fraction)/~number of CGE units in load)] x 100.
2 [(number of IEX units in fraction)/(number of IEX units in load)] x 100.
SUBSTITUTE SHEET (RULE 26) _ .
WO 96ro1268 r~ /a 2~ ~~35() Example 5 An a~l solution of GEM 91 having an avarage of 62% DMT-on was purified on phenyl sepharose fast flow (high ~Uh~ Ulivll) using a Waters 650 solvent delivery system, a HP integrator, 1 cm (Biorad) and 2.2 cm (Amicon) diameter glass S columns and a Perkin-Elmer s,u~ u,uh~
Phenyl sepllalua,, was packed into one of three column cl-nfig-lr~rions at height:diameter ratios of: 5.4:1, 2.2:1, and l:1.
Phenyl sepharose columns were eq~ in .I. ~ acetate pH 8.5. The run cr~hi~ln~ were as follows:
(A) no adj.. ~h~ to the GEM 91 _ I solution; the column was equilibrated with 2.5 M ,.,... ~ ... acetate, pH 8.5; oligu ' .i ~- was eluted with step gradient of 8% acetonitrile (ACN) in water pll 7.85, followed by water; or (B) the GEM 91 .. ~llul~ia~,al solution was adjusted to 1.7 M a.. w.. :~.l.. acetate, pH
7.'a'S before loading; the column was equilibrated with l.S M ,~ .. nlli...,. acetate, IS pH 7.85; oligon~lrleotPIe was eluted with step gradient of 8% ACN in water, followed by water.
Aliquots of wash and elution fractions were analyzed by ion exchange and reversephase HPLC. The results are shown in Table 9. These results demonstrate that phenyl sepharose fast flow resin can be used to prepare llmmnni~ l solutions of crude DMT-on 20 olig~ '-ulidcs for sl-hseqllent RPLC.
SUBSTITUTE SHEET (RULE 26) wo 9~012 ~82 1 9 ~r ~ S 3 1~ ~ la Table 9 height: Load'linear elution recovery of ODrecovery of e]ution diametervelocity protoco1 (%) p-rQsl~(7o) purity' ratio (cmlhr) Elution TotalElution Total 5.4:1 192 462 A 92.1 103.594.4 94.4 68-5.~:1 450 462 A 80.8 104.497.8 97.8 75 5.4:1 642 462 A 54.8 100.188.5 91.9 80 5.4:1 1285 462 A 24.5 105.5 nd3 nd nd l:l 400 396 A 62.7 101.181.4 91.~f 81 1:1 305 396 A 53.5 98.3 86.3 89.2 72 1:1 305 IS~ A 72.4 100.087.6 92.4 75 1:1 250 157 A 80.4 102.090.8 91.0 70 2.2:1 355 396 A 42.1 103.555.1 97.2 81 2.2:1 400 317 B 85.9 105.393.5 93.5 68 15 ' Load: OD unitslml packing 2 Elution purity: as fl. l,-....;. ~d by IEX-HPLC
F. '-6 GEM 91 is syufll~ D;L. .i using a CPG support and an automated synthesizer. The olic. '- ' iscleaved'rromthesupportusing c~' ~..f ~ff-d A~"~r'-' hydroxide. The 20 oli~ hydroxidemixtureisthen-.l..l c aphedusingllydlupLobic interaction chromatography using phenyl-sepharose or phenyl-5PW resins essentially according to the ~lucedulr s set forth above in Examples 1-6. The resulting solutions containing GE~M 91 are pooled and optionally .,1,-~ ' using preparative reverse-phase liquid chlu laLucla~rlly. The combined GEM 91 fractions are acidified to remove 25 the dimethoxytrityl (DMT~ protecting group. The dcLLiLylut~ d GEM 91 is suspended in water and ~hll cl ,'-~ over a DEAE-SPW ion-exchange column essentially as described above in Example 1 to purify it and convert it to the sodium salt form of GEM
91. The olic. ' : ~fP is then "desalted" via tangential flow filtration (TFF) to remove salt and any remaining small molecule impurities, and then dr~.yluO_~laLr d on a membrane SUBSTITUTE SHEET (hLlLE 26) . .. . . . .. . _ _ _ . _ _ _ _ _ W0~1268 2 1 ;' ~ 3 5 a ~ /a referred to as purified BDS. The overall recovery of product after these steps is about 70% with a purity of about 98%. Thus, using this technique, HIC and DEAE 5PW
chrom~L~ pl.i~s can be effectively combined to obtain good recovery of high purity oligo ~ oti~1~ s from ~ul....Juiacdl solutions.
~ 5 From the foregoing, it will be .~ .cci.lt.d that although specific e hoJ;~ of the invention have been described herein for purposes of il~ ~Lh~ll, various may be made without deviating from the spirit or scope of the invention.
SUESTITUTE SHEET ~RULE 26~
W09~0~2(i8 ~ 3 ~"~
SEQUENCX LISTING
(l) GENERAL INFORMAT}ON:
~i) APPLICANT: Puma Ph.D., Patricia lii) TITLE OF INVENTION: Purific~tion of Oligodeoxynucleotide Phosphorothioates Using DEAE 5P~ Anion Exchange Chromatography and Hydrophobic Interaction Chromatography ~iii) NUMBER OF sE~u~c~b: 1 (iv) CORRXSPONDENCX ADDRXSS:
0 (A) ADDRXSSXE: Allegretti ~ Witco~f, Ltd.
(B) STRXET: 10 South W~cker Drive, Suite 3000 (C) CITY: Chicago (DJ STATE: IL
(X) COUNTRY: USA
(F) ZIP: 60606 (~) COMPUTXR RXADABLE FORM:
(A) MXDIUM TYPE: Floppy disk (B) COMPUTXR: IBM PC compatible (C) OPERATI~G SYSTEM: PC-DOS~MS-DOS
(D) SOFTWARX: PatentIn Release #1.0, Version ~1.25 (vi) CURRENT APPLICATION DATA:
(A) APPLICATION NUM3ER:
(B) FILING DATX:
(C) CLASSIFICATION:
~iii; ATTORNEY/AGXNT INFORMATION:
(A1 NAME: Greenfield Ph.D., Michael 5.
(B) REGISTRATION NUMBER: 97,142 (C) RXFXRXNCXJDOC~ET NUMBER: 94,444 (ix) TELECOMMUNICATION INFORMATION:
(AJ TELEP~ONE: (312J715-1000 (B) TELEFAX: (312)715-1234 (2) INFORMATION FOR SEO ID NO:1:
(i; SEQUENCE CHARACTERISTICS:
(A) LENGTH: 25 base pair~
(B) TYPE: nucleic acid SUBSTITUTE SHEET ~RULE 2&) WO 96101268 r 1 ~,~ru~ -h la 2 1 9 4 3 ~ ~
(C) STR~Nn~n~'~qS: single (D) TOPOLOGY: linear (iii) HYPOTHETICAL: NO
(ix) FEATURE:
(A) NAME~EY: misc ~eature (B) BOCATION: 1..25 (D) OTHER INFORMATION: /note= "All internucleotide linkages are phosphorothioates~
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:1:
SUBSTITUTE SHEET (RULE Z6)
An i~ ,onis Al solution of GEM 91 having an avarage of 62% DMT-on was purified on phenyl sepharose fast flow (high ~llbs~hl~tion) using a Waters 650 solvent delivery system, a HP integrator, a Rainin Dynamax UV-C absoll,al.~c detector, 1 cm (Biorad) and 2.2 cm (Amicon) diameter glass columns and a Perkin-Elmer spectrophotometer The deblock solutions were adjusted to 1.7 M~ ~m. acetate pH 10 3 before loading onto phenyl sepharose The phenyl sepharose was previously equilibrated with 0 _UllllVlliUIll acetate. Elution of the ol4,u..uclcvtide was accomplished with reverse gradients of Allm~ll;lllll acetate, pH 7.35, followed by water The following runce~itinnq were used:
(A~ the column was equilibrated and washed with 2.5 M al~lnlui~u acetate, pH
8.5; oligonucleotide eluted with step gradient of8% ACN in 0.1 M Al l l~.ni acetate pH7.85, followed by water;
(B) the column was equilibrated and washed in 1 7 M A~ niul~l acetate, pH8.5;
oligonucleotide was eluted with consecutive linear gradients of1.5 M-1.0 M and 1 0 M-0 M al..l..vniu u acetate, followed by water;
(C) the column was equilibrated and washed with 7 M A~ acetate, p~ 8.5;
olig,~ otiAf was eluted with step gradient of 0.5 M al~, .nl,; ", acetate, followed by linear gradient of 0.5-0 M Ammrlnillm acetate, followed by water (D) the column was eqnilihratP(l and washed with 2.6 M a""~n; " acetate, pH
8.5; oligonucleotide was eluted with step gradient of 0.5 M a,.. oniu.. acetate, followed by a linear gradient of 0 5-0 M ..iu... acetate, followed by water Aliquots of wash and elution fractions were analyzed by ion exchange and reversephase HPLC. The results are shown in Table 5.
SUBS~ITUTE SHEET (R~!LE 26) ~ 9435~ 16 r~
Table 5 height: Load' linear elution recovery of OD recoYery of elution diameter velocity protocol (~c) pr~ purity2 ratio (cm/hr) (%) Elution Total Elution Total S.4:1 192 462 A 46.9 106.4 75.4 78.1 9g.7 2.2:1 385 315 B 42.4 97.7 66.7 83.6 97.8 2.2:1 385 315 C 18.9 101.5 30.2 93.1 99.0 2.2:1 252 315 D 32.3 96.6 52.5 85.3 97.5 ' OD units/ml packing.
10 ~ percent DMT-on: (% DMT-on by ion exchange by ion exchange HPLC + % DMT-on by reverse phase HPLC)/2.
These results d~ ..D~ DMT-on oligon~cll otifl~os can be purified from ammoniacal solutions and DMT-off oli~ k~ os.
Example 3 HIC as a Su'ostitutefor Rotoe~!aporation and RPLC
Two GEM 91 samples were subjected to L,ydluyLOb;~, interaction ~,Llullld~o~l~yh ~ .
These samples had the ~v~yv~;lioll shown in Table 6. Sample 3-1 had been stored at 4~C
as an ammoniacal solution; sample 3-2 had been recently prepared.
Table 6 CGE
Sample %DMT- %PO
on n n- 1 n-2 n-3 63 0.4 56.5 10.3 2.~ 2.9 2 69 0.4 57.6 6.5 2.0 3.7 These oligom~rl~ oii~es were purified on Phenyl sepL.~.u3c fast flow (high ~ ) using Amicon 2.2 cm glass columns, a Waters 650 solvent delivery systcm, 25 an HP integrator, a Rainin Dynamax UV-C abbo~ cc detector, and a Perkin-Elmer ., ' tVIII~t~..
SUBSTITUTE SHEET IRULE ~6 wos6/~l26s ~ 1 9 -1 3 5 0 P~
,~mmo~:or:ll solutions of GEM 91 were adjusted to 0.75 M a acetate and loaded at 75 cmlhr onto the column which was previously equilibrated with 0.75 Mall~ OIliull~ acetate, pH 10.2. After loading, the column was washed at 317 cm/hr with (0.75 M) a7nn oni~ acetate and DMT-on product was eluted by washing the column at 5 159 cmlhr with water.
Aliquots of wash and elution fractions were analyzed using ion exchange and reverse phase HPLC. The results are shown in Table 7. The purity and yield of the eluted product is equivalent to that achieved using reverse phase liquid ~hlul~ 6~h2hy. This dcl..u.~ , that by proper ~dj~lc~m~nt of load and elution conditions, high purity DMT-10 on product can be obtained with excellent yield on a relatively short (low height:diameter ratio) chl~ u~ hy columns with HIC.
Table 7 Crude GEM 91 % recovery of OD% recovery of purity of product elution oligo Loadl Elution Total Elution Total % D
sample 200 55.8 102.1 85.0 85.3 97.5 300 48.5 104.1 73.5 88.8 98.5 200 56.6 96.1 83.5 88.9 96.0 2 200 64.0 1~0.4 89.0 94.3 96.0 20 I total OD units loadedlml packing.
2 Purity calculated as: (% DMT-on by IEX-HPLC + % DMT-on by RP-HPLC)12.
Example 4 Olig~ o~ Purification by ~IC
GEM 91 was purified on TSK-gel phenyl-SPW (TosoHaas) and an agarose based 25 phenyl sepharose fast flow (high ,~I,s~ ioll) (Pharmacia) using a Biorad glass column (1.5 cm diam.), an ISCO UA-5 detector equipped with a 254 nm filter, a Rainin rabbit pump, and a Perkin-Elmer ~ tlu~ uLulll,,ter.
The GEM 91 (sodium salt form) was recovered from desalt column (gel filtration) side fractions from production lots via tangential flow filtration (TFF) on 2,000 MWCO
30 modified polyether sulfone filters (Filtron. Inc.l. The oli~odeoxvnucleotide s~ tionc SUBSTITUTE SHEET (RULE 26~
W096/01268 ~ F~ a J _J
were adjusted to 3M NaCI in 25 mM Tris-HCI, pH 7.4-7.5, prior to oppliro~inn to the columns.
E~,.. I Conditions:
A. Phenyl 5PW; oli~ ~ loaded in 3M NaCI/25 mh~ Tris-HCI pH 7.5, 5 oligo eluted using linear gradient of 3M - OM NaCI.
B. Phenyl sepharose; same oli~ l Ioading and elution conditions as in A.
C. Phenyl sepharose; olig. ' :ide loaded in 3M NaC1125 mM Tris-HCI, pH
7.4; oligolluclc~lidc eluted using step gradient of 2M and lM NaCI followed by linear 10 gradient of lM - OM NaCI.
D. Phenyl sepharose; oli~5~,. -' '- loaded in 3M NaCl/25 mM Tris-HCI pH
7.4; olig ~ eluted using step gradient of lM NaCI foliowed by linear gradient of lM - 0.7M NaCI, followed by step gradients of 0.7M and OM NaCI;
The results for each column are shown in Table 8. These results dc.l.ol.~ e that15 the sodium salt form of an olig~ ti~iP can be purified using either phenyl sepharose fast fiow resin or phenyl 5PW resin.
Table 8 OD units Prodl~r~ Rrr.-very. IF.X (%)1 Product Rec.overy. C&E (%)2 elution recovery: elution elution recovery: elution elution recovery:
recovery combincd recovery purity combined recovery purity combined (%)fractions (%) (%)fractions (%) (%)fractions (%) (%) (%) A 53.694.5 59.2 95.991.7 nd nd nd B 74.8100.8 77.0 95.695.8 77.3 91.8 96.3 C 62.5g3.0 65.2 94.990.1 63.9 91.7 96.7 D 66.0113.9 68.3 96.1112.2 67.1 92.0 110.1 ' [(number of CGE units in fraction)/~number of CGE units in load)] x 100.
2 [(number of IEX units in fraction)/(number of IEX units in load)] x 100.
SUBSTITUTE SHEET (RULE 26) _ .
WO 96ro1268 r~ /a 2~ ~~35() Example 5 An a~l solution of GEM 91 having an avarage of 62% DMT-on was purified on phenyl sepharose fast flow (high ~Uh~ Ulivll) using a Waters 650 solvent delivery system, a HP integrator, 1 cm (Biorad) and 2.2 cm (Amicon) diameter glass S columns and a Perkin-Elmer s,u~ u,uh~
Phenyl sepllalua,, was packed into one of three column cl-nfig-lr~rions at height:diameter ratios of: 5.4:1, 2.2:1, and l:1.
Phenyl sepharose columns were eq~ in .I. ~ acetate pH 8.5. The run cr~hi~ln~ were as follows:
(A) no adj.. ~h~ to the GEM 91 _ I solution; the column was equilibrated with 2.5 M ,.,... ~ ... acetate, pH 8.5; oligu ' .i ~- was eluted with step gradient of 8% acetonitrile (ACN) in water pll 7.85, followed by water; or (B) the GEM 91 .. ~llul~ia~,al solution was adjusted to 1.7 M a.. w.. :~.l.. acetate, pH
7.'a'S before loading; the column was equilibrated with l.S M ,~ .. nlli...,. acetate, IS pH 7.85; oligon~lrleotPIe was eluted with step gradient of 8% ACN in water, followed by water.
Aliquots of wash and elution fractions were analyzed by ion exchange and reversephase HPLC. The results are shown in Table 9. These results demonstrate that phenyl sepharose fast flow resin can be used to prepare llmmnni~ l solutions of crude DMT-on 20 olig~ '-ulidcs for sl-hseqllent RPLC.
SUBSTITUTE SHEET (RULE 26) wo 9~012 ~82 1 9 ~r ~ S 3 1~ ~ la Table 9 height: Load'linear elution recovery of ODrecovery of e]ution diametervelocity protoco1 (%) p-rQsl~(7o) purity' ratio (cmlhr) Elution TotalElution Total 5.4:1 192 462 A 92.1 103.594.4 94.4 68-5.~:1 450 462 A 80.8 104.497.8 97.8 75 5.4:1 642 462 A 54.8 100.188.5 91.9 80 5.4:1 1285 462 A 24.5 105.5 nd3 nd nd l:l 400 396 A 62.7 101.181.4 91.~f 81 1:1 305 396 A 53.5 98.3 86.3 89.2 72 1:1 305 IS~ A 72.4 100.087.6 92.4 75 1:1 250 157 A 80.4 102.090.8 91.0 70 2.2:1 355 396 A 42.1 103.555.1 97.2 81 2.2:1 400 317 B 85.9 105.393.5 93.5 68 15 ' Load: OD unitslml packing 2 Elution purity: as fl. l,-....;. ~d by IEX-HPLC
F. '-6 GEM 91 is syufll~ D;L. .i using a CPG support and an automated synthesizer. The olic. '- ' iscleaved'rromthesupportusing c~' ~..f ~ff-d A~"~r'-' hydroxide. The 20 oli~ hydroxidemixtureisthen-.l..l c aphedusingllydlupLobic interaction chromatography using phenyl-sepharose or phenyl-5PW resins essentially according to the ~lucedulr s set forth above in Examples 1-6. The resulting solutions containing GE~M 91 are pooled and optionally .,1,-~ ' using preparative reverse-phase liquid chlu laLucla~rlly. The combined GEM 91 fractions are acidified to remove 25 the dimethoxytrityl (DMT~ protecting group. The dcLLiLylut~ d GEM 91 is suspended in water and ~hll cl ,'-~ over a DEAE-SPW ion-exchange column essentially as described above in Example 1 to purify it and convert it to the sodium salt form of GEM
91. The olic. ' : ~fP is then "desalted" via tangential flow filtration (TFF) to remove salt and any remaining small molecule impurities, and then dr~.yluO_~laLr d on a membrane SUBSTITUTE SHEET (hLlLE 26) . .. . . . .. . _ _ _ . _ _ _ _ _ W0~1268 2 1 ;' ~ 3 5 a ~ /a referred to as purified BDS. The overall recovery of product after these steps is about 70% with a purity of about 98%. Thus, using this technique, HIC and DEAE 5PW
chrom~L~ pl.i~s can be effectively combined to obtain good recovery of high purity oligo ~ oti~1~ s from ~ul....Juiacdl solutions.
~ 5 From the foregoing, it will be .~ .cci.lt.d that although specific e hoJ;~ of the invention have been described herein for purposes of il~ ~Lh~ll, various may be made without deviating from the spirit or scope of the invention.
SUESTITUTE SHEET ~RULE 26~
W09~0~2(i8 ~ 3 ~"~
SEQUENCX LISTING
(l) GENERAL INFORMAT}ON:
~i) APPLICANT: Puma Ph.D., Patricia lii) TITLE OF INVENTION: Purific~tion of Oligodeoxynucleotide Phosphorothioates Using DEAE 5P~ Anion Exchange Chromatography and Hydrophobic Interaction Chromatography ~iii) NUMBER OF sE~u~c~b: 1 (iv) CORRXSPONDENCX ADDRXSS:
0 (A) ADDRXSSXE: Allegretti ~ Witco~f, Ltd.
(B) STRXET: 10 South W~cker Drive, Suite 3000 (C) CITY: Chicago (DJ STATE: IL
(X) COUNTRY: USA
(F) ZIP: 60606 (~) COMPUTXR RXADABLE FORM:
(A) MXDIUM TYPE: Floppy disk (B) COMPUTXR: IBM PC compatible (C) OPERATI~G SYSTEM: PC-DOS~MS-DOS
(D) SOFTWARX: PatentIn Release #1.0, Version ~1.25 (vi) CURRENT APPLICATION DATA:
(A) APPLICATION NUM3ER:
(B) FILING DATX:
(C) CLASSIFICATION:
~iii; ATTORNEY/AGXNT INFORMATION:
(A1 NAME: Greenfield Ph.D., Michael 5.
(B) REGISTRATION NUMBER: 97,142 (C) RXFXRXNCXJDOC~ET NUMBER: 94,444 (ix) TELECOMMUNICATION INFORMATION:
(AJ TELEP~ONE: (312J715-1000 (B) TELEFAX: (312)715-1234 (2) INFORMATION FOR SEO ID NO:1:
(i; SEQUENCE CHARACTERISTICS:
(A) LENGTH: 25 base pair~
(B) TYPE: nucleic acid SUBSTITUTE SHEET ~RULE 2&) WO 96101268 r 1 ~,~ru~ -h la 2 1 9 4 3 ~ ~
(C) STR~Nn~n~'~qS: single (D) TOPOLOGY: linear (iii) HYPOTHETICAL: NO
(ix) FEATURE:
(A) NAME~EY: misc ~eature (B) BOCATION: 1..25 (D) OTHER INFORMATION: /note= "All internucleotide linkages are phosphorothioates~
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:1:
SUBSTITUTE SHEET (RULE Z6)
Claims (23)
1. A method of purifying DMT-off oligonucleotide phosphorothioates and phosphorodithioates comprising applying a mixture of the oligonucleotide to a column containing DEAE-5PW anion exchange chromatography resin and eluting with a salt containing elution buffer.
2. A method according to claim 1 wherein the oligonucleotide is from 10 to about 35 nucleosides in length.
3. A method according to claim 2 wherein the salt is sodium chloride, which is present in a concentration in the range of about 0 to about 2 M and the pH is between about 7.0 and about 10.5.
4. A method according to Claim 3, wherein the sodium chloride concentration is from about 0.85 M to about 2 M.
5. A method according to Claim 3, wherein the oligonucleotide phosphorothioates and phosphorodithioates have a length of from about 20-35 oligonucleotides.
6. A method according to Claim 5, wherein the pH of the elution buffer is about 7.2.
7. A method according to Claim 3, further comprising desalting the DEAE-5PW
eluant by tangential flow filtration.
eluant by tangential flow filtration.
8. A method according to Claim 1 where the oligonucleotide is applied to the column at a loading concentration of about 150 O.D. units/ml.
9. A method of purifying DMT-off oligonucleotide phosphorothioates and phosphorodithioates comprising applying a mixture of the oligonucleotide to a column containing a hydrophobic interaction chromatography resin and eluting with a salt
10. A method according to claim 9 wherein the hydrophobic interaction chromatography resin is phenyl-sepharose fast flow chromatography resin or phenyl-5PW
chromatography resin.
chromatography resin.
11. A method according to claim 10 wherein the oligonucleotide is from 10 to about 35 nucleosides in length.
12. A method according to claim 11 wherein the salt is sodium chloride, which is present in a concentration in the range of about 1.0 to about 3 M and the pH is between about 7.2 and 8.5.
13 . A method according to Claim 12, wherein the sodium chloride concentration is about 3 M.
14. A method according to Claim 12, wherein the oligonucleotide phosphorothioates and phosphorodithioates have a length of from about 20-35 oligonucleotides.
15. A method according to Claim 12, wherein the pH of the elution buffer is about 7.5.
16. A method according to Claim 9, further comprising desalting the eluant by tangential flow filtration.
17. A method of purifying DMT-on oligonucleotide phosphorothioates and phosphorodithioates comprising hydrophobic interaction chromatography.
18. A method according to claim 17 wherein the hydrophobic interaction chromatography comprises column chromatography using a phenyl sepharose or TSK
phenyl-5PW resin.
phenyl-5PW resin.
19. A method according to claim 17 wherein the oligonucletides have length of
20. A method according to Claim 18, wherein the salt is ammonium acetate that is present in concentrations of about 0.75 M.
21. A method purifying DMT-on oligonucleotide phosphorothioates and phosphorodithioates comprising removing excess ammonium hydroxide from an oligonucleo-tide solution by the method of claim 19.
22. A method of purifying DMT-on oligonucleotide phosphorothioates and phosphordithioates comprising separating DMT-on oligonucleotides from DMT-off oligonuc-leotides by the method of claim 19.
23. A method of purifying DMT-on oligonucleotide phosphorothioates and phosphorodithioates comprising concomitantly removing excess ammonium hydroxidefrom an oligonucleotide solution and separating DMT-on oligonucleotides from DMT-off oligonucleotides by the method of claim 19.
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US27058294A | 1994-07-05 | 1994-07-05 | |
| US08/270,582 | 1994-07-05 |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CA2194350A1 true CA2194350A1 (en) | 1996-01-18 |
Family
ID=23031908
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CA 2194350 Abandoned CA2194350A1 (en) | 1994-07-05 | 1995-06-30 | Purification of oligodeoxynucleotide phosphorothioates using deae 5pw anion ion-exchange chromatography and hydrophobic interaction chromatography |
Country Status (5)
| Country | Link |
|---|---|
| EP (1) | EP0765334A1 (en) |
| JP (1) | JPH10505577A (en) |
| AU (1) | AU2952395A (en) |
| CA (1) | CA2194350A1 (en) |
| WO (1) | WO1996001268A1 (en) |
Families Citing this family (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US6087491A (en) | 1993-01-08 | 2000-07-11 | Hybridon, Inc. | Extremely high purity oligonucleotides and methods of synthesizing them using dimer blocks |
| SE9500183D0 (en) * | 1995-01-20 | 1995-01-20 | Pharmacia Biotech Ab | Method for the purification of short nucleic acids |
| ES2134157B1 (en) | 1997-11-05 | 2000-03-01 | Cuartero Angel Mejuto | ELECTRONIC TACHOGRAPH SYSTEM AND ITS FIXED EQUIPMENT. |
| DE69922740T2 (en) * | 1998-05-11 | 2005-12-08 | Tosoh Corp., Shinnanyo | Method for the separation of nucleic acids by liquid chromatography |
| JP7075359B2 (en) * | 2016-06-14 | 2022-05-25 | バイオジェン・エムエイ・インコーポレイテッド | Hydrophobic interaction chromatography for purification of oligonucleotides |
Family Cites Families (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO1994000214A1 (en) * | 1992-06-19 | 1994-01-06 | Sepracor Inc. | Passivated and stabilized porous supports and methods for the preparation and use of same |
-
1995
- 1995-06-30 JP JP8503914A patent/JPH10505577A/en active Pending
- 1995-06-30 AU AU29523/95A patent/AU2952395A/en not_active Abandoned
- 1995-06-30 WO PCT/US1995/008175 patent/WO1996001268A1/en not_active Application Discontinuation
- 1995-06-30 EP EP95925363A patent/EP0765334A1/en not_active Withdrawn
- 1995-06-30 CA CA 2194350 patent/CA2194350A1/en not_active Abandoned
Also Published As
| Publication number | Publication date |
|---|---|
| EP0765334A1 (en) | 1997-04-02 |
| AU2952395A (en) | 1996-01-25 |
| WO1996001268A1 (en) | 1996-01-18 |
| JPH10505577A (en) | 1998-06-02 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| AU691574B2 (en) | Process for producing endotoxin-free or endotoxin-poor nucleic acids and/or oligonucleotides for gene therapy | |
| EP0649853B1 (en) | Modified glass fiber membranes useful for DNA purification by solid phase extraction | |
| US5183885A (en) | Method for chromatographic separation of synthetic phosphorothioate oligonucleotides | |
| KR100688349B1 (en) | Methods of DNA Purification and Purified DNA | |
| JP3379758B2 (en) | Enhancement of transfection efficiency of nucleic acid using aqueous solution containing isopropanol | |
| EP0282042A2 (en) | Fusion proteins and their purification | |
| EP0804448B1 (en) | Method for the purification of short nucleic acids | |
| US6750333B1 (en) | Process for preparing purified nucleic acid and the use thereof | |
| JP2005520547A (en) | Purification method for oligonucleotides and analogs thereof | |
| CA2194350A1 (en) | Purification of oligodeoxynucleotide phosphorothioates using deae 5pw anion ion-exchange chromatography and hydrophobic interaction chromatography | |
| EP0755400A1 (en) | Purification of oligodeoxynucleotide phosphorothioates using anion exchange chromatography | |
| Swiderski et al. | Polystyrene reverse-phase ion-pair chromatography of chimeric ribozymes | |
| JP2007519407A (en) | Method for chromatographic separation of nucleic acid mixtures | |
| Ravikumar et al. | Large-scale synthesis of oligodeoxyribonucleotide phosphorothioate using controlled-pore glass as support | |
| Deshmukh et al. | Purification of antisense oligonucleotides | |
| EP1578968B1 (en) | Isolation of antisense oligonucleotides | |
| US20050136458A1 (en) | Method for nucleic acid preparation | |
| CN117143165A (en) | Oligonucleotide purification method | |
| WO1998027425A1 (en) | Large-scale purification of full length oligonucleotides by solid-liquid affinity extraction | |
| Jansen et al. | SEPARATION OF PROTEINS AND NUCLEIC ACIDS USING" TENTACLE-TYPE" ION EXCHANGERS |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| FZDE | Dead |