CA2186242A1 - Gene-therapeutic process using antibiotic-resistance gene-free dna vectors - Google Patents

Abstract

Use of a vector DNA for the production of a pharmaceutical agent for the treatment of mammals or humans by gene therapy in which the vector DNA causes a modulation, correction or activation of the expression of an endogenous gene or the expression of a gene introduced into the cells of the mammal or human by the vector DNA, which is characterized in that the vector nucleic acid does not contain an active antibiotic resistance gene or one which is relevant for humans.
Such a vector DNA is particularly suitable for treatment of the respiratory tract, the intestinal tract and the skin by gene therapy.

Description

21 ~62~2 BOE3RrNGER MANNu7~TM Gmbl 3955/OB/WO
ene thQrapy method u~7ing DNA vector3 whioh arc free from antibiotic re~i3tanco gene~
The invention concerns the use of vector DNA which is free from antibiotic resistance genes in gene therapy as well as the use of these vectors for the production of pharmaceutical agents for gene therapy.
The gene therapy of somatic cells can be carried out for example using retroviral vectors, other viral vectors or by non-viral gene transfer (for review cf. T. Friedmann, Science 244 (1989), 1275, Morgan 1993, RAC DATA
MANAf.7~M~NT Report, June 1993) .
Vector systems suitable for gene therapy are ~for example retroviruses (Mulligan, R.C. (1991) in Nobel Sy717posium 8: Ethiology of human disease at the DNA level (Lindsten, J. and Pattersun Editors), pages 143 - 189 Raven Press), adeno associated virus (McLughlin, J.
Virol. 62 (1988), 1963), vaccinia virus, (Moss et al., Ann. Rev. Immunol. 5 (1987), 305), bovine papilloma virus, (R~cr 7cs~n et al., Methods Enzymol. 139 (1987), 642) or viruses from the herpes virus qroup such as the Epstein Barr virus (Margolskee et al., Mol. Cell. Biol.
8 (1988), 2937) or herpes simplex virus.
Non-viral delivery systems are also known. "Naked"
nucleic acid, preferably DNA, is usually used for this or nucleic acid together with an auxiliary substance such as e.g. with transfer reagents (liposomes, dendromers, polylysine transferrin con~ugates (Wagner,

- 2 - 21~62~2 l9gO), (Felgner et al., Proc. Natl. Acad. Sci. USA 84 ( 1987 ), 74 13 ) .
In order to provide the nucleic acid that can be used for gene therapy in a therapeutic amount, it is necessary to multiply these nucleic acids before the therapeutic application. This involves at least one selection step which utilizes a marker gene located on the nucleic acid and its gene product. Common selection markers are for example genes which mediate resistances to antibiotics such as ampicillin, chloramphenicol, erythromycin, kanamycin, neomycin and tetracycline (Davies et al., Ann. Rev. Microbiol. 32 (1978) 469).
Several protocols for gene therapy are already known which are either still at the stage of animal experiments (Alton, 1993; 170 93/1224; Hyde, 1993, Debs, 1991) or are already in clinical trials on patients (Nabel, 1993, 1994). A vector based on pBR322 or pUC18/19 is usually used in these protocols which carries an ampicillin resistance gene as the bacterial selection marker.
l~hen nucleic acids are administered in a gene therapy treatment bacteria present in the respiratory and digestive tract and on the skin may take up the nucleic acids. ~owever, when the marker is an active antibiotic-resistance gene this may produce an antibiotic resistance in the patient as an undesired side effect.
This is particularly disadvantageous when cystic fibrosis is treated by gene therapy. In this case large amounts of vector nucleic acid are administered to the patient as plasmid DNA or as an aerosol using liposomes as a transfer reagent (Alton 1993).

~ 3 - ?186242 Patients with a cystic fibrosis illness usually additionally suffer from bacterial infections of the respiratory organs with for example Pseudomonas aeruginosa, Staphylococcus aureus, Haemophilus influenzae which are usually treated by administering antibiotics such as penicillin. Hence a resistance of the patients to these antibiotics is disadvantageous.
The previously described protocols for CF gene therapy by means of CFTR plasmid/liposome con~ugates and publications of in vitro or animal experiments use vectors based on pUC18/19 or pBR322 which contain the ampicillin resistance gene as the bacterial selection marker (Alton, 1993: WO 93/1224; Hyde, 1993).
The common E. coli vectors based on pUC or pBF~ with the ampicillin resistance gene (Nabel, 1992; Lori, 1994;
Cotten, 1994; Lew, 1994 etc. ) are also used in the other in-vivo gene therapy protocols and publications of in vitro or animal model studies with naked DNA or DNA/transfer system conjugates.
The invention concerns the use of a vector DNA to produce a pharmaceutical agent for the treatment of mammals or humans by gene therapy in which the vector causes a modulation, correction or activation of the expression of an endogenous gene or the expression of a gene introduced into the cells of the mammal or the human by the vector DNA which is characterized in that the vector nucleic acid contains no active antibiotic resistance gene.
The pharmaceutical agent is preferably administered as an aerosol.
, ~ 4 ~ 2 ~ ~6242 A vector DNA i5 particularly preferably used which can correct a defect gene, introduce an lntact gene or be exchanged at the correct gene locus. A vector DNA within the meaning of the invention is understood as a non-viral DNA molecule based on a prokaryotic plasmid. This DNA molecule additionally contains the DNA to be transferred in the gene therapy process which is preferably an expressible gene.
Non-viral DNA within the meaning of the invention is understood to mean that this DNA is not a component of an infectious viral particle and does not contain an intact viral genome. However, the non-viral DNA can contain viral sequences such as e.g. regulation sequences (e.g. promoter, enhancer), transcription stops, origins of replication or viral genes such as e . g. the thymidine kinase gene from the herpes simplex virus .
Such vector DNA is particularly preferably used for the treatment of cystic fibrosis in humans. A gene suitable for this i6 described for example in WO 91/02796. This also describes the production and use of vectors for the treatment of cystic fibrosis by gene therapy.
The DNA vectors are particularly suitable for gene therapy treatments in which the vectors come into direct contact with surfaces in mammals or humans. Such surfaces are for e~cample the respiratory and digestive tract and the surface of the skin.
The invention in addition concerns a vector DNA which contains a gene or gene fragment which causes the activation, modulation or correction of the expression 2 ~ ~624~
of an endogenous cystic fibrosis gene (CFTR gene, cystic fibrosis transmembrane eonductanee regulator gene) in mammalian cells or eontains a CFTR gene whieh, after mammalian cells have been transfected with the vector DNA, results in the expression of this gene which is eharaeterized in that this veetor additionally contains an inactivated antibiotie resistanee gene or a gene whieh eodes for an auxotrophic marker.
Nueleic aeids which are suitable aeeording to t~le invention ean be preferably prepared by the following proeess:
1. Plasmids with a neutral marker:
- These ean be prepared by deletion of the resistanee gene (e.g. Amp) in vectors (e.g. pUC 18 or pBR 322) and introduetion of a neutral marker which does not mediate antibiotic resistance.
- The vectors carry for example the lacZ gene fragment from pUC18 as a neutral marker which forms a functional B-galaetosidase by a-complementation in an appropriate E. coli strain, e.g. XLl-blue, which can be deteeted by blue-stained colonies on X-Gal agar.
This enables the stability of the plasmid construct to be examined. It is expedient to carry out the fermentation in eomplete medium.
2. Plasmids with an auxotrophie marker:
- Introduction of for example a leu, thi, pro or bio gene (coding for a leueine, proline or biotin -- 6 - 2 ~ 8 6242 synthesis gene) in a vector and transformation of the plasmid construct obtained in an E. coli strain which has a defect in the corresponding leu, pro or bio gene. The auxotrophy marker gene coded by the plasmid complements the defect.
- The preculture is grown under selection pressure in a minimal medium without leucine, proline or biotin.
- It is expedient to ferment the main culture in complete medium. However, it is necessary to previously ensure that the plasmid constructs have an adequate stability. If the plasmid is for example transferred to bacteria of the lung flora, these cannot utilize the transferred auxotrophy marker.

3. Antibiotic resistance marker (ABR):
Suppression of inactivated antibiotic resistance genes:
An insertion of 1 to 2 amber stop codons (UAG) instead of glutamine codons ( in the case of supE) or of tyrosine codons (in the case of supF) leads to a premature translation stop and thus to a nonsense gene product. An ABR gene can be inactivated in this manner. An ABR gene inactivated by amber stop codon insertions is suppressed in the presence of supF-tRNAs ( incorporation of tyrosine at the amber stop) or supE (incorporation of glutamine at the amber stop) i . e . a functional gene product (ABR) i s f ormed .
There are 2 possibilities for introducing safe resistance markers in therapeutic plasmids:
-~ 7 - 2~86242 Insertion of the ABR gene inactivated by amber stop codons instead of Amp, e.g. in pUC or pBR vectors, and transformation of the plasmid obtained in an E. coli strain which has chromosomally coded supE or supF
suppressor tR~A genes. This enables a selection of the transformants obtained on a medium containing antibiotics. If such plasmid constructs are taken up by bacteria of the lung flora, the inactiYated ABR genes that are taken up cannot be completely read and thus do not mediate an ABR.
Insertion of the supF tRNA gene (Seed, 1983) which is only 203 bp in size instead of a bacterial resistance gene and insertion of the ABR gene inactivated by an amber stop codon into the chromosome of the E. coli production strain. The plasmid-coded supF tRNA
suppresses the ABR inactivated by amber stops which is present in the chromosome and enables growth of the E. coli production strain on an appropriate antibiotic medium. The plasmids obtained are without ABR genes i . e.
there i5 for example no risk of transferring ABR genes into bacteria of the lung flora.

4.
It is also preferable to clone a gene cassette in an E. coli-specific bacteriol~haqe YeCtor e.g. M13mpl8 which is acceptable for humans, does not carry an ABR gene and which can be provided in high yield as ds-DNA. If the phage vector is taken up by for example bacteria of the lung flora, then no adverse effects would be expected.
An important appl ication is the improved treatment of cystic fibrosis by gene therapy. Previously known methods for the treatment of cystic fibrosis are , _ _ _ _ . .. .. ..

- 8 - ~ 86242 described for example in W0 91/2796. A CFTR gene 6uitable for gene therapy is also described there.
Cystic fibrosis i5 a serious monogenetLc, autosomally recessive hereditary disease with a frequency of 1/2500 births. It is characterized by a deficient electrolyte transport of the epithelial tissue membrane w~lich leads to abnormalities in the function (dysfunction of exocrinal glands) of the respiratory tract, pancreas ( increased production and increased viscosity of the secretory product of mucous glands~, sweat glands ( increased electrolyte content in the sweat and concomitant loss of liquid and electrolyte) and gonads.
Respiratory insuf f iciency due to an inadequate secretion of chloride ions into the bronchial mucus by cells of the epithelium of the respiratory organ represents the most frequent clinical manifestation and cause of death in CF patients. It has been possible to clone the gene responsible and to characterise the gene product as a cyclic adenosine monophosphate (cANP)-dependent chloride ion channel protein (CFTR = Cystic Fibrosis Transmembrane Conductance Regulator) (W0 91/2796).
Knowledge of the pathophysiology of the disease, the structure and function of CFTR and mutations related to disorders of CFTR function nowadays enables various gene therapy approaches to be carried out in addition to classical therapeutic methods which are not very effective.
Two methods have been used in registered and current clinical protocols for CF therapy. According to the first procedure, the CFTR gene is administered by means of inhalation of CFTR adenovirus vectors. Adenoviruses naturally infect the lung epithelium. First clinical successes have been achieved with this method but only - 9 - 2 ~ ~6~42 for a short time period of a few weeks and with undesired toxic side effects (Zabner & ~elsh, 1993) The second method comprises introducing CFTR plasmids complexed with cationic liposomes ~nto the respiratory tract by means of inhalation (Alton, 1993). In this case ca. 1 mg plasmid DNA/mouse is administered to mice: in the case of humans the plasmid doses are in the range of 300 - 500 ~g plasmid/patient which corresponds to a number of ca. 5 x 1013 DNA molecules at a plasmid size of 8.2 ko (Alton, 1993; ~hitsett, 1992). This application and dosage is also preferred according to the invention.
The lung epithelial cells can only take up a small amount of the introduced amount of plasmid. It is to be expected that the major portion of the plasmid is either exhaled or swallowed by the patient i. e. that a large amount reaches the environment (patients in hypobaric safety rooms) and the gastro-intestinal tract of the patient .
Various bacterial genera are located in the lung flora some of which can manifest themselves as opportunistic pathogens e.g. Pseudomonads, Haemophilus, Enterobacteriaceae, Staphylococci etc. (Manual of Clinical Microbiology, Balows, l991).
A bacterial colonisation of the viscous, protein-rich secretion in the region of the respiratory passages which is strongly increased in CF patients, is a frequent cause of severe cases of bronchitis and pneumonia. CF patients are exposed above all to infections of the bronchi and lungs by Haemophilus influenzae, Pseudomonas aeruginosa and Staphylococcus _ _ _ , _ . , .. .. .. . . _ - - lo 2 1 8~242 aureus (Cystic Fibrosis, Dodge, 1993, Fritz Simmons, 1993) which is why they have to be subjected to antibiotic treatments in frequent succession.
The most important antibiotics for this are penicillin and its derivatives, ampicillin (H. influenzae) and carbenicillin (P. aeruginosa, B-lactamase sensitive penicillin derivative, Davis 1980). Due to widespread penicillin resistances, the B-lactamase resistant penicillin derivatives (methicillin, oxacillin, cephalosporin and chemotherapeutic agents) are particularly important in the case of S. aureus.
In addition other pathogens are of importance in the case of lung infections e . g . Streptococcus pneumoniae (=pneumococci) the most common pathogenic agent causing bacterial pneumonia and Enterobacteriaceae (e. g.
Klebsiella pneumoniae), penicillin being the most important therapeutic agent, particularly in the case of pneumococci (Davis, 1980).
Enterobacteriaceae and Enterococci are present among others in the gastro-intestinal tract (Balo~s, l9gl).
Penicillin and its derivatives also play a central role in the treatment of intestinal infections which are caused by Enterobacter, E. coli, Serratia and Streptococcus faecalis (Davis, 1980).
Already in 1944 Avery (Avery, 1944) described the uptake of high molecular DNA by Pneumococci from the medium, a process which is denoted a natural competence, plays an important role in bacterial evolution and is therefore widespread in the bacterial kingdom. Physiological transformation was observed in the genera Haemophilus, _ _ _ , , .. , . , , _, . _ . _ _ . , . , . . ,, . , , , _ _ _ _ .. _ .. .

11 - 21 8G2~2 Streptococcus, Stapl~ylococcus, Neisseria, Bacillus and Acinetobacter (Davis, 1980~. As a result Pseudomonads in which horizontal gene transfer is widespread are also able to take up high molecular DNA from the medium.
Bacteria of the natural flora of humans (respiratory tract, gastro-intestinal tract, skin, mucous membranes, eye etc. ) are thus able to take up plasmid DNA. The DNA
which is taken up can become inteqrated into the cell ' s own DNA (chromosome, plasmids) by recombinant events and thus come under the control of a promoter of the host i . e. be expressed.
When ca. 300 - 500 ug plasmid DNA/CF patient is administered (which corresponds to ca. 5 x 1013 molecules at a plasmid size of 8.2 kb; Alton 1993) there is a risk that antibiotic-resistant organisms form among the bacteria of the lung flora and also in other regions of the body. As already stated, the production of antibiotic resistances and especially an ampicillin resistance (B-lactamase) is particularly disastrous for CF patients who suffer especially from bacterial lung infections and have to be continuously co-treated with antibiotics, in particular because the methods of gene therapy previously used still do not result in complete healing or a persistent correction.
In addition it is not possible to rule out that the ampicillin resistance gene introduced with the CFTR
plasmid may become integrated into the patient ' s DNA, be expressed there under the control of one of the cell ' s promoters and the gene product be secreted actively or passively (e.g. cell lysis in the case of inflammatory reactions). The locally released B-lactamase could impede a penicillin therapy even in the case of a general bacterial infection.
The use according to the invention of DNA vectors which are free from antibiotic resistance genes is also advantageous in the treatment of AIDS (~ori & Gallo, 1994) or cancer patients (Nabel, 1993) by gene therapy, since in both cases the patients are usually immunosuppressed by the clinical syndrome itself (in the case of AIDS) or by therapy with chemotherapeutic agents or by radiotherapy (in the case of cancer). Bacterial infections in these patients can be prevented or brought under control by antibiotic treatment.
Apart from the lung and the respiratory tract, gene therapy approaches must also be considered for the treatment of other tissues under the aspects described above:
Muscle tissue: gene therapeutic plasmids can for example be injected directly into muscle tissue (Ulmer, 1993:
Davis, 1993; I.ew, 1994) or into tumours (immuno-stimulation for tumour vaccination; Nabel, 1993; San, 1993) for in vivo vaccination. Therapeutic plasmids have previously been injected in low doses for this which is why the in~ected plasmid DNA only remained localized around the injection channel. In order to obtain systemic reactions it is not possible to avoid a larger dosage or a systemic administration of the therapeutic plasmids. This then results in a spread of the plasmid DNA in the blood system.
Blood system: Con~ugates of plasmid DNA/polylysine/liver targeting groups (Chiou, 1994) can be administered ,, _ ... . ... ...

intravenously for gene therapy in the liver. This results in a spread of the plasmid DNA in the blood system .
In both cases (muscle tissue, blood system) the introduced plasmids can reach bacterial focL, be taken up by these bacteria and impede antibiotic therapy when an infection breaks out.
Intestine: Conjugates of a therapeutic plasmid (e.g.
with a tumour suppressor gene) can be introduced directly into the intestine for gene therapy ~Arenas, 1994). Gene delivery of, for example, genes which code for the LDL receptor Yia the intestinal mucous membrane is also under consideration. Introduced plasmids can transfer the antibiotic resistance gene to the bacteria of the gastro-intestinal tract.
Skin: Plasmid DNA can be taken up directly in skin cells as a con~ugate with liposomes e.g. for t~le gene therapy of melanoma or haemophilia B (factor IX, X) (Alexander, 1994). In thls way it is possible for bacteria of the skin flora to obtain antibiotic resistances.
Eye: Persistent virus infections of the eye can be treated by gene therapy using therapeutic plasmids which involves the risk of transferring antibiotic resistances to the bacteria of the eye flora, In a further preferred embodiment of the invention a vector DNA is used which contains a gene or gene fragment which causes the modulation, activation or correction of an endogenous cystic fibrosis gene in human cells or which contains a cystic fibrosis gene - 14 - 2~86242 which is characterized in that this vector DNA contains a resistance gene for hygromycin, chloramphenicol, spectinomycin, blasticidin S, phleomycin, bleomycin, puromycin, apramycin or tetronasin as the antibiotic resistance gene. These antibiotic markers are only of limited clinically releYance in the human domain since the corresponding antibiotics are not usually used for humans ~for example hygromycin, HygR; veterinary medicine, is not in the "Rote ~iste"; Rote Liste, 1994;
Gritz, 1983 or chloramphenicol resistance CmR is only for an isolated, very special applicatLon in the case of life-threa'cening infections; "Rote ~iste", 1994~.
The plasmid amplification can also preferably be carried out with erythromycin or spectinomycin.
The following are also preferred:
~) Vectors with a hygromycin resistance marker (see above: hygromycin 8 phosphotransferase gene) Hygromycin B has no clinical relevance for humans. It is only used in veterinary medicine. The use of a HygR
marker gene in a therapeutic plasmid does not result in resistances to clinically relevant antibiotics when the plasmid is transferred to bacteria of the natural body fluid .
b) Vectors with a spectinomyain resistance marker ~O-adenyltransfera3e gene) Spectinomycin only plays a minor role as an antibiotic.
Only one spectinomycin preparation for gonococcal - 15 ~ 2 t ~G242 infections has been licensed ("Rote Liste"). The use of a spectinomycin marker gene in a therapeutic plasmid does not result in resistances to clinically relevant antibiotics when the plasmid is transferred to bacteria of the natural body flora.
c) Veators with a chloramphenicol resistance marker ~chloramphe~lcol acetyl transferase ge~e~
Chloramphenicol has only limited clinical relevance. It i5 only used in isolated, very special cases for life-threatening infections e.g. rickettsias, typhus, paratyphus, salmonella sepsis and meningitis. The use of a CmR marker gene in a therapeutic plasmid does not result in resistances to clinically relevant antibiotics when the plasmid is transferred to bac~eria of the natural lung flora.
d) Vectors with a bla~tlcidin ~ resistance marker (B8 ~eaminase) BS is used as a microbial fungicide (Kamakura, 19871. It has no relevance at all as a therapeutic antibiotic in humans. BS acts in bacteria as well as in eukaryotes by inhibiting protein biosynthesis. It has been possible to clone and express the corresponding resistance gene, BS
d~m~ ~se (a nucleoside aminohydrolase), from Bacillus cereus K55-Sl in E. coli and B. subtilis. E. coli transformants are resistant to a dose of 200 ug/ml (Kamakura, 1987).
The BS resistance gene can therefore be used as a safe selection marker gene in a therapeutic plasmid. No problems at all are to be expected with the formation of resistances when transferred to bacteria of the human body flora since BS is not licensed for therapy in humans .
e) Vectors with a phleomycin~bleomycin re~i3tance marker Bleomycin and phleomycin act on prokaryotes as well as on eukaryotes by causing strand breaks at specific sites of the cellular DNA. Only bleomycin is clinically relevant despite its high lung toxicity but not as an antibiotic, but rather as a cytostatic agent for the therapy of various human cancer types. It was possible to clone and express various BleR resistance genes in E. coli which presumably prevent the DNA from being cut by binding to bleomycin/phleomycin. E. coli transformants could be selected on medium containing bleomycin or phleomycin (1 ~g/ml phleomycin) (Mulsant, 1988) .
The BleR genes are therefore safe selection marker genes for therapeutic plasmids. No problems at all are to be expected with the formation of resistances when transferred to bacteria of the human body flora since bleomycin/phleomycin are not licensed for therapy in humans .
f) Vectors with a puromycin re3istanc~ marker Puromycin is an aminoglycoside antibiotic which inhibits peptide chain extension during translation by interacting with the A site of the large ribosomal 3ubunit o~ prokaryotic (70S) and eukaryotic (~0S) ribosomes. Puromycin can also be used as a dominant - 17 - 2 1 ~624~
marker in eukaryotes; it therefore has no relevance at all in human medicine as a therapeutic antibiotic due to its high toxLcity. Puromycin is produced by Streptomyces alboniger from which it is also possible to clone and express the puromycin resistance gene ~PacR gene, a puromycin N-acetyl transferase) in Streptomyces lividans and E:. coli (Vara, 1985).
The PacR gene can be regarded as a safe selection marker gene for therapeutic plasmids. No problems at all are to be expected with the formation of resistances when transferred to bacteria of the human body flora since puromycin is not licensed for therapy in humans.
g) Veotors wlth an apramycin resistance marker Apramycin is an aminoglycoside antibiotic. It has no clinical relevance at all. An apramycin resistance plasmid has been described in E:. coli which carries an aminoglycoside-acetyltransferase gene (Hunter, 1992).
The apramycin resistance gene can be regarded as a safe selection marker gene for therapeutic plasmids. No problems at all are to be expected with the formation of resistances when transferred to bacteria of the human body flora since apramycin is not licensed for therapy in humans.
h) Vectors with a tetrona3in re~istance marker Tetronasin (Tn) is one of the ionophore-forming antibiotics. It i5 only relevant in veterinary medicine as a fodder antibiotic, but is not licensed for human medicine. A resistance gene to tetronasin was isolated from sacteroides ruminicola (Newbold, 1992). The - 18 - 2l86~2 tetronasin resistance gene can be regarded as a safe selection marker gene for therapeutic plasmids. No problems at all are to be expected with the formation of resistances when transferred to bacteria of the human body flora since tetronasin is not licensed for therapy in humans.
The invention i5 elucidated further by the following examples. A detaLled description of the experimental conditions is included in J. Sambrook, Molecular Cloning, Second Edition (1989) Cold Spring ~arbor Laboratory Press, New York.
The invention is further illustrated by the following examples, the figure and the sequence listing.
Fig. 1: shows the restriction map of p7~7Cl8 cmR/SuPE
13xample 1 .)etRnm7n~tiQn of thç u7~take ratç Qf Pla~mi~3 ald 7~rodY~tign Q~ Rntibiotic resist;7nres by bac~çri~ Qf the hl~777~n 1~7n~ and i ltestinal flQra It i5 intended to demonstrate that E. coli plasmid D~A
e. g. pUC18 or derivatives thereof, can be taken up by bacteria of other genera and that the ampicillin resistance gene can be expressed which leads to ampicillin-resistant clones. The probability of the formation of ampicillin-resistant microorganisms i~
determined by the uptake rate of plasmid DNA from the substrate and the ratc of incorporation of the ampicillin resistance gene by non-homologous 2 l 86242 recombination into the chromosomal DNA of the host bacterium. Plasmids with alternative markers or with markers inactivated by stop codons (see above) do not cause any further development of resistance.
The experiments are carried out on the following bacterial specLes:
Gram-negative:
Haemophilus influenzae Pseudomonas aeruginosa Klebsiella pneumoniae Escherichia coli (WT) Gram-positive:
Staphylococcus aureus Streptococcus pneumoniae For this various amounts of plasmid DNA were added under various conditions to cultures of the above-mentioned organisms .
Liquid cultures in nutrient medium are carried out using isotonic buffer (NaCl, Mg2+, Ca2+). Various concentrations of plasmid DNA (e.g. pUC18; with Ap~
gene) are added to these cultures. After incubation for several hours while shaking, antibiotic is added. It is incubated further, plated out on agar containing antibiotic and a dilution series is carried out on agar which does not contain antibiotic. The number of living organisms is det~r~i ned after incubation by counting and identifying or characterising the colonies obtained.

2 ~ ~6242 Alternatively a defined amount of plasmid and a defined germ count of bacteria are plated out on nutrient agar and incubated for several hours, antibiotic is added by spraying and the colonies obtained are counted and identified or characterized. It is also possible to apply a defined a~ount of plasrnid and a defilled germ count of bacteria on a nylon filter, and to incubate the filters for several hours on nutrient agar. Subsequently the filters are transferred onto nutrient agar containing antibiotic, incubated and the colonies obtained are cou=nted and identified or characterized.
Example 2 Construction Qf safç~Y vecto~s based on PUC18 Which nQ
longer 0s8çss an ampicilli~ selç~tiQn marker.
Bubs~itution of the ~r~icillin resis~ance gene (Am--1 pUC18 1. by the hygromycin resistance gene ~HygR~ ~rom pHPH0 The DNA sequence of the hygromycin resistance gene (Gritz, 1983) i5 stored in the EMBL data bank under EMBL1 . PJHPH.
- Amplification of pUC18 without the AmpR reading frame by means of PCR
primer 1 (pUC-U1~: bp 2483-2513 of PUC18.seq;
(SEQ ID NO:1)

5 ' CGAGTGAAGACACCATGGTCTTCCTTTTTCAATATTATTGAAG*) primer 2 (pUC-~): bp 1628 - 1606 of PUC18.seq;
(SEQ ID NO:2) - 21 - 2 ~ ~ 62 42 5 ' GGACTAGATCTGCTAGCTAACTGTCAGACCAAGTTTA~TÇ
restrlction of the ampl i f icate with NcoI/NheI
preparative agarose gel ~ cutting out the pUC 18 ampl i f icate ligation with the HygR amplificate Amplification of the HygR reading frame from p~iDH0 by means of PCR
primer 3 (HygR-U): bp 260 - 278 of PHP~O.seq (SEQ ID N0:3) 5 ' GCTGTAGATCTCATGAAAAAGCCTÇAACTÇAC~GCGACG
primer 4 (HygR-L): bp 1257 - 1276 of PHPHO.seq;
(SEQ ID N0:4) 5 ' CGACAGATCTGCTAGCTCATTATTÇCTTTG~C~TCGGAÇG
restriction of the amplificate with BspHI/NheI
preparative agarose gel + cutting out the HygR
ampl i f icate ligation with the pUC18 amplificate (see above) Transformation in E. coli XL1 blue and selection on medium containing hygromycin B (125 ~lg/ml) isolation of the resulting plasmid DNA pUC18-HygR
sequence analysis of pUC18-HygR
Underlined region of the primer binds to the DNA
template Insertlon of stop codons into thc reading ~rame o~
HygR
Amber stops (UAG) were introduced into the reading frame the HygR gene of pUC18-HygR by means of PCR.

SupF suppresses better than supE: amber stops which are followed by a G or A are suppressed better than when a T
or C follows. Therefore point mutations were introduced by means of mutated PCR primers at two advantageously located (near to a single restriction site) tyrosine codons (TAT or TAC).
1. Tyr codon at position 640-642 (EMBLl.PJHPH) of TAC to TAG (=amber stop) primer 8 (pUC18-HygR-Mut640) (SEQ ID NO:8) - 5 ' GCAGATCTCGG~CCGSAAGGAATCGGTCAATAGACTACATGGCG
- PCR with universal sequencing primer against pUC18-HygR template - restriction of the amplificate and pUC18-HygR with RsrII/NheI
- preparative agarose gel; elution of the 600 bp amplificate and the larger fragment of pUC18-HygR
- ligation of both fragments - transformation in E. coli ER1458 (supF) and selection on agar medium containing hygromycin B (125 l~g/ml) - isolation of the plasmid DNA of pUC18-Hy~R-Mut640 - I~NA sequence analysis of pUC18-HygR-~lut640 2 . Tyr codon at position 1003-1005 (EME~L1. PJHPH) of TAT
to TAG
primer 9 (pUC18-HygR-MutlO03) (SEQ ID NO:9) -- 5 ' GCAGATCTCCGC~GCTCC~GGCGTAÇATGCTCCGC
- PCR with universal sequencing primer against pUC18-HygR-Mut640 template - restriction of the amplificate and pUC18-HygR-Mut640 with KspI/NheI
- preparative agarose gel: elution of the 240 bp amplificate and the larger fragment of pUC18-HygR-Mut640 - ligation of both fragments - 23 - 2 ~ 862~2 - transformation in E. coli FR1458 ~supF) and selection on agar medium containing hygromycin B (125 ,ug/ml~
- isolation of plasmid DNA of pUC18-HygR-Mut640+1003 - DNA sequence analysi~ of pUC18-HygR-Mut640+1003 Both plasmids, pUC18-HygR-Mut640 and pUC18-HygR-Mut640 +1003, are checked in E. coli ER15G2 (supF-, supE-).
Both plasmids should no longer mediate hygromycin B
resistance .
3. by the auxotrophy Inarker operon proAB
The DNA sequence of the proAB operon (Deutch, 1984) is stored in the EMBL data bank under EMBLl . ECPROAB .
a) for the cloning of the proAB operon with a proB
Shine-Dalgarno (SD) region (use of the promoter without SD of AmpR) - ampli~ication of pUC18 wi~hout AmpR and without SD by means of PCR
primer 5 (pUC-U2) :bp 2500-2524 of pUC18 .seq;
(SEQ ID NO:5) 5 ' CGAGTGAAGACACCATGGCAATATTATTGAAGCATTTATCAGG
primer 2 (pUC-L): bp 1628 - 1606 of pUC18 . seq;
(SEQ ID NO: 2) 5 ' GGACTAGATCTGCTAGCTAACTGTCAGACCAAGTTTACTC
- restriction of the amplificate with NcoI/NheI
- preparative agarose gel + cutting out the pUC18 -ampl i f icate - ligation with the amplificate of the proAB operon (see below) - Amplification of the proAB operon (with the proB SD
region) from E. coli K12 wild-type DNA by means .

Of pCR
primer 6 (proAB-U) :bp 341 - 362 of ECPROAB.EMBL1;
(SEQ ID NO: 6) 5 ' GCTGTAGATCTCCATÇGCAGAGAATCATGAGTGAC
primer 7 (proAB-L) :bp 26~2 - 2672 of ECPROAB.EMBLl:
(SEQ ID NO:7) S ' CGACAGATCTGCTAGCTCATTACGCACGAATGÇTGTAATC
restriction of the amplificate with NcoI/NheI
preparative agarose gel + cutting out the proAB
amplificate ligation with the pUC18-amplificate (see above) transformation in E. coli JM83 (~lac-pro) selection of the proAB+ clones on minimal medium withQut proline isolation of the resulting plasmid DNA
pUC18-proAB (SD) sequenc~ analysis of pUC18-proAB~SD) for cloning the proAB operon without a proB SD region (use of promoter + SD region of AmpR) amplification of pUC18 without the AmpR reading frame by means of PCR
primer 1 (pUC-U1) and primer 2 (pUC-L) (see above) restriction of the amplificate with NcoI/NheI
preparative agarose gel + cutting out the pUC18 ampl i f icate ligation with the amplificate of the proAB operon (without proB SD region) (see below) Amplification of the proAB operon with the same primers as in 2 . a) (primer 6 (proAB-U) and primer 7 ~proAB-L) ) restriction with Bsp~ cuts downstream of the SD
region directly at the translation start of proB) and NheI

- preparative agarose gel + cutting out the proAB
amplificate - ligation with pUC18 amplificate (see above) - transformation in E. coli JM83 (~lac-pro) - selection of proAB+ clones on minimal medium withQu~
prol ine - i301ation of the resulting plasmid DNA pUC18-proAB
- sec~uence analysis of pUC18-proAB
ProAB is present as an operon i . e. both genes of the proAB operon are transcribed starting at one promoter, firstly proB (~-glutamyl kinase, GK) then downstream proA (r-glutamyl phosphate reductase, GPR). GK and GPR
~orm a molecular complex which ensures the direct transfer of ~-glutamyl phosphate from GK to GPR (Deutch, 1984). The correct stoichiometric ratio of GK to GPR is therefore important for the activity of the complex. The relative expression rates of the individual components in an operon are also determined by the translation rates of the individual components. Thus two constructs of the proAB operon were prepared, one with homologous SD and one with SD of the AmpR gene.
4. Introducing the insert from pCMV-CFTR 936C (Alton, 19g3) w~th the CNV promotertenhancer and hum;m CFTR gene into the 3afety vector3:
- pUC18-HygR
- pUC18-prohB (8D~
- pUC18-proAB
- pUC18-HygR-Mut640 -- pUC18-HygR-Mut640~1003 Isolation, purification and DNA sequence analysis of the plasmid DNA of the constructs obtained.
m i n l ng the constructs obtained in the C~ in vitro model or CF mouse model in comparison to pC~V-CFTR 935C
(based on pUC18 with the AmpR gene).
Exampl~ 3 Insertion of an ~mh~r stQt) ~odon intQ thç re~linq fr~nQ
of thç ~lQr~mD~enicol a~tYl transferase qe~c, startlnq from p8U271~ (Martinc~ 8i3), ~nd ~ecloninq in PUC18~ R
- PCR mutaaenesis to supE/amber stop (~lutamine codons/CAA or CAG =:> UAG amber stop) - All process steps (PCR, DNA restrictions, ligations, E . coli transformation) were carried out according to Sambrook et al., (1989).
3.1 Amplifi~tiQn Qf thç ~at qene frQm pSU271~9 with all requlatcrY sicma~ ¢ Wçll as insertion of Rn ,~mher s~oP at ~osition bP = 103 1 nto ~:hQ rea~ i nq f~ r- of the ca~ aene primQr pair Ca~-supElQ3-1/2; (results in 470 bp f raqment) primer 1: bp 575-559 of pSU2720 (SEQ ID N0: 10) 5 ' GCACGGTCGACTCATGA TCCGGCGGTGCTTTTGC
primer 2: bp 115-138 of pSU2719 (SEQ ID N0:11) 5 ' GCAGGTCGACA5~AGTTATAGGTACA~TGAGC~AC
primçr Pair Cm-su~E103-~/~: (results in 625 bp fraqment) primer 3: bp 116-95 of pSU2719 (SEQ ID NO:12 5 ' CGACGTCGACTCTAGA ÇCGTTCAGCT~GATATTAC
~rimer 4, bp 1837-1858 of p~iU2719 (SEQ ID NO:13) 5 ' GCACGGGATCCTCATGAGAAC.ATCATCTTATTAATCAG
_ _ _ _ _ ... . . _ _ . _ .. .. .. . .......... ... .

2`~ ~624Z

- carrying out a first PCR each against pSU2719 with the primer pairs 1/2 and 3/4 - restriction of the PCR products of --> primer pair 1/2 with SpeI (0.47 lcbp DNA
fraqment) --> primer pair 3/4 with XbaI ( 0 . 62 bp DNA
f ragment) - ligation of both fragments results in 1.1 kbp DNA
fragment - second PCR via ligation with primers 1 and 4 - restriction of the PCR fragment with RcaI
3, 2 Restriction Qf ~T~C18 ~
- Restriction of pUC18 with RcaI results in 3 fragments: 1. 6 kbp, 1 kbp, 0. 1 kbp - isolation of the 1. 6 kbp fragment 3 . 3 Llqation gf the 1. 6 kbD ~UC18 fraqment witll thq 1,1 };hl) PCR fra,qment results in the circular plasmid 2 . 7 kbp in size called pUC18 cmR/suPE
(Fig. 1~
- Transformation of the ligated plasmid in E . coli DHl (ATCC 33849; supE44) and selection of the, by suppression of the amber stop, CmR clones on chloramphenicol agar plates (40 ~g/ml).
.4 Characterization of the resLIltinq pl~':mld CmR/supE by - DNA seguence analysis of the mutation site - Transformation in an E.coli strain containing no SupE suppressor mutation (E. coli JM83 (ATCC
35607: supE~ ) ) and selection on chloramphenicol agar does not result in any transformants because this strain is supE~, i.e., the CmR gene is - 28 - 2 ~ 86~2 inactivated here by the amber stop.
3 . 5 Recloning of the CMV-CFTR insert from pCMV-CFTR
936C in pUC18 cmR/suPE analogous to Example 2 . 4 Liter~ r~ referenae~: _ Alexander, M.Y., Bidichandani, S.I., Robinson, C.J.N.
and Akhurst, R.J.: "~reatment of Hemophilia B by Somatic Cell Gene Therapy Using Keratinocytes as a Gene Delivery System. " J. of Cellular Biochemistry 18A ~1994) Abstract Alton, E.W.F.W., Middleton, P.G., Caplen, N.J., Smith, S . N ., S t eel , D . M ., Munkong e , F . M ., J e f f e ry , P . R ., Geddes, D.M., Hart, S.L., Williamson, R., Fasold, K.I., Miller, A. D., Dickinson, P., SteYensOn, B.J., McLachlan, G., Dorin, J.R. and Porteus, D.J.: "Non-invasive liposome-mediated gene delivery can correct the ion transport defect in cystic fibrosis mutant mice". Nature Genetics 5 (1993) pp. 135-142 Arenas, R., Chmura, S.J., Otto, G. and Westbrook, C.A.:
"Genetic Modification of Rodent Gut Epithelium by Gene Therapy Using Liposomal Delivery Syster~s". J. of Cellular Biochemistry 18A (1984) Abstract DZ101 Balows, A., Hauser Jr., W.J., Herrmann, K.L., Isenberg, H.D., Shadomy, ~.J.: Manual of Clinical Microbiology, Fifth Edition (1991), American Society for Microbiology, Washington D. C.
Chiou, H.C., Merwin, J.R., Levine, S.M., Wimler, K.M., Salafia, M.A. and Spitalny, G.L.: "Expression of Secreted and Intracellular Proteins Following Receptor-Mediated Gene Transfer to Hepatocytes In Vivo. " J. of Cellular Biochemistry 18A (1994) Abstract DZ109 2 1 ~6242 Cotten, M., Wagner, E ., Zatloukal , K., Buschle, M., Chiocca, S., Plank, C., Zauner, W., Schmidt, W. and Birnstiel, N.L.: "Receptor-Mediated Gene Delivery." J.
of Cellular Biochemistry 18A (1994) Abstract DZ002 Davis, B.D., Dulbecco, R., Eisen, H.N. and Glnsberg, H.S.: Microbiology, Third Edition (1980), Harper International Edition DaYis, H.L., Demeneix, B.A., Quantin, B., Coulombe, J.
and Whalen, R.G.: "Plasmid DNA is Superior to Viral Vectors for Direct Gene Transfer into Adult Mouse Skeletal Muscle." Human Gene Therapy 4 (1993) pp.733-740 Debs, R.J., Zhu, N. and the Regents of the University of California: "Gene Therapy for Cystic Fibrosis Transmembrane Conductance Regulator Activity (CFTR) . " W0 93/1224; Al; 17.12.91 US;
Deutch, A.H., Rushlow, K.E. and Smith, C.J.:"Analysis of the Escherichia coli proAB locus by DNA and protein sequencing. " NAR 12 (1984~ pp. 6337-6355 Dodge, J.A., Brock, D.J.H. and Widdicombe, J.H.: Cystic Fibrosis, Current Topics, Volume 1 (1993), John Wiley &
Sons FitzSimmons, S.C.: "The changing epidemiology of cystic fibrosis." The Journal of Pediatrics 122 (1993) pp.l-9 Gao, L., Wagner, E., Cotten, M., Agarwal, C., Harris, C., Romer, M., Miller, L., Hu, P.-C. and Curiel, D.: "Direct In Vivo Gene Transfer to Airway Epithelium .. . ... _ . _ . . . .. _ _ . .

- 31 - 2 1 8 62~ 2 Employing Adenovirus-Polylysine-DNA Complexes. " Human Gene Therapy 4 (1993~ pp. 17-24 Gritz, I,. and Davies, J.: "~lasmid-encoded hygromycin B
resistance: the sequence of hygromycin B
phosphotransferase gene and its expression in Escherichia coli and Saccharomyces cerevisiae. " Gene (1983) pp. 179-188 Hunter, J.E.B., Shelley, J.C., Walton, J.R., Hart, C.A.
and Bennett, M.: "Apramycin resistance plasmids in Escherichia coli: possible transfer to Salmonella typhimurium in calves. " Epidemiol. Infect. 108 (1992) pp. 271-278 Hyde, S.C., Gill, D.R., Higgins, C.F., Trezise, A.E.O., MacVinish, L.J., Cuthbert, A.W., Ratcliff, R., Evans, M.J. and Colledge, W.H.: "Correction of the ion transport defect in cystic fibrosis transgenic mice by gene therapy. " Nature 362 ~1993) pp. 250-255 Jimenez, A. and Davies, J.: "Expression of a transposable antibiotic resistance element in Saccharomyces." Nature 287 (1980) pp.869 Kamakura, T., Kobayashi, K., Tanaka, T., Yamaguchi, I.
and Endo, T.: "Cloning and Expression of a New Structural Gene for Blasticidin S Deaminase, a Nucleoside Aminohydrolase. " Agric. Biol. Chem 51 (1987) pp. 3165-Lew, D. and Latimer, T.: "Long Term Persis~ence of Plasmid DNA after Intramuscular Injection in Mice. " J.
of Cellular Biochemistry 18A (1994) Abstract DZl20 Lori, F., Lisziewicz, J., Smythe, J., Cara, A., Bunnag, T.A., Curiel, D. and Gallo, R.C.:"Rapid protection against human immunodeficiency virus type 1 (HIV-1~
replication mediated by high efficiency non-retroviral delivery of genes interfering with HIV-1 tat and gag. "
Gene Therapy 1 (1994) pp.27-31 Morgan, R.A. and Anderson, lq. F.: "Human Gene Therapy. "
Annu. Rev. Biochem. 62 (1993) pp. 191-217 Mulsant, P., Gatignol, A., Dalens, M. and Tiraby, G. :"Phleomycin Resistance as a Dominant Selectable Marker in CH0 Cells. " Somatic Cell and Mol. Genetics 14 (1988) pp. 243-252 Nabel, G.I., Nabel, E.G., Yang, Z.-Y., Fox, B.A., Plautz, G.E., Gao, X., l~uang, L., Gordon, D. and Chang, A.E.:"Direct gene transfer with DNA liposome complexes in melanoma: Expression, biologic activity, and lack of toxicity in humans, " PNAS USA 90 (1993) pp. 11307-11311 Nabel, G.J., Fox, B.A., Post, L., Thompson, C.B., Woffendin, C. :"Clinical Protocol: A Molecular Genetic Intervention for AIDS - Effects of a Transdominant Negative Form of Rev. " Human Gene Therapy ~ (1994) pp.

2 ~ ~6242 Newbold, C.J., Wallace, R.J. and Watt, N. D.: "Properties of ionophore-resistant Bacterioides ruminicola enriched by cultivation in the presence of tetronasin. " J. of Appl . Bacteriol . 7 2 ( 19 9 2 ) pp 6 5 -7 0 Recombinant Advisory Committee (F~AC~ DATA MANAGEMENT
Report - June 1993; Human Gene Therapy 5 (1994~ pp. 135-Rote Liste 1994, Arzneimittelverzeichnis des BPI, ECV, Aulendorf/Wurtt .
San, H., Yang, Z.-Y., Pompili, V.J., Jaffe, M.L., Plautz, G.E., Xu, L., Felbner, J., Wheeler, C.J., Felgner, P.L., Gao, X., Huang, L., Gordon, D., Nabel, G.J. and Nabel, E.G.: "Safety and Short-Term Toxicity of a Novel Cationic Lipid Formulation for Human Gene Therapy. " Human Gene Therapy 4 (1993~ pp. 781-788 Seed, B.: "PuriIication of genomic sequences from bacteriophage libraries by recombination and selection in vivo. " NAR (1983) p. 2427-2445 Ulmer, J.B., Donnelly, J.J., Parker, S.E., Rhodes, G.H., Felgner, P.L., Dwarki, V.J., Gromkowski, S.H., Deck, R.R., DeWitt, C.M., Friedman, A., Hawe, L.A., Leander, K.R., Martinez, D., Perry, H.C., Shiver, J.W., Montgomery, D. L. and Liu, M.A.: "He~erologous Protection Against Influenza by in~ection of DNA Encoding a Viral Protein." Science 259 (1993~ pp. 1745-1749 2 ~ 86242 Wagner, E., Zellke, M., Cotten, M., Beug, H. and Birnstiel, M.L.: "Trans~errin-polycation conJugates as carriers for DNA uptalce into cells." PNAS llSA 87 (1990) pp. 3410-3414 Whitsett, J.A., Dey, C.R., Stripp, B.R., Wikenheiser, K.A., Clark, J.C., Wert, S.E., Gregory, R.J., Smith, A.E., Cohn, J.A., Wilson, J.M. and Engell~ardt, J.: "Human cystic fibrosis transmembrane conductance regulator directed to respiratory epithelial cells of transgenic mice. " Nature Genetics 2 (1992) pp. 13-20 Yoshimura, K., Rosenfeld, M.A., Nakamura, H., Scherer, E.M., Pavirani, A., Lecocq, J.-P. and Crystal, R.G.:
"Expression of the human cystic fibrosis transmembrane conductance regulator gene in the mouse lung after in vivo intratracheal plasmid-mediated gene transfer. " NAR
20 (1992) pp. 3233-3240 Zabner, J., Couture, L.A., Gregory, R.J., Grahem, S.N., Smith, A.E. and Welsh, M.J.: "Adenovirus-mediated Gene Transfer Transiently Corrects the Chloride Transport Defect in Nasal Epithelia of Patients with Cystic Fibrosis. " Cell 75 (1993) pp. 207-216 Zakharyan, R.A., Gasparyan, E.T. and Aposhyan, G.V.:
"Transport of a B-lactamase gene into human cells by artificial virus-like particles and its expression. "
Biol. Zh. Arm. (1982) pp. 730-734 Sambrook, J., Fritsch, E.F. and Maniatis, T.: Molecular Cloning, A Laboratory Manual. Second Edition.
Cold Spring Harbor Laboratory Press (1989) 2 t 8~2 Martinez, E., Bartolomé, B. and de la Cruz, F.:
pACYC184-derived vectors containing the multiple cloning site and lacZa reporter gene of pUC8/9 ans pUC18/19 plasmids. Gene 68 (1988) 159-162 2 ~ 86242 SEQUENCE LISTING
(1~ GENERAL INf~'ORMATION:
( i ) APPLICANT:
(A) NAl~fE: BOEHRINGER MANNI~EIM GMBH
(B) STREET: Sandhof-er Str. 116 (C) CITY: Mannheim (E) COUNTRY: Germany (F) POSTAL CODE (ZIP): D-68305 (G) TELEPHONE: 08856/60-34q6 (H) TE1EFAX: 08856/60-3451 ii) TITLE OF INVENTION: Gene therapy me~hod using DNA vectors which are free ~rom antibiotic resistance genes (iii) NUMBER OF SEQUENCES: 13 (iv) COMPUTER READABLE FORM:
(A) MEDIUM TYPE: Floppy disk (B) COMPUTER: IBM PC compatible (C) OPERATING SYSTEM: PC-DOS/MS-DOS
(D) SOFTWARE: PatentIn Release ~1.0, Version ~1.25 (EPO) (vi) PRIOR APPLICATION DATA:
(A) APPLICATION NUI~fBER: DE P 44 10 188.0 (B) FILING DATE: 24-MAR-1994 (vi) PRIOR APPLICATION DATA:
(A) APPLICATION I~UMBER: EP 94112165 . 9 (B) FILING DATE: 04-AUG-1994 (2) INFORMATION FOR SEQ ID NO: 1:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 43 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: cDNA
(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 1:
CGAGTGAAGA CACCATGGTC 11~ 111L1~, AATATTATTG AAG 43 - 37 - ~1815242 (2) INFORMATION FOR SEQ ID NO: 2:
(i) SEQUENCE CHARACTERISTICS:
~A) LENGTH: 40 base pairs ~B) TYPE: nucleic acid (C) STRANDEDNESS: single ~D) TOPOLOGY: linear i i ) MOLECULE TY PE: cDNA
~xi) SEQUENCE DESCRIP~ION: SEQ ID NO: 2:

~2) INFORMATION FOR SEQ ID No: 3:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 39 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: cDNA
(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 3:

~2) INFORMATION FOR SEQ ID NO: 4:
i ) SEQUENCE CHARACTERISTICS:
~A) LENGTH: gû base pai~s ~B) TYPE: nucleic acid ~C) STRANDEDNESS: single ~ D ) TOPOLOGY: 1 inear (ii) MOLECULE TYPE: cDNA
~xi) SEQUENCE DESCRIPTION: SEQ ID NO: 4:

~Z) IN~ORMATION FOR SEQ ID NO: 5:
~i) SEQUENCE CHARACTERISTICS:
~A) LENGTH: 43 base pairs ~B) TYeE: nucleic acid ~C) STRANDEDNESS: single (D) TOPOLOGY: linear - 38 - 2 1 8 62~
~ii) MOLECULE TYPE: cDNA
(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 5:
CGAGTGAAG~ CACCATGGCA ATATTATTGA AGCATTTATC AGG 4 3 (2) INFoRMATroN FOR SEQ ID NO: 6:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 35 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECU1E TYPE: cDNA
(xi) SEQUENCE DESCRIPTION: SEQ Ib NO: 6:

(2) INFORMATION FOR SEQ ID NO: 7:
~i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 40 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: cDNA
(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 7:

(2) INFORMATION FOR SEQ rD NO: 8:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 44 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: cDNA
(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 8:

2 1 ~G242 (2) INFORMATION FOR SEQ ID NO: 9:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 35 base palrs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: cDNA
(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 9:
GCAGATCTCC ~,~ c:i,G GCGTAGATGC TCCGC 35 (2) INE'OR~ATION E~OR SEQ ID NO: 10:
( i ) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 34 base pairs (B) TYPE: nucleic acld (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: cDNA
(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 10:
GCACGGTCGA CTCATGATCC ~ TTGC 3 4 (2) INE`ORMATION ~OR SEQ ID NO: 11:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 35 base pairs (B) TYPE: nucleic acid ~-(C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: cDNA
(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 11:

2 i ~6Z42 (2) INFORMATION FOR SEQ ID NO: 12:
( i ~ SEQUENCE CHARACTERISTICS:
(A~ LENGTH: 35 base pairs (B~ TYPE: nucleic acid (C~ STR~NDEDNESS: c ingle (D~ TOPOLOG~: linear (ii~ MOLECI~LE TYPE: cDNA
txi~ SEQrJENCE DESCRIPTION: SEQ ID NO: 12:

(2~ INFORMATION FOR SEQ ID NO: 13:
(i~ SEQ~ENCE CHARACTERISTICS:
(A~ LENGTH: 38 base pa~rs (B~ TYPE: nucleic acid (C~ STRANDEDNESS: single (D~ TOPOLOGY: linear (ii~ MOLECULE TYPE: cDNA
(xi~ SEQI~ENCE DESCRIPTION: SEQ ID NO: 13:

Claims (7)

C l a i m s

1. Use of a vector DNA for the production of a pharmaceutical agent for the treatment of mammals or humans by gene therapy, in which the vector DNA
causes a modulation, correction or activation of the expression of an endogenous gene or the expression of a gene introduced into the cells of the mammal or the human by the vector DNA, wherein the vector nucleic acid does not contain an active antibiotic resistance gene.

2. Use of a vector DNA for the production of a pharmaceutical agent for the treatment of humans by gene therapy in which the vector DNA causes a modulation, correction or activation of the expression of an endogenous gene or the expression of a gene introduced into the human cells by the vector DNA, wherein the vector nucleic acid contains a resistance gene for hygromycin, chloramphenicol, spectinomycin, blasticidin S, phleomycin, bleomycin, puromycin, apramycin or tetronasin.

3. Use as claimed in claim 1 or 2, wherein the gene therapy treatment is carried out in the respiratory tract, in the intestinal tract or on the surface of the skin.

4. Use as claimed in one of the claims 1 to 3, wherein the vector DNA causes a modulation or activation of the expression of the endogenous gene for cystic fibrosis or codes for the cystic fibrosis gene.

5. Use as claimed in claim 4, wherein the pharmaceutical agent is produced as an aerosol for application in the respiratory tract.

6. Vector DNA which contains a gene or gene fragment which causes the modulation, activation or correction of an endogenous cystic fibrosis gene in mammalian cells or which contains a cystic fibrosis gene which can be expressed in mammalian cells, wherein this vector DNA contains an inactivated antibiotic resistance gene or a gene which codes for an auxotrophic marker.

7. Vector DNA which contains a gene or gene fragment which causes the modulation, activation or correction of an endogenous cystic fibrosis gene in mammalian cells or which contains a cystic fibrosis gene which can be expressed in mammalian cells, wherein this vector DNA contains a resistance gene for hygromycin, chloramphenicol, spectinomycin, blasticidin S, phleomycin, bleomycin, puromycin, apramycin or tetronasin.