CA2180726A1 - Receptor specific bacterial adhesins and their use - Google Patents

Abstract

Bacterial adhesins that have been selected or recombined to have the ability to bind specifically to pre-determined, selected inanimate or animate receptors and the use of such adhesins or bacteria expressing the adhesins, in the targeting of useful compounds and/or bacteria to selected cells and surfaces.

Description

Wogsl206s7 2 ~ 8~7~ PCr/DKs5/00042 RE~;~L~R SPECIFIC Tl~f"T~T~T~T. AD}IBSINS AND l~EIR USE
FIB~D OF lNv~l~Llu~
The present invention pertains to n~t~1rAl7y occurring bacte- =
rial adhesins and derivatives and variant8 hereof, having the ability to bind to pre-~let~o~;n~9, specifically selected receptors, and to the use of such ~lh~qinq in the targeting of active ~ and microbial cells to lor~t;nnc compris-ing such selected receptors.
Thig invention wag supported in part by the US N::l t; nn~ 1 Institute of Health (NIE), under grant #DB07218 , and the US
Veteran8 Administration. The US ~uv, ha8 certain rights in the invention.
TBCHNICAL RACRGROUND AND PRIOR ART
The ability to adhere or bind 8pecifically to, and in many instances, to cnl rn; '~G an animate or ;n~n;r-t~ surface is ~of p~ - importance in microbial ecology and pathogenesis.
Such specific receptor binding is provided by microbial ~tlh~c;n~ which play a key role in bacterial/host and viral/host recognition and ;ntPr~r~jnn and for the recogni-tion of any specific surface by a rni.LooLyanism.
Accordingly, A~lh-~q; nn of bacteria to host surfaces is common-ly regarded as an essential step ~n:~hl; n~ bacteria to become est~hl; qhod as members of the normal flora of host organisms or to cause an infection (refs. 7, 18). R~rt~ri~l lectins are O 25 the most common and most thoroughly studied type of adhesins among both gram negative and gram positive bacteria (ref.
40). Evolutionary pres~.-L~s have selected lectins for adhes-ive functions probably due to the ~hlln~Anr~ of glycoconjugat-es on animate and ;n~n;r~te 5urface5. One cla5s of structures that a large range of gram-positive and gram-positive ~acteria; nrl ~ ; n~ Escherichia coli and other members of the ..... . _ . .

Wo 95J20657 2 1 ~ Q 7 ~ 6 pcrlDK95looo42 family EllL~ acteriaceae, have evolved to adhere to hoRt glycoproteins in a saccharide-rlPr~n~lPnt =er are surface fibrils called fimbriae (ref. 14) or pili (ref. 10). Coloniz-ation Factor Antigen (CFA) type I and Colnn;7~tlnn Factor 5 Antigen (CFA) type II are specific l P~ of guch fimbriae.
~y far the most common of the enterobacterial fimbriae iR
type 1, or =ose-specific (MS) fimbriae (refs. 11, 13, 14, 23). Type 1 fimbriae are heteropolymers of four different subunits (refs. 28, 44). For each fimbria, about 1000 copies of a 17-kDa primary structural subunit designated FimA (or PilA), are polymerized into a right-handed heliY surrounding a hollow aYial core (ref. 11~. Three ~nr;ll~ry subunits, FimF, FimG and FimH, are also polymerized into the fimbrial 15 st~ucture, but comprise only 1-3~ of the fi zl mass (refs.
20, 24, 27, 32).
The 28 kDa FimH subunit has been Rhown by several direct and indirect tests to l~e the actual fimbrial lectin (refs. 2, 4, 20, 21, 27, 29, 32, 36, 55), although its function may be 20 affected by other ~ubunits (ref. 55). The FimA subunit is highly variable, but t~e FimH subunit is highly cu,~seLvt:~
antigenically and genetically among Pnt~rnhactPri~ (ref. 1).
Interactions between type 1 fimbriae and D-=ose-rnnt~;n~n~
receptors have been shown in a number of studies to play a 25 key role in the infectious process (refs. 2, 4, 9, 19, 25, 26, 31, 33, 44, 50).
Detailed analysis of A~hpL~icm-inhibition or agglut;n~t;nn-inhibition by various r~-nnn~ P~ and =o-oligosaccharides have suggested that the - n;n~ site of the type 1 adhesin 30 is in the form of an ~Yt~n~ pocket ,oL~ nl;n~ to the size of a tr;~crh~ide and fitting best the structure ~-D-Manp- (1-3) -,B-D-Manp- (1-4) -D-GlcNac (ref. 16) . A hydrophobic region within or close to the ~ ; n; n~ site was also pre-dicted in these studies. A similar pattern Of sE~er; f; r; ty was 35 found ;ntlPrPn~Pntly in indirect adhesion-inhibition studies, as well as in direct adhesion studies using "neoglycr,l ;ri-1~n 8~
Wo 95t20657 PcrlDK95/000~2 as receptors ~refs. 37, 47). The c ` n;ng site of the Rleb-siella rn, ;Ae type 1 adhesin was shown to be similar to the Bscherichia coli adhesin, whereas the ,CA7 -77A typhimu-rium type 1 adhesin -~ ;nlng site appears to be smaller and 5 devoid of a hydrophobic region (ref. 16) Thus, it has long been thought that type 1 f imbriae of enterobacteria were functionally guite similar and that the primary essential characteristic of any potential receptor was the presence of tPrm;n~ 3-linked mannosyl re8idues.
10 Recently it has been reported that the type 1 fimbriated, ~-12-derived E. coli strain CSH-50 exhibits mannose-sensitive peptide-binding activity (ref. 51). CSH-50 E. coli bound to yeast mannan (Mn), a highly mannosylated glycoprotein, and to human plasma fibronectin (Fn) when; ~ Pd on assay 15 wells. ~rlhPcion to Mn, but not to Fn, was P~Pnt;~lly elimin-ated by periodate treatment. Furt~ c, CSH-50 E. coli adhered in a mannose-sensitive fashion to non-glycosylated peptide frA~ ~ ~ of Fn and to a 8ynthetic peptide copying the first 30 re8idues of the Fn ~' erl~l e, FnSpl. Fimbriae 20 purified from these organi8ms also bound to Fn and FnSpl. A
well-rh~ra~tPr;~pd re~-( ;n~nt strain of E. coll PC31 expres-sing type 1 fimbriae, H~3101 (pP~4), adhered to Mn, but did not adhere to the other substrata. Fimbriae purified from H~3101 (pP1~4) did not adhere to Fn or FnSpl. Thus, E. coli 25 type 1 fimbriae appeared to be fllnrtinn~l ly heterogeneous.
Several E. coli ;f ~l~tPt~ obtained from human urine also c~L~Lcssed peptide-binding activity similar to that of CSH- 50, ;n~;r~t;n~ that this new pllc..oLy~e was not restricted to a 1 ;IhorA~ory gtrain. Other; ~nl ~tP~ expresged an adhesive activity similar to that of H~3101 (pPRL4) . A third class of type 1 f; ~P- ~;~ted adhesive phenotype was also observed among these isolates.
.

The FimEI subunit is the D-mannose-sensitive adhesin of type 1 fimbriae, common i.a. to the ~ L,:)bactF~r;~ArPAe. It is pres-35 ently widely accepted that host receptors are strictly Wo ss/206s7 2 ~ ~ 0 7 2 6 PCT/D~95/00042 limited to glycoproteins rnnrA;n;n~ t~-rm;n~l mannogyl resi-dues (refs. 16, 37, 41, 42, 43, 47). Hereinbelow f-~nrtin and genetic evidence is provided demonstrating that this gener~l;7At;nn is not correct. Allelic variants of E. coli 5 f~m~ gene8 ~nrorl;ng proteins differing by as little as a single amino acid substitution confer distinct adhesive phenotypes and accordingly, the fi~ gene is not a single gene but rather a ~amily o~ fl~ genes.
Surprisingly, active receptors for Fim~ proteins were found 10 to include glycoprotein domains where mannosyl residues are not t onmi nA l and even protein domains devoid of saccharide .
This l~n~ect~d adhesive diversity within the fin~ family broadens the scope of potential receptors f or bacterial adhesion and may l~ad to a C ' ~Al change in the under-15 standing of the role(s) type 1 fimbriae and other b~ArtPr;adhesins may play in bacterial ecology or pathogenesis.
The present f indings also opens up a completely new f ield of ter~nnl o~y, since it provides the means to design bacteria expressing adhesins that bind to pre-det~nm;no-l, specific 20 receptors in a wide range of animate and ;nAn;~te locations.
miS new technology is referred to herein as Designer Adhesin Technol ogy .
SUM~IaRY OF THE INV~3NTION
Accordingly, the present invention relates in one aspect to a 25 l~:C ;nAnt or mutant bacterial adhesin variant derived from a nAt-lrAlly occurring adhesin, said adhesin variant having altered binding properties relative to the nAtllrAl l y occur-ring adhesin ~rom which it is derived.
In ~urther aspects the invention provides a FimH adhesin 30 having an amino acid sequence which differs from the E. coli PC3 1 FimH adhesin by at least one amino acid and a recombi -nant replicon comprising a DNA sequence selected from the wo g5,20657 2 ~ 8 ~ PCTIDK95/00042 group consisting of a sequence coding for a re ;n~nt bacterial a&esin variant as def ined above and a sequence coding for a FimH adhesin as also defined above.
In a still further aspect, there is provided a fusion protein 5 comprising an adhesin selected from the group consisting of a rP_ ' ;n~nt bacterial adhegin variant ag defined above and a FimH adhesin as also defined above, and a heterologou8 polypeptide .
The invention also pertains to a re~ '-n;lnt b~ct~ cell 10 which expre8ses an a&e8in 8~1 ert~d from the group consisting of a re: ;n~nt bacterial adhe8in variant as defined above and a FimH adhesin as defined above, and to a composition comprising a population of such cells.
In one interesting aspect of the invention there is provided 15 a method of i801ating a bacterial cell expressing an adhesin having ';f;etl binding properties relative to a natively expressed a&esin, comprising identifying in t~e bacterial cell DNA 8equence(s) coding for the binding domain(s) of said natively expres8ed adhesin and substituting at least one 20 codon hereiIl, whereby a modified a&esin molecule is L~ ed that is different in at least one amino acid from the a&esin expressed natively, and selecting a bacterial cell expressing the modified a&esin having an altered a&esion phenotype relative the natively expressed bacterial 25 a&esin .
In a further interesting a8pect the invention relate8 to a method of preparing a re- n~nt bacterial cell that binds to a 8pecific receptor moiety, comprising introducing into a bacterium that does not produce an adhesin binding to said 30 receptor moiety, a DNA sequence coding for an adhesin binding to the receptor moiety, and selecting a bacterial cell ex-pressing the DNA seqV~nre~

wo 95l20657 2 T 8 ~ 7 ~ ~ r~ c ~ ~2 There is also provided a method of targeting a bacterial adhesin to a specific lorAt;nnl comprising (i) identifying in said location an adhesin-;ntPr~-t;ng receptor moiety which is recojn;7~hle by bacterial adhesins, said moiety preferably being one which iq orcl~rr;ng ~h~ln~lAntly~ (ii) isolating a bacterial cell that grows in said location and expresses an adhesin rerogn;~;~g and ;nt-rAct;ng with said receptor moie-ty, and administering to the location the h~ct-r; A 1 cell or the adhesin under conditions where the adhesin and the receptor moiety are brought i~to ~nt-r~-t;ng contact whereby the adhe8in is Aq~o~~At-~l with the receptor moiety.
r)~T~Trr~n DISCLOS~RE OF THE lNV Nll~N
As used herein the term ~bacterial ~lh_c~nq" denotes proteins which recogni~e and bind to a large variety of target mole-cules such as polysaccharides, glycol ;r;~lc, glycoproteins, polypeptides and proteins . More than a hundred dif f erent A~ih_qinq have been degcribed go far originating from a large variety of gram-negative and gram-positive bacteria. Adhesins can be present on the bacterial surface as c --ItC o~
organelles guch ag fi-lbriae, algo called pili or f;hr;lli3_, these three terms being used inteL~ha~ ably herein, or as non-fimbrial or afimbrial ~rlhPc;nq (ref. 64). Examples of fimbrial or pili adhesins include the ~ollowing surface structures in E. coli: P pili, type 1 fimbriae, S pili, R88 pili, R99 pili, CS3 pili, F17 pili and CS31 A; in Rl-hq~-77 i~:e type 3 pili; in Bordetella pertussis: type 2 pili; in Yerslria enteLv~L,litlca: My~ fibrillae; in Yersi~a pestis: plI6 antigen and F1 envelope antigen.
Examples of non-fimbrial cell surface structures which have adhesin function or which may comprise proteins having such a function include capsules, lipopoly8accharide layers, outer - proteins, NFA (non-fimbrial adhesin)-1, NFA-2, NFA-3, NFA-4, AFA (afimbrial ~tlh_c;nc)-I, AFA-II and AFA-III.

Wo 95/20657 2 l 8 ~ PCr/DKss/00042 In the present context, the term "fimbriae'~ designates long thread-like bacterial surface orJ~npl l e~. Fimbriae are hete-ropolymers each consisting of about 1000 6tructural compo-nents, mostly of a single proteln species. However, in many cases a few percent minor ~ t~ are al80 present. Adhes-ins can either be identical to the maj or structural protein as in Esrh~r;chi;~ coli R88 and CFAl fimbriae and type 4 fimbriae of Pse- q, Vlbrio and Neisseria, or they may be present a8 minor components as in E. coli type 1 and P
fimbriae [for reviews see Rrogfelt 1991 (ref. 62); Raufman and Taylor, 1994 (ref . 60): Ruehn et al ., 1994 (ref . 63 );
Rlemm and Rrogfelt, 1994 (ref. 61)]. In the latter case, i.e.
when present as minor _ '~, the adhe8ins are closely related in amino acid sequence to the maj or f imbrial compo -nent. As used herein the term bArt~r;Al adhesin will also include AdhP~in~ ;q~lAted from non-ba~t~r;~l sources includ-ing viruses, and which are e~pressed in a bacterium.
In the following, the FimH adhesin of type 1 f; A~ will be described strl-rt-'rAlly and fllnrt;nnAlly a8 a representative example of a bacterial adhesin.
FimH is located at the tip of the type 1 f imbriae and also intercalated at intervals in the fimbrial organelle. Most forms of the Fim~ adhesin target to (bind to) oligr~a~rh~ride structures rr,ntA; n; n~ t~rm; n~ 1 1 y located ~-D-r -nnr,sirlP resi-dues [Rrogfelt et al., 1990 (ref . 29) ] . Based on studies with various D-mannose derivatives the receptor binding site of the FimH adhesin is assumed to be shaped like an elongated pocket large enough to ac- ~ te a tr; ~?rrh~ride motif [Sharon, 1987 (ref . 65) ] .
-30 The fim~ gene encodes the precursor FimH protein of 300 amino acids [Rlemm and Christiansen, 1987 (ref. 27)]. This precur-sor is processed into a mature form of 279 amino acids. The amino acid sequence of the E. coli PC31 FimH protein is shown in Table 1 below wherein cysteine residues are ;n~l;CAtP~l by a8terixes, the signal peptide is Qlltl ;n/~fl in bold letters, wO95l20657 2 1 8 Q 7 ~ ~ PCTIDK9~/00042 ~
and two regions contributing to the binding site are under-lined (SEQ ID NO:1). (It should be noted that residue 176 is a proline residue and not as previously ;nrl; CAtPd when the PC31 FimH proteirL was first pllhl;chPrl, an arginine residue):

TAhle 1. Am;nn acid 8e~uence Qf the E. coli PC31 F;mT~ l~rotP;n -21 1 ~
I~RVIT~FAVT.T. VnAWSFACRTANGTAIPIGGGSANv~ ~v VN. V~ ~N I ~VVDI,~
10 1`)~ N~r~ LL~Jx\~ T~ cz~yGGv~ N~ Ky~Gs~y~L~ rKvvyN::;K
DRpwpvALyLTpvssAGGvz~TR~r~ T~Tz~ IL-KylLNNy~ JL~u~vw-NlyA?~ vvv~l~
GcDvsAKDvTvTIl~L~ y ~G~ v ~ TvycARs QNIlG -y~sG~T~n ~l TN .~ l AS FS PAQ

15 GVGVQ~LKN~ilLl~ANNTVSL~iAV~ AV~LGLTANYAKl~uvlA~l~vY~ll~vlL~vYu The FimH ~nrtA;nc 4 cysteine residues assumed to direct folding of the molecule into distinct fllnrt;nnAl domains. For comparison FimA and the minor ~ ~ - c FimF and FimG only have two cysteine residues. The 10~A1; 7AtioIl of the cysteine 20 residues in FimH points to a tandem alL~ t of two ances-tral genes. Furth~ , similar amino acids can be found in similar positions in the two halves of the FimX protein. The "midway" point is located roughly around residue 150 in the mature protein. The two halves or dQmains of FimH have 25 evolved differently with the N-tPrm;nAl section becQming the domain harbouring the receptor binding site, whereas the C-tPrm;nAl sector became the domain of the molecule required for integration into the fimbrial organelle structure, i.e.
having the features of a structural ^nt.
30 In-frame linker insertions into the fim~ gene cnnf;rmq this model of the Fi~X protein . Thus ingertion8 in the C- t~rm; nA 1 half of the mQlecule generally do not interfere with the

2 1 ~7~6 Wo gs/20657 PCr/DKss/00042 receptor-binding ability whereas ilhr~ l of receptor binding ability following linker ingertion in the N-t/~rm;n;ll is the rule (glemm et al., unpublished data). A similar domain structure has been observed in the PapG adhesin of P-5 fimbriae [Hultgren et al., 1989 (ref. 59); guehn et al., 1994(ref . 63) ] .
In accordance with the invention, the re~ in~nt bacterial adhesin as defined above is one which is derived from an adhesin having certain binding properties, but which recombi-10 nant b~ctr-ri~l adhesin has altered binding properties rela-tive to the naturally occurring adhesin (the parent adhesin) from which it is derived. As used herein this feature r-nc ~ses situations where the adhesin variant recognizes and binds to receptor iet;r-~ not being re~o~n; ~r-~i by the 15 parent adhesin irrespective of whether the adhesin variant has lost its normal ability to rerrJ~n; ~P and bind to a cer-tain receptor moiety or certain receptor moieties, or not.
As used herein the term "binding" indicates that the adhesin has a degree of affinity to the receptor moiety which enables 20 it, when brought into contact herewith, to interact in a binding manner with this moiety whereby an adhesin- receptor moiety association occurs. The strength of this binding depends on the type of binding f orce which causes the inter-action between the receptor moiety and the adhesin. In the 25 present context, such binding forces include covalent binding and binding by non-covalent binding forces including hydrogen bonds, llydL~J~hObic ;n~Pr~rti~nc, van der Waal forces and ionic ;ntpr~ctir~n~. ~rcor-l;n~ly, the term ~receptor moiety"
as used herein ~nr ~ ~ses any moiety to which an adhesin may 30 interact by the above binding forces.
.

In one specific ' ~'; , the adhesin variant is a FimH
mannose- sensitive adhesin normally binding to a receptor selected f rom a domain where mannosyl residues are not ter-minal and a domain devoid of saccharide and having an amino 35 acid sequence which differs from the E~. coli PC31 FimH adhes-_ _ _ _ _ _ _ , . .... . _ ... _ .. . . .

-Wo 9s/206s7 2 1 8 0 1 ~ ~ PCT/DiC95/00042 in by at leat3t one amino acid residue gubstitution, an amino acid sequence differing by at least 2 amino acids, pre~erably by at least 3 amino acids, more preferably by at least 4 amino acids, most prefer_bly by at least 5 amino 5acids. In further useful ~ 9, the amino acid aetauence may even differ by more than 5 amino acids ~uch as at least 6, preferably by at lea6t 7, more preferably by at least 8, even more preferably by at leagt 9 and in particular by at least 10 amino acid residues, such as by at least 12 amino 10acids ; n~ ; n~ by at least 15 .
Accordingly, the above FimH adhesin variant is preferably at least 90~ homologous to the PC31 FimH adhesin, such as at least 92~ homologous, more preferably at least 9396 homologous, even more preferably at least 94% homologous, 15most preferably at leagt 95% homologous, and in particular at least 96~ homologous, e.g. at least 97~ homologous. In par-ticularly interesting ` '; ~c, the adhegin is at least 98~ homologous, including at least 999~ homologous such as at least 99 5~ homologous.
20The above FimH adhesin variant can be a chimeric adhesin comprising amino acid SP~IPncpq from different FimH A~hPqinC~
having iflpnticA7 or different binding specificities.
As it has been ~;~nP~l above, the present invention is generally aimed at providing the meang to design hArtPr;Al 25adhesins having specific binding properties whereby bacteria expressing the adhesin variants or the adhesin variants in ;qolA~P~l or purified form can be dpq;~np~ to bind to a speci-fic desired target receptor moiety. -~-r-rlinsly, the adhesin variant may in accordance with the invention be an adhesin 30variant as defined above which binds to an animate receptor moiety. Such receptors include receptors located on inner surfaces of humans and animals, such as e.g. the mucosal -- of the gastrointestinal tract including the teeth and the oral cavit~, and the mucosal ~~- of the respir-35 atory and the genito~ nAry systems. Included are also W0 95/20657 P~ 12 adhesin variants that bind to outer surfaces, inr~ ;n~ the skin, of humans and animals.
In a further embodiment, the adhesin variant is c~Pcl~rnp~l 80 as to acquire the ability to bind to a plant receptor moiety.
5 This aspect is of particular interest in relation to deliber-ate release to out-door or in-door enviL~ -c where plants are cultivated, of useful re: ; n~nt bacteria having a desirable effect on the growth and yield of the plants.
Such rlpc;r~hle bacteria are e.g. bacteria PYprPcc;nrg a pesti-10 cidally active substance, i.e. a biopesticide tnr~ ;ng asexamples pesticidal toxins produced naturally by ,Rc~ri77~ 8pp such as the R.qri777~R thuringiensis (Bt) toxin. In this con-text, another example is bacteria which protect plants against low t~ _ 3r t~lre damages or bacteria which express 15 gene products protecting plants against detrimental ef f ects of hPrh; r; tlP,C, .
By providing such bacteria with genes expressing adhesin variants which e . g . bind specif ically to certain plant spe -cies and/or to certain locations on the plant, these useful 20 bacteria will, when administered to the plant growing envi-ronment, be selectively associated with the target plant species or a specif ic target area of the plant . It may thus be lPq; r~h~ e to have these useful bacteria administered to the leaves of the plants or to have the root system colonized 25 herewith .
Arrnr~;n~1y, the pregent invention Pn~ ces adhesin vari-ants as def ined herein which bind selectively or 8pecif ically to a phylloplane receptor moiety or which bind to receptors on plant roots. Similarly, adhesin variants can be provided 30 which are targeted to the stem or the ~lowers of the plants.
- As it is -;nnPd above, bacterial ;lclhPcinc include ;~ hPclnc having an inherent r~r~hil;ty to bind or ;ntPr~rt with inani-mate surfaces carrying receptor et; Pc with which the adhesin can interact to become bound to the surfaces. It is W095~20657 ~ I ~Q72~ 12 PCr/DKss/00042 known that certain h;~rt~r;~ hP~inq can bind to in~nim~te surfaces 1nrl~ ;n~ as examples glass, I.ydLu~ylpc~tite (a tooth enamel model compound) or polymer structures including plas-tics and polyl3; 1; r~t~ . The pregent invention has made it 5 possible to design bacteria which bind selectively to any ;n~n;r-te surface which carries a receptor moiety for which an adhesin variant binding thereto may be constructed. Accor-dingly, the present invention also provides an adhesin vari-ant as defined herein which binds to an ;n~n;r-te receptor lO moiety. Such adhesin variants are particularly interesting in cnnn~ctjnn with the concept of bioL, ';~tinn, i.e. a tech-nology ~9P~ n~cl to enhance ~l~or,r;~ tlnn of chemical pollutants in the environment. It is clearly a significant il.~LUVI
of this technology to have at hand bacteria which comprise 15 genes coding for pollutant-~ rAfl;nr~ gene products and which also express ~h.o~; nl:~ targeting the bacteria selectively to the environment where the po1 lllt~nt~ are present, e.g soil, ariuatic enVil~ ~ 9 and drinking water supply systems.
Furthermore, adhesin variants capable of binding to tooth 20 enamel are useful in the protection of teeth against caries.
In a further -; t, there is in accordance with the invention provided an adhesin variant which is part of a fusion protein comprising the adhesin variant and a non-adhesin, heterologous polypeptide. using the FimEI as an 25 example, it has been found that fusions between a bacterial adhesin and other proteins can be made whereby the resulting fusion proteins are inserted into the cell surface organelle of which the adhesin is a structural part. These resulting hybrid adhesin-carrying cell organelles remain fully func-30 tional with respect to binding properties. Additionally, ithas been found that large regions of non-adhesin proteins, e.g. regions comprising in the range of 1 to 100 amino acids including a range of 5 to 75 amino acids and a range of 10 to 60 amino acids, such as regions comprising 15 to 54 amino 35 acids, can be inserted into type 1 fi~briae without impairing the binding properties of the fxrnbriae.

-Wo 95l20657 2 1 8 0 7 2 6 PCr/DKs~l00042 In useful ~i ~ of the invention, the non-adhesin region of a fusion protein comprising an adhesin variant as def ined herein include a heterologous polypeptide which is selected from an epitope, an enzyme, a toxic gene product and 5 an antibody.
It has significantly been found that, when fusion proteins are expressed in which the heterologous polypeptide is an epitope or an epitope-carrying domain forming an integrated part of the fusion protein, and thus presented on the surface 10 of the host cell expressing the fusion protein, the epitope-carrying polypeptide can be presented in a confn~-t;
form similar to its natural conformation.
Furth~ , it has surprisingly been found that the above fusion proteins can be uv-:lyL.,~luced by the bacteria compris-15 ing hybrid genes coding for fusion proteins, resulting inexcretion of the fusion proteins to the growth medium in large quantities. Accordingly, the excreted fusion proteins are then readily isolated and purified, e.g. by means of affinity C~lL~ tography. mese f;n~ q provide the means to 20 ~-n~lf~ctl~re bacterial cells having on their surface hybrid adhesin- carrying cell organelles as well as to produce large quantities of excreted fusion proteins, both of which can be targeted to specific surfaces as ~ t~rm;n~cl by the binding properties of the adhesin variant of the fusion protein.
25 The above technology of making adhesin variant- fusion pro-teins is useful for a range of industrially important pur-poses such as:
(i) development o~ live vaccines targeted to specific cellu-lar surfaces;
30 (ii) development of subunit vaccines for administration orally or by injection, which are targeted to pre-det~rm'ned, specifically selected cell surfaces or mucosal surfaces;

Wo 95/20657 2 ~ ;7 2 ~ PCrlDKs5/00042 (iii) devPl ~ of fusion proteins cl~mh;nin~ specific binding properties with specific enzymatic or toxin activ-ities. Such fusion proteins have applications as therapeuti-cal or diagnostical agents, including use in biosensors;
5 (iv) use of fusion proteins as carriers of non-covalently linked rhPm; rA 1 moieties whereby the adhesin part of the protein is used to target the che~mical moiety to specif ic locations and the non-adhesin part carries and then releases the moiety when the fusion protein has reached its target.
lO ExAmples of rhPm;rAl entities which may be linked to the fusion protein include i,maging agents and rhArm-cologically active _ ~U~ 8. r 1P~ of applications for this use include imaging of atherosclerotic plaques or tumor tissues, and delivery of rhPm; c~ 1 agents at sper; f i ~ locations in or 15 on microbial, hum~an, animal or plant cells ;nr~llr1;n~ specific tissues or tissue ~ t q;
(v) development of fusion proteins which are useful in affin-ity purif ication processes .
It has been found that the fim~ gene coding for the E. coli 20 FimH adhesin is not a single gene but rather a family of fimE
genes, and ACc~r~;n~ly it has now been eS~Ahl;qhprl that allelic variants of E. coli fimN genes exist that encode adhesin pro~eins which, relative to the known E~. coli PC31 fimH gene product differ by as little as a single amino acid 25 substitution and confer distinct binding or adhesive phenotypes .
Accordingly, as it has been ~ nPrl above, the present invention relates in a further aspect to a FimH adhesin having an amino acid sequence which differs from the E. coli 30 PC31 FimH adhesin as defined above by substitution of at least one amino acid. It will be understood that such an adhesin Pnl -Cses nAtl~rAl ly ocr~lrr;n~ A~hPq;nq as well as ArlhPq;nq which are encoded by rPc ;nAn~ or mutant fi~Z~
genes. In this context the term "fimH gene" denotes a gene W095/20657 2 l ~ ~ 7 2 6 J ~ c~ ~7 coding for a gene product which can be integrated into a type 1 fimbria and which confers to the fimbria the ability to recogni~e and bind to a receptor.
The FimH adhesin as defined above may be an adhesin having 5 its inherent binding properties or an adhegin variant which in relation to an adhesin encoded by a n~tllr~lly occurring gene from which the gene coding for the adhe8in variant is derived, has altered binding properties. Furth~ ~, the FimH adhesin may be either mannose-sensitive or mannose-lO insensitive. The term "mannose-sensitive" is used herein to designate that the binding of an adhesin i8 inhibited in the presence of mannose residues. In one specific -';-- , the FimH adhesin may be a FimH adhesin normally binding to a receptor moiety selected from a domain where mannosyl resi-15 dues are not tPrm;n~l and a domain devoid of 8accharide sucha8 e.g. a glycolipid, a glycoprotein, a protein, a polypeptide and a peptide, including a hormone. r l P~ of proteins to which a FimH adhesin according to the present invention may bind include as examples animal proteins such 20 as a casein ;nrlllA;n~ K-casein, a gelatine, a globin, an albumen and a collagen, and vegetable proteing ;nrlllr~;ng 80y protein.
The FimH adhesin according to the inventio~ include an adhes-in having an amino acid seguence which differs from the E.
25 coli PC31 FimH adhesin by at least 2 amino acid residues, such as an amino acid seSrlPnre differing by at least 3 amino acids, preferably by at least 4 amino acids, more preferably by at least 5 amino acids, most preferably by at least 6 amino acids. In further useful '~ ~, the amino acid 30 seqllPnre may even differ by more than 6 amino acids such as at least 7, preferably by at least 8, more preferably by at least 9, even more preferably by at least 10 and in particu-,. lar by at least 11 amino acid residues, such as by at least 12 amino acids ;nrlll~l;n~ by at least 15.

218~7~o WO 95~20657 PCT/DR95100042 Accordingly, the above Fim~ adhesin is preferably at least 9096 homologous to the PC31 FimE~ adhesin, such as at least 92 homologous, more preferably at least 93% homologous, even more preferably at least 94~ homologous, most preferably at least g59i homologous, and in particular at least 96~ -homologous, e.g. at leagt 97% homologoug. In part;c~llArly interesting '; ~, the adhesin is at least 989i homologous, ;n~ ;ng at least 99~ homologous or at least 99.5% homologous.
In one spe~; f; ~ , the FimEI adhesin as def ined above is one which, when tested for binding to yeast mannan (Mn), human plasma f ibronectin (Fn), periodate treated Fn and the synthetic peptide FnSpl comprising the first 30 amino acids of Fn, only binds to M~L. In the following, an adhesin having this pattern of binding properties i9 designated an M class FimEI adhesin. In other specific ';-- ~, the FimEI
adhesin is an adhesin which, when tested for binding to the above 1_ '~, binds to ~In and Fn (MF class FimH adhesin) or an adhesin which among these ~ u~ bind to all of these (MFP class ~imE~ adhesin).
It has been found that bacteria expressing Fin~H arlhF~;n~ of the above MFP class bind in a mannoEIe-sensitive (MS) manner to polyoxyethylene sor~itan rn-lnc~l~llr~te (Tween 20) and a little less well to polyoxyethylene sorbitan monooleate (Tween 80). Furthl- ~, bacteria expressing MFP class FimH
adhesins make a m~ch tougher pellicle than bacteria expres-sing other types of adhesins. In the pre~ent context, the term "pellicle" i~dicates a layer or film of b~ctFr;~ that forms at the air/liquid interface of a liquid growth medium.
This noticeable rhF- might be of particular interest where there is a reason to c~ncFntrate microorganisms at the surface of an aquatic environment, such as e.g. bacterial cells which in accordance with the present invention express a pol l~t~nt-degrading gene product.

2 1 8~7~
Wo gs/20657 PC r/DKgsl00042 Another interesting finding is that bacteria expressing a MFP
class adhesins bind to l~y-lLu~ycL~atite to a higher degree than do bAct~r;r7 expressing a M class adhesin. liydLu~yd~dtite~
especially saliva-treated l~ydru~ycL~atite is i.a used as a model for tooth enamel, and accordingly, this finding indi-cates that bacteria expressing MFP class adhesins are par-ticularly u8eful in bacterial compositions ;nt~n~ l for col7ni ~7t; 7n of teeth.
It has also been found that the MFP class adhesins bind to a large range of synthetic peptides and accordingly seem to have a broad specificity in terms of amino acid motifs.
In further specific ' 7t';-- ~ of the invention, the FimH
adhesin is an adhesin which, when tested for binding to the five Fn-fra~ ~ obtained by thermolysin treatment as it is described in reference No. 51, only bind8 to the 40-kDa gelatin-binding frAs or which binds to all of the8e Fn-fragments, or to none of these.
In addition to the above classes of FimH adhesins, another class ~as been ;~ nt;f;ed which is designated the ML (low adhesive) class. Such an adhesin confers the ability to aggregate yeast cells in a mannose-sensitive (MS) fashion, in titers 8imilar to M class Arlh~;nR, but surprisingly, it binds at only low levels to Mn or Fn and FnSpl. Furth~ 7 ~:, adhesins of this low adhesive ML class adhere poorly to MDCR, buccal cells and erythrocytes as compared with M class adhes-ins. Example of a M~ class adhesin is one expressed by the recombinant E. coli 8train R~3 23 which differs only from the PC31 FimH adhesin by having an alanine instead of a valine at re8idue 27 and the FimH adhesin expres8ed by the human fecal 30 E. coli isolate which is designated F-18 [McCormick et al., 1989 (ref . 34) ] . Thi8 latter adhesin differs from the PC31 Fim}I in three amino acid residues and the F-18 isolate has been found to colonize the large intestine to a higher degree than certain E~. coli R-12 strains do. Accordingly, it is 35 c~7nt ~17tf~d that these MI' class A~h~;n~ confer to W095/206s7 2 ~ 8 0 7~ 18 pcrlDK9slooo42 gastrointestinal bacteria the ability to colonize the large intestine which is q;gn;fi~Ant for a live bacterial vaccine for exerting its immunological effect in the gastrointestinal tract .
5 Furthermore, it has been found that among ~q class adhesins a&esion is f ound that is not sensitive to inhibition by D -mannose. Such a mannose-insensitive (or mannose-resistant) M
class a&esin is clesignated in the following as an MR adhes-in. One example of a bacterial strain expressing an MR adhes-in i9 the clinical isolate U221-3 which is - -;nnecl in the f ollowing .
In accordance with the invention, a FimH a&esin as defined above can be a chimeric adhesin comprising amino acid sequences from different Fim.~H AtlhPR;nq Such rh; q are 15 constructed e.g. by providing multiple regtriction fr;~gmPntq of a fimF~ gene, followed by exchanging under ligation condi-tions these fr~A~ tq with corrPqpqn~l;n~ fragments of an other fim~ gene and cloning the ligation product as it is described in Example 1 below. As it is also P~ ~; nPt~ below, 20 rPrnmh;nAnt plA~m;~lq cnntA;n;n~ such chimeric f:~nH genes can be transformed into a host cell and transformants tested for adhesive phenotype, allowing flP~Prm;nAt;nn of the regions of each gene capable of conferring functional activity (Fig. 5).
'rhese ~tudies which are described in details below showed 25 that all of the sPq~lPnnP changes relative to the PC31 fim~
gene that affected binding function in the studied strains of E. coli CSH-50 and clinical ;qqlAtPq (CIs) lPqir~n~tpd #8 3, 4, 7, 10, F-18 and U221-3, respectively, occurred between residues 27 and 119, both ;nrl~ PA, of the 279 residue, 30 mature f~l~ 8eq~lPnrpq~
Accordingly, the invention Pn- qqes in one ' ~'; a FimH a&esin comprising an amino acid sequence which differs from the E. coli PC31 FimH a&esin by at least one amino acid occurring between residues 27 and 119 of the mature FimH
35 sequence, ;nrl~ ;n~ a FimH adhesin comprising an amino acid ~ Wog5/20657 2 ~ 8~2~
seguence which differs from the E. coli PC31 Fim~ adhesin by at least one amino acid occurring between residues 33 and 78 of the mature FimH sequence.
The selected potential receptors f or a FimH adhesin as 5 defined above include tho8e Animate and ;nAn;--te receptors t;onPcl above for a rP~ ~;nAnt bacterial adhesin variant and the potential uses of the FimH adhesins are al80 the same as those uses described above for this re{ lnAn~ bacterial adhesin variant.
10 As t; onPd above, the invention relates in a further aspect to a re: ;nAnt replicon compriging a DNA spgllpn~e coding for a re_ ;nAnt bacterial adhesin variant as defined herein or a DNA sequence coding for a FimH adhesin as also defined herein. Such a replicon i8 8uitably selected from a chromo-15 some or a pla8mid. The DNA s~lu~ e includes a sequence whichis inserted by convP~t; onA l recnmhinA t j nn techniques 8uch as insertion by means of restriction enzymes and subsequent ligation, or the DNA seguence is provided by subj ecting a replicon comprising a nAtllrAl ly occurring sequence coding for 20 an adhesin to a mutagPn;7~tion ~Loc~:dufe ;nnll~l;n~ site-directed mutagenesis, insertion of a trAn~pnsAhle element, mutagPn;7Atinn by rA~t;nn or chemical mutagPn;7At;nn, followed by selection of cells comprising a mutated sequence conf erring altered binding properties relative to a cell 25 comprising the wild-type sequence.
In preferred ~ c, the L~__ ;nAnt replicon is one having a broad host range including bacterial species na-turally occurring in soil, in aquatic enviL, c, on inner and outer surfaces of humans and animals, and which is com-30 patible with rP~l; cnnc occurring in potential host strains.
In one useful -'; , the recombinant replicon as defined above is one wherein the DNA seguence codes for a FimH adhes-in having an amino acid sequence which differs from the E.
coli PC31 FimH adhesin by at least one amino acid, including _ _ _ _ _ _ _ . . .. . .. ..

WO 95/20657 2 ~ 8 ~ 7 ~ 6 Pc rlDK9S/000~2 an adhesin having an amino acid sequence which dif f ers f rom the E. coli PC31 Fiml~ adhesin by at least 2 amino acid resi-dues, such as an amino acid sequence differing by at least 3 amino acids, preferably by at least 4 amino acids, more 5 preferably by at least 5 amino acids, most preferably by at least 6 amino acids. In further useful emb~flim~n~R, the amino acid sequence may even dif f er by more than 6 amino acids such at least 7, preferably by at least 8, more preferably by at least 9, even more preferably by at least 10 and in particu-lO lar by at least 11 amino acid residues, such as by at least12 amino acids including by at least 15.
Accordingly, the above rect~--~;nAnt replicon preferably com-prises a DNA sequence coding for a Fim~ adhesin which i5 at least 90~ homologous to the PC31 fim~ gene, such as at least 92~ homologous, more preferably at least 93~6 homologous, even more preferably at least 94~ homologous, most preferably at least 95~ homologous, and in particular at least 96~6 homologous, e.g. at least 97% homologous. In particularly interesting '~ , the a&esin is at least 9896 20 homologous, inrlllfl;n~ at least 99~ homologous such as at least 99 . 5~ homologous .
In a further ~ , the above replicon comprises a DNA
sequence which is a chimeric fimH gene as it has been defined above, comprising DNA from different fim~ genes. The replicon 25 can also be one which comprises a further DNA seguence e . g .
derived from a mi~:LUOL!ldrliSm selected from a bacterium, a virus, a protozoa~, a fungus and a yeast. This further DNA
sequence is e . g . one coding f or a heterologous polypeptide, ;nrlllfl;ng an epitope, an antibody, a toxic gene product, an 30 enzyme, a pesticidally active gene product and a pollutant-degrading gene product.
In useful ~ ofl; fl, the replicon as defined herein com-prises a DNA sequence which is isolated f rom an E~ltero~acte -riaceae species, ~nc~llfl;ng a DNA ~P5r~Pn~ ~ which is ;~olAt~fl Wo gs/206s7 2 ~ 8 ~ 7 2 6 PCT/DK95/00042 from E. coli, a ~rleb~7iella 5p., an Rntero~acter sp, a Yer~7i n ~ a sp . or a S;q 7 1 - 7 7 fl Bp .
In additlon to being a DNA sequence as def ined above, the s~qn~nrr- can be a synthetic sequence constructed by conven-5 tional techniques of DNA synthesis.
As it is also ~;nnPd above, the present invention f~nr ~P~ a fusion protein compri8ing a rPc 'nAn~ bacte-rial a&esin variant or a FimH adhesin as defined above, and a heterologous polypeptide. Such a polypeptide is in useful 10 C n~ A an immunologically active gene product i.e. an epitope (antigenic ~tF~n;nAnt) from a pathogenic organism, which polypeptide, when administered to the body of a human o~ an animal is capable of st; l;~t;n~ the forr-t;nn of An~;ho~ therein. A cell in which such an epitope is 15 expressed is advantageously ~l~; l; 7ed in the preparation of live vaccines. Such vaccines have several advantages over known live vaccines:
Firstly, the epitope forms a structural part of an adhesi~
which is ~ d in a surface organelle of the vaccine 20 cells. This implies that the hybrid DNA sequence coding for the epitope further comprises the means for transporting the epitope, when expressed, to the outer surface of the cell, i . e . translocating it through the cell - - . This is immunologically highly advantageous, since the epitope will 25 be brought more closely in contact with; nl ogically competent cells of the body to which the fusion protein-expres~ing vaccine cells are administered.
Secondly, the a&esin part of the epitope-carrying fusion protein can be selected so as to have specif ic binding prop-

3 0 erties whereby the vaccine cell may be targeted to a particu -- lar location in the body where an; r~logical response to the epitope is desirable . The adhesion of the epitope- carry-ing cell to a particular location or region of the body will in this manner ensure that the cell is retained in the human Wo 95/20657 2 ~ 8 ~12 6 22 PCT/DK95l00042 or animal body in that particular location f or a period of time which is sufficient to obtain the desired immune response .
In accordance with the invention, a useful cell for expres-5 sion of the above fusion protein is one selected from a bacterial species which inherently cnnt~ 1 nc an adhegin- carry-ing surface organelle. Such species include as examples gram-negative species of E~ntero~acteriaceae such as E. coli, ~le~slella SPP, .CA71 ^7 7A spp, Yersi~ia spp, Vi~rionaceae, 10 ~ ~ ~i7rrR spp, Bordetella spp and P_ ' ~7Ane~e, and gram-positive species such as NP;RSPr;A spp and Streptococcus 9PP .
The epitope part of a fusion protein according to the inven-tion can be an epitope derived from any pathogenic organism 15 or agent against which it is ~1PC; rAh] e to develop vaccines .
Such pathogenic organisms include viruses, bacteria and eucaryotic organisms such as fungi, yeast or protozoa.
h7hereas cells expressing an epitope-carrying fusion protein as defined herein may be used as a live vaccine, it is also 20 within the scope of the invention to provide isolated and/or purified cell surface or~n~ c comprising the fusion pro-tein, ;n~ ;ng fimbriae and pili, as a vaccine, and it is also cnnt~ l Ated that useful vaccines may be provided where-in cells expressing an epitope-carrying fusion protein _ave 25 been killed by conv~nt; nn~l me~hods such as forr~ hyde treatment or thermal treatment.
In a further ~ of the invention, the fusion protein according to the invention comprises as the non-adhesin polypeptide part a toxic gene product e . g. having a selective 30 toxic effect on particular cells in the body such as e.g.
cancer cells. ~y selecting the adhesin part as one having a specif ic binding af f inity to receptors in such cells it is possible to have cells expressing the toxic gene product bound selectively to such target cells whereby these cells -Wo 95/20657 2 1 ~ Q ~ 6 PCr/DKs5/00042 may be killed or damaged by the toxic gene product. It is also possible to use isolated or purified cell or~
cfntA;n;n~ a fusion protein comprising the cell toxic (cytotoxic) gene product for the purpose of targeting the 5 toxic product.
In a further interesting ~ -~; , the fusion protein comprises an antibody. Such an '; is, inter alia,' particularly interesting with respect to the provision of fusion proteins which may be used in affinity purification of 10 biological ~ '- having binding affinity to the antibody part of the fusion protein. It is ~nnt ~ Ated that cells expressing as part of a surface organelle, such a fusion protein may be utilized directly as a means of cfnrf-ntrat;ng a biological ~ ', or the ;AolAtPd surface organelles 15 comprising the antibody-carrying fusion protein may be used f or this purpose .
Furthermore, the fusion proteins as defined herein are useful as carriers of non- covalently bound c U~ S such as pharma-cologically active, diagnostically active and imaging com-20 pounds with the purpose of providing cell8 or cell or~nf-l 1 Pq carrying the active '-, which thereby become targetab-le to particular regions or locations of a body to which these cells or cell organelles are administered. The inven-tion ~nf _-q~P~ any - in~;fn of a fusion protein as 25 defined herein and an active - ' which can be covalently bound to a fusion protein.
As i-~rP~9 above, the present invention ~n~ in one aspect a re~ ; nAnt bacterial cell which expresses a recom-binant bacterial adhesin variant or a FimEI adhesin as defined 30 above. In one specific - '; , the bacterial cell is one which comprises the above-defined rec~ in;lnt replicon.
Df-r~n~;ng on the field of application of such a cell, it may e.g. be selected from a soil bacterium, an a~uatic bacterium, a bActf~r; which is normally associated with plants, a 35 bacterium which is member of the human or animal indigenous -Wo ss/206s7 ~ t g ~ 1 2 ~ 24 Pcr/D~95100042 bacterial flora, or a bacterium which ig adapted to colonize certain ecologic~l nicheg such as e . g . sewage purif ication plants or certain ; nAniT~-t~ surfaces .
The maj or signif~icant advantages which have been achieved by 5 the present invention is the pQcc;h;lity to provide recombi-nant bacterial cells which are not only ecologically well-adapted to grow in a particular ecological environment, but which are also provided with mean_ for no~nn;7;n~ more perma-nently in their ecologically natural environment. These means lO for improved ability to colonize an environment are the A~lh~c;nq expresged by the bacteria which have been con-structed and/or selected 80 as to enable the recombinant bacterial cell to adhere to or bird to specif ic receptors in the environment, i . e . the bacterial cells are targeted to lS that environment. Thereby the bacteria according to the present invention will have an ecologically competitive advantage relative to organisms in the particular environment which do not have surface structures comprising ~lh~;nc binding to receptors present in the environment, at least not 20 to the same extent as the bacterial cells Acrnr~l; ng to the invention .
In addition to the environment-specific Aflh~q;nc which the bacterial cell expresses, the cell will have a phenotype which is desirable in the environment to which it is tar-25 geted. A8 one example, a cell according to the inventionwhich is origi~ally ;cnl~t~d from the human or animal indige-nous bacterial ~lora may typically be one which expresses an epitope ;ncl~ ;n~ an epitope which is part of a fusion pro-tein ~L,:~ed by the bacterial cell. As another example may 30 be mentioned a bacterial cell which is ~ColAt~d from a plant and which expresses a pesticidally active ~ ~ ' such as a RAC; 7 7~q th:lringiensis toxin. Further examples include a plant root-associated nitrogen-f;Y~t;ng bacterium isolated from soil which in accordance with the invention is provided 35 with A~hPq; nc improving the ~ArAh; l; ty of the bacterium to become p~-n~ntly colonized to the roots of a specific plant ,, , ~

Wog~/206s7 ;~ 3 ~ pcr/DKs~looo42 or specific plants, or a bacterium which is ecologically associated with an aquatic or terrestrial environment con-taining pollutants to be f9~rAf9~d or remsved.
Accordingly, the recombinant ~acterial cell can be derived 5 from any gram-negative or gram-positive hArt~rlllm for which a need exists to obtain;, JV~:d Co~ 7Atif)n in a particular ;nAnl~-te or animate environment. Such bacteria include as examples E~nterobactpriAcpAp spp, ~ ;77lR spp, Neisseria spp, Bordetella spp, SLL~:~Lococcu7 8pp, P~ "7A~-PAP 8pp, 10 Vibr i ~nA CPA P gpp, ~A CC- i 7 A C~q e spp .
In certain embs~; tq of the invention it is advantageous that the present r~- in~nt bacterial cell is provided as one which, when it is administered to a particular location or environment, will not persist in that environment. Accord-15 ingly, such a rec~ inAn~ hAct.ori~l cell may further csmprisea gene coding for a gene product which, when expressed has a killing or cell function-limiting effect in said cell, the expression of 8aid gene coding for the cell killing or cell function- limiting gene product being regulated in such a 2 0 manner that the bacterial cell when targeted to receptor in a specific location will be killed or limited in its function in a pre--l~t~rm;n~d manner. The gene coding for the cell killing or cell fllncti~n-limiting gene product is suitably regulated by a factor selected from the group consisting of a 25 stocha8tic event, the presence/absence of a chemical in the location, and a physical factor.
In a further aspect, the invention relates to a method of isolating or constructing a rec ;n~nt ~tPr~A1 cell ex-pressing an adhesin having ''~f~d binding properties rela-30 tive to a natively expressed adhesin such as a nativelyexpressed FimF. adhesin. As it is defined above, this method - comprises identifying in the bacterial cell DNA sequence (8) coding for the billding dsmain(s) of said natively expressed adhesin and substituting at least one codon herein whereby a 35 ~ '; fi~d adhesin molecule is expressed that is different in Wo 9s/206s7 2 1 ~ ~ 7 2 ~ 2 6 PCTIDK9~/000~2 at least one a~mino acid from the adhesin expressed natively, and selecting a bacterial cell expressing the modif ied adhes -in having an altered adhesion phenotype relative to the natively expressed bacterial adhesin.
5 As it i8 p~l z~; nPd in detailg below, the binding domain can e.g. be ;~pnt jfipd by constructing chimeric adhegin-Pnt ~9;ng genes and screening for cells which by having a region in the adhesin gene replaced by a corrpcpnn~l~ n~ heterologous region of a differe~t DNA sequence, acquires a new binding 10 phenotype. Having ;~lPnt;f;ed a binding domain of the natively expressed adhesin, recnmhin~nt cells having ~7Pc; rAhl e binding phenotypea may be nh~A; nP~ by substituting one or more codons in ehe binding domain(s) to obtain expression of recombinant a~lhpcinR and selecting cells having the dPC; rAhl e phenotypes .
15 The substitution 4f codons may be achieved by methods know per se such as si~e-directed mutagenesis using synthetic oligonucleotides and PCR technology or transposable elements or by conventional ra~l;Atinn or chemical mutagPn;7At;nn.
In certain useful e_bn~l; c, the above method includes 20 steps whereby a non-adhesin ,~ ~ o~ln~l is associated with the adhesin, e.g a scep where a gene coding for the recombinant adhesin is part of a llybrid gene comprising a gene coding for a non-adhesin poll~peptide which thereby is expressed with the re~ ; n~nt adhe8in a8 part of a fugion protein comprising 25 the adhesin. Furthr ~, rPc ;nAnt ~lhPc;nR resulting from the above method may in specific -; A, comprise a non-covalently bound c ,_ ' which is Acson;AtPcl with the adhes-in when expressed.
As mentioned ahove, the invention also r-n~ ~-CCes reco-m-bi 30 nant bacterial cells having selected binding properties whereby cells with desirable phenotypes can cnl nn; 7e environ-ments where the presence of hArtPriA having a particular ~h~l,o~y~e is advantageous. Accordingly, there is in a further aspect of the invention provided a method of preparing a 35 rPc inAn~ bacterial cell that binds to a specific receptor . . _ _ . .

Wo ssl206s7 ~ PCT/DK95/00042 moiety, comprising introducing into a bacterium that does not produce an adhesin binding to said receptor moiety, a D~A
sequence coding for an adhesin binding to the receptor moie-ty, and selecting a bacterial cell expressing the DNA
5 sequence.
The primary obj ective of this method is to provide the means of constructing a bacterial strain having the capacity to colonize an environme~t, based on a parent strain which has an inherent, useful phenotype in this particular environment 10 but which does not express an adhesin binding to receptor iet;P~ in the environment. ~ rel;ngly, the method includes as a first step the; q~ ti~n of an envir, Al ly adapted bacterium not binding to dy~Lu~Liate receptor moieties and in subsequent steps, the ;ralpnt;f;cation of heterologous genes 15 encoding Aflhps;nq which bind to receptor -'Pt;~ occurring in said environment, preferably moieties occurring Ah-1n~Ant-ly, ;R~lAt;n~ this gene and introducing it into the above parent strain. The adhesin gene may e.g. be a gene coding for a nAtllrAl ly occurring FimH adhesin or a re~ ;nAnt FimH
20 adhesin as defined above.
In one useful; ' of the method, the adhesin-Pnro~a;
gene is introduced by transforming a parent kActPr;Al cell with a recombinant replicon as defined herein. In further embo,l; tS, the method is designed so as to obtain a cell 25 wherein a non-adhesin ~ ' is associated with the adhes-in, e.g. by introducing the gene coding for an adhesin as a hybrid gene coding for a non-adhesin polypeptide whereby non-adhesin c, a is expressed with the adhesin as part of a fusion protein comprising the adhesin, or by binding non-3 0 covalently a ,~ ~ ' to the adhesin when expressed .
~3esides the ahove method, an adhesin carrying bacterial cell having an altered pattern of A~ P~ion can be provided by using a selection PLCI~:dULe comprising contacting an appro-priately sized porulAt;r~n of wild-type adhesin-carrying 35 bacterial cells with a potential receptor moiety to which the wos5/2o6s7 2 t 8 Q 7 ~ ~i 28 Pcr/DKgs/000~2 wild-type cells do not adhere, e.g. in a manner aC it is disclosed in Example 6 below whereby spnntAn~oovqly or random-ly mutated cells having acsiuired the ability to adhere to the receptor moiety in question, become pLuyLe~ssively enriched.
5 From such an enriched culture, cells with the new adhesion ability can readily be; Rr,l ~te~i and further characterized.
As it has been f~ lA;n~ in details above, one primary objec-tive of the present invention is to provide the means of targeting a ~ ' to a specific location. Accordingly, the 10 invention relate~ in an; _ La~lt aspect to a method of targeting an adhesin to such a location. The method comprises the identification in the location of a receptor moiety, said moiety preferably being one which occurs ~hllnfl~ntly in the particular location, which moiety can recognize and ;nt,~r~rt 15 with an adhesin, and the ;col~t;r~n of a bacterial cell which is capable of growing in the location and expressing an adhesin which reco~n;7~q and ;nt~r~ct,c with the ;r1~ntif~
receptor moiety, and administering the cell or the adhesin in an isolated f orm to that location.
20 The identification of a suitable receptor moiety in a par-ti~ular location can be carried out in several manners. One example is a screening procedure where cells expressing known adhesins or known isolated ;~lh~c; nq are administered to the location e.g. being isolated cells or tissues of microbial, 25 animal or plant origin or an inanimate surface as defined herein, and screening ~or binding/adhesion of the tested ;l~lhf-c;nc e.g. according to adhegion assays as disclosed herein. I~ binding of one or more ~h~q;nq occurs, it is an tn~;r~t;r~n that receptor je~t;Pq for that or those tested 30 adhesin(s), is/are present in the location.
Alternatively, available data with regard to the presence and amounts O~f chemical moieties present on the sur~aces of the location may be collected or such data have to be g~n~r~t~d, and based upon such data, adhesin_ which are known to bind to 35 one or more of the ;~ ntif;ed major et;~q are selected and . ~

2~72~
WO g5/20657 PCT/DKgS/00042 their binding to this/these structure (s) is tested e.g Arrnr~;n~ to the assays as used herein. Chemical moieties which are considered potentiAl adhesin-;ntpr~ct;n~ receptor moieties include as exampleg glycolipids, glycoproteins, 5 proteins, polypeptides, sacc_aride moieties and peptides.
IL the case no suitable rhPm;rAl moiety is i~Pntif~ed in the location, which is capable of binding to known adhesins or which bind with a sufficient affinity, it is required to construct a library of modified adhesin molecules based on 10 known AflhP~;nc which are ';f;~d by rPrl~Ar;ng one or more codons as it is P~rrl~;nPd herein, and/or such a library provided by constructing synthetic adhesin molecules, and then screening this library for recognition of and interac-tion with ;dPnt;fiPd location surface moieties. A library of 15 modified FimEl adhesins may e.g. be selected for spec;f;c;ty towards a given receptor by running cloneg of thege A~hP~l nc~
through a column or matrix rnntA;n;nr~ the receptor moiety in question or cells or tissues isolated from the location without knowing what the receptor moiety is. The clone (8) 20 expressing the ~lhP~;n~ with affinity to receptor moie-ty/ - et;P~ will adhere/bind to the column or matrix, and can subsequently be; qol AtPd therefrom.
It is within the rnntl ,1Atinn of the invention that crystal-lographic analyses of A~lhP~;n~, whether nAtllrAlly occurring 25 or constructed as indicated above, is a useful tPrhn;~lP for the obtA; of information about adhesin structures that A~ ;n~ly will recognize and tntprArt with particular adhes-in receptor iet; P~ .
In ~ccorllAnre with the invention, one ~ '; t of the above 30 method is one wherein the ;~olAted bacterial cell expresses an adhesin having ';f;ed receptor moiety-binding properties relative to an adhesin natively expressed by the cell, the isolation of the cell comprising identifying in a parent b~rtPr;Al cell, DNA sequence(s) coding for the binding 35 domain(s) of said natively ~Le~sed adhesin and substituting _ _ _ _ _ , _ w095/20657 218;07~j 30 PCr/D~95100042 at least one codon herein, whereby a ';f;Prl adhesin mole-cule is expressed that is different in at least one amino acid from the a&esin expressed natively, and selecting a bacterial cell expressing the modified adhesin having an 5 altered A~hPAinn phenotype relative to the natively expressed bacterial adhesin or a method wherein the bacterial cell expressing an a&esin that rPcor; 7PA and binds to the receptor moiety is a re~ inAnt bacterial cell derived from a parent h~Act~riAl cell that does not produce an adhesin 10 binding to said receptor, by inserting into the parent cell a DNA sequence coding for an adhesin binding to the receptor moiety, and selecting a hArtPr;Al cell expressing the DNA
sequence .
O~e primary ob; ective of the present invention is the target -15 ing of useful non-adhesin ~ '~ to a particular location.
Accordingly, the invention Pnr, AAes i~ an interesting ~';~Pnt a method as defined above wherein a non-adhesin r, olln~l is A~;COr;~Ated with the adhesin, whereby said com-pound is targeted with the adhesin to the location comprising 20 the receptor moie~ies reror~n; 7~Ahle by the adhesin.
The, , ' can 3~e a~sociated with the adhesin by a covalent binding or by any of the above ; r~nP~1 non- covalent types of molecule interaction f orces .
When associated covalently with the adhesin the ~-, ' to 25 be co-targeted to the selected lor~Ati~n with the a&esin can be an en7yme, an antibody, an epitope or a toxin which is part of a fusion protein comprising the adhesin. A compound which is ~sor;AtPd with the adhesin by a non-covalent bind-ing is typically a rhArr-colo~ically active, diagnostically 3 O active or imaging r hocations to which it is 1P~; rAhle to have an adhesin tar-geted by the present method include a human or animal sur-face, a plant surface and an ;nAn;~Ate surface as defined above .

2 1 ~
wo 9~/20657 pcTlDK9slooo42 In one specific: ' -~1 o~ the present method the bacteri-al cell being administered to the location expresses a recom-binant bacterial adhesin variant derived from a naturally occurring parent adhesin, said a&esin variant having altered binding properties relative to the n~t~ l y occurring adhes-in from which it is derived, the altered binding properties ;nrl1~A;n~J binding to at least one receptor moiety to which the parent adhesin does not bind. Such an adhesin variant is advantageously derived from a naturally occurring adhesin ;~ol~ted from a cell structure selected from the group con-sisting of a capsule, a lipopolysaccharide layer, on outer - protein, a flagellum, a pilus, a fimbria, a non-fim.brial adhesin (NFA) or an afimbrial adhesin (AFA).
In sper; f; c pmho~ of the invention, the above adhesin variant as used in the present method is a protein having an amino acid SeQUenCe differing in at least one amino acid residue from its parent protein adhesin such as a FimH adhes-in having an amino acid sequence which differs from the E.
coli PC31 Fim~ adhesin as defined herein in at least one amino acid. Such a FimH adhesin ;nr1ll~ an adhesin which binds to a receptor selected from the group consisting of a domain where mannosyl residues are not terminal and a domain devoid of saccharide and an adhesin variant which is at least 90% homologous to the PC31 FimH adhesin as defined herein, such as at least 92% homologous, more preferably at least 93%
homologous, even more preferably at least 94~ homologous, most preferably at least 95% homologous, and in particular at least 96% homologous, e.g. at least 97~ homologous. In par-ticularly interesting ` '; c, the adhesin is at least 9896 homologous, ;nrllld;n~ at least 999~ homologous or at least 99 . 5~ homologous .
The above FimE~ adhesin can be a chimeric adhesin as defined - above, comprising amino acid sequences from different FimH
ior~h~; nç~ and con8tructed according to the methods below.

Wo 9s/20657 2 i 8 012 ~ ,~ c - ~

In accordance with the invention, an adhesin can be admirlis-tered to a location in the form o~ an adhesin-expressing bacterial cell. Such a cell is one capable of growing in that particular location. Accordingly, the ~acterial cell is 5 suitably derived ~rom a bacterial gpecieg which is normally occurring in the location including human or animal body surf aces, plant sur~aceg such as plant root surf aces and ;n~n;~-tP surfaces. In this context, an animal body surface includes the insect gut, whereto it is .l~qt r:~hl e to adminis-10 ter a h~CtPr;~l cell expressing an insecticidally activetoxin.
Thus, if it is desired to adminigter the b;~rtf~ri~l cell to the root of a plant, a suitable bacterial cell is preferably isolated from a strain which hag colonized the rh; ~sphPre of 15 that plant to a large degree, i.e. the strain is a ma~or member of the natural plant root f lora . Such an isolate is then provided with a gene coding for an adhesin which will recognize and interact with an ~hllntl~ntly occurring moiety on the roots of said plant. In this manner, a suitable adhesin 20 which is e~ssed n~tllr~lly in a bacterium which is not adapted to grow ir~ a plant rh; ~Qs~hpre~ becomes expressible in a normal inhabitant of the rhizosphere environment (loca-tion) In specific -'' q of the present method of targeting a 25 bacterial adhesin to a sper; f; C location, the adhesin is a FimEI adhesin as defined above, having an amino acid sequence which differs ~rom the B. coli PC31 Fim~ adhesin as defined herein in at least one amino acid.
In an interesting '; , the adhesin-carrying bacterial 30 cell being targete~ is a cell which further comprises a gene coding for a gene product which, when it is expressed, has a killing or cell flln~ti~n-l ;m;t;ng ef~ect i~ said cell, the expression of said gene codi~g for the cell killing or cell ~unction- limiting gene product being regulated in such a 35 manner that the b~tPri~l cell, when targeted, will be killed ~ WOs~t206s7 2~726 p~, ~
or limited in its fllnrt;cm i~ a pre-detP~;nP~l manner. The expression of such a "suicide" or cell function-limiting gene may suitably be regulated by a factor selected from the group consisting of a stochastic event, the presence/absence of a 5 chemical c _ ' in the location and a physical factor. As examples of such "suicide" or cell function-limiting genes providing the means of biological cnntA; , may be me~-tioned thoge disclosed in W0 87/5932 and W0 93/20211 Furthl ~:, the present Designer Adhesin Te~hnf)logy (DAT) 10 provides very useful means of obtaining cnlf~n;7~Atj~n with desirable bacteria in a particular environment with the purpose of obtaining bPnPf;~;Al changes of the microbial flora i~ the environment. As one example, certain hartPr;
species in the gastrointe8tinal (GI) tract of humans and 15 animals have beneficial effects on the health condition of the host organism e.g. by ~iuy~ ,as~i~g pathogenic organisms or by contributing to the digesting of certain diet c lonPnt~.
The present tPrhn~ gy makes it possible to select particu-larly useful bacteria ~rom the GI-tract arld have them0 desig~ed in accoL~ ce with the preseIlt invention, to have ~,v~d c~] r~n; '~At; rn abilities . Similar examples include ~ irAh~e bacterial rolon;~At;nnq of biological sewage puri-fication systems, plants where invasion of pathoge~ic organ-isms may be controlled by colonizing the plants with harmless 25 bacteria, and teeth where caries may be controlled by coloni-zing the dental erlamel with bacteria ,iu~p~e~si~g those caus-ing the caries attacks.
In another industrially interesting aspect, the invention provides the means of ;R~lAt;n~ a ~ _ ' from a ~ ltinn or 30 E~ 2pPnA;c~n r~ntA;n;ng the , '. The method comprising c~ntArt;n~ the solution or the suspension with a fusion protein as def ined herein wherein the heterologous polypeptide has an affinity to the c ~ to be; ~ol Ated.
Purth~ ~ ~, the invention provides a composition comprising 35 a porlllAti~ln of a bacterial cell as defined herein.
, . _ _ _ _ _ , . .. , . _ . .

Wo95l20657 2 ~ 8~7~ - r ~ o~,2 The invention i5 further illustrated in the below Examples and the Figures, rdrherein Fig. 1 is a schematic model for the construction of recom-binant pl~ ~c pGBl-24 (~nntA;n;ng fim~ from CI #10) and pGB2-24 (c~nnt;l;n;ng fimH from PC31) used for transforming E.
coli AAEC19lA(pP~I.114) with cloned fimH genes. Plasmid pGB2-24 was used as the vector for all other cloned fimH genes described herein;
Fig. 2 is a restriction map of fimH genes. Five unique res-triction sites are present in the PC31 fimH gene. Numbers in parPnthpcpc following enzymes are the base pair positions of the cut sites. Some of these sites are found in the other fim~ genes, as ma1-ked. S'h; ~ genes were produced by ex-changing each available re8triction fr:ls from the other five fimE genes with cuLL~ fl;ng- frF~, ' c in the PC31 gene and then re~ n~nt 8train8 expres8ing regulting chimeric fi~l subunits were tested for ~rlhpcinn. F _ R indicated by boxes are those which conferred MF or MFP adhesive phenotypes on the chimeric genes;
Fig. 3 illustrate~ hPc;nn of representative "wild-type" (A) and re~ ;n~nt (Ei) M-clagg, MF-class and MFP-class strains to Mn (1), Fn (2), periodate-treated Pn (3) and to FnSpl (4) .
Strain tl~si~n~tlnnc given for the "wild-type" strains are given in AS. Strain design~t;~nc RB31, RBl2, RB4, RB7, RB50 and RB10, are for Ll ' in ~nt strains of AAECl9lA(pPX~114), which is f~, after transforr-tinn with plA~ 'flc that contain fim~l+ from strains HB101 (pPECL4), CI #12, CI #4, CI
#7, CSH-50 and CI #10, respectively. Open columns indicate results when bacteria were ;ncl~h~tp~l in buffer without D-mannose, while solid columns are results in the presence of D-mannose. Values indicated are the mean t S.E.M. (n-4) for each column;
Fig. 4 illustrates the ~(lhpcinn of ~ Lesc~Lative M-class, MF-class and MFP-class strains (CIs #12, #4 and #lO, respect-. . .. _ _ ... .. . _ _ _ _ _ _ _ _ . _ . .

w0 95/20657 ~ 3 r~ s,~ ~ l2 ively) to Fn fra; ~ prepared by thermolysin treatment as described in ref . 51. Columns 1 ~hPl 1 Pd 1-5 indicate ;lf~hP~inn to: 1) NH2-terminal 30-kDa domain; 2) the 55-kDa gelatin-binding domain; 3) the 110-kDa cell ~tt~ domain; 4) the 5 29-38-kDa heparin binding domains; and 5) the 20-kDa COOH-tPrm;nAl domain. Open columns represent adhesion in the absence of D-mannose; solid columns rt~Lt:SC~ adhesion in the presence of D-mannose. Mean + S.E.M. (n~4);
Fig . 5 is a composite f igure illustrating comparison of amino 10 acid sequences of FimH ~tlhP~;n~ and active restriction frag-ments of fimH genes. The pllhl; FlhP~l nucleotide and deduced amino acid sequence of the PC31 f~mF{ gene and gene product (ref. 27) serve as prototype. Numbered amino acid residues shown above the model of the PC31 FimEI represent residues 15 that are different in other FimH subunits due to amino acid substitution or deletion. Standard one-letter code applies and residues in the other FimH sequences that are different are ;nrl;r~tPd~ Deleted amino acids are indicated by ~\. It should be noted that residue 176 i5 not arginine a5 pllhl; ~h 20 previously (ref. 27) for the PC31 FimEI, but proline. Regions of the FimH subunits conf erring change in adhesive phenotype, highlighted in bold, were detP~;nPd by fllnrt;nn~l assays performed on chimeras between the ~classic~ mannose-specific PC31 fimH gene present in H13101 (pPRL4) and the ahove 25 described genes. Residues predicted to be key in conferring receptor specificity are circled. Approximate positions o~
unique restriction siteg used to create rh; ~ are indi-cated along the bottom of the model;
Fig. 6 illustrates plasmid pP~L4 which is a derivative of 30 p3R322 (thick line) carrying the entire fim operon (Fim~-H) ;nrl~ ;n~ the regulatory genes fllnE~ and firnE (not shown), and the promoter region with the SnARI site. In this plasmid an 8mer linker with an BglII site was inserted in the S~a~I site to create pPRL83;

Wo95/20657 2 ~ 8 ~J 726 r~ s ~r '7 Fig . 7 illustrate~q the construction o~ plasmid pSM13 14; the vector pVLT33 i8 a derivative of the broad host range replic-on RSP1010. Plasmid pP~I,83 was digested with BglII and pVLT
was digested with Bai~H1; the two were ligated and pSMl314 was 5 the resulting plasmid in which expression of the fimA-H
cluster is under the control of the tac promoter;
Fig. 8 illustrates plasmid pl PA22 and derivatives hereof as used in this study. The triangles indicate the position o~
translational stop-linkers in the fim~ gene in plasmid 10 pPRL115. The positions of heterologous inserts are indicated (black boxes). Small tr;An~l~q indicate signal-peptide encod-ing sectors.
Fig. 9 illustrates E~lA~ ~lq pI,PA29, pLPA30, pLPA36, pLPA58, pLPA59 and pLPA98 j 15 Fig . 10 shows immuno - electron microscopy with colloid gold lAh~l1;ng of E. coli H~3101 cells cnntA;n;n~ E)lA~-~;tlq pLPA22 plus pPKL115 (a), pLPA37 plus pPRL115 (b), pLPA38 plus pPRL115 (c), using anti-pre-S2 monoclonal antiserum. 13ar, 0 . 1 ~lm.
2 0 EX~MPLE
pllnrt;nnAl het~rn~eneity o~ t~e 1 f; Al A~lh~-q;nq due to m;nnr se~nl~-n-~P vAriati~lnq; ~r fl ' q.onaq 1.1. IYIA ter~ A 1q An~ hn~lq 1.1.2. ~PAq~ntq 25 Yeast Mn, a poly..~.-~o2,ylated glycoprotein isolated from Saccharolzyces cerevisiae cell walls, was obtained from a commercial source (Sigma Chemical Co, St. ~ouis, M0, U.S .A. ) .
Mannan is c -r~-~ of an N-lir,ked hAt ~hnn~ of ,B1,2-linked ~yLa~lose units with al-linked mannopyranose side chains 30 (re~. 38). The ma~ority o~ the carbohydrate of human plasma y~
wo s5/206s7 pcrlDKsslooo42 Fn is - ~c of N-glycosidic complex-type h;AntPnnAry glycans and no high mannose-type or hybrid-type N-glycans have been described (refs. 30, 45, 54). Human plasma Fn and Fn fra~; t5 were purified as described previously (refs. 5, 15, 51, 58~. Periodate treatment was performed as described previously (ref. 51). The synthetic peptide, FnSpl, copying the first 30 amino acid residues of the Fn molecule (EAQQMVQ-PQSPVAv~K~G~rll-- H~I) was synthP~;7Pd in the Protein Chemistry T~hnratory of the VA Medical Center, Memphis, TN
(SEQ ID N0:2). The saccharide content of the four substrata was rhArArt~rized using two lectins, cu~ ~vcLlin A (ConA), well known to react with tPrm;n31 and ;ntPrnAl =osyl residues , and the r~ 7-qnthTlq niralis agglutinin (GNA), which recr,~ni7~ only tPrm;nAl Mano~1-3Man, Man~1-6Man and Man~Yl-2Man sec~uences (E. Y. TAhnr~tr,ries, San Mateo, CA). Immobi-lized Mn and Fn both reacted with ConA, whereas GNA bound only to Mn. These results are consistent with the known structures of the oli~osacrhAride moieties of these two . Neither lectin reacted with; -`-il;7Pcl FnSpl.
Periodate treatment (ref. 51) of Mn or Fn eliminated lectin reactivity .
1.1.3. 3acter~A1 strAin~ ~nfl TllAI 'rlq The CSH-50 strain (lambda~,F~ara~(lac-pro) rsp~ thi fimE: :ISl) is a Cold Spring Harbor R12-derived strain (ref .
35). The 1~. coli strain MG 1655 (CGSC6300; R12 derivative, lambda~,F~) and a derivative strain AAECl9lA (MG1655 recA
~fim were generously provided by Dr. Ian Blomfield (30wman Gray University, Winston-Salem, NC). AAEC19lA has had the entire f~m gene cluster deleted by allelic ~a.~ (ref. 8).
Clinical ;~nl~tP~ (CIs) were urinary tract ;~nlAtP~ obtained from the clinical microbiology lAhorAtories of the Memphis VA
r~edical Center or The City of Memphis Hospitals, Memphis, TN.
The 12 CIs used in this study were sPlectPfl on the basis of I~S agglutination of yeast cells af ter growth in broth, a classic test for type 1 fimbriae.

WO95l20657 2 ~ ~7~ 33 PcrmKA l2 Plasmid pPR~4, a p3R322 derivative rnnti:l1ninr~ the entire fi~
gene cluster from E. coli gtrain PC31 (R12-derivative, gal tonA ph~r ara) and Pnrorlin~ for the expression of fully func-tional type 1 fimhriae in B101 (supE: hsdS recA ara proA lacY
5 gal~ rspL xyl mtl ~fimB~), has been described previously (ref. 28). pPK~114 is a re- ;n~nt plasmid derived from pPRL4, but with a tr~n~l~tinn~l stop-linker inserted into the Rpnl site in the fimF~ gene. No transcriptional effects of the stop-linker are to be PYrected. Antibiotics were used at the 10 following final cnncPntrPtinnR: ampicillin (50 ~g/ml), kanamycin (60 ~g/ml) and chl' ~hPnicol (30 ~g/ml).
1.1.4. Polymer~e rh:~;n reaction Oligonucleotide primers were degigned uging the p-lhl ~ chP~l sequence for the fimN gene in pPRL4 (ref. 27) . The 5' primers 15 copied regions 13 and 49 bp upstream from the f~mN gene and were f~YtPnrlPd on the 5 ' end by an Apall restriction site and a GC clamp: Primer 1: 5'-GGGGG-GTGCAC-ACC TAC AGC TGA ACC
CGG-3' (SEQ ID N0:3); Primer 2: 5'-GGGG GTGCAC T QG GGA ACC
ATT CAG GCA-3' (SEQ ID N0:4). The 3' primers copied 18 bases 20 of the bottom strand of the f~mH gene that encode for the 6 terminal amino acids of flmH and were PYtPnrlPtl by an Fspl or Sphl site and a GC clamp: Primer 3: 5'-GGG TGCGCA TTA TTG
ATA AAC AAA AGT CAC - 3' (SEQ ID N0:5); Primer 4: 5'-GGG
GCATGC TTA TTG ATA A~C AAA AGT CAC-3' (SEQ ID N0:6) . Primer 1 25 and 3 were used for CI #10 and pPRL4, primer 1 and 4 were used for CI #4 and CSH-50 and primer 2 and 4 were used for CI
#s 7 and 12 to generate PCR products from plasmid or 1 DNA prepared from B. coli expressing differe~t fllnrt; nnAl cla8geg of type 1 fimbriae. The PCR reaction 30 mixture consisted of template DNA, primer pairs, d~lTPs, and Taq DNA polymerase in PCR buffer. The PCR was performed in a Perkin-Elmer Cetus ~lt~ tiC thermal cycler with ~Pn~tl1rpt~nn at 96C for 1 min., primer ~nnP~l ;nrJ at 55C for 1 min., and primer P~rtPncinn at 72C for 2 mins. for a total of 40 35 cycles. All of the PCR products migrated similarly in agarose Wo 95/20657 2 ~ 8 ~ 7 ~ 6 PCrll)K9~100042 gels. Purification, restriction and ligation of DNA was performed using standard yLuceduLes (refs. 39, 48). All primers f or PCR and f or nucleotide se~uencing were produced by the ~olecular Resources Center, UT, Memphig.
5 1.1.5. Sllhrlt nint~
The PCR products from CI#10 and from pPRL4 were cut with respective restriction enzymes and ligated into the Apall and F~7pl re8triction site8 of pla8mid pACYC177 (New England Biolabs, Beverly, MA, U.S.A.) which is ~ -t;hl~ with the 10 pBR322-based pPRL114 to be used in _ 1~ Ati on experi-ments, creating rlAr- ;~lq pGBl and pGB2, respectively (Fig.
1). However, it became incorlvenient to u8e pACYC177-based pl~P~ C because of a high frequency of appearance of sponta-neous Rmr in the A~EC19lA host strain. The origin of this 15 problem is not entirely clear, but it was avoided by subclon-ing the fim~ genes from pGBl and pGB2. The inserts and upstream regions of pACYC177 t~r,n~tining the tet promoter were cut from pGB1 and pGB2 with Fspl and BamH1 and subcloned into the polylinker site of pGEM-3Z (Promega, Madison, WI) that 20 had been cut with l~amHl aud ~inc2, creating ~1A~ tlq pGBll and pGB2-1 respectively. pGEM-3Z was simply used as a con-venient ~ n~ '; Pte in 8ubcloning into pACYC184 .
The iIIserts were cut out again using Smal and Nind3 and subcloned into pACYC184 (New England Biolab8, Beverly, MA) 25 cut with ~inc2 and Hind3, creating r~ q pGBl-2 and pGB2-24 rrntA;nin~ the fim~ gene8 from CI#10 and pPRL4, respect-ively. These plA~-~itlq complement the non-adhesive defect of AAEC19lA(pPl~L114) giving the adhesive phe~lttLyyes of the parental strains (see Results) . Cutting the fi~E gene from 30 pGB2-24 using Apall and Sphl makes it possible to easily insert other fimH genes ^htAin~d by amplifying C1-L~ ~~ 1 DNA of other isolates by PCR. All , ~:- i n~nt gtrain8 we have tested thus far using this terhnl tI'I~ exhibit the same adhes -ive phe:~uLy~e as the parent strains from which the fimH genes 35 were cloned.

-Wo 9Sl20657 2 ~ 8 ~ 7 ~ ~ 4 0 PCTIDK95/00042 1.1.6. ~nnqt~uction of rh; ic fil -~ qPnP~
Unique restriction sites ~Fig. 2) were used to construct chimeric fimH genes between the prototypical MS pPX~ fim~
gene, used as genetic ba~hyL"u~.d, and re8triction fr~
5 obtained from the newly de8cribed fimN gene8. Frs~ ~ were purified from agarose gels and ligated into restriction ~spaces'~ gPnPratP~ in the pP~tL4 fimH gene pregent in pACYC184 (pGB2-24). Each chimera was analyzed by restriction mapping and the nucleotide seg lPnrP~ of bridging gegments were deter-10 mined to ensure proper constructions. The rl;~r~i~ rnntA;nlngchimeric fim~ genes were transformed into AAECl9lA(pPi~L114) and clones were tested for agglllt;n~t;on of yeast cells and for adhesion to Mn, Fn and FnSpl.
1.1. 7 . Nucleot; riP se~;Tuencing 15 The nucleotide sequences of fin~ genes were ~ptprm;np~l by the dideoxynucleotide chain tP~n;n~tinn method of Sanger (ref.
49 ) using a Sequenase II~ kit (U. S . 13iochemical Corp ., Cleve-land, Ohio) and [a-35S~dATP (800 to 1,000 Ci/mmol) according to the ~^nllf~rtllrer~ s ~uggestions. The amino acid SPrl~lPnrpq 20 were deduced from xlucleotide sequence¢ using MacVector~
protein and DNA analysis software (Eastman ~odak, Rochester, NY). To ensure fidelity of the PCR amplification, selected fimE genes were re-amplified, cloned, tested for activity and re-sequenced. More recently, we have used the fmol~ Polymer-25 ase Sequencing System (Promega, Madison, WI), because it isuseful with small amounts of DNA and thus subcloning the fim~
genes from the pAC~Cla4-based pl~r~;~l~ to high copy number pl~l rl~ wag obviated. ~ands were visualized by :lutnrAr~
graphy of sP~lPnrl ng gels and compared with the pllhl; ~hPd 30 fimF~ gene sequence (re:E. 27).
1.1. 8 . YP~t cell aqqreqation ~ v E~. coli were tested f or their ability to aggregate yeast cell8 . Commercial baker' 8 yeast, Sac~ y~es cerevisiae, _ 21 8~726 was sll~pPnAPd in PBS (5 mg dry weight/ml). E. coli were washed in PBS, resuspended to an ODs30 of 0 . 4, and mixed with the yeast cell suspension in PBS with or without 1~ D-mannose. Aggregation waa monitored visually and the titer 5 recorded as the last dilution giving a positive aggregation reaction .
1.1.9. ~lh~ n ~q~ys Adhesion assays were performed as described previously (ref.
51). Briefly, microtiter assay wells were coated with 10 receptor -l~c~l P~ as indicated in the text and figure leg-ends. After the wells were washed two times with PBS, 100 ~11 b~tPr;~l suspensions were added in 0.1~ BSA-PBS. After ~nrllh;lti~n at 37C for indicated timeg, wells were washed three times with PBS and adherent bacteria were APtec~tPd by 15 using rabbit anti-E. coli serum. Antibody bi~ding was detected using peroxidase-conjugated goat anti-Rabbit IgG.
FP~t;on product gl~n~rat~A~ from the 5-Am;nn~l icylic acid substrate was measured at 405 nm after 10-15 minutes by using an ~t~ tic microplate reader ~olecular Devices, Inc., 20 Menlo Park, CA). Values reported are corrected for background reaction using BSA coated plates as control.
1. 2 . RP~II1 ts In a previous publication it was reported that type 1 fimbriae of E. coli CSH-50 and B101 (pPi~4) differ func-25 tionally in their pattern of ~AhP~ n to Mn, Fn, periodate-treated Fn and a synthetic peptide, FnSpl, ; h; 1; 70~ on plastic (ref . 51) . Since CSH-50 and HB101 (pP~4) are labora-tory strain6, we tested 12 clinical E. coli isolates (CIs) obtained from human urine for ~hP~; nn to these four substra-30 ta. All of the CIs aggl~lt;n~tP~A~ yeast cells in a MS fashion.
- Five of the twelve CI6 adhered only to Mn. The adhesive activity of HB101 (pPRI4) and of CI ~12 are shown as examples of this class, which we have tentatively designated as ~q class (Fig. 3A). Three of the 12 CIs adhered to Mn and Fn, W0 9S/20657 2 1 8 ~ ~ 2 ~ r l~ ~ l2 ~

but not to periodate- treated Fn or to FnSpl . The adhesive activities of CI #s 4 and 7 are shown as examples of this class, designated as MF class. Three of the twelve CIs adhered to each of the substrata. The adhesive activities of 5 CSH-50 and CI #10 are shown as examples of this class, desig-nated as MEP class.
~rlhPqinn of 8trains repregenting these three classes to Fn fr~5 ' ~ further illustrates the distinct differences between the three classes. The M class CI #12 does not adhere 10 to any of the Fn fra,3 q ~Fig. 4). The MF class CI #4 adheres to the 40-kDa gelatin-binding fr~3 . The MFP class CI #10 adheres, with only slight differences, to all 5 frag-ments of Fn tested. Periodate treatment Pl ;m;nAtPd binding of CI #4 to domain 2, but had no effect on the binding of CI ~10 15 to any of the Fn domains (data not shown).
Since the fimH subunit has been shown to mediate the mannose-sensitive activity of type 1 fimbriae, we focused our initial efforts to Pl~r;~te the molecular basis for the observed fl~n~t;nn~l heterogeneity on the fimEI gene. fimH genes were 20 ~1; fiP~ from chromosomal (or plasmid, for pPE~L4) DNA and the genes were cloned into pACYC177 and subcloned into pACYC184 under co:r~trol of the ,B-l~ct~r~qe promoter of pACYC177, according to Materials and Methods (Fig. 1) The adhesive phenotypes conferred by the fimH genes were 25 tested in the following way. E. coli ~-12 strain AAEC19lA
(~fim) was first ~ransformed with plasmid pP~L114, which cnnt~;nq an intact fim gene cluster but with a tr;:lnqls~t;c~n~l stop-linker inserted into the last gene, fimF{. This deriva-tive produces morl~hologically normal fimbriae that are non-3 0 adhesive due to absence of the FimH subunit . Plasmids har-bouring cloned fi~lH genes were transformed into E~. col~
AAEC19lA(pP~L114) and the resultant strains were tested for their ability to adhere to Mn, Fn, periodate-treated Fn and to FnSpl (Fig. 3B) . Each of the re~ ln int gtraing displayed 35 adhesive phe:~oLyyes mimicking those of the reprPqPnt~t;ve 2 ~
_ wo ssno6s7 ~ 7 parent strains from which the fimE genes were obtained. fimF~
genes were cloned from each of the other 8 CIs and 8imilar results were obtained with the adhesion of recombinant strains mimicking that exhibited by the parental CI8.
5 The complete nucleotide sP~rl~lPn~P~ of each of the six repre-sentative f~ genes were ~lPtPrm;nPd and the amino acid sequences of the fimH proteins were deduced as it is shown in Table 1 below which is a represent~tion of amino acid sPq~lPnrPC of the FimEI subunits deduced from nucleotide 10 sPql1PnrP~ of selected fimN genes disclosed in this example [CI#3 (SEQ ID NO:33), CI#4 (SEQ ID NO:29), CI#7 (SBQ ID
NO:30), CI#10 (SEQ ID NO:31) and CI#12 (SEQ ID NO:28) ] and those of the E. coli ~C12 strain PC31 (SEQ ID NO:1) and E.
coli strai~ CSEI-50 (SEQ ID NO:32). Additionally, the FimE~
15 amino acid PP~PnrP~ of the following ~rl;n;r~l ;Qnl~tp~ of E.
coli are shown: 1~321 (SEQ ID NO:27), ~S54 (SEQ ID NO:35), U221-3 (SEQ ID NO:36), M~#9-3 (SEQ ID NO:37), ~$J#31-3 (SEQ ID
NO:33), M~#11-2 (SEQ ID NO:39), MJ#2-2 (SEQ ID N0:1) and F-18 (SEQ ID NO:34). Standard one-letter code applies. Deleted 20 amino acid residues are ;nrl;r~tP~l by ~8. M, ML, MF, MFP, and MR indicate the adhesin class as defined above.

Table 1. Amino acid sequences of the FimH proteins deduced from nucleotide sequences of fimH genes of clinical isolates disclosed in this example and of E. coli K12 strains PC31 and Table 1, continued W095/20657 21~Q~6 46 P~ l,'C ~2 The nucleotide and deduced amino acid sequences of the pPl~L4 fim~ gene are l~pntir~l to that reported previously, except that residue 176 is not an alanine residue as previously reported, but a proline residue. Tn~lPpPnflPnt re-amplifica-5 tion, re-cloning and re-8Pq~.lPnrlng rnnf; ' this for the pPR~4 f~ gene. Se~uencing was also repeated on lntl~ ,A-"~ly amplified and cloned ;q~ tPC of the CI #10 and CI #7 f imH genes to conf irm sequence f idelity and no errors were f ound .
10 me nucleotide and deduced amino acid spqllpnrpq of the other fim~ alleles described in this Example are ~ g8~ conserved, but there is more than one amino acid residue difference in all but one of the new fimF~ sP~lpnrpq when compared to the p~.hl; qhP-l pPRL4 8equence. To focus on the gequence differ-15 ences that resulted in changes in fl~nrt;~n~l activity, advan-tage of unique re~triction sites were taken (Fig. 2) to construct chimeri~ fi~nE genes. Multiple re8triction fr~s -~covering the entirety of each of the sequenced fi~n}~ genes were ~u~ d wi th corresponding f r:3; q in the prototypi -20 cal fimN gene of :E. coli strain PC31 that was amplified frompPR~4, cloned into pACYC1~4 and used as the genetic back-ground. ~Pr~ ' ;n ll~t ~lAI 'tlq rnnt~;n;ng- the chimeric finL~
genes were transf ormed into E. coli AAEClglA (pPR~ ) and transformants were tested for adhesive phenotype, allowing 25 rlptprmln~t;on of the regions of each gene capable of confer-ring flmrt;~m~l activity (Fig. 5). All of the sequence changes that affected function occurred between residues 33 and llg of the 279 residue mature fim~ se~auence.
1.3. 3;qr~qqion 30 The functional heterogeneity which is described above must be due entirely to a] lelic variants of the f~ gene. The only variables in the rernTnh; n;~nt strains which are described in this Example are the fi~n~ geneg; all other geneg nPcpf~q~;lry for fimbrial subunit synthesis, tL~ LL and assembly are 35 the same in each case. Since the ratios of the various genes _ ~ sa~O
9s/20657 ~ '7 and gene products should also be identical, 7ubunit incorpor-ation into the fimbrial superstructure should not vary sig-n; fi ;lntly. Thege regultg emphagize that in these experiments it is the FimH subunit that ~l.ot~rm;n~ receptor specificity.
In comparing the new FimH 8equences to the one p lhl ~ ~Pd previously (ref. 27), the only 8tructural alt~rA~inn that can be clearly linked to a fun~tinn~l change, without resorting to analysis of chimeric fim}~ genes, is the non-conservative substitution of arginineS8 in the MFP class CSH-50 FimH
8ubunit for leucineS8 in the M cla8s PC31 FimH subunit. Since each of the other FimH sequences had more than one change, it was nPcP~Ary to construct chimeric genes to begin to focus on fllnctirnA~ ly relevant changes.
In the case of the CI #10 FimH, an MFP class adhesive activ-ity similar to that of CSH-50 is conferred by a different region of the gene which encodes for a subunit deleted of residues 116 -119 . It remains to be detPrn7; n~d how two dis -tinctly dif f erent structural changes can bring about appar-ently similar change8 in receptor spef; f; ~; ty . It is pos-sible, of course, that as additional receptor molecules are tested, these two variants will be found to be flln~t jnn;ll ly distir,ct .
The Apall-Tt~llllI fra5 ' of the CI #7 flmH gene confers ~qF
cla8s activity in the CI#7/PC31 fimH chimera. Since the asparaginel6 - threonine7 6 substitution is within the leader sequence and thus not L~L~:s~:~lted in the mature protein, the histidine33- asparagine33 substitution must be of functional importance for the MF cla~3s CI #7 FimH. Comparison of the active regions of the MF class CI #4 and the M class CI #12 -30 FimH subunits suggests the importance o~ the glutamic acid73- glycine73 substitution for MF cla8s activity of the CI #4 FimH. Thus, histidine33, arginine58, gluta~ic acid37 and deleted glycine116-; ~nl e~ ; n~119 appear to be key residues in the flln~tinnAl activity of FimH subunits of CI #7, CS~-50, CI
#4 and CI #10, respectively, but a more precise demonstration =~

WO 95/20657 2 1 8 ~ 7 ~ ~ P~ C ~
of which regidues are involved and how they affect the ligand-binding cleftls) remains to be performed.
At first glance, the FimH ';~ted, mannose-sensitive pro-tein-binding activity of type 1 f imbriae is the most surpris -5 ing of the adhesive phenotypes described here. However,protein-binding activity of FimH (i.e. PilE) subunits was noted earlier in a study rll~ractPrizing mutT-induced muta-tions in the fimH fpilE:J gene (Harris et al., ref. 22) How-ever, the protein-bi~ding activity described by Harris et al.
10 was not mannose-sengitive. It i8 presently not known whether the protein-binding activity described herein is in addition to or S~rAr~te from the mannose-binding activity, but the concept of bifunctional properties of lectins has been estab-lished for several years (ref. 6). While the MFP class type 1 15 fimbriae appears to react s~ t promiscuously with most Fn fr~A~ ~~s, the reaction does not appear to be non-specific.
For instance, the MFP class CSH-50 type 1 fimbriae do not adhere well to gelatin (ref. 51). Further, the adhesion to ovalbumin is sensitive to both periodate and glycosidase 20 treatment (ref. 51). Further work will be required to deter-mine the consensus amino acid motif reactive with this class of FimH subunit.
Previous studies ~uggested that the combining site of the E.
coli FimH adhesin is in the form of an ~Yt~n~l~od pocket cor-25 rPç2pnnrl; n~ to the size of a tr; ~æcnhAride with an AASOr; AtPdhydrophobic region (ref. 16). The MS nature of all of the adhesive ;ntl~rA~t;r~n~ described suggests that if the combin-ing sites are s~rAr~te, they may be close to each other.
However, it remaisls to be ~l~t~-rm; n~d whether or not the 30 mannose effect is direct or allosteric. Conforr~tinnAl changes that f requently occur in lectins upon binding the saccharide ligand (ref. 46) could affect a second, distant binding site. Site-directed '~t;~n~ may be sufficient to clarify which structural changes result in changes in 35 receptor specificity. ~owever, such studies are unlikely to shed much light Oll how the structural changes actually relate wo ss/206s7 2 ~ ~ ~ 7 2 6 ~ a - -to the ligand-binding cleft (8) and it will ultimately be nD~DR~Ary to ~lDtQrm;nD the 3-~ 'nnAl structure of FimE or Fim~ fr, - q crystallized in the presence of ligand to fully ulldeL~Lalld structure/function relatinnqh;rq.
5 The three adhesive classes of type l f; ' ';le ;~ nt;f;Pd above may understate the functional heterogeneity of type l fimbriae. The group of CIs that has been tested in this 3x_mple is small and only a few substances have been tested as potential receptors. A larger group of isolates tested 10 against additional receptor rAn~l; tlAtDq might yield additional f~nrt;rnAl classes. Prel ;m;n~ry studies with MS EuLeL~bacter ae.u~ 3 and }~lebsiella, iA~ strains exhibiting NF
class and MFP class activity suggest that heterogeneous receptor sper;f;rities will also be found among other type 1 15 f imbriated enterobacterial species .
It is also believed that it is possible that a~lheq;nq from some fimbriae responsible for mannose-resistant hemagglutina-tion or ArlhPq; ~n are structurally related to Fim~, but with ser~llDnre altDrAt;onc that Dl im;nAte sensitivity to mannose.
20 The pr~q~;h;l;ty that the MS lectin-like properties of Fim~r might be Dl ;m;nAtD~l while retaining other adhesive properties of FimEI (e.g. pellicle fnrrA-t;nn) has been shown previously in a study charactPr~;n~ mutT-induced -~At;nnq in the f~mF{
(pilE) gene (ref . 26) . At the m; n; , it is believed that 25 tests for type 1 fimbriation should include additional func-tional rhArAr~tDrization. While all type 1 fim~briae- '; Atrcl A~lhDR; rn which have been described in this ~xample is ma~nose-sPnq; tive. it is not all marmose- or even saccharide-s~ecific as has commonly been thought. Further studies of 30 type 1 fimbriae as a virulence factor must be able to distin-guish among the various fllnrt;nnAl classes.
Allelic variation of the so-called G ~1h~inq of P fimbriated uropathogenic E. coli also results in different f~lnrt;
classes, but the requirement f or the Gal~l - 4Gal sequence 35 within isoreceptors is r~~;ntAinD~ (refs. 52, 53). These wo 9~20657 ~ ¦ 8 ~ 7 2 ~ 5 0 PCT/DKg5/00042 differences in G adhegin receptor specificity appear to be rather subtle, at least superficially, when compared to the differences in Fim~ receptor specificities. Yet there i5 significantly greater sequence homology amo~g the fim~ genes 5 than among the G adhegin genes, some of which share less than 50 percent homology. me G adhe8in receptor specificities af~ect host susceptibility, due in large part to host-speci-fic expression of glycolipid isoreceptor variants. Whether the FimEI family of A~lhl~q;ncl bears a similar r~l~tjnnqhip to 10 host ausceptibility or tissue tropism remains to be deter-mined. In this regard it ig pnq~;hle that the G adhesin family could ex_ibit :~rl;tlnn;:ll receptor specificities not restricted to the Galo~1-4Gal gequence . The lectin-; ntl~rPnrl~ont affinity of P fimbriae for ~ '-; 1; 7ed Fn is not r?f~rQn~nt on 15 the G adhesin, but on two other minor subunits, E and F, neither of which bear significant homology to FimH (refs. 56, 57) .
It is important to point out that the degree of functional heterogeneity of type 1 f imbriae ~Pqrr; he~ in the present 20 Example was not appreciated when any of the studies cited above were performed. The results of the#e studies have made it clear that structural and fllnrt;nn~l heterogeneity occurs within the class of adhesive ors~n~ commonly referred to as ~IS or type 1 fimbriae and that the adhesive diversity will 25 lead to a broader spectrum of receptive surfaces for poten-tial colnn;7~t;nn. The surprising finding that a FimH family of iof~h~q; n~ exi8t8 may prove to be an important step toward unravelling the role(s) type 1 f; '~ may play in the ability of enterobacteria to reach their normal habitat or 30 gain entry into de~per tissues, where devastating effects can occur .

2 ~ 8~6 Wo 95l20657 E~1/~ s C C ~2 ExaMP~ 2 E~r~qsio~ of t~e 1 f; ' ~1~ in h~rolo~rnlq bacterial s~ecies The f~m operon of E. col i compriges a cluster of genes 5 covering about 8 kb of DNA. This operon has been iqnl~to~ and cloned on r~ q in its entirety. The promoter upstream~of the fimA gene is located within an invertible DNA sequence, which in E. coli leads to a switch on/switch off situation for fimbrial synthesis. In one orientation of the invertible 10 sequence the promoter is directed towards the fim genes, and the cell is fimbriated; in the other orilon~tinn the promoter is directed in the opposite direction, and the cell is non-f imbriated .
Since the regulation of the switch of the invertible ~l~ ti~r 15 s~ n~-~ is very complex and involves several genes outside the fim operon it is far from certain that the switching takes place in other b~t~r;A than the enterics. It was therefore l-nnqid~red n~c~qq~ry to insert a r~'r~ ~' ' promo-ter for the expression of the fim genes, and as a model for 20 gene expression in a number of different bacterial species the lac promoter was chosen This promoter has been shown to be active and regulatable in many bacterial species.
Plasmid pPRL83 is a derivative of pPRL4 (ref. 27) carrying the entire f~m operon in pBR322, in which the promoter has 25 been de~LL.y~:d by inserting a BglII linker in the SnaB site located in the promoter sequence. There is a second BglII
site in plasmid pPRL83 upstream of the f~m operon ~Fig. 6).
Plasmid pVT,T33 (Fig. 7) is a kanamycin resistant derivative of the broad host range plasmid RSF1010, carrying the lac~g 30 gene and the tac promoter placed UyU~Lt:C~M of a multiple cloning site in which a unique BanEI1 8ite is placed. The two p~l 'rl~ were ligated together after digestion of pPRL83 with BglII and pVLT33 with Ba~tFC1. In one ori~n~ n (pS~314), this fusion plasmid will express fimbriae in the presence of Wo 95/20657 2 1 8 0 1 2 ~ 52 PCT/D~95/00042 IPTG due to the fusion between the fimbrial genes and the lac promoter .
The correct ~ripntAtion of the fusion plasmid pSM1314 was verified by transforming it into a strain of E. coli which carries a deletion of the fim operon. Pro~l~ct;rn of fimbriae was assayed in two ways: 1 ) Cell aggregation with f; ' ' A 1 ;~nt;ho-l;PA and 2) ELISA ag5ay of whole cells. The former analysis is rather simple: to a small volume (10 ~l) of an outgrown or IPTG- induced culture of the cells to be tested is added a small volume (2 ,ILl) of ~nt;horl;p~ rai~ed against fimbriae, on a glass alide. After mixing the samples, fimbriated cells begin to show cell aggregates which are easily observed ~irectly as clumps or under a microscope. No rl in5 was observed with cells of the strain with a fim deletion, whereas pSM1314 transformants of this strain showed clearly ~Pte~t~hl e cell aggregates . The ELISA arlalysis of whole cells rr~nf; ' the aggregation assay. In Table 2 below the readings from this type of assay are presented, and they show quantitatively the occurrence of Fim antigens on the cells as a result of IPTG ~n~ rt;t~n of the pSM1314 carrying strain .
TAhle 2. RPRl~ltg (~ licate) of RT,Tq~ AR~A~y for t~e 1 f; A P~essed by nqM1 U~ in E. coli ~l~T~'cl9l (OD~9 AAEC191 (pSM1314) 0 .145/0 .164 AaEC191 (pSM1314 ) +IPTG 1. 026/1. 260 Blank 0 .113/0 . 095 Plasmid pSM1314 also carries a mob site which allows it to be transferred to ot,~er gram negative bacteria provided a helper plasmid is introduced. This type of transfer is most easily performed in ~triparental" matings in which a donor strain (E. coli carrying pSMl314), a helper 8train (E. coli carrying a plasmid with co~ljugation genes) and a recipient strain carrying a sPlp~tAhle marker not present in any of the two , . , , _ _ _ _ _, _ _ _ _ _, _ _ _ . . . .

Wo 95l206s7 PCTIDK95/00042 other strains, are mixed on a plate (directly or on a fil-ter). After some growth (often overnight) this mixture i5 spread on selective plates with antibiotics that only allow the rPc;r;Pnt carrying the desired plasmid to grow and form 5 colonies.
In the present context, the B. coli strains MC1000 (pSM1314) and MC1000 (pR~2013) and (as rer;piPn~) Enterobacter cloacae strain A50 Nalr (ref. 67), were mated. This recipient strain is resistant to n~ r; c acid. After selection for growth on 10 plates with kanamycin plus n~ r; c acid the resulting clones were grown in liquid medium and assayed for the pres-ence of f imbriae in the ab8ence/presence of IPTG . The cell aggregation assay was employed.
This assay showed that f imhriae were produced i~ the Enterob-15 acter cloacae strain and were present on the cell surface;
however, full repression of expression from the tac promoter was not obtained, most likely due to an increased escape synthesis. The results showed that E. coli type 1 fimbriae may be 8yrl~h~qi~e~l and procegsed correctly for pili fn~-tinn 20 on the surfaceg of heterologoug gram-negative hartf~r;~l 8pecies .
The plasmid pSM1314 in E. coll HB101 was deposited o~ 26 January 1994 with DSM, the Deut8che Sammlung von Mikroor-~:~n; I und Zellkulturen GmbH, (German Collection of Micro-25 organisms and Cell Cultures), Mascheroder Weg lB, D-38124 Braunschweig, Germany, under the ~rrP~s~ on number DSM 8922 .

ThP rnnRtruction of ~-f~l~; on qPllP~ n~l the ~resginn Of r~nnnce- qPns~itive F; Tr~T~ fll~; nn l~rotP; n~
30 ~eterologous sequences mimicing the pre-S2 regio~ of the hepatiti8 B viral surface antigen and a nPll~r~l;7;ng epitope Wo 9sl206s7 2 1 ~ Q ~ ~ 6 PCTn)K95l00042 of the cholera toxin B chain were inserted in two different positions in the FimEI adhesin of type 1 fimbriae. This was carried out by i~trnd~ t;on of restriction site handles (E~glII-sites) in the fim~ gene, followed by in-frame inser-5 tion of heterologous DNA qE_ c PnL n-9;ng the foreign epito-pes. In the selected positions guch insertions did not sig-n;f;tAntly alter the adhesive function of the Fim~ protein, since hosts producing hybrid fimbriae that CnntA;nP~l the chimeric adhesins ~h;hit~d A~lh~;nn ph~ cLy~es and were 10 normally fimbriated. The heterologous inserts of 52 and 15 amino acids, respectively, residing in the rh; 'C FimH
proteins were r~n~n; ~ by specific sera on the surface of the f imbriae on bacterial hosts . The results illustrate the poqsihility of using bacterial A~lh~q;nq as general presenters 15 of foreign antigevs and epitopes.
3.1. I~Ater~Alq An~l ~hnrlq 3.1~ 3acter;Al atrA;n Antl qrowth nnnr9;~~;nn~
The Escherichia coli R12 strain Hslol was used in this study as a host for expression of chimeric fimbriae. This strain is 20 phenotypically Fim~ due to a deletion in the fim gene cluster (ref. ~). Cells were grown on solid medium or in liquid broth supplemented with a~l.Lu~Llate antibiotics. When required, gene expression from the lac promoter, residing in front of the fimH gene in plasmid pLPA22 and its derivatives, was 25 induced by the addition of IPTG (isopropyl thiogalacto-pyrano8ide) to the growth medium.
3 . :L.2 . P1AP~; ~1P
Plasmids pPRL4 (comprising the entire, functional fim gene cluster) and pPl~L114 (comprising the fin~ gene) have been 30 described previously.
pP}~L115 which is a plasmid ~nn~Ain;n~ the entire type 1 fim gene cluster with a stop linker insertion in the ~ { gene .. _ .. _ . .. , , . , . _ _ _ _ _ . . .

2~ z~
W095/20657 r~l, r~-~ i.e. this plasmid expresses all the proteins nP~p~s~ry for the pro~ ct; c-n of f imbriae except the FimH protein) was constructed in two steps:
(i) plasmid pPKL4 (refs. 27, 28) was digested with ~pnI which 5 reco~n; 7-'R a uni~ue restriction site in the fimH gene. The staggered end Of the li~earized plasmid was made blunt and ligated with the synthetic piece of DNA below (SEQ ID NO:7) cnnt~;n;ng stop codon8 in all three reading frames, resulting in plasmid pPKL114:
5 ' - GTCGACTTAATTAATTAAGTCGAC - 3 ' 3 ' - CAGCTGAATTAATTAATTCAGCTG- 5 ';
(ii) the HindIII-EagI fr~ ' from pPRLllg, cnnt A; n;ng the entire fim gene clu8ter with the inactivated fimH gene was subse~uently inserted into the HindIII and EagI sites of plasmid pACYC184, resulting in plasmid pPKL115.
Plasmid pSM782 (generously provided by S. Molin, Department of Microbiology, Technical University of Denmark, DR-2800 Lyngby) ront~;n;ng the pre-S2 and S Pn~ ntl~ng regions of the hepatitis ~3 viral genome, was made from plasmid A-BV1 (ref.
72) by subcloning a EcoRI-DraI fr~ i~to pBR322.
Plasmid pLPA22 was constructed by inserting a 1018 })p PvuII-MluI f~ cnnt:9;n;n3- the fimH gene from pPRL4 into plasmid pUC18. The insert wa8 positioned downstream and in a ~LyL~:ssion C~ ~ t;hlP orientation to the lac promoter resid-25 i~g on the vector part of the plasmid (Fig. 8). Expression i~E. coli HB101 cells of functional FimE~ protein was monitored by compl ;ng pLPA22 in trans with pPRL115 and testing for MS ~tlhf~R;nn upon ;n~ ctinn with IPTG.
- Plasmids pLPA29 and pLPA30 were made by inserting 9-mer a~ymmetric BglII-linkers into the BsaAI and HincII sites, respectively, in the ~imH gene of plasmid pLPA22. At six different positions in the pLPA22 fim~ gene a BglII site was wo 95/20657 2 ~ 8 ~ ~ ~ 6 56 PCT/l)KA r 12 introduced without changing the reading frame, resulting in r~Pm;,lc pLPA98, pLPA36, pLPA58, pLPA30, pLPA29 and p~PA59 (Fig. 10). This was done either by ingerting a BglII linker into an CL~LU~Liately treated restriction enzyme site, or by changing 1-3 basepairs uging PCR and thereby rrFI~t-n~r~ a BglII
site .
The plasmid pLPA36 was prepared by opening the pLPA22 fimN
gene with the restriction enzyme ~ lllI and making the ends blunt using Rlenow polymerage and ligating uging an 8 mer BglII liIIker (SEQ ID NO:8~:
5 ' - CAGATCTG- 3 ' 3 ' - G~a5~AC - 5 ' Plasmids pLPA58 and pLPA59 were made by BglII site-creating site-directed mutagenesis of phPA22 uging standard PCR and plasmid pI,PA98 was constructed by opening the fimN gene, making the ends blunt with T4 DNA polymerase and ligating with the below 10 mer BglII linker (SEQ ID NO:9):
5 ' - GA~GATCTTC - 3 ' 3 ' - CTTt~T~r~r. 5 ~
Of the six resulting mutated f~mH genes, three e~ressed protein that was integrated into type 1 f imbriae, and at the same time P~rh;hitl~d mannose-sensitive A~lhPq;r~n Of these three mutated Fiml~ proteins, the two that conferred to E.
coli cells the strongest mannose-sensitive adhesion were expressed from p7~ 9q pLPA29 and pLPA30 (Fig. 9) and these two pl~;tlc were investigated further for their ability to contain large ~r;r,~q and still be biological active.
Plasmid pLPA29 has a 9 bp long symmetrical BglII linker inserted into the BsaAI site 66 bp upstream of the stop codon for the fimE~ gene, while plasmid pLPA30 has the same 9 bp BglII linker inserted into the ~ncII site 163 bp upstream of the stop codon of the ~imFI gene.

2 t ~ 2~
Wo 95/206s7 PCT/DK9~00042 The rl~ rla pLPA37 and pLPA38 (Fig. 8) were constructed by inserting a 162 bp DNA fr~ ~nroflin~ the pre-S2 region of the ~pat;t;a B virus surface antigen into the ~glII sites in pLPA29 and pLPA30, respective1y. T~is DNA fra; was crea-5 ted by a standard polymerase chain reaCtion ~ PCR) using t_esynthetic primers: (i) 5' -GGAGATcTAATTcr2~r~7~r~ rT-3' (SEQ 3 NO:11) and (ii) 5'-GGAGAlo~L~ rr~ ~T-3~ (SEQ ID N0:12), and pla8mid pS~782 as a t~ te.
A ~-~~, of p1asmid pLPA38 cr.~rnprising the inserted 10 hetero1Ogous 8er~Uence c-nro~l;ns the pre-S2 region of h~ratit;r~
3 surface antigen is shown iIl the below table wherein the hetero1Ogous seSIuence ig lln~lerl;nl~d and the numbers ;n~l;r~ter3 COL ~ d to the positions of the amino acid residues in the mature FimEI protein.
~9/ ll Gln Phe Arg Ser Arin Sr,r Thr Thr Phe His Gln Thr L0u Gln Asp CCC AGA GTG AGA GGC CTG TAT TTC CCT GCT GGT GGC TCC AGT TCA
Pro Ar9 Val Arg Gly Lr~u Trr Ph~ Pro Ala Gly Gly Ser Ser Ser GGA ACA GTA AAC CCT GTT CTG ACT ACT GCC TCT CCC TTA TCG TCA
Gly Thr V~l A~n Pro Val Leu Thr Thr Ala Ser Pro Leu Ser Ser ATC TTC TCG AGG ATT GGG GAC CCT GCG CTG AAC AGA TCT TCG ACG
lle Ph~ Ser Arg lle Gly A~p Pro Al~ Leu Asn Ar~ Ser Ser Thr 15 The pl~P-^;rla pLPA95 ~nd pLPA93 (Fig. 8) were then made by inserting the below 51 bp synthetic double stranded DNA
segment ~-nr~l~;n~ amino acids 50-64 (comprising an epitope) of the ;3 subunit o~ the cholera toxin into the 13glI sites on pLPA30 and pLPA29, respective1y (SEQ ID NO:10):

WO 95/20657 r ~ .'oa L ~2 2 ~ 8~2~ 58 5'-GA~ol~L.~A~.wG~LAGTr~ÇrAT~TcGATAGTr~r~ cTG -3' 3'- ACAACTTr~rr,rcr~TCAGTCGTATAGCTATCA~ .L1.~ ArcTAr.-5 A fr~ 3 t of plasmid pIPA93 comprising the heterologous ser~uence ~nrorii n5 the above DNA gegment of the B subunit o~ -5 the cholera toxi~ is shown in the below table wherein the heterologous sr~r~ Pnre i5 underlined and the numbers indicated correspond to the positions of the amino acid re~idues in the mature FimH protein.
80l ll CAG TTC AGA TCT GTT GAA GTT CCG GGT AGT CAG CAT ATC GAT AGT
Gln Phe ArD Ser Val Glu Val Pro Gly Ser Gln His lle Asp Ser 8~m~t It80l ll CAG AAA AA~ GCT GGA TCT TCG ACG
Gln Lys Lrs Ala Gly Ser Ser Thr 3 .1. 3 . DNA tr~rhn; rn~qq 10 Tqnl~tinn of plasmid DNA was carried out ~c~nrrl;ng to the method of P~rnhn;~ and Doly (ref. 73). Restriction endonu-cleases were used qrrr r~l;n~ to the r~qn~fArt~rer's specifica-tions ~Biolabs). DNA sr~rlu~nr;n~ was carried out by the di-deo~ chain tPrm;n~;nn terhn;q~r~ (ref. 49) using a s~r~ nqqe 15 version 2.0 kit from USB. Ol;r~nnllrleotides were made at the core f~r;l;t;r~q of the Department of Microbiology, Technical University of Den~nark.
3 .1. 4 . PCR ~hnrl,nl or~y Polymerase chain rP~rtinnq ~PCR) were performed on a Perkin 20 Elmer Cetus DNA Thermal Cycler 480. ~r~t;r~nq were set up as 100 1~1 volumes r nntq;n;n~ 200 ~M each of dATP, dCTP, dGTP and dTTP, 0.2-1.0 ~LM of each of the two primers, 2 mM MgCl2, 10 Tris-ECl (pH 8.3), 50 mM ~Cl, 2.5 units of AmpliTar~ DNA

2 ~
WO 95no6s7 polymerase and 0 .1- 0 . 2 ~g of plasmid template . The reactions were run for 25-30 cycles each consisting of 1 min. at 94C, 1 min. at 40C, and 1 min. at 72C. For amplification of the pre-S2 fr~ ' the above primers 5lGGAGATcTAATTcr~r~r(TT 3' (SEQ ID NO:11) and 5'GGAGA'~ AGCGCAGGGT 3' (S~3Q ID NO:12) were used.
3 . 1. ~ r~ r~ t t n~ t; nn The capacity of bacteria to express a D-mannose binding phenotype was assayed by their ability to aggltlt;nAte guinea pig erythrocytes on glass slides. Aliquots of liquid cultures grown to an optical density of 3 . 0 and 5~ erythrocytes were mixed, and the time until aggl~ltin~tinn occuLL~d was measured.
3.1.6. pnr;qpr;s Rabbit anti-type 1 fimbria serum raised against purified type 1 fimbriae has previously been described (ref. 74). A
monoclonal antibody directed against FimH (ref. 75) was kindly provided from Dr. Maryvonne Dho-Moulin, Institut N:~t~nn~ll de la Recherche AYLI - gue, France. Goat serum raised against cholera toxin ~3 subunit (intPrn~t; nn~l stan-dard for WHO No. 12-246) produced at the State Serum Insti-tute, r-oppnh~renl Denmark was kindly provided hy same insti-tute. A monoclonal antibody directed against the pre-S2 domain of ~epatitis B surface antigen (ref. 76) was kindly provided by Dr. Makoto Mayumi, Jichi Medical School, Japan.
Fluorescein (FITC) conjugated anti rabbit, anti mouse, or anti goat sera were provided from D ~knp~tq, Denmark.
3 .1. 7. Fluore8rPnrp l;~hPl l; n~ nr1 ~rn m; rrOSCOpY
Cells from overnight cultures (IPTG-induced, if required) 30 were harvested, washed in PBS and fixed for 10 minutes at room t _ t~lre in a 3.59~ (w/v) snl~t;nn of paraforr-ldPhyde in PBS. Samples of 20 ~1 were placed on a poly-L-lysine WO 95/20657 2 1 8 ~ PCTn)K9S/00042 coated ~lide and air dried . Af ter washing in PBS, 16 ~l of a 1:5 (monoclonal) or 1:25 (polyclonal) rl;lut;rn of the primary antiserum was placed on top of each sample and lef t in a moist ;nr-lh~t;r,n chamber for 1 hour. The slides were washed 5 three timeg in PBS and 16 ~l of FITC conjugated ;Int; ~Ptolm were added. After two hourg in the dark, the slides were washed three times in PBS and a drop of Citiflour (Citiflour Ltd., London, U.~. ) was placed on top of each sample. For .
v;fn~ t;-~n, a Carl Zeigg ~Y;OplAn microgcope ~qn;rped for lO epifluorescence and phase-contrast was employed. Using a charge-coupled device (CCD) camera, pictures were captured as 12-bit files with P~S software (Photometrics) and subsequently transferred to a MAr;ntr,~h Quadra 950 computer for image analysis.
15 3 . l . 8 . El ectron m; croscopy.
Electron microscopy and immuno-electron microscopy was carried out essentially as described previously (ref. 61). In brief, a 25 ~Ll aliquot of bacterial suspension was placed on a carbon-coated, ~low discharged grid for 30 seconds. Grids 20 were washed in 2 drops of PBS, dehydrated for 5 min in each of the following ~t~ncpntr~t;r~n~ of ethanol: 2596, 50~, 75~ and 9696, blotted dry and ~h~8 .. :I with tungsten wire at an angle of 30. For immuno-electron microscopy a monoclonal antibody directed against the pre-S2 region was uced diluted 1:5 as 25 the primary antibody and rabbit anti-mouse serum conjugated with 10 nm gold particles (Dako) was used in ~ t;nn 1:20 as the secondary antibody.
3 . 2 . Results As described above, two pr,R;t;r,n~ in the C-t~rm;n~l part of 30 the Fim~I protein ~vere engineered to contain heterologous sequences mimicing foreign antigenic tlPtorm;n~nt~. In the present study, double plasmid systems were used. In each 2 1 ~726 Wo95/206S7 Pcrn)T~ [~2 plasmid pair one encoded either a wild- type or an engineered version of the fim~ gene, whereas the second plasmid encoded All~r;l;Ary flln~tinn~ such as the two-- _mn~nt Fim-specific trAnCport system, regulatory genes and other structural ~- ^-lt~ of the fimbrial organelle except FimH (Table 3).
3.2.1. ~nc~ineerinq new rest~ic~ion sites ;ntn f;~
Based on algorithms for prediction of such pA -t~rs as hydrophilicity and secondary structure, two pot~nt;~lly 10 optimal positions for insertions of heterologous S~ nr-~ in the C-t~rm;nAl domain of the FimH protein were selected.
These COL ~ u-~d to positions 225 and 258 in the mature protein predicted to be situated in a surface-exposed part of the FimH protein. In order to facilitate later ~-n;plll~tinn~, 15 the fim~ gene was subcloned into the pUC18 vector resulting in plasmid pLPA22 . 5llhs~qn~nt 1 y a BglII site was introduced in-frame into positions 225 and 258, respectively. This was carried out by site-directed mutagenesis employing synthetic oligomers resulting in ~ pLPA30 and pLPA29, respect-2 0 ively ( Fig . g ) .
The introduced BglII sites resulted in a codon change from aLeu to a Phe codon in position 225 and addition of codons for the sequence Arg-Ser-Ser, in the case of plasmid pLPA29, and A~lrl;t;nn of codons for the s~ n~e Arg-Ser-Gly after posi-25 tion 258 in the case of plasmid p~PA30. Seguence analysis ofthe entire modified fim~{ genes in ~ pLPA29 and pLPA30 ~onfi ' that no other changes had occurred. lIost cells which in addition to pla8mid pLPA29 or pLPA30 al80 ~ ntz-;n~yl plasmid pPl~L115 (finZ~, showed wild-type pl,e~y~ic charac-30 teristics with regard to ~h~ n and fimbriation as judgedby such criteria as hemagglutination (Table 3 ) and immuno-fluorescence microscopy.

Woss/2o6s7 2 ~ 8Q726 62 r~
3.2.3. Rn,~inPPr;nr heteroloqollc nNz~-seal~pnrpq ~nrnrl;nr thP
re-S2 ~1l ;n of he~)atit;R 8 s~rface ~nt;q~n An~l a rhnlera tnY;n e~itoDe into fl -~.
As heterologous reporter epitopes the pre-S2 region of the 5 hepatitis B surface antigen and a well rhAr~ctPrized region of the B subunit of cholera toxin were selected. The pre-S2 region is known to contain; -lo~ically important (and protective) antigenic ~let~rm;nAntc (ref. 76). In addition, this region is disulphide bond-;n~lPrPnrl~nt and apparently 10 more ; ~ ic than the maj or S protein. me cholera toxin segment consists of residues 50-64 of the 2 subunit and has previously been shown to elicit ~nt;ho~;pR that bind to and nP~ltrAl;~ cholera toxin (ref. 77).
15 A DNA segment of 162 nucleotides Pnrnrl;n~ 52 of the 55 amino acids of the pre-S2 region was amplified by PCR technology using plasmid pSM782 as t~ lAte and primers that provided the _ l; f; Pd 8equence with f 1 Ank~ n~ BglII gites . Following restriction with BglII and purif ication the amplif ied f rag-20 ment was inserted into the BglII sites of pl A~ ~lc pLPA29 andpLPA30 resulting in r~ rlq pLPA37 and pLPA38, regpectively (Fig 9). Subsequent ce~lpnre analysis confirmed that the inserts were correctly oriented and that the reading f rame of the chimeric fim~-pre-S2 genes was correct.
A synthetic DNA segment ~nro~;n~ the cholera epitope was made by AnnPAl ;n~ two complementary 51 bp oligonucleotides which were designed to result in a double gtranded DNA friqs with a BglII uv~:Lh~g in one end, a BanEII uv~:Lha~l~ in the 30 other and an ;nt~rnAl ClaI site. The epitope-pnrQ~l1n~ segment was inserted into the ~glII gite in the fim~ gene in rl~qm;rlq pLPA29 and pLPA30, resulting in Lt~ t;rn of a BglII site at only one end of the insert. This feature was used to identify rlA, lc with correct ori~nt~t;rn of the insert. The 35 presence of the Cl,3.I site was used for initial screening for clones rnntA;n;n~ the insert. Sequence analysis of plasmid pLPA93 and pLPA95, both harbouring the epitope-~nrn~lln~
.... _, _ , , . . . _ _ _ _ _ _ _ . . . .

2 ~ 8~726 wo 95l20657 ~ ' 7 segment confirmed the or;Pnt~At;orl and c~,llseLveltion of the reading frame iL the chimeric fim~-cholera genes (Fig 8).
3.2.4. ~nressiorl of rh; riC F; ~ hP~in comprisino as 5 heteroloq~ seaue~ces th~ vre-S2 dor~;n of he~atitis B
surface Ant;ren and a cholera tn~in eDitoDe.
To evaluate whether the heterologous inserts in fi~ were t;hle with protein expression the T7 polymerase/promoter system of Tabor and Richardson (ref. 78) was used. Sl~hrlrn;ng 10 into the pGEM3 vector system and sllhsPq~lPnt a8saying revealed that proteins with the expected sizes were produced in all cases from the chimeric ff~ genes. More importantly, to assess whether the FimH proteins harbouring f oreign inserts were accepted by the type 1 fim.,brial trAn~port system and 15 additionally, whether they were present on the bacterial surface in a biologically fllnrt;r,nAl form, the AdhPIq;nn phc: ,o~y~e of rP nAnt strains expressing the chimeric FimH
proteins was studied.
Bacterial hosts which in addition to plasmid pLPA38 (pre-S2 20 insert in position 225 in FimH) also crntA;nPcl plasmid pPRL115 (fimN) gave, when induced by IPTG, good agglllt;nAtion of guinea-pig erythrocytes indicating the presence of a biologically active form of the FimH adhesin on the cells (Table 3) . The ~ ;nAt;nn Of p1A~m;rl~ p~PA37 (pre-S2 in 25 position 258 in FimH) and pPKL115 resulted in weaker, but detPrtAhle, hemagglllt;nAt;~n (Table 3). Furthermore, such cells were also shown by electron microscopy to have essen-tially norm.al fim.briation (Fig. lO).

WO 95l20657 2 ~ ~ ~ 7 2 ~ 64 . ~111.~ _ C: ~2 T~hle 3. GenotyDe ~n8 gh~nntvDe Q;E nl~;flq (A, B or U
res~ectivelv ~ nrl; cate ~ACYC184 . pBR322 or 1~UC18 h~qed vector) ~ed in th;c gtllAr. pogition of ;n-l~rts ~n~9 h lutination titer. Host cell: E. coli HB101 Plasmid releva~t ~e~uLy~e insert hemagglu-position t; nFI t inna pPRL4 (B) all ~ genes 15 pPRL115 (A) fimE ~600 10 pLPA22 (U) fim~ ,600 pLPA29 (U) fln~-BglII 258 ~600 pLPA30 (U) fin~-BglII 225 ~600 pLPA37 (U) fimF~-pre-S2 258 ~600 pLPA38 (U) fimF~-pre-S2 225 ~600 15 pLPA93 (U) fim~- cholera 225 ~600 pLPA95 (U) fimF~-cholera 258 ~600 pLPA22 (U) ft~
+pPRL115 (A) fimH 10 pLPA29 fimFI-BglII
20+pPRL115 fimN 7 pLPA30 fim~-BglII
+pPRL115 fim~ 8 pLPA3 7 fim~- pre - S2 +pPRL115 fimE~ 210 2 5pLPA3 8 finZ~- pre - S2 +pPRL115 fim~ 100 LPA9 3 fimN- chol era +pPRL115 fim7~ 11 pLPA95 fimF~- cholera 30+pPRL115 fim~ 16 a) Hemaggllltinit;nn of guir~ea-pig erythrocytes iIldicated in seconds be~ore reactio~ occurred. The average values o~ 4 mea~ Ul ~.._ ' ts are given .
35 Irl the cases where a s~ nre mimicing a cholera epitope had beerl inserted into FlmH viz. pLPA93 (irlsert i~ pnq1t;nn 225) wog5no657 2 t ~ JC ~

and pLPA95 (insert in position 258~, respectively, an agglu-tination phenotype also resulted when either of these plas-mid3 were complemented by plasmid pPE~L115 (fimH~ (Table 3).
Again, this suggested that in spite of the presence of ~-foreign peptide segments the chimeric FimH proteins were gtill able to reach the bacterial surface and r-;nt~;n its adhesive function. In addition to the adherence phenotypes of the various clones the pregence of rn~; n/~red Fim"H ;l~hf~cin~
on the surface of the cells were monitored by CCD microscopy in connection with fluorescent antibody methn~lnl o~y employing a FimH-specific monoclonal serum. In all ca8es, si~n;f;r~nt signals, albeit of varying intensity, were ~ tect-oc9 when compared to a negative control strain that harboured the auxiliary plasmid, pPEL115, alone.
3.2.5. I~nnloqir~l detection Qf thP pre-S2 seqment Qf he~;latit;P B 81~rface ~nt;qen ~nrl thP cholor~ tn~ ;n epito~e i~
rh; - ic F; ~~ 1h~q;nc.
Since there was good evidence that the chimeric FimH proteins were present on the surface of the B. coli hosts the ability of specific antisera, raised against the pre-S2 part of hepatitis B surface antigen or the cholera toxin B chain, respectively to recognize the chimeric Fim,H-pre-S2 and FimH-cholera proteins directly on the surface of the recombinant bacteria were tegted. By ; ~ ~1 U~IL~:8C=~ u8Cu~ly B.
coli hosts harbouring either of pl~Pm;~P pLPA37 or pLPA38 in addition to plasmid pPKL115 were ghown to react grer;f;r~lly with ;Int; P-~r~ directed against the inserted heterologous sequence, whereas hosts expre8sing wild-type FimH did not.
Similar results were obtained with the cholera toxin insert in the same positions (pl~rm;~lP pLPA93/pPRL115 and pl,PA95/pPiCL115). Again, the heterologous inserts in the rh; - ' r Fim~H proteing were reco~n; 7-~t1 by insert-specific - serum on the bacterial surface, whereas the relevant control did not react.

21 8~726 WO 95/~0657 . ~_I/LI._ ~ ~ 12 These f;r-l;nl7q demonstrate that the foreign epitopes are exposed on the surface of P~rtracP7lll~Arily located chimeric FimH proteins and, signi~icantly, in a conformation which mimics the natural confnr~--t;nr of the epitope(s) as it appears in the native hepatitis B surface antigen or the native cholera toxin.
The results obtained by; -'l~lnrescence microscopy were cuLL~h~ t~od by immuno-electron microscopy, employing the pre-S2 specific monoclonal antibody as primary serum and a colloid gold-labelled secondary antiserum. A significant amount of gold particles were seen, mostly in rnnn~Ct; nn with the fimbrial or~An~llpql on bacterial hosts harbouring chim-eric fimH-pre-S2 genes (Fig. lOb and lOc~, whereas only few goldparticles were present on the control strain expressing wild-type fimbriae (Fig. lOa). Furth, ~c:, in the latter case the gold-particles were not see~ to be associated with the f imbriae .
The pl~ pLPA22, pLPA29, pLPA30, pLPA37, pLPA38, pLPA93, pLPA95 and pPK~115 in E. coli H~3101 were deposited on 26 January 1994 with DSM, the Deutsche Sammlung von Mikro-or~-n; ~ und Zellkulturen GmbH, (German Collection of Microorganisms an~ Cell Cultures), Mascheroder Weg lB, D-38124 Braunschweig, Germany, under the accession numbers DSM
8915, DSM 8916, DSM 8917, DSM 8918, DSM 8919, DSM 8920, DSM
8921 and DSM 8923, respectively.
E3X~MPLE 4 F~;n~l;nc~ of thP MFP rlAqq A~lhPR;n of E~ n7i t~cFr-50 to syn-thetic ~el~tides 14 synthetic peptides were 8ynth~q; 7e~ on an A3I automated 30 peptide synthp~ r Arror~l;n~ to the method of Merrifield (Merrifield, R.B. 1963. Solid phase peptide synthesis.I. The synthesis of tetrArPrtide. J. Am. Chem. Soc. 85:2149). The Wo 9s/206~7 2 ~ ~ ~ 7 ~

binding of the E. coli strain CSH-50 to these peptides were tested essentially as described in Example 1. The results of these binding assays indicated that this MFP class strain adhered strongly to o!le group of peptides whereas the birldi~g 5 the an other group of peptides was absent or weak. In the below listing the one-letter code ser~ nrPq of the synthetic peptides are shown in a + group, i . e . the group of peptides to which the tested strain adhered strongly, and a - group of peptides to which the binding was weak or absent:
10 + ~roup of DeDtidea FnSP1: EAQQMVQPQSPVAVSQ~ G~YI. KHYUI (SEQ ID NO:13) CB-II-G: T~FrR~r-AT~'RRr.AA~.vv~ AT~r.~R (SEQ m N0:14) sM1(19-32): AT~NTT~T,T~TRN~nl, (SEQ ID NO:15) sM6(1-11): ~Vr'~K~LV~;N~C (SEQ ID N0:16) sM12 (1-12): DHSDLVAEEQR~C (SEQ ID NO:17) sM12 (7-18 ): ~RQ~T.RnT.rQRr (SEQ ID NO: 18) sM5(175-184): TVRnRTARRQC (SEQ ID NO:19) sM5 (28-54): R~TRNRr.T.~rRNRr.T.RA,~RNT.~r.T.Rr,AFNR.r.C (SEQ ID NO:20) - r~rou~ of DeDr; ~1PR
sM5 (134-163): ~ xKKN~-:KAT.~RT.T.~:K vK~K ~ ARRQRNRT~. (SEQ ID NO:21) s~q5 (117-146) ~T~TRRT~QRT~ANRQQRxK~ :KAT~r~RT~ (SEQ m NO:22) sM5 (14-26): RRAT.nRYT.~T.RNF~n (SEQ ID NO:23) sM6 (22-31): DVT~NxMT.Q~N (SEQ ID NO:24) sM5 (55 - 84 ): T.RTRR.r~NT.~RTAT. T.~ 8 ~ K ~ :AT~NnRT.Rr (SEQ ID NO: 25 ) sM24 (289-303) :FQRT-K~NK ~ ~ASRC (SEQ ID NO:26) EX~MPLE 5 F.i - ArlhPR;n of fllrther ol;nirAl isolates 'lAhe f ollowing clinical isolates of E. col i were tested f or ~AhPsirn class according to the methoda described in Example 30 1: EB-23, ES-54, U221-3, MJ#9-3, MJ#31-3, MJ#11-2, ~#2-2.

Wo 95/20657 2 ~ 8 Q ~ ~ 3 PcrlDK95looo42 The results o~ these experiments are illuatrated in Fig. 5.
As Pyr~l~;npd above, the isolate ~}3-23 showed the MI' type of adhesion, and the isolate U221-3 expressed a M class adhesin showing a mannose-resistant type of ~rlhp~inn and accordingly, S this strain was ~ s;f;ed as having a ~ class adhesin.
The amino acid Sprr~lpnnpf~ of these clinical; qol ~tP~l are shown in Fig. 5 and their nucleotide sequences in Table 5 below.
Table 5 shows the nucleotide sP~lPnrp~ of the fim~ genes of selected fl~rlH genes disclosed in Example 1 [CI#3 (SEQ ID
NO:50), CI#4 (SEQ ID NO:44~, CI#7 (SEQ ID NO:51), CI#10 (SEQ
ID NO:4a) and CI#12 (SEQ ID NO:54) ] and as the reference that of the E. coli R12 strain PC31 ag it was originally disclosed by Rlemm et al. (ref. 27) as the top setauence rlP~lgn~tPcl PC31a and the se~uence as it was ~lptprm;npd recently (PC31b).
15 Additionally, the nucleotide sPq~1PnCP~ of the following clinical isolates of B. coli are shown: RS54 (SEQ ID NO:52), U221-3 (SEQ ID NO:53), MJ#9-3 (SEQ ID NO:46), /~#31-3 (SEQ ID
NO:47), MJ#11-2 (SEQ ID NO:43), MJ#2-2 (SEQ ID NO:45) and F-18 (SEQ ID NO:42) .

21~7~6 Wo 9s/206s7 Table 5. ?' rleoti~ Pe~lF.nrF~F~ oi~ the above fimF~ genes dis-closed in 2xample 1, ~. coli ~12 strai~ PC31 (PC31a and PC3~) and the ~ucleotide ~e~ue.~ces of ~CS54, U221-3, M~#9-3, ~#31-3, ~J#11-2, ~5J#2-2 a~d F-18.
-109~
~C31-- ATG AAA CGA GSS ASS ACC CTG SSS GCS GTA CSG CTG ATG GGC SGG TCG GTA Al'S
F-18 --- -- -__ _ _ __ _ _ __ _ _ _ _ _ _ _ _ tU11--2 ------ ---- ---- --_ _ _ _ __ _ _ _ _ _ C~ ~ -- -- -- -- _ __ __ __ ___ ___ ___ _ __ ~9 3 ---- ---- --__ __ _ __ ___ _ __ ___ IIJ31 3 -- ---- --_ __ __ _ _ __ ___ _ __ rc3~ --~ ~~--~~----~~~ ~~ ~~~ ~~------~~ ~~~ ~~~ ~~~--CI 3 ----- --- -- ---- ---- --A-- --- -- -- ----- ---- ----- -_ ------ --_ _ _ __ CI 7 ---- ----- ---- ---- -- --A- -- -- ------ __ __ ___ __ __ __ ___ _ _ ~554 -- -- ------ --_ _ __ ___ _ ___ __ ___ _ U221--3 ------ --_ _ ___ __ _ _ __ ___ __ _ _ CI 12 --- --- ---- -- --- --_ _ _ __ __ _ __ __ __ __ _ _ 11lJ8 F-18 _ _ --- --- --- -- -- -- --- ---- --- --- ---A ----- ---- --- ----- ----ILJ11-2 --- --- -- --- -- -- -- --- --- --- --- -- _A --- --- -- -- ---CI ~ -- --------- --- --- -- --- -- --- --- --- --- --- --- --- --- --~22 _ _-_ _ --- --- --- -- --- --- --- --- --- --A --- --- -- --- ---CI 10 __ __ _ _ __ __ ___ __ __ ___ _ __ ___ ___ __ _ _ _ l'C3~ ---- _ _-- ---- --_ __ ___ __ __ __ __ __ __ _ __ ___ CI 3 __ -- --- --- -- --- -- -- -- --C --- --- --- ---- --- -- --1~55~ __ _ _ _ _ _ _ _ __ _ __ __ _ _ _ _ ___ ___ UZZl 3 __ -- ---- ---- ---- ------ ---- ---- ---- ----CI 12 --_ ---- -- ---- ---- ---- -- ---- -- ---- -- ----- -- ----- ---- ---- -- ----~'C31~ GGC AGC GCC AAS GTS SAS GTA AlC CTS GCG CCC GSC GSG AAS GTG GGG CAA AAC
~ 18 ------ ---- -- -- ---- ---- ----S C -- ---- -- __ ___ ___ Wll 2 ----S C-- -- ---- ---- ---- -- ----CI i ----- ---- ---- -- ---- -- -- --- -- ---- --S -C- --- ---- -- ----- ---- ---!U9-3 --- --- --S --- -- --- -- --- --- --- --T -C- --- --- --- -- -- ---I'C31~ -- -- -- -- ------ ---- ---- -- -- ------ ------ ---- ----KSS~ --- ----- --T --- ---- ---- ---- ---- ------ ---- --T -C-- --- ---- -- -- --'~1221 3 C-- ------ ---- ---- ------ -- ----WO 95120657 2 1 8 ~ 7 2 6 70 r~ t 't Table 5, ~ nt;n~

I'C31~ CTG GTC GTG GAT CST rCG ACG CAA ATC TTT TGC CAT AAC GAT TAT CCG GAA ACC
F-16 -- --- --A ~ -- -- ------ -- -- -- -- --C ---A -- - .
MJ11--2 ---- -- --A ---- ---- ~ ----C --A -- ----W2Z --- ---- _A -- ---- -- ----- ------ ---- ---- ---- --- --- --C --A --- ----wg-3 --- ----- --A --- ---- ---- -- _ _ _ __ __ _ _ _ _ ___ _ ~LJ31-3 ---- -- --A ---- --- ---- -- -- -- --- -- -- -- ---- ---- -- ----~1~31~ ---- ------ -- -- ---- ---- -- -- -- __ -- _ _ _ __ _ _ I~SS~I ---- --- --A ---- --- --- __ _ __ __ ___ __ _ _ __ ___ _ ___ 11221 3 -- -- -- ------ ------ ---- --_ _ __ ___ ___ I'C31~ ATS ACA GAC TAT GSC ACA G CAA CGA WC TCG Gt S TAT WC WC GTG TTA SCS
r-lB -- --- -- -- ---- -- -- -- -- --T --- ---- --- ---- ---- -- ___ --_ W11-2 --- ---- ---- -- -- -- ---- ---- ---T --- ----- -- -- ---- -- -_ _ CI ~ ---- --- ---- -- --- -- -- -- ----- --T ---- -- -- -- -- __ _ I~J9--3 -- -- __ _ __ _ __ _ _ _ __ _ M~31--3 ------ -- -- -- ---- -- -- -- -- -- -- -- ---- --~C3~b -- -- ---- -- ------ ---- -- -- -- -- -- -- -- -- --CI 3 -- -- --T - ----- --- _ _ __ _ _ _ _ _ _ __ _ _ CI 7 --- ---- ----- ---- --- -- -- -- -- ----T --- -- --- --- -- ---- --_ --1~55.1 -- -- -- -- -- _ _ _ ___ __ _ CI 12 ---- -- ---- ---- -- ---- -- ---- ---- _T --- ---- -- ---- -- ----- __ --_ 1~66 I'C31-- AAS m TCC GW ACC GTA AAA TAT AGS GGC AGS AGC TAT CCA TST CCT ACC ACC
F-la -G- --- -- ---- -- -- --- -- --A- ----- -- --- -- --T --C ---- --T ---II,J11-2 -G- ----- ---- ---- -- -- -- -- -A- ----- ---- -- --- --T --C --- --T ----CI ~ -G- --- ---- -A- --- ---- --- -- -A- ---- ---- --- ---- ----T --C --- ---T ---ILJ22 ~ ---- ---- -- -- -- -- -- -A- --- __ _ --- --T --C --- --T ---H,J9-3 --- ---- -- -- --- -- --- -- -- -- -- ---- -- --C --G ---T ---~C31b ---- ------ -- -- ---- ---- -- -- -- -- -- -- ------ --CI 3 ---- --- --- ------ -- -- -- ---- ---- -- -- ---- -- -- --; --- --CI ~ --- --- --- ------ -- --- -- --- ---- -- -- -- ---- --- --- --- --It65~ ----- ----- -- ---- --- -- -- -- ---- --- -- -- ---- -- --G --T ---~1221--3 ----_ --_ __ _ ___ _ _ _ _ _ CI lZ ~ --- ---- --A- ---- __ __ _ ---T --C --- --T ---21 ~7~
pcrlDK9slooo42 Wo 95l206s7 Table ~, Cnnt;m-P~l -l~ZO
7C31~ AGC GAA ACG CCG CGC GT~ GST TAT .'IAT l'CG AGA ACG GAT AAG CCG SGG CCG GTGr-18 - G --- --- --- --- --- -- --- - __ _ _ _ ___ CI ~ - ---- ---- --G ---- -- ---- ----- ---- ---- ___ ___ __ ___ _ ___ __ M~Z2 --- -- --- --- ---G --- --- --- --- --_ __ __ __ ___ ___ ___ ___ ~J9-3 --- -- --- ---- --G --- --- -- --- __ __ _ _ __ _ ___ _ __ MJ31-3 --- -- --- --- --G --- --- --- --- --_ __ _ __ ___ ___ _ __ _ C~ 10 -- -- ---- --_ __ _ _ __ _ _ _ _ _ PC31b ---- -- ------ ------ -- ------ --C~ 3 ---T --- ---- -- --G --- -- -- __ ___ __ ___ _ __ _ C~ 7 --- ---- -- --T- ---G ----- --- ---- --- ---- --- _ __ ___ __ __ _ __ 1~85~ --- -- -- --- --G --- --- --- --- --- --- __ _ __ __ __ __ __ ~7221--3 ------ _ _ __ __ __ _ C~ 12 ------ ---- ------ _ _ ___ _ __ _ _ __ __ _ 1~7 ~
7C31- GCG CTT SA~ 5TG ACG CCT GTG AGC AGT GCG GGC GGG GTG GCG A~T AAA GCT GGC
r-18 ---- ---- -- --- --- ----G ---- -- -- ---- ----G --A --- ---- ---- -- ---- ----1~1-2 ---- --- --- ---- ---- ---G -- -- ---- ------ _G ----A ----- ---- ---- -- -- --CI --- -- ---- ---- -- ---- --- ---- ---- ----G --A ---- ----- ---- ---- -- ---la22 --- -- ----- ---- ---- --G ---- --- ---- ----- --G ---A -- ---- ---- ---- --- --C~ 10 -- -- --_ _ _ __ _ ___ ~C3~b -- -- --_ _ _ __ _ ___ _ _ __ __ __ __ __ ___ ___ C~ 3 -- -- -- ---- ---- ---- -- -- --- ---- ---- -- -- -T- ----- -- -- ----CI 7 _ __ _ ~55~ ---- -- ---- ---- ------ ---- -- --- -- ---- ---T --- ---- ---- ------ -- -- -----~7221--3 ---- ~ ---- ---- ---- ---- -- ---- ---- ---- ------ ------C~ 12 ---- -- ---- -- -- -- -- -- ---- ------ _G ----A ---- ------ ---- ---- -- ----~C31~ TCA TTA ATT GCC G~G CTT ATT TTG CGA CAG ACC AAC MC TA~ AAC AGC GAT GAT
F-1~1 _ _ __ ___ __ _ _ __ __ ___ __ __ __ __ ___ __ _ _ ~Wll Z ------C~ ~ -- ---- ---- --__ _ __ __ __ _ ___ __ ___ __ _ NJ9 3 ---- ---- ------ _ _ _ __ ___ ___ __ __ _ CI 10 --_ __ __ __ __ __ _ _ __ _ _ ~K~3~b ------ -- __ _ __ _ __ __ _ __ __ _ _ __ ___ _ _ __ CI 3 __ ___ _ __ __ _ __ _ ___ ___ __ __ _ __ __ ___ __ CI 7 __ _ _ __ ~ _ _ ___ __ __ ___ __ _ ___ __ __ __ __ 1~85 ~ ---- --_ _-- ___ _ _ _ _ __ __ __ _ C~ lZ ---- --_ __ __ __ ___ _ __ __ W0 95/20657 2 ~ 8 ~ 7 2 6 72 r~ 2 Table 5, ~ n~ i n~
lsa2 I'C31~ rTC CAC s'r~ G~G 'rGG AAl' AT~ rAC GCC AAT AA~ CAT CrG GSG G5'G CCI' ACT GaC
8J11--2 ------ -- ---- ---- ------ ------ -- _ -- -- -- C ----_ ___ ~IJ9 3 -- ---- _ ___ __ _ __ __ __ __ _ _ __ __ ___ __ __ I~JIl 3 ------ ---- _ _ _-- __ ___ _ __ __ ___ _ _ __ _ _ __ CI 10 -_ __ _ __ __ ___ _ _ _ _ _ ~C3~ ___ _ _ _ ___ __ _ _ _ __ ___ __ _ __ _ _ ___ __ C~ 3-- ---- ---- ---- -- ---- ------ ------ -- ----C --C~ 7-- ------ _ _ _ _ _ __ _ __ __ __ __ __ ___ __ _ __ KS5 ~ -- -- _ __ ___ _ __ __ ___ __ _ _ _ __ __ _ __ _ ~1221 3 ---- -- ------ ---- -- ------ -- ---- ---- ------ ------ ------ -- ----C~ 12 ---- -- ---- ---- ------ ---- -- ------ ---- ---- ---- ------ ---- ---- ----C ------ ----C31~ C TCC CAT Cl~ ~rcs CCT CG~ CAS CTC ACC C~T ACT CTC CCC GAC ~ac CGT CC~

~J11--2 ~ C -- -- -- -- -- ------ --C--CI ~ --- --~ -- --- ---- ---- ---- -- ----- -- ---- -- T-- --- ---- -- -C- ---ILJZ2 ~r C -- ---- -- -- ------ -- --C--IIJg-3 --- -- -- ---- ---- ---- --A- -- --- ---- --- -- -- ---- --- ----- -C- ---C3~ __ ___ _ ___ __ __ __ _ C-- ___ C~ 3 -- -- -- --C--C~ 7 ------ ---- -- ---- ---- ---- ---- -- ---- ---- -- ---- ---- ---- ------ -- --C-- ------1~55~ ------------- ----a- ---------------------- -c---U221-3 -------------------------- ---------------ca--C~ 12 __ --T --- -- --~ T-- --_ __ __ __ _ T-- -- ---- --- -C- ---I'C3~ ~ca GTG CCA A~r~ CCl' c~r~ ACC C~ 'rAT ~G~ GCG AAa AGC Cll.A AaC C~G CGG 5'A~
F-lB ---- ---- --G --- ---- ---- -- ---- --- --- ---- -- -- ---- --- -- --- ----II,Jl 1-2 --- --- --G --- --- -- -- ----- --- --- - --CI ~ --- -- C ----- --- -- --- -- --- --- --- --- --- --- --- -- --II,J22 _-- -- --C
W9 3 ___ _ _ _ ___ ___ _ __ __ __ __ _ __ _ ___ ___ __ _ H,J3 1 3 _ _ __ __ ___ __ ___ _ ___ ___ _ ___ __ --_ __ _ _-- _--_ C~ 10 __ __ __ __ _ ___ __ __ ___ ___ ___ _ __ _-- __ _ _--_ I~C3~b ---- -- -- ---- --_ ---- _ --_ __ __ __ __ __ ------ --_-- -- -- ----C~: 3 ---- -- --G ------ ------ ---- -- ---- ------ ------ ---- -- -- -- ---- ------ ---- --C~ 7 ___ _ _ __ __ ___ ___ _ _ __ _ __ __ __ ___ __ __ __ I~S5~ _ __ _ _ __ _ _ ___ ___ ___ _ _ _ __ __ ___ _ Q21 3 _ _ _ __ __ __ ___ ___ ___ ___ _ _ __ ___ __ ___ _ _ C~ 12 ---- ---- --G ------ ---- ---- -- -- -- ---- ---- ---- -- -- ---- ---- -- ------2 1 8~726 Wo 95/20657 Table 5, Cnrt i n~
174~1 I'C31- SAC CTC TCC GGC ACA CAC GCA GAT GCG GGC AAC SCG ATS TTC ACC AAT ACC GCG
~-~a ---------- --- ----- - --- -_- _- _ __ __ __ _ _ __ C~ 4 --- ---- --- -- --- G-- -- --- --_ ---- __ _ _ __ ___ __ __ _ II,J22 ---- --A --- --- ___ ___ _ _ __ ___ __ _ ~ __ __ _ _ W9 3 -- ---- -- -- -- ---- _ _ __ ___ ___ __ __ H~J31 3 -- ------ ------ ---- -- -- ---- ------ ---- -- ---- --C~ 10 -- -- -- --_ __ __ __ __ ___ __ __ _ rc3~b --------- ------ ------------------ ------------ --- --- ---C~ 3 -- ------ __ __ __ _ _ __ __ _ __ _ CI ~ --- --- --- -- -- --- --- --- --- --- -- -- --- --- --- --- --- --C
~7221 3 C~ 12 ---- ------ --__ ___ __ _ __ __ _ _ ___ ___ _ _ 17g8 ~C31-- TCG TTT SCA CCT GC~ CAG GGC GTC GGC GTA CAG TTG ACG CGC aAC GGT aCG aTT
r ~8 ----C G ---- __ _ _ _ ___ _ ___ ___ __ 11~11-2 -- --- -- --C --G -- -- --- -- --- --- --- -- --- -- --_ ___ _ CI ~ --- --- --- --- -- --- --- -- ---- --- -- --- -- --- --- --- -- --W31-3 --- -- ---- ----A ---G ---- -- ---- --- ------ ----- ---- -- ___ __ _ __ __ C~ 10 ~C31b - ---- - ---- ---- -- -- ---- ----- ---- ---- ---- --- -- --- ---- --A-CI 3 __ ___ _ _ ___ ___ _ __ ___ __ __ _ ___ _ _ __ __ _ C~ 7 --- ---- -- --A ---G --- ---- -- --- ----- ---- --- -- -- ---- ----- --- --_ X85.1 --- -- ----A --G ---- -- -- --- -- -- --- -- ---- --_ __ __- __ ~7Z21-3 --- --_ _ _ _ C; 12 ---- -- -- ------ -- _ _ ___ __ ___ __ _ __ _ _ lB52 PC31~ ATT CCA GCG Al-T A~C ACG GTA SCG STA GGA GCA GTA GGG ACT TCG GCG GTG AGT
E'--lB _-- ---- -- ---- ---- ---- -- ---- ---- ---- -- -- ---- ------ ------ -- ----A ------W11--2 _ _ -- -- -- ---- -- -- -- ------ ------CI ~ -_ __ ---- -- -- -- ---- -- ---- -- -- ---- -- --- ---- --- --A ---W22 -__ __ -- -- -- -- -- -- ---- -- --- --- -- -- --- -- --A ---W9-3 - _ ---- ------ ---- -- -- -- -- ---- --- -- -- -- -- -- --A ---W31-3 __ _ -- ---- -- -- -- -- ---- -- ---- --- -- ------ -- ---- --A ---CI 10 ___ ___ _ _ __ ___ __ _ __ __ __ __ ___ __ __ __ _ _ PC31b ---- -- -- ---- ---- -- -- ---- ------ ------ ------ -- -- ---- ---- ---- ------ --CI 3 -_ -- -- ----- -- --- ---- --- -- -- -- --- -- ---- ----- -- --A ----cr 7 __ ------------------- --------------- -------A ---XS5~ __ __ _-- -- ----- ----- -- -- ---- ---- -- --- -- ----- ---- --- --A ---U221- -3 ___ _-- -- -- ---- ---- -- ---- ---- ------ ---- ---- -- ---- -- ---- ---- --CI 12 __ __ -- -- ---- ---- -- ---- -- ---- -- ---- --- ---- ---- --- --A ----Wo s5/20657 2 l ~ Q 7 ~ ~ 74 P~ 2 Ta~le 5, rnni-; nll~rl PC31~ C5G GGA STA ACG GCA AAT TAT GCA CGT ACC t;GA GGG CAG GTG ACT GC~ GGG AAT
W11--2 -- -- _ _ ___ __ _ ___ _ __ _ _ _ ___ CI 'l --- --- -- -- -- -- --C --- --- --- --- -- ------ -- _ -_ ___ ~IJ31--3 -- -- -- C ---- ------ -- -- -- -- -- -- ---- -- --_ Cl 10 T-- -__ __ _ ___ _ _ _ __ __ _ _ __ __ __ __ _ _ PC31b ------ -- -- ---- ------ ---- -- ---- -- -- ---- --CI 3 --- -- -- ---- --- --C --- --- --- --- --- --- -- -- __ -_ __ CI 7 --- --- ----- ---- --C --- --- --------- -- ----- --_ _ KS54 -- -- ------ -- --C ---- ---- -- ------ -- -- ---- _ __ _ _ UZ21--3 ---- ---- -- _ _ _ __ _ _ _ _ _ _ _ _ _ CI 12 --- -- -- -- -- --C ---- --- --- -- -- -- --_ _ _ __ PC31~ GTG CAA TCG ASS ATS GGC GSG ACT SSS GTS TAS CAA
r-l~ ----------------------- --_ I'J11--2 ------ ---- -- -- -- ---- -- ---- ---- -- -- --CI i --- -- ---- ----- _ __ _ - _ _ W22 __ __ _ _ _ W9--3 -- -- ------ _-- _ _ _ _ ___ __ IIJ31--3 ------ -- ---- --_ --_ _ _ _ __ _ _ __ CS 10 --__ __ _ __ _ _ _ _ _ _ _ _ PC31b __ __ ___ _ ___ _ _ __ __ _ _ _ 1~55~ ___ _ _ _ _ _ _ 2~8~726 WO 95120657 r~

EXaMPLE 6 FnrirhmDnt selection of StrA;nq havjncs mlltated F;m~ AtlhDq~nq rnnferr;r~cr Altered AflhDq;nn Ah;litY
One mechanism whereby new binding activities of bacterial Ar1hDq;nq may arise is by random, nAtllrAl ly occurring mutage-nesis. In nature, a variety of factors would enrich for strains that possessed adhesive capacities conferring a selective advantage. In the present exAmple an in vitro procedure was used to select for potential mutants with altered adhesive capacity. As a target substratum bovine K-casein was selected.
K-casein is the glycosylated isoform of bovine casein con-sists of a single polypeptide chain cnnt~in;n~ 169 amino acid residues the sequence of which has been ~l~tPrm;nDd (ref. 68).
Bovine K-casein does not contain N-glycosidic linkages, but up to six O-linked oligo~Arrh~rides are present in the C-tPrm;n~l region of the molecule (refs. 68, 69). ~mhe sacchari-de moieties are heterologous and also vary as a function of time after parturition. Of si~n~f1rAnre for the present study is-the fact that D-mannose is not present in the bovine K-casein. Only di- to hD~Aq~AcrhArides cnntA;n;ng galactose, N-acetyl-galactosAm;n~, N-acetyl-glllrnqAm;nD, fucose and sialic acid have been described (ref. 68). Glycoproteins having such saccharide compositioIIs would not be expected to serve as a receptor for the classic type of the FimH adhesin such as is found in E. coll 8train PC31.
Adhesion tests were performed to verify the inability of L'~ ' 1nAnt strains carrying the fimH gene from E. coli strai~ PC31 to adhere to; '-; l; 7ed K-casein. Lmhe 1~. coli strain used, l~B1001 is B101 cnntA;n;n~ plA~ q pP~L115 and - pLPA22 (ref. 70). The ~rlhDqinn assay was performed using microtiter plates coated with 30 llg/ml K-casein in 0.1 M
sodium ~; rArhnnAte (pH 9 . 6~ for 30 minutes, followed by blocking any l~ i n; n~ binding sites with a subsequent in-Wo ss/2o6s7 2 t 8 Q 7 ~ 6 76 1 ~ 0~- 17 ~
rllh~tinn with 0.196 bovine gerum albumin (BSA) in PBS. A
quantitative adhesin assay was performed as described in more detail Pl Apwhpre (ref . 71) . Briefly, bacteria were diluted to equivalent cnnrPntr~t; nn~ (5 x 107 cells/100~1) in PBS
5 ~nn~;~;n;n~ 0.1% BSA, added to coated microtiter wells for 30 minutes at 37C. Pfter washing the wells thoroughly to remove unbound bacteria, BHI broth was added and the h~-~tPr;~ were allowed to grow at 37C on a rotating platform (150 rpm) until the optical denaity could be measured (2-2.5 hours).
10 Comparisons can be made of optical densities obtained in the test wells to tho~e obtained in standard curves developed f rom the plating of known nu~nbers of h~ rtPr; ~ under similar conditions, allowing ~YtrArol~t;nn to ~hsnl~te numbers of bound bacteria (ref. 70).
15 The KB1001 strain cprising the f~mtI gene from PC31 bound to 'il; ~P~l mannan in significant numbers, but there was subst~nt;~lly no - ~llr~hle ~hP~inn to; '- 1;7PCI K-casein.
To select f or possible mutant cells having acquired the ability to bind to K-casein, cells of RB1001 were allowed to 20 interact with K-caseill; ~-;1; 7Prl on microtiter wells. After thorough washing to remove non-~lhpr;ng bacterial cells, cells adhering to the wells were collected and grown over-night in BHI broth. T~lese "enriched" bacterial cultures were again allowed to ~nteract with immobilized K-casein, the 25 plates were washed and ~nlhPr; n~ cells collected in nutrient broth. This enrichment cycle was repeated up to ten times.
Bacterial cells obtained from the last of these cycles ( "en-riched" strains) adhered to K-casein in sign;fir~ntly iIl-creased nu~bers in comparison to the parent ("non-enrichedn) 30 strain (Table 6.1). Individual colonies of "enriched" ~B1001 were isolated and f our tested f or ability to adhere to K -casein. Three enriched cultures (clones) bound to K-casein significantly better than did the non-Pnr; rhP~l parent strain.

wo ssno6s7 PCTlDKgS100042 T~hle 6.1. ~Arlh~Qion to r;~Q~;n of non-~nriched ~nrl rnrirhl~tl E.
coli str~;n ~ 001.
5 Strain bacteria binding to K - casein~) Non-enriched g~31001 0.043 + 0.018 (pPgL115 + pLPA22) Enriched g31001 0 .249 + 0 . 004 (pPgLl15 + pLPA22 ) a) numbers represent optical density of bacterial growth +
S.D. with ba~;}.yL.,ull~ O.D. ~ubstracted. N = 3.
To determine whether the new adhesive activity was due to plasmid- related changes and not simply to host cell - related 15 changes, plasmid preparations of pLPA22 were made ~rom en-riched and from non-enriched strains and used to transform E.
coli ~3101 rr,ntA;n;n~ the ~ r;];~ry plasmid pPKLl15. Randomly selected trans~ormants resistant to ampicillin and chloram-phenicol were tested for adhesion to K-casein, and several o~
20 the transformants harbouring ~ lQ from enriched cultures adhered in signif icantly increased numbers relative to plas -mid-cont~;n;ng cells of the non-enriched parent strain (Table 6 .2) .
T~hle 6.2. A~lh~qi~n to r~ ;n of ~RlOl (~p~T,ll~) tr:~nQf 25 with ~l~, tlQ ~ PnrirhP~l or non_f~nrirhf~rl strl;n l~RlOOl.
Plasmid derived from: bacteria binding to K - casein~ ) Non-e~riched g31001 5 + 0 . 1 X 103 30 Enriched RB1001 50 + 1.5 x 103 WO 95/20657 2 ~ ~ Q ~ 2 ~ PcrlDK95/00042 a) numbers, eyLês~ L mêan number o~ bacteria per well + S.D.
N - 3.
The above results demonstrate that random or S~pont~n~ml~
mutations in geneg coding ~or a bacterial adhesin that conf er 5 binding to a new substratum (i.e. a receptor moiety to which the parent strain does not bind), can be selected ~or by appropriate in vitro pL UCe~UL e8 .

Wo ss/206s7 T ~ 2 1. Abraham, S.N., D. Sun, J.B. Dale and E.H. Beachey. 1988.
Nature 336: 682 - 684 .
2. AhrAhAm, S.N., D.L. Hasty, W.A. Simpson and E.H. Beachey.
5 1983. J. Exp. Med. 158:1114-1128.
3 AhrAhAm, S.N., J.D. Goguen, D. Sun, P. Xlemm and E.
H. Beachey. 1987. J. Bacteriol. 169:5530-5536.

4, AhrAhAm, S.N., J.P. Babu, C.S. ~ D.L. Hasty, W.A.
Simpson and 3.H. Beachey. 1985. In~ect. ~mmun 48:625-628.
10 5. Akiyama, S.R. and X.M. Yamada. 1985. J. Biol. Chem.
260 :4492-4500 .
6. Barondes, S.H. 1988. Trends in ~iorh~om Sci. 13:480-482.
7. Beachey, E.H. 1981. J. Infect. Dis. 143:325-345.
8. Blomfield, I.C., M.S. McClain and B.I. 3isenstein. 1991.
15 Infect. Ln~nun. 5: 1439-1445.
9. Bloch, C.A., B.A.D. Stocker a~d P. Orndorff. 1992. Mol.
Microbiol . 6: 697 - 701.
10 . Brinton, C. C ., Jr. 1959 . Nature 183: 782 - 786 .
11. Brinton, C.C., Jr. 1965. Trans. N.Y. Acad. Sci. 27:1003-20 1005.
12. Dodd, D.C. and B.I. 3ise~stein. 1982. I~ect. ~nun.
38: 764 773 .
13. Durguid, J.P. and D.C. Old. 1980. Adhesive properties of EnternhAr~t~r;Ar~Ai, p. 185-217. I~ E.H. 3eachey (ed. ), Bac-W0 9~20~57 2 t ~ 0 ~ ~ 6 8 0 J ~ 12 terial Adherence (Receptors and R~ro~n; t~ nn Series B, vol .6 ) . Chapman and Hall, London .
14. Duguid, J.P., J.W. Smith, G. Dempster and P.N. Edmunds.
1955. J. Pathol. !3acteriol. 70:335-354.
15. Engvall, E. alld E. Rllns~;~ht;~ 1977. J. Cancer 20:1-5.
16. Firon, N., I. Ofek and N. S_aron. 1983. Carbohydrate Res.
120 :235- 249 .
17. Gerlach, G. -F, S. Clegg and B. ~. Allen. 1989. J. Bac-teriol. 171:1262-1270.
18. Gibbons, R.J. 1984. J. Dent. Res. 63:378-385.
19. Guerina, N.G., T.W. ~essler, V.J. Guerina, M.R. Neutra, H.W. Clegg, S. 3 ~1~y~L~ , F.A. Scannapieco and D.A Goldman.
1983. J. Infect. Dis. 148:395-405.
20. Hanson, M.S., J. Hempel and C.C. Brinton, Jr. 1988. J.
15 Bacteriol. 170:3350-3358.
21. Hanson, M.S. and C.C. Brinton, Jr. 1988. Nature ~London) 322 :265-268 .
22. Harris, S.L., D.A. Elliott, M.C. Blake, L.M. Must, M.
Messenger and P.E. Orndorff. 1990. J. Bacteriol. 172:6411-20 6418.
23. Hornick, D.B., B.L. Allen, M.A. Hor~ and S. Clegg. 1991.
J. Clin. Microbiol. 29:1795-1800.
24. Hull, R.A., R.E. Gill, P. Hsu, B.H. Minshew and S. Fal-kow. 1981. In~ect. Immun. 33: 933-938.
25 25. Hultgren, S.J., T.N. Porter, A.J. Schae~fer and J.L.
Duncan. 1985. Infect. Immun. 50:370-377.
.. _ _ _ _ . .... . _ _ _ _ _ _ _ W095/20657 2 1 8 ~ 7 2 ~ PCr/DK95/00042 26. ~eith, B., h. Maurer, P. Spears and P. Orndorff. 1986.
In~ect Immun. 53:693-696.
27. Klemm, P. and G. Christensen. l9a7. Mol. Gen. Genet.
208 :439-445 .

5 28. Rlemm, P., B.J. Jorgensen, I. van Die, X. de Ree and E.
D~Lylaus . 1985 . Mol . Gen. Genet. 199 :410-414 .
29. }Crogfelt, R.A., E. Bergmans and P. EUemm. 1990. Infect.
Immun. 5a: 1995-1998.
30. Krusius, T., M. Fukuda, A. Dell and E. ~-loQl~h~;. 1985.
J. Biol. Chem. 260:4110-4116.
31. Lockman, H.A. and R. Curtiss, III. 1992. Infect. Imnun.
60:491-496.
32. Maurer, L. and P. Orndorff. 1987. J. Bacteriol. 169:640-645 .
15 33. Mayaan, M., I. Ofek, 0. Medalia and M. Aronson. 1985.
Infect. Inunun. 49:785-789.
34. McCormick, B.A., D.P. Franklin, D.C. Laux and P.C. CoheIl.
1989. Infect. I~mu~. 57:3022-3029.
35. Miller, J.H. 1972. Experiments Irl Molecular Genetics.
20 Cold Spring Earbor Press, Cold Spring Harbor, New York.
36. Minion, F.C., S.N. ~hr~h~m~ E.E. Beachey and J.D. Goguen.
1986. J. Bacteriol. 165:1033-1036.
37. Neeser, J.-R., B. 3Coellreutter and P. Wuersch. 1986.
Inf ect . Immun . 52: 42 a - 43 6 .
25 38. N;~hik~a, A., T. Sekine, R. Ikeda, T. Shinoda and Y.
Fukasawa. 1990. Microbiol. Immunol. 34: 825-840.

Wo 95/20657 r~ 2 2~ ~Q~ 82 39. Ohm~n, D.E. 1g88. Exp~r; ~ in Gene r~-n;r~ ti nn, Prentice Hall, Inc., Englewood Cliffs, New Jersey.
40. Of ek, I. and N. Sharon. 1990. Curr. Top. Microbiol.
Immunol . 151: 91-113 .
41. Ofek, I., D. Mirelman and N. Sharon. 1977. Nature 265: 623 - 625 .
42. Ofek, I. and ~.H. Beachey. 1978. Infect. Immun. 22:247-254 .
43. Old, D.C. 1972. J. Gen. Microbiol. 71: 149-157.
44. Orndorff, P.E and S. Falkow. 1984. J. Bacteriol.
159: 73 6 - 744 .
45. Petersen, T.E, 1~. Skorstengaard and R. Vibe Pedersen.
1990. Primary structure of fibronectin, p. 1-24. In D. Mosher (ed. ), Fibronectin. Ar~rlPm; r Press , New York.
46. Quiocho, F.A. 1986. Ann Rev. R;o~h~m 55:287-315.
47. Rosenstein, I J., M. Stoll, T. M;~-lo~h~, R. Childs, E.
Hounsell and T. Feiz;i. 1988. T_e Lancet ii:1327-1330.
48. c ' .,ok, J., E. Fritsch and T. M;-n;ct;~. 1989. Mnlecl~ r Cloning. CSH T~hor~tory Press.
49. Sanger, F., S. Nicklen and A.R. Coulson. 1977. Proc.
Natl. Acad. Sci. U.S.A. 74:5463-5467.
50. Sharon, N. and I. Of ek. 1986. Bacterial surface lectins specific for m~nnose, p. 55-81. In D. Mirelman (ed. ), Micro-bial Lectins and Aggll~t;n;nc, J. Wlley and Sons, New York.
25 51. Sokurenko, E.V., H.S. Courtney, S.N. ~hr~h~m, P. EUemm and D.L. Hasty. 1992. Infect. ~nun. 60:4709-4719.

2181~7~6 WO 95/20657 8 3 PCT/I)K ''~ 2 52. Stromberg, N., B.-I. Marklund, B. Lund, D. Ilver, A.
Hamers, W. Gaastra, K-A. Karlsson and S. Normark. 1990. EMBO
J. 9:2001-2010.
53. Stromberg, N., P-G. Nyholm, I. Pascher and S. Normark.
1991. Proc . Natl . Acad. Sci . U. S .A . 88: 9340-9344 .
54. Takasaki, S., K. Yamashita, K. Suzuki, S. Iwanaga and A.
Kobata. 1979 . J. Biol . Chem. 254: 8548-8553 .
55. Tewari, R., J.I. MacGregor, T. Ikeda, J.R. Little, S.C.
Hultgren and S .N. Abraham. 1993 . J. Biol . Chem. 268: 3009-3015.
56. Westerlund, B., P. Kuusela, T. Vartio, I. van Die and T.
K. K~)rh~nF~n . 1989 . FE:BS Letteræ 243 :199-204 .
57. Westerlund, B., I. van Die, C. Kramer, P. Kuusela, H.
~olthofer, A-M. T~rkk~n.on, R. Virkola, N. Riegman, H. Berg-mans, W. Hoekstra and T.K. ~r rh~n~n . l991. Mol . Microbiol .
5: 2965-2975 .
58. Zardi, L., B. (~;3rn~ , E. Balza, ~. Borsi, P. Castel-lani, M. Rocco and A. Siri. 1985. Eur. J. Biochem. 146: 571-579 .
59. Hultgren, S.J., F. Lindberg, G. MagnusEon, J. Kihlberg, J.M. Tennent and S. Normark. 1989. Proc. Natl. Acad. Sci.
U.S.A., 86:4357-4361.
60. Kaufman, M.R. and R.K. Taylor 1994. Fimbriae of Vi~rio cholerae. In Fimbriae: Adhesion, Genetics, Biogenesis and Vaccines. Ed P Klemm. CRC Press, Boca Raton, pp. 165-179.
61. Klemm, P. and K.A. Krogfelt. 1994. Type 1 fimbriae of Escherichia coli. In Fimbriae: Adhesion, Genetics, Biogenesis and Vaccines. Ed. P. ~Clemm. CRC Press, Boca Raton, pp. 9-28.
SUBSmUTE SHEET

WO 95120657 2 1 8~ ~ 2 ~ 84 PCTIDK95/00042 62. Rrogfelt, R. A. 1991. Rev. Infect. Dis. 13:721-735.
63. Kuehn, M. J., D. Haslam, S. Normark and S. J. Hultgren.
1994. Structure, function and biogenesis of Escherichia coli P pili . In Fimbriae ~ hpf~inn, Genetics, 3iogenesis and 5 Vaccines. Ed. P. ~:lemm. CRC Press, Boca Raton, pp. 39-55.
64. Schmidt, M.A. 1994. Non-fimbrial ~rlhP~in~ of Escherlchia coli. In Fimbriae: ~tlhpf~inn~ Genetics, Biogenesis and Vac-cines. Ed. P. Rle~m. CRC Press, Boca Raton, pp. 89-100.
65. Sharon, N. 19&7. FEBS Lett. 217:145-150.
10 66. Sokurenko, E.~., H.S. Courtney, D.E. Ohman, P. Rlemm and D.L. Hasty. 1994. J. Bacteriol. 176:748-755.
67. Pedersen, J.C. and T.D. Leser. 1992. Microbial Releases.
1:95-102 .
68 . Jollès , J., F . Schoentgen, C . Alais , A. -M. Fiat and P .
15 Jolla8. 1972. Helv. Chim. Acta. 55:2872-2883.
69. Fiat, A.-M., C. Alais and P. Jollès. 1968. Chimia 22:137-139 .
70. Pallesen, L., L.R. Poulsen, ~.B. Jensen, G. Chistiansen and P. Rlemm. 1995. Chimeric FimH adhesin of type 1 fimbriae 20 as presenter of heterologous epitopes. J.Bacteriol. submitted for publication.
71. Sokurenko, E.~., V. M~MA~k;n and D.L. Hasty. 1994. Growth assay for bacterial ;~hP~inn to; ~ ili7P8 ligands. In R.
Doyle and I. Ofek (eds), Methods in Enzymology. Vol 252, 25 Methods ~or Microbial ~tlhP~inn Academic Press, N.Y. in press .
72. Charnay, P., C. Pourcel, A. Louise, A. Fritsch and P.
Tiollais. 1979. Proc. Natl. Acad. Sci. USA 76:2222-2226.

Wo 95no6s7 2 1 8 ~ 7 2 6 PCT/DK9!i1000'12 73. ~i -;m, H.C. and J. Doly. 1979. Nucl. Acid Res. 7:1513-1523 .
74. Xrogfelt, K.A. and P. Rlemm. 1988. Microb. Pathog. 4:231-238 .
5 75. Chanteloup, N.R., M. Dho-Moulin, B. ~snault, A. Br~e and J.-P. ~afont. 1991. Microbial Path. 10:271-280.
76. Itoh, Y., ~. Takai, H. Ohnuma, K. Kitajama, F. Tsuda, A.
Machida, S. Mishiro, T. l~l , Y. Miyakawa and M. Mayumi.
1986. Proc. Natl. Acad. Sci. USA 83:9174-9178.
10 77 . ~acob, O. C., M. Sela and R. Arnon. 1983 . Proc . Natl .
Acad . Sci . USA. 80: 7611- 7615 .
78. Tabor, S. and C. Richardson. 1985. Proc. Natl. Acad. Sci.
USA. 82: 1074 - 1078 .

WO 95/20657 2 ~ ~ Q 7 ~ 6 PCI/DK95100042 INDICATIONS RELAnNG TO A DEPOSITE~D MICROORGANISM
~PCI'Ru1c 13bfs) A. Tne indit~tions ~ O tbe tcfctrttd ro in tbc dct~ption on~t~C 53 ,~jneV 26 B. IDENI~ElCA'llON ~ ~t `~ Furtber de}tosits ~trc identiGcd on -D -ddidonutl sbret ~1 Ntttnc of dttpn~nory tDsritution DSM-Deutsche Samtttlung von Mikroorganismen und ZeLllculturen Gtttbll AhlnttttsoEdcftosioryinstitutionf ' '~
Mascheroder Weg lB
D-38124 Braunschweig Germany D te of depic Ae~sion Nutnb 26 January 1994 ¦ DSM 8922 C ~ ,~ T INDIcAnoNs (Icttt~c~i~not ~ppriad~iC~ Tbis inforrD~tion is ron~inued on Jn ~ddit~on~l sbect 3 As regards the respective Patent Offices of the respective desig-nated states, the ~rr1 ir,~n1-c re-auest t~at a sample of the deposi-ted microorganisms only be made available to an eYpert nominated by the rer~uester until the date on whic~t the patent is granted or the date on which the application has been refused or withdrawn or is deettted to be withdrawn.
D~ M~sTATEsFoRwlIltcEI~sDIcAnoNsAREMADE~r~ ~rc~otrr~r~b'~ v ' '' ' ) E. SE~ARA7iEl~t At~..~OF~INDICAnOMS(/ellvcvh~i/no oppr~
~ t ~ ~ r ~ v ' r ' r 'Ar~i IVv~oro~D~D~') - For~veivin~Offj~,etlseonly For1mcrn~tion~lBurct~uuseon1y Ç~ IbissbtMtsrevtttivttdwi~btbein~ n~tion~l~pp~ on O Tbiss'v~ettlur.tsre~ei~tttdby~beZmernrtiontlBurettuon:
Autboritrcd offirer -- Autbori~ttd offir,er 21~72~
Wo 95/206s7 PCT~K9Sl00042 INDICATIONS RELATING TO DEPOSITED MICROORGANISMS
(PCT Rule 12bis) Additional ~heet In addition to the miC:LUOLydllism indicated on page 53 of the 5 description, the following mi~Lo~Ly~llisms have been deposited wi th DSM-D~t~-~h~ Sammlung von Mi~LUUL'J'I~ mL~n und Cel lkul turen Gm. bH
Mascheroder Weg lb, D-38124 Braunschweig, Germany 10 on the dates and under the accession numbers as stated below:
Accession Date of Description Description num.ber deposit Page No. Line No.
DSM 8915 26 January 1994 66 24 DSM 8916 26 January 1994 66 24 DSM 8917 26 January 1994 66 24 DSM 8918 26 January 1994 66 24 DSM 8919 26 January 1994 66 24 DSM 8920 26 January 1994 66 24 DSM 8921 26 January 1994 66 25 DSM 8923 26 January 1994 66 25 For all of the above~ nt;f;~ deposited mi~LUoL ~ isms, the following additional indications apply:
25 As regards the respective Patent Offices of the respective designated states, the applicants reguest that a sample of the deposited mi~;LuuLyallisms stated above only be made available to an expert r n~te~l by the requester until the date on which the patent is granted or the date on which the 30 application has been refused or withdrawn or is deemed to be withdrawn .

WO 95/20657 2 ~ 8 Q 7 ~ 6 88 ~~
SEQ~ENCE LISTING
~1) GENE.AL l~r~ lUlY:
( i ) A.PLI CA~T:
(A) NA~E: GX BioSy~tem~ A/S
(B) STEET: Mot}lsve; 70 (C) CITY: Holte (D) COIJ~TRY: Der~mark (E) POSTAL CODE (ZIP): 2840 ii) TITLE OF INVENTION: Receptor ~;peci~ic ~acterial adhe~in~ and their use (iii) N0MBER OF SEQ~ENCES: 55 (iv) COMP~TER .=BLE FOR~!I:
(A) MEDIUM TYPE: Floppy dillk (B) CO~TER: IBM P~ 'hl~.
(C) OPERATING SYSTEM: PC-DOS/MS-DOS
(D) SOFTWARE: P~tentIn Releal3e #1.0, V~rsion #1.25 (2) . FOR SEQ ID NO:l:
(i) SEQ~lENCE rY7~0~l . - - I ~., l~::i:
(A) LENGTH: 300 ~mino ~cid5 IB) TYPE: ~mino acid (C) Smo~ : unlcno~n ~D) TOPOLOGY: line~r (ii) MOLECtlLE TYPE: peptide (xi) SEQ~ENCE Dr.~u~Llur~: SEQ ID NO:1:
~et Ly~ Arg Val Ile Thr Leu Phe Ala Val Leu Leu Met Gly Trp Ser al AGn A1A Trp Ser Phe Ala Cyl3 LyEI mr Ala A~n Gly Thr Al~ Ile Pro Ile Gly Gly Gly S~r Ala A~n VA1 Tyr Val Asn LeY Al~ Pro Val 35 ~10 45 V~l Aon V~l Gly Gln Asn Leu Val Val P.sp Leu Ser Thr Gln Ile Phe Cy~ Asn Asp Tyr Pro Glu Thr Ile Thr Asp Tyr Val Thr Leu Gln rg Gly Ser Al~ Tyr Gly Gly V~l Leu Ser Asn Phe Ser Gly Thr Val ~5 90 95 y~ Tyr Ser Gly Ser Ser Tyr Pro Phe Pro Thr Thr Ser Glu Thr Pro 2~
W0 95/~0657 8 ~ 7 ~ 6 PCT/Dli9~/00042 Arg Val Val Ty~ Asn Ser Arg Thr ABP Lys Pro Trp Pro Val Al~ Leu Tyr Leu Thr Pro Val Ser Ser Al~ Gly Gly Val Ala Ile Ly6 Ala Gly Ser Leu Ile Ala Val Leu Ile Leu Arg Gln Thr Asn Asn Tyr Asn Ser sp ABP Phe Gln Phe V~l Trp Asn Ile Tyr Ala Asn Asn ABP Val Val al Pro Thr Gly Gly CYB Asp Val Ser Ala Arg Asp Val Thr Val Thr Leu Pro Asp Tyr Pro Gly Ser Val Pro Ile Pro Leu Thr Val Tyr Cys Al~ LYB Ser Gln Asn Leu Gly Tyr Tyr Leu Ser Gly Thr Elis Ala Asp Al~ Gly Asn Ser Ile Phe Thr Asn Thr Ala Ser Phe Ser Pro All Gln ly Val Gly Val Gln Leu Thr Arg Asn Gly Thr Ile Ile Pro Ala Asn 2i5 250 255 sn Thr Val Ser Leu Gly Ala Val Gly Thr Ser Ala Val Ser Leu Gly eu Thr Ala Asn Tyr Ala Arg Thr Gly Gly Gln V~l Thr A1A Gly Asn al Gln Ser Ile Ile Gly VA1 Thr Phe Val Tyr Gln (2) llYrU~.lUl~ FOR SEQ ID NO:2:
( i ) SEQ13ENCE ~'~ ~ o (A) LENGT~: 30 a~ino ~cids (B) TYPE: amino Acid (C) ' : unknown (D) TOPOLOGY: linear ~ii) ~LECULB TYPE: peptide (xi) SEQ~ENCE v~s~u~l~llu~: SEQ ID NO:2:
Glu Ala Gln Gln ~5et Val Gln Pro Gln Ser Pro Val Ala Val Ser Gln er LYB Pro Gly Cys Tyr ABP Asn Gly Lys }~is Tyr Gln Ile (2) . FOR SEO ID NO:3:
.

WO 95/20657 2 ~ 8 ~ 7 2 6 PCT/DK95/00042 _ _ 90 i ) SEQUE~CE rP7~ " ~ ~i ~A) LENGTu.: 29 b~-se p~irs ~B) TYPE: nucleic ~cid (c) ~Tr~ : single (D) TOPOLOGY: linePr (ii) ~OLECDLE TYPB: DNA (ge~r~ic) (xi) SEQI~ENCE Ll~aC~llUN: SEQ ID NO:3:
,;,,, ~,,,,~,, .. r~rr~T~r~rr Tt;~AcccGG 29 (2) lNrl FOR SEQ ID NO:4:
(i) SEQ~ENCE rP7~n~ , y ", .
(A) LENGTu: 29 b~se p~ir~
(B) TYPE: nucleic ~Icid (C) 3'. : single (D) TOPOLOGY- line~lr (ii) IYIOLECl~LE TYPE: DNA (genrmic) (xi) SEQI~ENCB DlS~lellUN: SEQ ID NO:4:
r~r.rrlr,r~r Tr~rr~ rr ATTCAGGCA 29 (2) . lUN FOR SEQ ID X0:5:
(i) SEQ~ENCE rT~7'n~ llu j (A) LExGT-u-: 30 bas~ p~lirs (B) TYPE: nucleic ~cid (C) _ : single (D) TOPOLOGY: lineo.r ( i i ) I~OLEC~lLE TYPE: DNA ( ge~omi c ) (xi) SEQIJENCE IJ~S~.ltll'llUN: SEQ ID NO:5:
;,.,;"_1 1_~ ~T .1.~l 7'7~ CA~AGTCAC 30 (2) . lUN FOR SEQ :~D NO:6:
(i) SEQ~ENCE ru7~ nZ~
(A) LENGTU: 30 ba~e p~irs (B) TYPE: nucleic ~cid (C) ST~ : single (D) TOPOLOGY: lineilr (ii) Y~LEC0LB TYPE: I~NA (genr~ic) 2 1 ~
WO9!i/20657 P~ ,'C~ '?

(Xi ) S}! Q~lENCE l/ke~ SEQ ID NO: 6:
TATTGATA~iA CAAI~AGTCAC 3 0 (2) lh~. FOR SBQ ID NO:7:
(i) SEQI/ENOE ~T7'0~ " ~
(A) IENGTH: 24 bA8e p~irs (B) l'YPE: nucleic acid (C) ! : single (D) TOPOLOGY: line~lr (ii) MOLECtiIE TYPE: DNA (genc rlic) (Xi) SEQ~IENCE L~l~a~ lu~: SEQ ID NO:7:
GTCG~TAA TTAP I~AAGT CG~C 24 (2) l~... FOR SEQ ID NO:8:
(i) SEQ~ENCE t~rrr~
IA) LEI~TH: 8 b~se p~irs (B) TYPE: nucleic elcld (C) ! : single (D) TOPOLOGY: line~r (ii) i~LEC~lLE TYPE: DhA (genc~ic) (Xi ) SEQUENCE Llr;:~ lu~: SEQ ID NO: 8:

(2) lhru~_ Ilow FOR SEQ ID NO:9:
(i) SE~JENCE ~
(A) LENGTH: 10 base pairs (B) TYPE: ~ucleic ~cid (C) ST~ : single (D) TOPOL0GY: line~Lr (ii) 11~0LECBLE TYPE: DNA (genamic) (xi) SEO~ENCE ~~ w~r~lUc~: SEQ ID NO:9:
GA~GATCTTC 1 0 (2) lh~ ~ FOR SEQ ID NO: 10:
(i) SEQ~OE ~ ,._r~
(A) ~ENGTH: 51 b~se p~irs (B) TYPE: nucleic Jcid (C) STrr : single . _ .

W095/20657 2 1 8(~7~ 92 1.~ 2 (D) TOPOLOGY: line~r (ii) ~IOLE= TYPE: DNA (gellomic) (xi) SEQ~ZNOE IJIsa~ u~: SBQ ID NO:lO:
&ATCCA&CTT Tl~TCTGACT ~Lo~:lhL~lu~ TGACTACCCG r-7~rrr~D-~r A 51 (2) l~.. lUh FOR SEQ ID NO:11:
(i) SEQl~ENCE c~ x (A) LEN&TH: a2 b~se p~irs (B) TYPE: nucloic Acid (C) ! : single (D) TOPOLOGY: line~r (ii) ~:OLE= TYPE: DNA (geDoLnic) (xi) SEQ~IENOE l~ ll'LluL~: SEQ ID NO:11:
GGA&ATCTAA TTCCACDACC TT Z2 (2) lL.. lUll POR SEQ ID NO:12:
(i) SEQllENCE CTr~D~
(A) = TH: 22 ba~e p~irG
(B) TYPE: nucleic ~Icid (C) _ : ~ingle (D) TOPOLOGY: line~r (ii) ~lOLEC~lLE TYPE: D~A (genoLnic) (xi) SEQI~ENOE L~L~a-:~l'LlUrl: SEQ ID NO:12:
..r.~ T TcA&cGcA&G GT 22 (2) . FOR SBQ ID NO:13:
(i) SEQ~ENCE ~7~l~DI~ xl ~l x (A) LEN&TH: 30 ~mino ~cids (B) TYPE: z~i~o ~cid (C) ' : unkno~n (D) TOPOLO&Y: linear (ii) ~lOLE = TYPE: peptide (xi) SEQ~ENCE l/~a~eLlu~: SEQ ID NO:13:
Glu Al~ Gln Gln ~et Val &l" Pro Gln Ser Pro V~1 Ala V~l Ser Gln WO 95/20657 2 6 r Ser Lys Pro Gly Cys ~yr Asp A5L Gly Lya His Tyr Glll Ile ~2~ .LlUN FOR SEQ ID NO:14:
(i) SEQI~ENCE r~r~~ ", x, ~
~A) LENGTH: 29 a~irlo acids (B) TYPE: amillo acid (C) :~ : unicrlo~
(D) TOPOLOGY: linear (ii) MOL~CC~E TYPE: peptide (xi) SEQUENCE 1~1SXUI~ 1UN: SEQ ID NO:14:
Glu Glu Gly Lys Arg Gly Ala Arg Gly Glu Asx Gly Ala Ala Gly Pro V~l Gly Pro Asx Gly Glu Arg Gly Alll Arg Gly Asn Arg (2) 1~ FOR SEQ ID NO:15:
(i) SEQ~ENCE CY~n7~ f~
(A) LENGTH: 14 ~il~o ~cid~
(1~) TYPE: ~ o acid (C) ! : UnknOW I
(D) TOPOLOGY: lir~e~lr (ii) r~LECl~LE TYP~: peptide (xi) SEQIIENCE L~lsSw~ lu~: SEQ ID NO:15:
Ala Ile Glll ~srl Ile Arg Leu Arg His Glu Asll Ly5 A~p Leu (2) lOlr~ FOR SEQ ID NO:16:
(i) SEQI~ENCE ~n~ I( x (A) LENGTH: 12 ~mino acid~
(R) TYPE: ~ o acid (C) r : url3snow (D) TOPOLOGY: linear (ii) ~OLECULE TYPE: peptide (xi) SEQNENCE LI~D~ lU~: SEQ ID NO:16:
rg VA1 Phe Pro Arg Gly ~r VA1 Glu As~ Pro Cys (2) 1~l FOR SEQ ID NO:17:

W095/206~7 2 1 8~726 9~, I~,I/L.. ' .. ~l2 (i) SEQI~ENCE (~ o~ , " -, ~A) LENGTE: 13 1i7ino ~cids i3) TYPE: ~mino acid (C) ::, : u~known (D) TOPOLOGY: line~r (ii) ~DLECtJLE TYPE: peptide (xi) SEQllE~CE Llr.~ UN: SEQ ID 110:17:
Asp Eis Ser A7p Leu Val Al~ Glu Lys Gln Arg Leu Cys (2) LNr~ FOR SEQ ID N-0:18:
(i) SEQI.7ENCE ~~
(A) LENGTE: 13 ~7ino ~Icids (B) TYPE: ~mi~o ~cid (C) ~ : u~own (D) TOPOLOGY: 7ir~e~r (ii) MOLECI7LE TYPE: peptide (xi) SEQ~IEXCE Llo~ UN: SEQ ID NO:18:
Ala Glu Lys Gln Arg Leu Glu Asp Leu Gly Gln Lys Cy8 5 lO
12) . FOR SEQ (D N-O:l9:
~i) SEQ~EN-CE t~ 7~
~A) LEN-GTE: ll a~ino acids (B) TYPB: ~ino acid (C) 5~ : unXnown ~D) TOPOLOGY: lineAr tii) MOLECNLE TYPE: peptide (xil SEQUENC-o L~r.~ LlUN: SEQ ID ~0:19:
Thr Val Lys Asp Lys Leu Al~l Lys Glu Gln Cys (2) . FOR SEQ ~D N-0:20:
( i ) SEQl lENCE ~'~ ~ m (A) LE~GTE: 2 8 amino a~ids (B) TYli:: ~mino o.cio (C~ _ : unXnown (D) TOPOLOGY: linear 2 ~ ~Q~6 WO 95l20657 P~:IIIJK .~/ C '~

(ii) MOLECULE TYPE: peptide (xi) SBQ~EXCE u~S~ loc-: SBQ ID NO:20:
Lys Thr Lys Asn Glu Gly Leu Lys Thr Glu Asn Glu Gly Leu Lys Thr Glu Asn Glu Gly Leu Ly~ mr Glu Asn Glu Gly Cys (2) lXr~ FOR SEQ ID NO:21:
(i) SEO~lENCE ~7~0~ x (A) LENGT~: 30 ~mino ~cids (B) TYPE: ~mino acid (C): : urlknown (D) TOPOLOvGY: line~lr (li) MOLECnvLE TYPB: peptide (xi) SEQ~IENCE WSX~r~lUX: SEQ ID NO:21:
Gln Glu Ser Lys Glu Asn Glu Lys A1A Leu Asn Glu Leu Leu Glu Ly~

mr VJ~1 Lys Asp Lys Ile Al~ Ly~ Glu Gln Glu Asn Lys Glu (2) lXr~ FOR SEQ ID NO:22:
(i) SEQ~iENCE cr~onr ,.v~
(A) LE~ : 30 amino acids (3) 7.'YPE: ~ino ~cid (C) ST-~ : unknown (D) TOPOLOvGY: line~lr (ii) MOLECtlLE TYPE: peptide (xi) SEQtlENCE Ul~ lUW SEQ ID NO:22:
Asp Leu Thr Ly6 Glu Leu Asn Ly6 mr Arg Gln Glu Leu Al~ Asn Lys Gln Gln Glu Ser Ly~ Glu Asn Glu Lys Al~ Leu Asn Glu Leu (2) J.. ~ l~X FO~ SEQ ID NO:23:
(i) SEOI~ENCE ~7~on~ " ~j (A) LENGl~: 13 ~mino /~cids (3) TYPE: a-nino ~cid (C) _ : unkno~ n WO 95/20657 2 ~ 8 U 7 2 6 PcrmK^ ~ ,2 (D) TOPOLrvGY: lineAr (ii~ xoLEcr-TvE TYPE: peptide (xi) SEQ~E:~OE !vh5~rl1u~: SEQ ID 1~0:23:
Lys Glu Al~ Leu Agp Lys Tyr Glu Leu Glu Asn His Asp (2) . FOR SEQ ID NO:24:
(i) SEQUEIICE CH~'nZ~
(A) LEn~GTEl: 10 a~ino ~cida (3) TYPE: Dmino acid (C) : unkno~n (D) TOPOLOGY: line~r (ii) XOLECl~LE TYPE: peptide (xi ) SEQ~JEIIOE ~ Jn: SEQ ID 2~0: 24:
Asp VJ~1 Glu Asn Ser l~et Leu Gln Al~ Asn (2) . _ POi~ SEQ ID NO:25:
(i) SEQTV'EIICE r~
(A) LEXGTH: 31 ~mino ~cids (B) TYPE: ~mino ~cid (C) ~ : unknown (D) TOPOLOGY: linear (ii) MoLEcrvLE TYPE: peptide (xi) SEQ~E~CE LlrS~ lus~: SEQ ID X0:25:
eu Lys Thr Glu LyE; Ser Asn Leu Glu Arg Lys I'hr Al~ Glu Leu ~hr s 10 15 er Glu Lys Lys Glu }lis Glu Al~ Glu Asn Asp Lys Leu Lys Cys (2) lDIr~ FO~ SEQ ID X0:26:
(i) SEQrVErlCE ~r~
(A) LEI~GTII: 16 ~nino acid~ -(B) TYPE: aminc acid (C) STI~ : unknown (D) TOPOLOGY: linenr (ii) xoLEcr~TvE TYPE: peptide 2 ~ 8~72~

(xi) SBQ~BNCE L~ ,K~ un: SEQ ID NO:26:
}iis Gln Ly~ Leu Glu Glu Gln A~n Lys Thr Ser Glu Ala Ser Arg CY8 (2) lDI~l FOR S~Q ID NO:27:
(i) S~Q~NOE C~
(A) LBNGT~: 300 amino ~ids (B) TYPB: ~ino a~id (C) : unknown (D~ TOPOLOGY: line~r (ii) MDLECOTE TYP~: peptide (xi) SBQI~ENOE L/~;)UKl~llUlY: SE;Q ID NO:27:
!Set Lys Arg V~l Ile Thr Leu Phe Al~ V~1 Leu Leu ~et Gly Trp Ser V~ n Ala Trp Ser Phe Al-l Cys Ly~ Thr Ala Asn Gly Thr Al~ Ile Pro Ile Gly Gly Gly Ser Al~ Asn Val Tyr V~l Asn Leu Ala Pro Ala 35 ~.0 45 VA1 Asn Val Gly Gln A~n Leu Val Val Asp Leu Ser Thr Gln Ile Phe Cy~ Asn Asp Tyr Pro Glu Thr Ile Thr Asp Tyr Val Thr Leu Gln rg Gly Ser Ala Tyr Gly Gly Val Leu Ser A~n Phe Ser Gly Thr Val yE~ Tyr Ser Gly Ser Ser Tyr Pro Phe Pro Thr Thr Ser Glu Thr Pro Arg Val Val Tyr A~n Ser Arg Thr Asp Lys Pro Trp Pro Vz~ Leu Tyr Leu Thr Pro V~l Ser Ser Ala Gly Gly V~l Al~ Ile Ly~ AlJ Gly Ser Leu Ile Al~ Val Leu Ile Leu Arg Gln Thr Asn A~n ~yr Asn Ser E~P Asp Phe Gla Phe V~l Trp A~n Ile Tyr Ala Asn Asn A~p Val Val ~1 Pro Thr Gly Gly Cys Asp Val Ser Al~ Arg Asp Val & Val Thr eu Pro Asp Tyr Pro Gly Ser Val Pro Ile Pro Leu Thr Val Tyr Cys WO 95/20657 2 ~ 8 ~ ~ 2 6 1 ~ I ~ A~_;~l . 1 2 195 200 20s Ala Ly~ Sor Gln Al;~ Leu Gly Tyr Tyr Leu Ser Gly Thr His Ala A~p Al~ Gly Asn Ser Ile Phe Thr Asll Thr Ala Ser Phe Ser Pro Ala Gln 22s 230 235 2~L0 ly Vlll Gly Vnl Gln Leu l~hr Arg A~n Gly Thr Ile Ile Pro Al~ Asn 24s 2s0 255 sn Thr V~l Ser Leu Gly Ala VA1 Gly Thr ger Al~l Val Ser Leu Gly eu Thr Al~ Asn Alc Arg Thr Gly Gly Gln Val Thr Ala G A~n 275 Tyr 280 285 ly al Gln Ser Ile Ile Gly Val Thr Phe V~1 Tyr Gln ~2) ~ FO S3Q ID ~10:28:
(i) SEQUEIICE rp7~o~
~A) LE~IGTH: 300 ~mino ~cid6 (B) TYPB: ~mino ~cid (C) ~ : unicnown (D) TOPOLOGY: line~-(ii) MOLEC~LE TYPE: peptide (xi) SEQUE!ICE WS~C~LlUl~: SEQ ID ~0:2&:
et Ly~ Arg VA1 Ile Thr Leu Phe Ala Val Leu Leu Yot Gly Trp Ser al A~n Ala Trp Ser Phe Ala Cy8 Ly~ Thr Ala Asn Gly mr Ala Ile Pro Ile Gly Gly Gly Ser AlA Asn VA1 Tyr Val Asn Leu Ala Pro Ala 35 ~.0 ~L5 Val Al~n V~1 Gly Gln Asn Leu Val Val Asp Lcu Ser Thr Gln Ile Phe Cy~ Hi~ p Tyr Pro Glu Thr Ile Thr Asp Iyr Val Thr Leu Gln rg Gly Ser A1A Tyr Gly Gly Val LCu Ser Ser Phe Ser Gly Thr VA1 yli Tyr Asn Gly Ser Ser Tyr Pro Phe Pro Thr Thr Scr Glu Thr Pro rg V~l Val Tyr Al;n Ser Arg Thr A~p Ly~ Pro Trp Pro Val Ala L~u 2~7~

Tyr Leu Thr Pro Val Ser Ser A1A Gly Gly Val Ala Ile Lys Ala Gly Ser Leu Ile Ala Val Leu Ile Leu Arg Gln Thr Asn Asn Tyr Asn Ser sp Asp Phe Gln Phe Val Trp Asn Ile Tyr Ala Asn Asn Asp Val Val al Pro Thr Gly Gly Cy8 Asp Val Ser Ala Cys Asp Val Thr Val Thr 180 1a5 190 Leu Pro Asp Tyr Pro Gly Ser V~1 Pro Ile Pro Leu Thr Val Tyr Cys Ala Lys Ser Gln Asn Leu Gly Tyr Tyr Leu Ser Gly Thr ~is Ala Asp Ala Gly Asn Ser Ile Phe Thr Agn Thr Ala Ser Phe Ser Pro Ala Gln ly Val Gly Val Gln Leu Thr Arg Asn Gly Thr Ile Ile Pro Al~ Asn 2~.5 250 255 sn Thr Val Ser Leu Gly Ala Val Gly Thr Ser Ala Val Ser Leu Gly eu Thr Ala Asn Tyr Ala Arg Thr Gly Gly Gln Val Thr Ala Gly Asn al Gln Ser Ile Ile Gly Val Thr Phe Val Tyr Gln (2) lnrl FOR SEQ ID r~0:29:
( i ) SEQ~IENCB ~7~ 4 (A) L31~GTH: 300 amino acids (B) TYP3: amino Acid (C) S~P~ : unknown (D) TOPOLOGY: linear ii) ~0LECIIL3 TYP3: peptide xi) SEQIJENCE IJ~5~ Un: SEQ ID 1i0:29:
et Lys Ar~ Val Ile Thr Leu Phe Alll Val Leu Leu Met Gly Trp Ser al Asn Al~l Trp Ser Phe Ala Cys Lys Thr Ala Asn Gly Thr Ala Ile Pro Ile Gly Gly Gly Ser Ala Asn Val Tyr Val Asn Leu Ala Pro Ala Val Asn Val Gly Gln Asn Leu VA1 Val Asp Leu Ser Thr Gln Ile Phe WO95/20657 2 1 8072~ loo r~l,. ~c~c12 Cys HiD AGn AGP Tyr Pro Glu Thr Ile Thr AGp Tyr Val Thr Leu Gln rg Gly S~r Al~ Tyr Gly Gly Val Leu Ser Ser Phe Ser Glu Thr V~l YG Tyr AGn Gly Ser Ser Tyr Pro Phe Pro Thr Thr Ser Glu Thr Pro Arg VA1 Val Tyr Asn Ser Arg Thr AGp LYG Pro Trp Pro V~l Ala Leu Tyr Leu Thr Pro Val Ser Ser Ala Gly Gly V~l Ala Ile LYG Al~ Gly Ser Leu Ile Al~ V~1 Leu Ile Leu Arg Gln Thr AGn Aan Tyr AGn Ser Gp AGp Phe Gln Phe V~l Trp AGn Ile Tyr Ala AGn Asn AGp Val Val al Pro Thr Gly Gly CYG AGp Val Ser Ala Arg A p Val Thr Val Thr Leu Pro AGP Tyr Pro Gly Ser V~l Pro Ile Pro Leu Thr Val Tyr CYG

Ala LyG Ser Gln AGn Leu Gly Tyr Tyr Leu Ser Gly Thr AGp Al~ AGp Al:~ Gly Asn Ser Ile Phe Thr AGn Thr Ala Ser Phe Ser Pro Al~ Gln ly Val Gly Val Gln Leu Thr Arg AGn Gly Thr Ile Ile Pro Ala AGn Gn Thr V~l Ser Leu Gly Ala Val Gly Thr Ser Ala Val Ser Leu Gly eu Thr Ala AGn Tyr Ala Arg Thr Gly Gly Gln Val Thr Ala Gly Asn 211 Gln Ser Ile Ile Gly V~ll Thr Phe Val Tyr Gln (2) lNrl FOR SEQ ID X0:30:
(i) SEQUENXCE ~T~
(A) LEXGTH: 300 amino ~IcidG
(B) TYPE: amino ~cid (C) : unknown (D) TOPOLOGY: linear ~ii) MOLI~CDLE TYPE: peptide (xi) SEQTJEXCE l~K~ LuN: SEQ ID X0:30:

2 1 8~726 W0 95/~0657 ~ ,'C - C '~

et Lys Arg Val Ile Asn Leu Phe Ala Val Leu Leu r~et Gly Trp Ser al Asn Ala Trp Ser Phe Al~ Cys Lys Thr Ala Asn Gly Thr Ala Ile Pro Ile Gly Gly Gly Ser Ala Asn Val Tyr Val Asn Leu Ala Pro Ala 35 ~0 45 VIL1 Al~n Val Gly Gln His Leu Val VA1 Al;lp Leu Ser Thr Gln Ile Phe Cys His A~n Asp Tyr Pro Glu Thr Ile Thr Asp Tyr Val Thr Leu Gln rg Gly Ser Ala Tyr Gly Gly Val Leu Ser Asn Phe Ser Gly Thr Val ys Tyr Ser Gly Ser Ser Tyr Pro Phe Pro Thr Thr Ser Glu Thr Leu Arg V~l Val Tyr Asn Ser Arg Thr A~p Lys Pro Trp Pro Val Ala Leu Tyr Leu Thr Pro Val Ser Ser Al~ Gly Gly Val Ala Ile Lys Ala Gly 130 135 1~.0 Ser Leu Ile Ala Val Leu Ile Leu Arg Gln Thr Asn Asn Tyr Asn Ser sp Asp Phe Gln Phe Val Trp Asn Ile Tyr Ala Asn Asn Asp Val Val al Pro Thr Gly Gly Cys Al~p Val Ser Ala Arg Asp Val Thr Val Thr Leu Pro A~p Tyr Pro Gly Ser Val Pro Ile Pro Leu Thr Val Tyr Cys Ala Lys Ser Gln Asn Leu Gly Tyr Tyr Leu Ser Gly Thr His Ala Asp Ala Gly Asn Ser Ile Phe Thr Asn Thr Ala Ser Phe Ser Pro Ala Gl~
225 230 235 2~.0 ly Val Gly Val Gln Leu Thr Arg Asn Gly Thr Ile Ile Pro Al~l Asn 2~.5 250 255 sn Thr Val Ser Leu Gly Ala Val Gly Thr Ser Ala Val Ser Leu Gl Leu Thr Ala Asn Tyr Ala Arg Thr Gly Gly Gln Val Thr Ala Gly Asn Val Gln Ser Ile Ile Gly Val Thr Phe Val Tyr Gln (2) . FOR SBQ ID NO:31:

6~7 2 1 8 ~ / ~ 6 PCTIDK95/00042 i ) SEQllENOE ~ L L~:~:
(A) LENGTH: 296 ~ino 7Lcids (B) TYPE: Alnino ~cid (C) sr, : unknown (D) TOPOIOGY: linenr (ii) MOLEWLE TYPE: peptide (xi) SEQUENCE L/~ ~LrLLuc-: SEQ ID NO:31:
et Lys Arg V~l Ile Thr Leu Phe Ala Val Leu Leu Met Gly Trp Ser al A8L A1A Trp Ser Phe Ala Cy8 LyS Thr Ala Asn Gly Thr A17L Ile Pro Ile Gly Gly Gly Ser Alzl Asn Val Tyr Val Asn Leu A1A Pro Ala 35 40 ~15 Val Asn VA1 Gly Gln Asn Leu Val Val Asp Leu Ser Thr Gln Ile Phe Cys His Asn Agp Tyr Pro Glu Thr Ile Thr Asp Tyr Val Thr Leu Gln rg Gly Ser Ala Tyr Gly Gly Val Leu ger Asn Phe Ser Gly Thr Val ys Tyr Ser Gly Ser Ser Tyr Pro Phe Pro Thr Thr Ser Glu Thr Pro Arg V~l VA1 Tyr Asn Ser Ars Thr Asp Lys Pro Trp Pro Val Ala Leu Tyr Leu Thr Pro VA1 Ser Ser Ala Gly Lys Ala Gly Ser Leu Ile Ala V~ll Leu Ile Leu Arg Gln Thr A~n Asn Tyr Asn Ser A~p Asp Phe Gln lq5 150 155 160 he VA1 Trp Asn rle Tyr Ala Asn Asn Asp Val V~l V~l Pro Thr Gly ly Cys Asp VA1 Ser Ala Arg Asp Val Thr Val Thr Leu Pro Asp Tyr Pro Gly Ser V~l Pro Ile Pro Leu Thr V~ll Tyr Cys A1A Lys Ser Gln Asn Leu Gly Tyr Tyr Leu Ser Gly Thr His Ala Asp Ala Gly Asn Ser Ile Phe Thr Asn Thr Ala Ser Phe Ser Pro Al~ Gln Gly V~l Gly Val 225 230 235 2~.0 Gln Leu Thr Arg Acm Gly Thr Ile Ile Pro Ali~ A~n Asn Thr V~ll Ser

7 2 ~ 2 ~ F~ [ ''~

eu Gly Ala Val Gly Thr Ser Ala VA1 Ser Leu Gly Leu Thr Ala Asn yr Ala Arg Thr Gly Gly Gln Val Thr Ala Gly Asn V~l Gln Ser Ile Ile Gly Val Thr Phe Val Tyr Gln (2) ~c.~. LU~11 POR SEQ ID NO:32:
~i) SEQ81ENOE ~
(A) LENGTH: 300 amino acids (B) TYPB: a ~lino clcid (C) :, : unknown (D) TOPOLOGY: line~r (ii) MOLBCaLB TYPE: peptide (xi) SEQaBNOE L~o~ UN: SBQ ID NO:32:
et Ly6 Arg Val Ile Thr Lcu Phe Al~ Val Leu Leu Met Gly Trp Ser al Asn Ala Trp Ser Phe Ala Cya Ly6 Thr Ala Aan Gly Thr Ala Ile Pro Ile Gly Gly Gly Ser Ala A6n Val Tyr V~l Asn Leu Ala Pro Val 35 ~0 45 Val Asn Val Gly Gln Asn Leu Val Val A6p Leu Ser Thr Gln Ile Phe Cys Hi6 Asn Asp Tyr Pro Glu Thr Ile Thr Asp Tyr Val Thr Arg Gln rg Gly Ser Al~ Tyr Gly Gly Val Leu Ser Asn Phe Ser Gly Thr Val ys Tyr Ser Gly Ser Ser Tyr Pro Phe Pro Thr Thr Ser Glu Thr Pro Arg Val Val Tyr Asn Ser Arg Thr Asp Lys Pro Trp Pro Val Ala Leu Tyr Leu Thr Pro V~l Ser Ser Al~ Gly Gly Val Al~ Ile Ly6 A1A Gly Ser Leu Ile Ala Val Leu Ile Leu Arg Gln Thr Asn Asn A6n Ser 145 150 155 Tyr 160 Asp Asp Phe Gln Phe Val Trp A8n Ile Tyr Ala Asll A6n A6p Val Val WO 9~/20657 2 t ~ ~ 7 ~ 6 PCT/DK95/00042 al Pro Thr Gly Gly Cys Asp Val Ser Ala Arg Agp Val Thr VA1 Thr Leu Pro A~p Tyr Pro Gly Ser Val Pro Ile Pro Lou Thr Val Tyr Cy8 Ala Ly~ Ser Gln Asn Leu Gly Iyr Tyr Leu Ser Gly Thr Hil; Ala Asp Ala Gly AGn Ser Ile Phe 7~hr Asn Thr Ala Ser Ph~ Ser Pro Ala Gln ly VA1 Gly V~l Gln Leu Thr Ary Asn Gly Thr Ile Ile Pro Ala Asn sn Thr Val Ser Leu Gly ;~1A Val Gly Thr S~r Ala V~I1 Ser LQu Gly eu Thr Ala Asn Tyr Ala Arg Thr Gly Gly Gln V~l Thr Ala Gly Asn 275 2ao 285 ~l Gln Ser Ile Ile Gly Val Thr Phe Val Tyr Gln (2) . FO.~ SEQ ID NO:33:
(i) SEQI~ENCE ~7'0~ " Y:
(A) LENGTH: 300 amino z.cids (B) TYPE: amino Acid (C) ST-~ : unknown (D) TOPOLCGY: linear (ii) ~5OLECIJLE TYPE: peptidQ
(xi) SEQTlENCE L)~Yu~l~uN: SEQ ID NO:33:
5et Ly~ Arg Val Ile Asn Leu Phe Ala Val Leu Leu 15et Gly ~rp Ser ~l Asn Al~ Trp Ser Phe Al~ Cy~ Ly~ Thr ~lc Asn Gly Thr Al~ Ile Pro Ile Gly Gly Gly Ser Ala Asn V~l Tyr Val Asn Leu Al~ Pro Ala 3~ 40 45 V~l AGn V~l Gly Gln Asn keu V~l Val Asp I.eu 9er Thr Gln Ile Phe Cy~ Hi~ Asn Asp Tyr Pro Glu Thr Ile Thr Asp 7yr V~ll Thr Leu Gln rg Gly Ser Ala Tyr Gly Gly Val Leu Ser Asn Phe Ser Gly Thr V~l y~ Tyr Ser Gly SQr Ser Tyr Pro Phe Pro Thr Thr Ser Glu Thr Pro . _ _ _ _ . _ _ . _ _ . . . _ _ . . _ _ ~ WO95/20657 2 1 ~ b F~
Arg Va1 Val Tyr Asn Ser Arg Thr Agp Lyg Pro Trp Pro VA1 A1a Leu ~yr Leu Thr Pro Val Ser Ser Ala Gly Gly V~l Val Ile Lys Ala Gly Ser Leu Ile Ala Val Leu Ile Leu Arg Gln Thr Asn Asn Tyr Asn Ser sp Asp Phe Gln Phe Val Trp Asn Ile Tyr Ala Asn Asn Asp V~l Val ~l Pro Thr Gly Gly Cys Asp Val Ser Al~ Arg Asp Val Thr Val Thr Leu Pro Asp Tyr Pro Gly Ser Val Pro Ile Pro Leu Thr Val Tyr Cys Al~ Ly~ Ser Gln A~n Leu Gly Tyr Iyr Leu Ser Gly Thr }lis Ala Asp Al~ Gly Asn Ser Ile Phe Thr Agn Thr Ala Ser Phe Ser Pro Ala Gln ly VA1 Gly Val Gln Leu Thr Arg Asn Gly Thr Ile Ile Pro Ala A~n 2~5 250 255 sn Thr Va1 Ser Leu Gly Ala Val Gly Thr Ser Ala Val Ser Leu Gly eu Thr Ala Asn Iyr Ala Arg Thr Gly Gly Gln Val Thr Ala Gly Asn al Gln Ser Ile Ile Gly Val Thr Phe Val Tyr Gln (2) . lUN FOR SBQ ID ~0:34:
( i ) SEQUBNCE ~7~ r -~:
(A) LBNGTH: 300 z~ino acids (B) TYPE: a~ino acid (C~ r ~~ : unknown (D) TOPOLOGY: line~r ii) MOLECaLE TYPE: peptide xi) SBQ~ENCE ~ LlUCi: SBQ ID NO:34:
et Lys Arg Val Ile Thr Leu Phe Ala Val Leu Leu ~!5et Gly Trp Ser al Asn Ala Trp Ser Phe Ala Cys Lys Thr Ala Asn Gly Thr Ala Ile ro Ile Gly Gly Gly Ser Ala A~n Val Tyr Val Asn Leu Ala Pro Ala ~.0 45 WO95l20657 2 ~ ~726 i~ 12 VA1 Asn V~l Gly Gln Asn Leu V~l Val Asp Leu Ser Thr Gln Ile Phe Cys Hi~ Alin A~3p Tyr Pro Glu Thr Ile Thr Asp Tyr Val Thr Leu Gln rg Gly Ser Ala Tyr Gly Gly Val Leu Ser Ser Phe Ser Gly Thr Val ys Tyr Asn Gly Ser Ser Pro Phe Pro Thr Thr Ser Glu Thr Pro 100 Tyr 105 110 Arg Val V~l Tyr Asn Ser Arg Thr Asp Lys Pro Trp Pro VA1 Al~l Leu Tyr Leu Thr Pro VA-1 Ser Ser Ala Gly Gly Val Ala Ile Lys Ala Gly Ser Leu Ile Ala Vell Leu Ile Leu Arg Gln Thr Asn Asn Tyr A~n Ser 1~.5 150 155 160 sp Asp Phe Gln Phe Val Trp Asn Ile Tyr A1A- Asn Asn Al~p Val V~l ~l Pro Thr Gly Gly Cys Asp V~l Scr A1A- Arg Asp V~l Thr V~I1 mr 180 las 190 Leu Pro Asp Tyr Pro Gly Ser VA1 Pro Ile Pro Leu Thr V~l Tyr Cys A1A Ly~ Ser Gln Asn Leu Gly Leu Ser Gly Thr His Ala Asp 210 Tyr Tyr 220 A1A Gly Asn Ser Ile Phe Thr Asn Thr Ala Ser Phe Ser Pro Al~ Gln 225 230 23S 2i0 ly Val Gly V~l Gln Leu Thr Arg Asn Gly Thr Ile Ile Pro Ala Asn sn mr V~l Ser Leu Gly Ala Val Gly Thr Ser A1A- V~l Ser Leu Gl eu Thr Ala Alin Tyr A1A- Arg Thr Gly Gly Gln Val Thr Ala Gly Asn al Gln Ser Ile Ile Gly V~l Thr Phe V~l Tyr Gln (2) l~rl FOR S~Q ID NO:35:
(i) S13Q~NCB r'~ l '`Ll~
(A) LENGTEI: 300 amino Acids (B) TYPB: amino acid (C~ r ~~ : unlcnol~n (D) TOPOLOGY: line~r (ii) ~LECI~LB TYP~: peptide W0 95l206S7 2 1 ~ ~ 7 2 6 r~

(xi~ SEQ~ENCE L~15S~~ SEQ ID ~0:35:
et Ly~ Arg Val Ile Thr Leu Phe Ala VA1 Leu Leu Met Gly Trp Ser al Asn Ala Trp Ser Phe Ala Cy~ Lyl; Thr Ala A6n Gly Thr Ala Ile Pro Ile Gly Gly Gly Ser Ala Asn Val Tyr Val Asn Leu Ala Pro Ala VA1 A6n VA1 Gly Gln A6n Leu Val V~l Asp Leu Ser Thr Gln Ile Phe Cy6 His A6n A6p Tyr Pro Glu Thr Ilo Thr A6p Tyr Val Thr Leu G1L

rg Gly Ser Ala Tyr Gly Gly Val Lou Ser A6n Phe Ser Gly Thr Val y6 Tyr Ser Gly Ser Ser Tyr Pro Phe Pro Thr Thr Ser Glu Thr Pro Arg Val Val Tyr A6n Ser Arg Thr A~p Ly6 Pro Trp Pro V~l Ala Leu Tyr Leu Thr Pro V~l Ser Ser A1A Gly Gly V~l Al~ Ile Ly6 Ala Gly Ser Leu Ile Ala V~l Leu Ile Leu Arg Gln Thr A6n Asn Tyr Asn Ser 6p Asp Phe Gln Phe VA1 Trp A6n Ile Tyr Ala A6n Asn Asp Val Val ~l Pro Thr Gly Gly Cy~ A6p Val S~r Ala Hi6 Asp Val Thr VA1 Thr Leu Pro Asp Tyr Pro Gly Ser Val Pro Ile Pro Leu Thr V~l Tyr Cy8 Al~ Ly6 Ser Gln A6n Leu Gly Tyr Tyr Leu Ser Gly Thr ~li6 Al~ A6p Ala Gly A6n Ser Ile Phe Thr Asr, Thr Al~ Ser Phe Ser Pro Ala Gln 225 230 235 2~.0 ly Val Gly Val Gln Leu Thr Arg Asn Gly Thr Ile Ile Pro Ala Asn sn Thr Val Ser Leu Gly ALI Val Gly Thr Ser Ala Val Ser Leu Gly Leu & Ala Asn Tyr A1A Arg Thr Gly Gly Gln Val Thr Ala Gly A6n Val Gln Ser Ile Ile Gly VA1 Thr Phe Val Tyr Gln WO 95/20657 2 ~ 8 Q 7 ~ 6 P_11. ~ ~ n ~ ~2 loa (2) . lUL~ FOR SEQ ID NO:36:
(i) SBQIIEXCE rP~ llW:
(A) LE~GTE~: 300 a~ino acids (B~ TYPE: amino acid (C) ~ : unkno in (D) TOPOLOGY: li~ear (ii) ~OLEC~ILE TYPE: peptide (xi) SBQIJEI~OE Ll~;,C~lOU~: SEQ }D 110:36:
et Lys Arg Val Ile Thr Leu Phe Ala Val Leu LQU ~let Gly Trp Ser s 10 15 al Asn Ala Trp Sor Ph~ Ala cys Lys Thr Ala Asn Gly mr Ala Ile Pro Ile Gly Gly Gly Ser Ala Asn Val Tyr Val Asn Leu Al~ Pro Ala Val Asn Val Gly Gln A~n I,eu Val Val Asp Leu Ser Thr Gln Ile Phe Cy5 }~i8 Asn Asp Tyr Pro Glu Thr }le Thr Asp Val Thr Leu Gln 65 70 Tyr 80 rg Gly Ser Ala Tyr Gly Gly Val Leu Ser Asn Phe Ser Gly ~r Val ys Tyr Ser Gly Ser Ser Tyr Pro Phe Pro Thr Thr Ser Glu mr Pro Arg Val Val Tyr AEm Ser Arg Thr Asp Ly~3 Pro Trp Pro Val Ala Ar Tyr Leu Thr Pro Val Ser Ser Ala Gly Gly Val Ala Ile Lys Ala Gly Ser Leu Ile Ala V~l Leu Ile Leu Arg Gln Thr Asn Asn A~m Ser 145 150 155 Tyr 160 lp A5p Phe Gln Phe Val Trp A~n Ile Tyr Ala Asn Asn A5p V~l Val A1 Pro Thr Gly Gly Cy~ Asp Vnl Ser Ala Arg A~p Val Thr Val Thr Leu Pro Asp Tyr Pro Gly Ser V~l Pro Ile Pro Leu Thr Val Tyr Cy5 Ala Ly~ Ser Gln Asn Leu Gly Tyr Tyr Leu Ser Gly Thr ~ Ala A~p WO 95l20657 2 i ~ ~ 7 2 6 r~ 5 ~ - ~

Ala Gly Asn Ser Ile Phe Thr Asn Thr Al~ Ser Phe Ser Pro Al~l Gln 22~ 230 235 240 Gly Val Gly VA1 Gln Leu Thr Arg Asn Gly Thr Ile Ile Pro Ala Asn Asn Thr Yal Ser Leu Gly A1A V~l Gly Thr Ser Ala Val Ser Leu Gly Leu Thr Ala AB3 Tyr Ala Arg Thr Gly Gly Gln V~l Thr Ala Gly Asn 275 2B0 2&5 Val Gln Ser Ile Ile Gly VA1 Thr Phe Val Tyr Gln (2) . l~JN FOR SEQ ID NO:37:
(i) SEQUENCE ~ '`r~ , r ~1 ~i I 11 '~
(A) LENGTH: 300 a~ino acids (B) TYPE: amino ~cid (C) ~- : single (D) TOPOLOGY: linear (ii) MOLECl~LE TYPE: peptide (xi) SEQUENCE ~S~ 1JW: S~Q ID NO:37:
Met Lys Arg Val Ile Thr Leu Phe Al~ V~ll Leu Leu Met Gly Trp Ser Val Asn Ala Trp Ser Phe Ala Cys Lys Thr Al~ Asn Gly Thr A1A Ile Pro Ile Gly Gly Gly Ser Ala As~ Val Tyr V~I1 Asn Leu Ala Pro Ala 35 40 i5 Val A~n VA1 Gly G1~ Asn Leu V~l Val Ar~p Leu Ser mr Gln Ile Phe Cys His Asn ABP Tyr Pro Glu Thr Ile Thr ABP Tyr Val Thr Leu Gln Arg Gly Ser Al~ Tyr Gly Gly V~ll Leu Ser Asn Phe Ser Gly Thr V~l a5 90 95 Ly~ Tyr Ser Gly Ser Ser Tyr Pro Phe Pro Thr Thr Ser Glu Thr Pro Arg V~l Val Tyr Asn Ser Arg Thr Asp Lys Pro Trp Pro Val Ala Leu Tyr Leu Thr Pro Val Ser Ser Dla Gly Gly Val Al~ Ile Lys Ala Gly 130 135 liO
Ser Leu Ile Ala Val Leu Ile Leu Arg Gln Thr Asn Asn Tyr Asn Ser lg5 150 155 160 WO 95/20657 2 ~ 8 ~ 7 ~ ~ T~~ 't ~ '~ ~

sp Asp Phe Gln Phe Val Trp Asn Ile Tyr Ala Asn Asn Asp Val Val al Pro Thr Gly Gly cyg Asp Val Ser Al~ Hio A~p Vnl Thr V~l Thr Leu Pro Asp Tyr Pro Gly Ser V~l Pro Ile Pro Leu Thr V~l Tyr Cys Ala Lys Ser Gln Asn Leu Gly Tyr ~yr Leu Ser Gly Thr Nis Al~ Asp Al~ Gly Asn Ser Ile Phe Thr Agn Thr Ala Ser Phe Ser Pro Al~ Gln ly V~l Gly V~l Gln Leu Thr Arg Asn Gly Thr Ile Ile Pro Al~- Asn sn Thr V~l Ser Leu Gly Ala Val Gly Thr Ser Al~ Val Ser Leu Gly eu Thr Ala Asn Tyr Ala Arg Thr Gly Gly Gln V~1 Thr A1A Gly Asn ~1 Gln Ser Ile Ile Gly VA1 Thr Phe Vnl Tyr Gln ( 2 ) ~ FO~ SBQ ID NO: 3 8:
i ) SEQ~IEXOE rT~
(A) LENGTN: 300 a~ino acids (B) TYPE: ~mino ~d (C) :. : un}~no~ n (D) TOPOLOGY: linenr ii) MDLBC;~LE TYPE: peptide xi) SEQ~E~CE ~l~ J~: SEQ ID NO:38:
et Lys Arg Val Ile Thr Leu Phe Al~ Val Leu Leu Met Gly Trp Ser A1 Agn Aln Trp Ser Phe Ala cyg LYB Thr Ala Asn Gly Thr AlA Ile Pro Ile Gly Gly Gly Ser Ala Asn Val Tyr Val Asn Leu Al~ Pro Aln Val Asn Val Gly Gln Asn ;ieu Val Val Asp Leu Ser T~r Gln Ile Phe CYB Ni~ Asn Asp Tyr Pro Glu Thr Ile Thr Asp Tyr Val Thr Leu Gln Arg Gly Ser Ala Tyr Gly Gly Val Leu Ser Asn Phe Ser Gly Thr V~l WO 95no657 2 1 ~ 0 7 2 6 PCT/D~ .. J2 yEi Tyr Ser Gly S~r Ser Tyr Pro Phe Pro Thr Thr S~r Glu Thr Pro Arg Val Val Tyr Asn Ser Ars Thr Alip LYD Pro Trp Pro Vàl Ala Leu Tyr Leu Thr Pro Val Ser Ser Ala Gly Gly Val Ala Ile Lys Ala Gly Ser Leu Ile Ala Val Leu Ile Leu Arg Gln Thr Asn Asn Tyr Asn Ser sp Asp Phe Gln Phe Val Trp A~n }le Tyr Ala Asn Asn Asp Val Val al Pro Thr Gly Gly Cys A~ip V~l Ser Ala ~i8 AGP Val Thr Val Thr 180 la5 190 Leu Pro Asp Tyr Pro Gly Ser V~l iro Ile Pro Leu Thr Val Tyr CYB

Ala Ly~ Ser Gln Al~n Leu Gly Tyr Tyr Leu Ser Gly Thr ~is Ala Asp Ala Gly A~n Ser Ile Phe Thr A~n Thr Ala Ser Phe Ser Pro Ala Gln ly Val Gly Val Gln Leu Thr Arg Asn Gly Thr Ile Ile Pro Ala Asn 2~5 250 255 ~n Thr Val Ser Leu Gly Ala Val Gly Thr Ser Ala Val Ser Leu Gly eu Thr Ala Asn Tyr Al~ Arg Thr Gly Gly Gln Val Thr Ala Gly Asn al Gln Ser Ile Ile Gly Val Thr Phe Val Tyr Gln (2) lNr~ FOR SBQ ID NO:39:
(i) S~QDBNOE ~ oD. ,,~ "1.,;
(A) LBNGTH: 300 amino acid~
(B) TYPE: amino acid ~C) 5~D : unkno in (D) TOPOLOGY: line r (ii) MOLBCOLB TYPB: peptide -(xi) SBQUBNOE Ur:~Kl~LlUL~: SBQ ID NO:39:
Met Lys Arg Val Ile Thr Leu Phe Ala Val Leu Leu Met Gly Trp Ser Val Asn Ala Trp Ser Phe Ala Cys Ly~ Thr Ala A~n Gly Thr Ala Ile 2 ~ $~7?6 WO 95/206~7 1 ~ '7 Pro Ile Gly Gly Gly Ser Ala ADn Val Tyr V~l Asn Leu Ala Pro Ala Vill Asn Val Gly Gln ADn Leu Val Val ADP Leu Ser mr Gln Ile Phe Cys His Asn ADP Tyr Pro Glu Thr Ile Thr Asp Tyr Val Thr Leu Gln rg Gly Ser Ala Tyr Gly Gly Val Leu Ser Ser Phe Ser Gly mr Val ys Tyr Asn Gly Ser Ser Tyr Pro Phe Pro Thr Thr Ser Glu Thr Pro Arg Val Val Tyr Al~n Ser Arg Thr Asp Lys Pro Trp Pro Val Ala Leu Tyr Leu Thr Pro Val Ser Ser Ala Giy Gly Val Ala Ile Lys Ala Gly Ser Leu Ile Ala Val ~eu Ile Leu Arg Gln Thr Asn A~n Tyr Asn Ser 8p Asp Phe Gln Phe Val Trp Asn Ile Tyr Ala Asn Asn Asp V~ll Val ~l Pro Thr Gly Gly ~ys Asp Ala Ser Ala Arg A~p Val Thr Val Thr lao las 190 Leu Pro Asp Tyr Pro ~ly Ser Val Pro Ile Pro Leu Thr Val Tyr Cys Ala Lys Ser Gln Asn Leu Gly Tyr Tyr Leu Ser Gly Thr His Ala Asp Ala Gly Asn Ser Ile Phe Thr A~n Thr Ala Ser Phe Ser Pro Ala Gln 22s 230 235 240 ly Val Gly Val Gln Leu Thr Arg Asn Gly Thr Ile Ilc Pro Ala ADn sn Thr Val Ser Leu 51y Ala Val Gly Thr Ser Ala val Ser Leu Gly eu Thr Ala Asn Tyr .~la Arg Thr Gly Gly Gln V~l Thr Ala Gly Ailr~
275 2a0 285 al Gln Ser Ile Ile Gly ~ral Thr Phe Val Tyr Gln (2) l~r~ FO.~ SEQ ID X0:40:
( i ) SEQ~NCB rY~
(A) LBXGTH: 300 ~mino acid~
(B) TYPB: a~ino ~cid (C) sr~ ~: unlcnown (D) TOPOLOGY: linear 2~726 WO 95/20657 . ~ ~ . 12 (ii) I~OL~WIE TYPE: peptide (xi) SEQ~NCE ~ UW: SEQ m 170:~0:
!let Lys Arg Val Ile Thr Leu Phe Ala Val Leu Leu ~et Gly Trp Ser al Asn Ala Trp Ser Phe Ala Cys Ly~ Thr Ala Asn Gly Thr Ala Ile Pro Ile Gly Gly Gly Ser Ala Asn V~l Tyr V~l Asn Leu Ala Pro Ala 35 ~.0 45 Val Asn Val Gly Gln Alm Leu Val Val Asp Leu Ser Thr Gln Ile Phe Cy~ His Asn Asp Tyr Pro Glu Thr Ile Thr Asp ~yr Val Thr Lcu Gln rg Gly Ser A1A Tyr Gly Asp VA1 Leu Ser Ser Phe Ser Gly Thr Val YB Tyr Asn Gly Ser Ser Tyr Pro Phe Pro Thr Thr Ser Glu Thr Pro Arg Val Val Tyr A2~n Ser Arg Thr Al~p Ly~ Pro Trp Pro Val Ala Leu Tyr Leu Thr Pro Val Ser Ser Ala Gly Gly Val Ala Ile Ly~ Ala Gly Ser Leu Ile Al~ VA1 Leu Ile Leu Arg Gln Thr Asn Asn Tyr Asn Ser ~p Asp Phe Gln Phe VA1 Trp Asn Ile Tyr Al~ A~n Asn Al3p Val Val al Pro Thr Gly Gly Cys Asp Al~ Ser Ala Arg A~p Val Thr V~l Thr lB0 185 190 Leu Pro Asp Tyr Pro Gly Scr V~l Pro Ile Pro Leu Thr Val Tyr Cy~

Ala Ly~ Ser Gln A~n Leu Gly Tyr Tyr Leu Ser Gly Thr Hi~ Ala Asp Ala Gly A~n Ser Ile Phe Thr A3n Thr Ala Ser Phe Ser Pro Ala Gln ly Val Gly Val Gln Leu Thr Arg A~n Gly Thr Ile Ile Pro Ala Asn sn Thr Val S~r Leu Gly Al~ VA1 Gly Thr Ser Ala Val Ser Leu Gly eu Thr Al~ Asn Tyr Al~ Arg Thr Gly Gly Gln V71 Thr Ala Gly Asn 2 ~ 6 WO95/20657 1~1, _~,[Lt'~
lli Val Glrl Ser }le Ile Gly V7l1 Thr Phe Val Tyr Gln (2 ) ll J __ llUN PO R SEQ ID NO 41 (i) SEQIJENC~ rT'7`0D
(A) LENGTH 900 base pAirs (B) TYPE nucleic Icid (C): ~ingle (D) TOPOLOGY linoAr (ii) ~OIECCILE TYPE DNA (gencmic) (xi) SEQ~NCE ~~ ~llUN SEQ }D NO 41 DTr7 ~rr~ ~-- TTATTACCCT ~lL1~7~-L~ 1~L1~7 ~-1~71~ l D'`rTrrrTr~G 60 L~ ~7~-1 r~TD7 7~7~cr~r rD~Trr,TDr~r . ~ _ l .. l.( l.l.. li rDr~,rrr~T 120 GTTTATGTAA ACCTTGCGCC ~rr,TrrTr~ T rTrrrrrr7r ACCTGGTCGT ~r~lll., 180 ACGCAAATCT TTTGCCADiA ~11~1~ GADACCATTA rD~`~TrT~rT CA~ACTGCA ~ 240 CGAGGCTCGG ~1.T~u~ ~ 711~ DATTTTTCCG r~~~rrTD ~r DTDTDr~rr~r 300 DrTDrrTDTC ~ ~C rDrrDrrr~r Drr7~rcGrrrr TTrTTTDTrr TTrr~ rrG 360 r~TD7~~,rrT 17 1 l l 1 ~ Drrr~rTrTrD GrDrTrrrrr ~ ,, 420 DTTD~7'~rTrJ r,rTrDTTrrT '~ J~ 7~11 ATTTTGCGAC D~~~rrrrDr rTDTD7~Dnr 480 ~T~A111~ A~Gl~rTGTGTG GAZTATTTAC G~rrD~TD~Tr ~ (;, nrrTDrTrnr 540 7 111~ 7 Tr~Tr,TrDrr GTTACTCTGC rr~~TDrrr TGGTTCAGTG 600 CCAATTCCTC TTACCGmA TT~;Tr,,rr~r Dn,rrD~7~~r ~ 660 DrDrDrr,rDr DTr,rrr.t:rD1~ ~Llll~ DrrDlTDrrn ~71.71111i DrrTr7rDrDr 720 ~ wu7 ~GTTG7AC r~rr7rD7rr,rT Drr~TTDTTc rDrr~~Tr7 rDrrrTDTrn 780 TTAGGAGC~G TAr~CTTC ~7 - CTGGGATTAA CGGCAAATTA TnrDrrTrrr 840 r~~~~GrDrr Tr~~TrrDr~, C''~Tr7TrrD7` ~11~1~7 GCGTGACm TGTTTATCDA 900 (2) lN~ ~ FOR SEQ XD N-0 42 (i) SEQ~ENCE rT~r~r - ~
(A) LEN--GTH 900 b~e p~irs (B) TYPE nucleic ~cid (C) ~ ~ingle (D) TOPOLOGY li e~r 21~7~6 WO 95/20657 P~

( i i ) ~OLBCtlLB r-7pB DN-A ( genci c ) (xi) SBQ~lBNCE l8~D~LLJN SBQ ID NO 42 ATr 77~~r~~ TTATTACCCT vLL-vLLuL ~ ~Lv~-L~,L~ v~luvLLvV~ TrrrTGr 60 L~LLLVL~L r~TA7~r~rrr~c rA'`TGrTDrC GCAATCCCTA 'LLVVLVVL~ rAnrrcrr~T 120 GTTTATGTAA ACCTTGCGCC TrvrcGTr~ T rTrrrr,rA~ ACCTGGTCGT AVA1~LLL~V 180 ACGCA~ATCT TTTGCCATAA CGATTACCCA GAAACCATTA rAr""TDTrT rArr~-rrrA ~ 240 CGAGGTTCGG ~ vLuLL L~-L AGTmTCCG C-~-rrTA~7 DT~TA7~Trr, 300 AGTAGCTATC CTTTCCCTAC TrrrArr~r7~ Arr,rr~,rrr~, TTGTTTAT~A TTrr~ -r 360 ~~TArrrrr~r ,, l la ,vl l v~-LLl, lLLv ArrrC~rT~~ r7l Al~lvl,, ,; C-- ~rTrr,rr, 420 ATTAZAGCTG GCTCATTAAT 'LVL~VLU~LL ATTTTGcrvAc ~r~-rArrDAr rT~TArrAnr 480 vA-vJ lLlLL AGmGTGTG GAATATTTAC rirCArTDA _ ~ v~ ;v~ GCCCACTGGC 540 v LLL.LV~.~V Tr T~TrrrC v~L ~L~LuL ~r - T7` cr LVVLl~LV 600 LC~.L~-LL TTACCGmA TTGTGCGAAA Pncrr~ rrc LUVVVL~LL ~ ~-L~L.CvvC 660 -ArArDrrrAn ATGCGGGCAA ~L~v,~llL~ Prr~r~TArn ~,vl~Vllll~ ArrrGrnrDn 720 VV VL~VV~V TACAGTTvAC r,r~jrA \rrrT ACGATTATTC rArrr~rTDr CACGGTATCG 780 TTAGGAGCAG TAGGnAcTTc r~r~rr~TD7~rT CTGGGATTAA CGGCAAATTA crrPrGTPrr 840 r~r7_~r rArr~ T~r,rPrr r~ TrTrrP~ L~ VAll~lLV GCGTGACTTT TGTTTATCAA 900 (2) FOR SEQ ID N-0 43 (i) SBQ~BNCB rTTr~ - ~ 4Ll~D
~A) LBN-GT~ 900 ~se pAir~
~B) rypE nucleic ~Icid (C) ! ~i3gle (D) TOPOLOGY 1ine~r (ii) ~!50L~CtlLB rL'PB DN-A (geno~ic) -(xi) SEQI~BNCE LIL~DL~Ll~ SBQ ID NO 43 r~ 7rr~- TTATTACCCT vlllu~ lulA~ i - v~ ~;;, P~T~rrTr,r, 60 l~ll~V~L r~TD7~ rrr~c rP7~TrrTPrr GCAATCCCTA LlVVLVVLVV rPrrnrrr7~T 120 GTTTATGTAA PrrTTr7rr~rc ~Grrr-T-~l~T r-Tr-r~r~r-r7`~'` ACCTGGTCGT AGATcTrTcG 180 ACGCAAATCT TTTvCCATAA CGATTACCCA r'`7`''rrPTTP rr-"-TPTr,T rDrDr-rr CD 240 _ _ _ _ _ _ _ _ . . . . . . .

2~Q7~6 WO 9sl206s7 PCT/DK95/00042 ~1i~7LL~W ~LL~ L~jLLL-~7 L~jLULL~L~L AGTmTCCG r~r~"rrT;~ aTDTD~Trr~ 300 D.~ ~-LLL~L L~C TDrrDrrr~7~ Drrrrr~rrrr. TTGTTTATAA TTrr~ rn 360 rDTD rrrrT ~ (;17l~71,l 7~LLL LLLU DrrrCGr7Tr~ r,rDr.Tr.~rrrr. rr~ Tr,~rr. 420 ATTA,DaGCTG GCTCATTAAT L~jL~7L~S~LL ATTTTGCGAC D~ rrD-~r~ rTDTD7`rDr~ 480 LU~LLL~ AGTTTGTGTG GAaTATITAC r~rrD~TD'`T~7 ~LULU7LUUL r,rrr~rTrr.r 540 U ~L1~-LU~-L~7 Tr~Tr~TrDrr GTTACTCTGC rr~ TDrr,r Trr.TTrDr.Tr. 600 L~LL~L~ 1L~ L~LLL~ TTûTGCGAaA DnrrD rr LU~7L~LL I I ~ 660 ~rDrDTrrDr DTrrrrr,rDD ~L~ ~ LLLL- Drr7~DTDrrr ~;7~ULLLL~ ~rrrnrr.rDr. 720 WL-7L~W~ TACAr,TT~7AC r,rl-rD~rGr~T ACGATTATTC rDnrr~ TD~ rDrrr.TDTrc 780 TTDrr.Dr.rDr. TAG~ACTTC r,G~rrGTr~ T CTGGUATT~DA CWcAaATTA TrrDrrT~rr 840 r"`""""Drr~ Tr`~TGrDr~U r~Tr,Tr~r7~D L~LL~LLU GCGTGACTTT TGTTTATCaA 9oo (2) 1L~r~ FOR SBQ ID NO:44 (i) SEQ~ENOE rr~ y (A) ILNGT}I: 9oo b~r e p~irr~
(B) TYPE: nucl~ic ~cid (C) STrlr : siLgle (D) TOPOLOGY: lirlear (ii~ k~LEC~E TYP--: DNA (genoric) (xi) SEQ~ENOE lJhaL~Llur~: ShQ ID NO 44 DTr-~ rr~ TTATTACCCT ~7LLLU~LUL~ ~LU~-L~ShLUU U~LUUL~7L AaATGCCTGu 60 L~LL~7L~-L r~TD7~1Drrrr, rDDTGrTDrr 7~L~ L~L~L ~ LLU~7~X7LU7 rDr~rr,rr~7~T 120 GTTTATGTAA ACCTTGCGCC Tr,~rrr.Tr"~T rTrGrr~r~ DrrTrrTrrT ~ L~LLL~U 180 AcGcAaATcT TTTGCCATAA CGaTTACCCG GADACCATTA rD"'`~T~Tr.T rDrDrTr,rD7~ 240 ~1iA~7LL~7 ~L~IU~7LW LULUL1~LL~L AGTmTccG D~`"r~r,TD7~1~ DTDTDDTrrr 300 AGTAGCTATC ~-LLL~L~L~c T1~rrDr~rr-~ Drr.rrrrrr~: TTGTTTATAA TTCûAEaACû 360 r~T~ rr,T ~ LLL"LLL~j prrrrTr.Tr~ r,rDr.Tr.rrrr. rrr~ Trr~c~r7 420 ATTAaAGCTG GCTCATTAAT LULLULULlL ATmGCGAC ~ rD7~rD~ rTDTDDrDrr 480 w~L~LLl~L Ar7TTTGTGTc7 GAaTATTTAC GCCD,ATAATG i~IUl~i~7lU~7l Gc~rrDrTr~7r 540 ~j~7' ~ V 111~1U~1~j Drr GTTACTTTGC r,~r~ TDrr~r TGGTTCAGTG 600 1~-1~ 1 L~ 7111~ TTGTGCGAaA Dr~rrD7` 7`''rr i~W 7LJ 11~ L~1~1~ 660 'Gr~f' ZTGrr~rGrz~ . jAl~L~ Drrr~'rZ~rrn ~ llLl~ 7rCTrJrI~r~r~ 720 ~UI~ TACAGTTGAC Grrjr~rrr-'r ACGATTATTC C~rrC'`'`T~`'` CACGGTATCG 780 TTAGfAGCAG TAGGGACTTC r~CrG~r~1`rT CTGGGATTAA CGGCAAATTA cnr7~rr.TDrr 840 r~r ,~--rr~r,r, TGArTGCAGG GAATGTGCAA 1~1A11~ GCGTGACTTT TGTTTATQA 900 (2) FOR SEQ ID W0:45:
(i~ SEf~ENCE C~ r' 11U`
(A) LENGT~ 900 base pairs (B) TYPE nucleic ~cid (C) i ~: single (D~ TOPOLCGY linear (ii) ~DLEr~LE TYPE DNA (genomic) (Xi) SEQ~ENOE ~ ~L~11Url SEQ ID NO 45 ~Tr~ rn~r TTATTACCCT ~lllU~ lA I ;~ ~1 AAATGCCTGG 60 1~A~ GT~ rrnr CAATGGTACC GCAATCCCTA ll~ W1~3 j r~ncr~cr~ r 120 GTTTATGTAA ~rrTTr,rrjrr TGrrrTr~T GTG~GGQAA ACCTGGTCGT A~A1~ J 180 ACGQAATCT TTTGCCATAA CGATTACCCA GAAACCATTA r~ TC.T r~r~r7r,r~ 240 CGAG~TTCGG ~-11A1~JA C~ .1 AGTmTCCG r~ rr.T~ ATDT~TrGr 300 ~nT~rrTD~rC ~ ~-1AC ~r~rr5nrr~ rrjrrnrrrr TTGT~AA TTCGAGAACG 360 ~ crrJ~r f.(~ rr~rrr~r7Tc~ nr~r.~rr,crrr, r~ Tcr~rr. 4ao ATTAAAGCTG GCTCATTAAT ~ x~ ATTTTGCGAC r~ rr-~rr.-~ r~T~ rrrr 480 ~iAl~l~C A~ GAATATTTAC nCr~lT~ A1~ 1~1 rrrr~r~rrGr 540 GTTACTCTGC r~`~Arrr TGGTTCAGTG 600 ~;L~A11~ TTACCGTTTA TTGTGCGAAA r~r~crr~ rr ~W'A' 1A ~1A1~U 660 arrrrrnrrn z~rGrrrGrr~ Alll~ Prr~ rrr ~ rrrnrnr~n 720 ~ lu~aJ TACAGTTGAC rJ~rGr~rrr~T ACGATTATTC r~ r~ T~7~ CACGGTATCG 780 TTAGGAGCAG TAGGGACTTC GacrGT~ rT CTGGGATTAA CGGCAAATTA cnr~rr.T~rf~ 840 rr~ r~G TGACCGCAGG ~ Tr.Tnr~ J GCGTGACTTT TGTTTATCAA 900 (2) ~ FOR SEQ }D NO:46:
~i) SEQ~ENCE CT"~~ r.~i, " x (A) LENGTI~: 900 base p~irs .

WO9~J20657 2~8~726 r l~ ~L[L12 ~

(B) TYPE nucloic acid (C) ~ single (D) TOPOLOGY linear (ii) I~I)LECOLE TYPE DNA (ge~lic) (xi) gEQlJENOE IJlS:ICKll'llUN: SEQ ID NO 46 r~r ~r7- TTATTACCCT bLL~ 7~71~ ai ~ a ~ ~a rrrTr,crTrr 60 bC~l rTrrrl~rrr rD~Trr~Tr~rr~ b~ bbL~i~7 r~rrr~TrrT 120 GTTTATGTAA ACrTTGCGCC TrrrrTr~rT r7TGrr~rrr~r ACrTGGTCGT AGATCTTTCG 180 ACGQAATCT TTTGCCATAA ~b ~L l~ b r"~ r~r~TTD rD~ --TDTr~T CACACTGCAA 240 U7AW~l~W ~ 7a,~ ~- ~7L 7Ll~l.-~ AATmTCCG r--7~rr~T~r7 DTDTDrTrrr 300 AGTAGCTATC cATTcccr7Ac T~rrDr~ r~rr~rrr7r~r7rr TT~r7TTTATAA TTCGAGAACG 360 ~--rr~T (7~ a~ ( b~ 7 rrrrrTr.Tr~ a.~ a.A.. a.( ~. 420 ATTA~AGCTG rirTrDTT~rT 1 7~bl ~:11 ATT~GCbAC r~~~~rDr~Dr rTDTr7~r~r-r 480 1 l~C A 7 ~ lUl~7 r~AATATTTAc r~rrD ~Tr ~Tr,, ~ , r7r~rTDrTGrr~ 540 ~7b-1~7U_ ~ 7 ~ lCA TGATGTCACC GTTACTCTGC rr-~-TDrrr TGGTTCAGTG 600 CCAATTCCTC TTACCGTTTA TTr,TGCGAAA ~r.rr~rrrrr lUbbbl~ll~ ~ bb~ 660 Drrrr~rrrrr ~Tr,rr~rrr~r l~bAlllli 2~rrr~TDrr,r, bl~bLlll~ Drrr~rr,Grrr 720 ~ib~bl~bb~b TACAGTTGAC r,rr,rD~--r~r~T ACGAiTTATTC r~r.rr` rTZ`'` CACrGTATCG 780 TTAGGAGCAG TAGGr,ACTTC rrrrrTP~-T CTGGGATTAA rrrr r~TTD rr,rrrrTDrr 840 (--------rrr. Tr~--Tr,rrrr~ r~rTr.Tr.rDr ~ 7 GCGTGACTTT TGTTTATCAA 900 (2) -- FOR SEQ ID NO 47 (i) SEQUENCE r~ (r l ~r~ 1~ 7 (A) LENGTH 900 base pairs (B) TYPB ~ucleic acid (C) sing1e (D) TOPOLOGY ~ inear (ii) ~50~EC~E TYPE DNA (genomic) (xi) SEQHENCE L~:~iKl~llUN SBQ ID NO 47 DTr~ r~--r~-- TTATTACCCT bl l l 7~1 7l ~ a ~(7 1 r r7~Tr~rrTrr- 60 ~b~L r,T~ rr~r rr~rTrr~T~rr~ b~L~Li~L l ai~ la ~7~7 rrrrrrT~rT 120 GTTTATGTAA PrrTTr~cr~r~r TGCCr-Tr`DT ~r~TGr~rGr~ 7 ACCTGGTCGT AGiATCTTTCG 180 ACGC~DATCT DCCATAA L~l.~.. 'L~i GADACCATTA CAGA~TATGT rPrDrrGrP-~ 240 CGAGGCTCGG u ll- ~L~ ~ l AATTTTTCCG c-~~rr~Tp7 ~ L ~ ' 300 AGTAGCTATC CATTTCCGAC Tpr-rpr-cr7D prrrr~Gcrr~t: TTGTTTATAA TTCGAG ACG 360 '~rACrT j~ (7~ Llll~ rr~rrTr.Tr7~ ~rPr.TGrGrar~ T~ 420 PTTP7~7~~ GCTCATTAAT 'lV~LL~ ll ATTTTGCGAC r~~rr7~~DD rTPTr7~rPrr 480 ~ AGTTTGTGTG GAATATTTAC GCCD~ATAATG ~ ;l.l rrCTPrTr~ r~ 540 LlCA TGATGTCACC GTTACTCTGC ~rr~7~rTprrc TGGTTCAGTG 600 CCAATTCCTC TTPrrrTTTP Trr~Tr~rr7~DD Pnrrp~ ~r l~wl.. ll~- L~ --W- 660 PrPr7'rr,rPr P~rrarGrD7 ~ PrrP"TPrrr ~L~ Pr~Pr.~rrrP~ 720 L-l~,W-li TACAGTTGAC r~rrr~DrrrT ACGATTATTC C'~~~r'`'`T~'' CACGGTATCG 7ao ~ .rrDr TAGGGA~TTC rGrrGTD7~~T CTGGGATTAA CGGC~AAATTA rrr~prGTprr 840 cr''~-c~Pr~, Tr''--lrjrPrr r'''`TGTrr5' l~L~.l~ll~J GCGTGACTTT TGTTTATC~AA 900 (2) J,~ LW FOR SEQ ID N-0:48:
~i) SEQ~ENCE r~7 ~D~ T~ ", ~j ~A) LENGT~}: 888 ~a~e pairs ~B) TYPE: nucleic acid ~C) ! : single ~D) TOPOLOGY: linear ~ii) I~OLEC.~LE TYPE: DN-A ~genr~nic) ~xi) SEQIJEWCE L/~:iU~I~llUN: SEQ ID N-0:48:
pTr"DDrr"~ TTATTACCCT L~ L-ll~ AAATGCCTGG 60 l~l~L-LUl r~rTp~DDrrr~c rP7`TG~rTDrr i~ , rpnrr~r7~DT 120 GTTTATGTAA ACCTTGCGCC cr-rrr-Tr~DT r.Trrrr.r~-`7 AccTGr~TcGT: ~Lll~i 180 ACGCAAATCT TTTGCCATAA ~l~` L~i GADACCATTA r' ~"~TPTnT rPr7. rTGr7 -. 240 CGAGGCTCGG ~ l AATTTTTCCG r~D~rr.Tr7~7 P~ 300 Pr.TPnrTDTC ~ C r~rr7~~r7~D Prrrrnrrrr TTGTTTATAA TTCGAGAACG 360 r~TP7~cr~T ~ lllU ACGCCTGTGA ~ Wi TAADGCTGGC 420 TCATTAATTG ~ lL.. T rrrrrr~-Dn ArrP~r7 ~rT ~T~.rPr.,r~~ TGATTTCCAr~ 480 ATATTTACGC r-`7~TP~Tr7T ~ r ~71i~ 1l 540 , _ . . ,, , _ WO 95/206~,7 2 ~ 8 Q 7 ~ 6 PCT/D~/C95l00042 1~1~7~1~i ~1~71~1:~71 TDrTrTr~r,r C"--TDrr,rTg GTTCDGTGCC AATTCCTCTT 600 ACCGTTTATT GTGCGA.~AAG rrz~7 7 DrrTg GGGTATTACC TrTrrr~rDr DrDrr.rD--~T 660 rrr,gr,rD~rT CGATTTTCAC rD7~TDrr,rrr, TCGTTTTCDC rTr.rrrDr~g ~ 720 CAGTTGACGC grD7~rr~r~TDr ~l.. ll.~_A rrr77~TD7~rD ~ zv.. Dr_7lr~Dr,TD 780 GGGACTTCGG W~71~ 7111 GGvATTAACG GCADATTATG rrrr~TDrrrv Drrr-rDr~r,Tg 840 DrTgrrrr--~ ATGTGCAATC I ..... ~i~: GTG~C~TTG TTTATCZIA 888 ~2~ lNrl FO~ SEQ ~D N-0:49:
(i) 5BQ~7EN7CE rY~
(A) LENGTK: 900 b~lse p~irs (B) TYPE: zl~cleic ~rid (C) .7 : sizlgle (D) TOPOLOGY: iirze~lr (ii) XOLECliLE TY}'E: DN-A (gezlr~ir~
(xi) SBQ~'CE Ll5;7~ N: SEQ ID .~'0:49:
DTr''D~rr''-- 111~11~1 ~1 ~71~1~7~1~71~ 1 'V~ 717 ~7~1~71--~1 A/iATgCCTGG 60 L~ 7~1 r~TD7D7~rrr~r rr~TrrT~rr ~7~LIL~L~ d7~V~71~17 rDrrrrrD7~T 120 GTTTATGTAD. ACCTTGCGCC cg~rcGTG~AT r,Tr,gr,r,rr7 71 DrrTr,r,Tr.T ~j~"~,,-,,,,~; 180 ACGCAAATCT TTTGCCATA,D U~L~ 7 GADACCATTA rD-~rTDTr.T rDrDrTr.rrr 240 r~'`--"--Trrr ~11~1~7~,7 ~71-i711J-1--1 AATTTTTCCG ~_-`r,rr7TD7~ ~T_ ~ 300 AGTAGCTATC ~ ~I lL~-l~C rDrrDrrr7 r Drnrrr.rr.rr. TTGTTTATAA TTCGAGADCG 360 r--rr~T ~717~ lLli Drr,r~Tr7 rrDr.Tr,rgg .~ 420 ATTADAGCTG GCTCATTAAT .~ ,. . . ATTTTGCGAC rr----rDrrr7 rTDTD7--Drr 480 ... ~ AGTTTGTGTG GAZ~TAT~TAC rrrDrTD7Tg ~.. ~.. ,~,, r,~rrTDrTrg~r 540 ''i( ' ''i 111~1~71-1~7 TG~TGTCACC ~".,~.. -.~,~ rr~ rTDr~rr .. ,~,, ,, .. "j, 600 CCDATTCCTC TTACCGTTTA TTGTGCGAAA Dr-rrD~`D~rC ~,-~---~ ~--------~,~ 660 PrDrDrrrDr DTrrrr,CrDD ~-L~ DrrDrTDrrn l r ~ DrrTr,rrrDr 720 ~7~71~7Ui TACAGTTGAC rrr7rrrrrr.T ACGDATATTC rDnrr' rTD7 CACGGTATCG 780 TTAGGAgcAG TAGGGACTTC r,r.rr,r,Trl~-T CTGaGATTAA CGGCADATTA T~rDrr.TDrr a40 rr7~rrrrDr~r Tr7~rTrrDrr, r7' 1`TrTrrDD '1~ L ~l l i GCGTGACTTT TGTTTATCAA 900 (2) 1~.. FOR SEQ ID N'0:50:

WO 95/20657 ~ 7 lZ1 (i) SEQ~BNOE ~ P~ LL~:
~A) ~GT~: 900 b~se p~lir~
(B) TYPB: llucleic ~cid (C) ~ ingle (D) TOPOLOGY: li~e~r (ii) NOLBC~LB TYPB: D~A (ge3rmic) (Xi) SBQ~BXCB IJhSC~1J~11UUI S~Q ID XO S0 ~Tr~ rr~~ TTATTAAC VLllU~.:lVl~ ' .GI. b-lVVl~VV~ 7~Tr~rrmrG 60 ;V~'l r.TP~ rrr.r rP~rrr~r~r~r ~ . llVVLVVl~ rPrrrrr2~ 120 UTTTATGTAA ACCTTGCGCC rrrrGTr~`I`T r~T~GGGr~ PrrTaaTCr~r VVM-~L1L~V 180 ACVCA~ATCT TTTGCCATAA CGATTACCCG GAI~MCCATTA WAl.~.lVl r7~rPrT~r.r~ 240 rr`~--Trrr. ~ lC~ W ~V-VlL~ l AATmTCCG r~~~rrTr~ PTPT~r.Trr,r 300 AV.MV.1~1C CATTTCCGAC CACCAGTGAA Prrrrr~rr7Gr- TTGTTTATAA TTCGAGAACG 360 T~rrrG.J. ~.GI'('13;~ V~ lllV ~rrrrTr.T~r~ VI_~Vl~---liVV CWVVlVVlV i20 rrTG GCTCATTAAT lVL~,V~ll ATTTTGCGAC 7~ ~rr~rP7~ rTpTp~r~ar 480 .~.. ~,~ AGTTTGTGTG GAATATTTAC r~rrP'`TP7`TG ~''71~''~3'' GCCCACTGGC 540 ~3.1 ~ ~-lV~-l~V TGATGTCACC GTTACTCTGC r-~r~~rTprr~c TGGTTCAGTG 600 VJll~V TTACCGTTTA TTGTGCGA~A PnCr~ rr ~ VVVV-~ .. - ,-.. -,V. 660 prprprrrpr. ~rr.rrrarP7~ VAllll~ ~rc~ Tprrr~ ~vl~vl.l.~ DrrTr,r~rpr, 720 V~j.. ,.. W.V TACAGTTGAC Grr~rp~~rr~T ACGATTATTC r~ar~r7~TP~ CACGGTATCG 780 TTArGAGCAG TAGGGACTTC Gr~rGr~T~T~r~T cTGa-GATTAA CGGCAAATTA rrrZ~rr.TDrr~ 840 r~~ r~Pr~G Tr~rT~rprr~ r~ rrr,r~ . ~.~1V CCGTGACTTT TGTTTATCAA 900 (2) FOR S3Q ID NO:51:
( i ) SBQ~BNCB rr7 (A) LBNG~: 900 }~e p~ir~
(B) TYPB: nucleic ~cid (C) ~ : single (D) TOPOLOGY line~r (ii) D~LBC~LB TYPE: DNA (genrmic) (Xi) SBQIJB~CB ~ .W SBQ ID NO:51:
pTr~ rr~~ TTATTAACCT V.--V~ ,. r~ TvrrTrr~ 60 WO 95l20657 2 ~ 8 ~ 7 ~ ~ PCT/DK95100042 ~

~L~Ll~U~l r~TD77~7rr~r7c rD~TrarrDrr r,~ lLu7~1u7 rDrrrrrD7T 120 GTTTATGTAA ACCTTGCGCC rr,rrrTr-77T rTrarara-irD~ ACCTGGTCGT AGATCTTTCG 180 ACGCAAATCT TTTt7CCATAA Cr7ATTACCCr~ GADACCATTA r--~"TDTrT rDrDrTr,r7 7 240 CGAGGTTCGG ~ (a ~lULL.. I.l AATTTTTCC~3 C~ -rrTD7~7~ DTDT~rTr~r 300 AGTAGCTATC ~ALLL~Lf~C rDrrDrrr~ DrrrTrrrrr TTGTTTATAA TTCGAGAACG 360 ~--rrT a ~ -LLL"Ll.~i Prr~rrT~iT-r rrDr.Trirrrr. I laaa.~ 420 DTT7~77--~i GCTCATTAAT ~v~ vi L ~Tlq~7r--~-- D--7--rD71r7~7. rT TD-.r7rr 480 .C AGTTTrTr,TG GAATATTTAC GCCAA~DATG ~ ~7 ~,a7 ,a7 rC~CTDrTr,rr 540 -~, LLl~ C~i TGA'rGTCACC GTTACTCTGC rr-7~rTDrrr TGGTTCAGTG 600 CCAATTCCTC TTACCGTTTA TTG~rGCGAaA DrrrD7 7 7 r~r ,a,a,,ai ~ -L~-L~ ~7- 660 DrDrDrnrDn ATGCGGGCAA ~L~ LLll~ DrrD7TDrrr ~l~illLl~ DrrDnrarDn 720 l TDrDrT~- rrnr~7~7~rnT ACGATTATTC rD--""7TD7 CACGGTATCG 780 TTAGGAGCAri TAGGGAt~TTC rr,rr,rTD7~T CTGGGATTAA CGGCAAATTA rGrDrr~TDrc 840 r~~---Drr T-~rr,r~rr r~TrTrrD~ L~ILL7 GCGTGACTTT TGTTTATCAA 900 (2) PO~ SEQ ID NO 52 (i) SEQCENCE rY7oD~
(A) LENGTH 900 base pairs (B) TYPB nucleic acid (C), ~ sing1e (D) TOPOLOGY linear (ii) I~OLLCCLE TYPE DWA (geno3lic) (xi) SBQ~E~C'' LI~S~LluN SEQ ID ~0 52 D~ r~ - L l~L L~ ~l ~ -- ~-L~71~7L D7 ~Tr,rrTrr 60 ~ _ ljl l-l rT2~7 rc~r7r rD7Tr,r,T rt~ w1~7 rDrrrrTD ~T 120 GTTTATGTAA ACCTrGCGCC Tr~r~-r~Tr~7~T rTrrrrrD~ DrC~rrr~Trr~T AGATCTrTCG 180 ACGCAZ~ATCT TTTGCCATAA ~l L~L~7 GADACCATTA rD-"-TDTr,T rDrDrTrrD7~ 240 CGAGGCTCGG ~LL~L~ ~~ 7lL~T.l AATTrTTCCG r.--7-~rrTDr7 DTDT rTrrr 300 AGTAGCTATC CATTTCCGAC TDrrDnrr7 ~ Drr~rrnrrrr TTGTTTATAA TTCGAGAACG 360 7 ~--rrT ~ ~ I ~,1 G~-L L ll~L L L~ DrnrrTt~7 l,l . n I 7~jl7 7 ", ~ l 420 ATTAD,AGCTG GCTCATTADT L~ cLl ATTTTGCGAC Dr~-rD7 rD~ rT3T.7r2~n,r 480 WO95/20657 2 1 8 0 726 ,~ 12 A7L1L~71~7LU GAATATTTAC rrr~rD rG L ~ ,A~, r,tr~r~r~rrr 540 i 'LlL~ 7~ TC7ATGTCACC GTTACTCTGC rrr~ rrc lV~71L~ ~71~7 600 CC~ATTCCTC TTACCGTTTA TTGTGCGA~A rrr~ '"rc 1~7L~l~ L~L L~Lw( 660 7~ rPrarDr rlTrrrarr~ OLLlL, Drr~rT7rcn C~7L~7LLLL~ rr arrrDr 720 ~7L~7~L-~7LG TAClAGTTrAc rrnr- rrr,T ACGATTATTC r~rrr~ rr~rr,rT Trr 7ao TTAGGAGCAG TAGGGACTTC rrrrr;r ~~T CTGGGATTAA CGGCAAATTA rarDrr~Drr 840 r- ~-r~ r~r i~ ~TGr~ra r TrTr,r ~ ~L,~ Ll.~Ll~7 GCGTC7ACTTT TGTTTATCAA 900 (2~ lL... lU~I FOR SEQ ID NO 53 ( i ) SEQI~ENOE rr~ y ~ L~
(A) LENGTH 900 base pairs (B) TYPE nucleic ~cid (C) ~ single (D) TOPOLOGY line~lr (ii) I~DLECDLE TYPB DNA (genomic) (xi) SEQ'JENOE L/~ Llun SEQ ID NO 53 C ~ ~ ~ rr -- ~L .~. L~-l ~7L LU~l~iLJ, ~ J ~iL-L~jL~i~71 D7 DTarrrrr 60 l ~. L,`t,~LL r~D7~ 7 7 crGr rr~TrGT~rC 3 ~ r ~~Grr~ T 120 GTTTATGTAA ACCTTGCGCC CGCCGTGAAT r~Trr~arr7~7~7 ACCTGGTCGT ~L,~LLL~ 180 ACGCA~ATCT TTTGCCATAA Ll.L.~7 GADACCATTA rD~ ~~TL~TrT r r~rTrr. 240 CGAGGCTCGG ~-LL ~L~L~7 L~71~7LL ~L~-L A~TTTTTCCG r~ ~~rrT7~ "C~ 300 ~,rT nrT~Tr ~LLl~Ll~C r~rr~rrr ~ ~rGrcr~rGra~ TTGTTTA~A TTCGAGAACG 360 r ~T ~rrrrT l~.r~ L7~1L1~ LLL~7 DrrrrTrrr7 ar r~crr,r ~ 7 420 ATTA~AGCTG arTr~TTl ~ L jL~7L~7~ll ATTTTGCGAC 7~7`~r7DrDn C'rDTDDrDar 480 .l,L AGTTTGTGTG r "r~ r rrrD'"rD'TG ~1~71~71~jL arrTDrTGr-C 540 ~ llL.L;7~ 7 TGATGTCACC GTTACTCTGC rr~~ rrr AGGTTCAaTG 600 CCAATTCCTC TTACCGTTTA TTGTGCGADA arrD rr L~7L~Ll . L-L~L~:L~3L 660 DrDrDrar r. 7~'T`GrGrGr7'7 ~ LlLl~ Drrl~DTDC'ra L~7L~ ~711L1, rr~rr~rDr 720 ~iC L~ TACAGTTGAC arar D~ rrT ACGATTATTC r ~rrr ~ T D CACGGTATCG 780 TTAGaAGCAG TAGGGACTTC r,~rrr~rTr rT CTGG~jATTAA CGGCAAATTA Tr r rr~T-~rr 840 r~ I~rr,r~r~r r~rTGrDr~r~ r~7~Tr~3rD7~ ll~Ll~ GCGTGACTTT TGTTTATCAA 900 W095/20657 ~ 1 8 0726 124 PCT/I)IC95/000~2 ~2) . lUN FOR SEQ ID N'0:54:
(i) SEQ~EN-CE r~ "~ ~j (A) LEN-GTEI: 900 base plirs (B) TYPE: nucleic acid (C) :. ~ ~: single (D) TOPOLOGY: line7~r (ii) MOLEC~LE TYPE: DN-A (genr~ic) (xi) SEQ~JEN-CB Ll~:.C~.lUN: SEQ ID N-0:54:
pTr7~rr~~ TTATTACCCT ~lLL~- VL~ __ (~i~L~L Wl r7~7Tr~crTrG 60 L~ -L r~TP7~7~'rrjr rPl`Tr7r7TPrr j~ Ll~i~ i rPr.rrrrP7T 120 r.TTTDTr.Tr7 ACCTTGCGCC Tr~rrr~Tl~LpT /~-Tr,rr~r77'~ ACCTGGTCGT ~AL~LLL~ 180 ACGCAAATCT TTTGCCATAA ~ GAAACCATTA rP~"~~TPTr.T r~r~rTr.r7.7. 21L0 CGAGGTTCGG ~-LL~ W CI~L~;LL~L~-L AGTTTTTCCG r-~~rr,Tr~ ATATAATGGC 300 AGTAGCTATC ~Ll~ L~C T~rrDrirr~ rnrrnrr,~rG TTGTTTATAA TTcr~ 7rr, 360 7rrrrT 1~ I I~L1L~ LLL~ ~rrj~rrTG--Tr ~ I , 420 ATTAAAGCTG GCTCATTAAT l~ lL~LL ATTITGCGAC P~~rD7~r~-~ rTDT~7~r~nC 480 ~L~ A~ GAATATTTAC rjrr~7~T~T~. L ,, i ~ rrrr2rTrrr 51'0 i lLL~L~-Ll~i TGATGTQCC GTTACTTTGC rr~r~~T~rcr TGGTTCAGTG 600 L~L~ LL~lLl~ TTGTGCGAAA 2inrr7\7l7~7~rc 'lUl~LJ'lL~ ~-l~-l.~W~ 660 ~r1~rl~rrrLr DTr~rrrrr~ I ALLLL~ ~rr~7~Tl~rrr ~ LLl~ ~rrTrrDr~n 720 W~ TAQGTTGjAC rjrr.r~ rrr.T ACGATTATTC r~r.~rr~rT2-~ CACGGTATCG 780 TTAGGAGCAG TAGGGACTTC WCwGTAhGT rTrr~TT~ CGGCAAATTA rr~r~rGT~rr 840 r~ ~,cr~rr. Tr~~Tr~rLr~G GAATGTGQA L~lJhlL~ll~i GCGTGAcTTT TGTTTATCAA 900 (2) . lUN FOR SEQ ID N-O:SS:
(i) SEQ~EN-OE r~ , ,. . " ~
(A) LE'N-GTH: 51 base pAirs (B) TYPE: nucleic ~cid (C) ~ . ~'' - IKI. ~.~: 13ingle (D) TOPOLOGY: linear (ii) ~OLEC0IE TYPE: DN-A (ge~r~ic) 2l~a72Q

(xi) SEQ~lE~iCE ~ un: SBQ ID ~0:55:
~_:lVl lV~ AGTTCCGGGT AGTCAGCATA l~,V~ lJ~Vl~ A ~'' 7~ 717~ 7' ~'~"r' G 51 -

Claims (40)

NEW CLAIMS

1. A method of targeting a non-adhesin compound to a specific location, comprising (i) identifying in said location an adhesin-interacting receptor moiety which isrecognized by bacterial adhesins, (ii) isolating a bacterial cell which is capable of growing in said location and of expressing an adhesin recognizing and interacting with the receptor moiety identified in said location, the adhesin being associated with the non-adhesin compound in the form of (a) a non-adhesin polypeptide which is expressed as partof a fusion protein comprising the adhesin, or (b) a pharmalogically active, diagnostically active or imaging compound which is non-covalently bound to the adhesin or a fusion protein comprising the adhesin, and (iii) administering to the location the bacterial cell or the adhesin under conditions where the adhesin and the receptor moiety are brought into interacting contact whereby the adhesin is bound to the receptor moiety.

2. A method according to claim 1 wherein the receptor moiety is selected from the group consisting of a glycolipid, a glycoprotein, a protein, a polypeptide, a saccharide moiety and a peptide.

3. A method according to claim 1 wherein the isolated bacterial cell expresses an adhesin having modified receptor moiety-binding properties relative to an adhesin natively expressed by the cell, the isolation of the cell comprising identifying in a parent bacterial cell, DNA sequence(s) coding for the binding domains(s) of said natively expressed adhesin and substituting at least one codon herein, whereby a modified adhesin molecule is expressed that is different in at least one amino acid from the adhesin expressed natively, and selecting a bacterial cell expressing the modified adhesin having an altered adhesion phenotype relative to the natively expressed bacterial adhesin.

4. A method according to claim 1 wherein the bacterial cell expressing an adhesin is a recombinant bacterial cell derived from a parent bacterial cell that does not produce an adhesin binding to said receptor, by inserting into the parent cell a DNA sequence coding for an adhesin binding to the receptor moiety, and selecting a bacterial cell expressing the DNA sequence.

5. A method according to claim 1 wherein the compound which is part of a fusion protein comprising the adhesin is selected from the group consisting of an enzyme, an antibody, an epitope and a toxin.

6. A method according to claim 5 wherein the compound is an epitope-carrying polypeptide comprising 10-60 amino acids.

7. A method according to claim 1 wherein the specific location is selected from the group consisting of a human or animal surface, a plant surface and an inanimate surface.

8. A method according to claim 1 wherein the adhesin is a FimH adhesin.

9. A method according to claim 1 wherein the bacterial cell expresses a recombinant bacterial adhesin variant derived from a naturally occurring parent adhesin, said recombinant bacterial adhesin variant having altered binding properties relative to the naturally occurring adhesin from which it is derived, the altered binding properties including binding to at least one receptor moiety to which the parent adhesin does not bind.

10. A method according to claim 9 wherein the adhesin variant is derived from the naturally occurring parent adhesin by replacing at least one amino acid residue of said parent adhesin.

11. A method according to claim 10 wherein the adhesin variant is a FimH
adhesin.

12. A method according to claim 8 wherein the FimH adhesin is a chimeric adhesin comprising amino acid sequences from different FimH adhesins.

13. A method according to claim 8 wherein the adhesin is one which binds to at least one of yeast mannan(Mn), human plasma fibronectin (Fn), periodate treated Fn, the synthetic peptide FnSp1 comprising the first 30 amino acids of Fn.

14. A method according to claim 8 wherein the adhesin is at least 90%
homologous to the PC31 FimH adhesin.

15. A method according to claim 8 wherein the adhesin has an amino acid sequence which differs from the E. coli PC31 FimH adhesin by at least one amino acid occurring between residues 27 and 119 of the mature FimH sequence.

16. A method according to claim 1 wherein the bacterial cell further comprises agene coding for a gene product which, when expressed has a killing or cell function-limiting effect in said cell, the expression of said gene coding for the cell killing or cell function-limiting gene product being regulated in such a manner that the bacterial cell when it is administered will be killed or limited in its function in a pre-determined manner.

17. A fusion protein comprising a FimH adhesin and a non-adhesin polypeptide, the polypeptide preferably comprising in the range of 1-100 amino acids, said protein having retained the binding properties of the adhesin and presenting thepolypeptide in a conformational form which mimics the conformation of the nativepolypeptide.

18. A fusion protein according to claim 17 wherein the adhesin has an amino acid sequence which differs from the E. coli PC31 FimH adhesin as defined in Table 1 herein by at least one amino acid.

19. A fusion protein according to claim 18 wherein the adhesin variant has an amino acid sequence which is at least 90% homologous to the PC31 FimH
adhesin.

20. A fusion protein according to claim 17 wherein the adhesin is a chimeric adhesin.

21. A fusion protein according to claim 17 wherein the adhesin binds to a receptor moiety selected from the group consisting of an animal receptor moiety, a plant receptor moiety and an inanimate receptor moiety.

22. A fusion protein according to claim 17 wherein the non-adhesin polypeptide is selected from the group consisting of an epitope, an enzyme, a toxic gene product and an antibody.

23. A fusion protein according to claim 22 wherein the non-adhesin polypeptide is an epitope-carrying polypeptide comprising 10-60 amino acids.

24. A fusion protein according to claim 17 which carries a non-covalently bound pharmalogically active, diagnostically active or imaging compound.

25. A recombinant replicon comprising a DNA sequence coding for a recombinant fusion protein as defined in any of claims 17-23.

26. A replicon according to claim 25 wherein the non-adhesin polypeptide of the fusion protein is selected from a group consisting of an epitope, an enzyme, a toxic gene product and an antibody.

27. A replicon according to claim 25 which further comprises a DNA sequence coding for a gene product which is selected from a pesticidally active gene product and a pollutant-degrading gene product.

28. A recombinant bacterial cell comprising a replicon as defined in any of claims 25-27.

29. A bacterial cell according to claim 28 which is selected from Enterobacteriacea, Pseudomonadaceae, Vibrionaceae and Baccilaceae.

30. A bacterial cell according to claim 28 which further comprises a gene codingfor a gene product which, when expressed has a killing or cell function-limitingeffect in said cell, the expression of said gene coding for the cell killing or cell function-limiting gene product being regulated in such a manner that the bacterial cell when bound to a receptor in a specific location will be killed or limited in its function in a pre-determined manner.

31. A method of isolating a bacterial cell expressing a FimH adhesin having modified binding properties relative to a natively expressed FimH adhesin, comprising identifying in the bacterial cell DNA sequence(s) coding for the binding domains(s) of said natively expressed adhesin and substituting at least one codon herein, whereby a modified adhesin molecule is expressed that is different in atleast one amino acid from the adhesin expressed natively, and selecting a bacterial cell expressing the modified adhesin having an altered adhesion phenotype relative the natively expressed bacterial adhesin.

32. A method according to claim 31 wherein a non-adhesin compound is bound to the adhesin.

33. A method according to claim 32 wherein the non-adhesin compound is a polypeptide bound to the adhesin by being expressed with the adhesin as part of a fusion protein comprising the adhesin.

34. A method according to claim 31 which in a further step comprises binding non-covalently a pharmalogically active, diagnostically active or imaging compound to the adhesin when expressed.

35. A method according to claim 31 wherein the codon(s) is/are substituted by mutagenization.

36. A method of preparing a recombinant bacterial cell that binds to a specific receptor moiety, comprising introducing into a bacterium that does not produce an adhesin binding to said receptor moiety, a DNA sequence coding for a fusion protein comprising a FimH adhesin binding to the receptor moiety and a non-adhesin polypeptide preferably comprising in the range of 1-100 amino acids, andselecting a bacterial cell expressing the fusion protein, said protein having retained the binding properties of the adhesin and presenting the polypeptide in a conformational form which mimics the conformation of the native polypeptide.

37. A method according to claim 36 wherein the DNA is introduced by transforming the bacterial cell with a recombinant replicon as defined in claim 25.

38. A method according to claim 36 which in a further step comprises binding non-covalently a pharmalogically active, diagnostically active or imaging compound to the fusion protein when expressed.

39. A composition comprising a population of a bacterial cell as defined in any of claims 28-30 or a fusion protein as defined in any of claims 17-24.

40. A composition according to claim 39 which is a vaccine.