CA2159323A1 - Dna segment comprising gene encoding insecticidal protein - Google Patents

Abstract

This invention relates to a method of increasing the insecticidal spectrum and/or toxicity of Bacillus thuringiensis strains whereby an exogenous crystal toxin encoding DNA sequence is stably integrated into the chromosomal DNA of a host wherein the exogenous DNA
sequence is expressed and further wherein crystal toxin encoding DNA sequences on resident plasmids may be expressed. The invention further relates to the B.t. host including said exogenous DNA sequences, methods of preparing said host, insecticidal compositions containing said host and methods of use.

Description

~ 0 94/25611 21~ ~ 3 2 3 PCT~EP94/01249 INTEGRATIVE DNA SEGMENT COMPRISING GENE ENCODING INSECTICIDAL PROTEIN

This invention relates to the field of microbial incectiri~les, and more particularly, to the construction of hybrid microbes yOS~ ;..g gTeater insect toxiritips and broader insect host ranges. This invention is useful in the protection of plants from insect infc~ ion.

In recent years there has been cf~nci~ hle interest in R~rilll~c th--rinpiP,ncic (B.t.) and their use in the biological control of insect il~r~ s~i~lion of plants. These insect pd~llogclls from a toxic crystalline protein during sporulation, called the pal~syoldl crystal.

B.t. strains with dir~.,.ent insect host spectra are cl~ccifiP-l into dirr. ,~n~ selo~yyes or ~ub~cies based on their fl~ r ~nti~enc. Most B.t. strains are active against larvae of certain l.lell.~ of the lepidoyte.dn order inrl~l~ing caterpillars of buttrrfli~s and moths but some also show toxicity against ~ of the diyt~ n or cole~yt~,ldn order including mosquito larvae and beetle larvae ll,sy~;li~ely. Toxic activity has not yet been ~lemonctrated for several crystal-producing strains.

The crystalline inclusions of B.t. dissolve in the midgut of the larvae, rclP~ g one or more insecticidal crystal proteins, or ~endotoxins, of 27 to 140Kd. Most crystal proteins are pro-toxins that are proteolytically converted to smaller, toxic polypeptides in the insect midgut.
In general, it is well known in the art to refer to the crystal yloteills as Cry and the gene e~r,orling said protein as cry.

Over 42 B.t. cry genes have been C}idl~ fl A cl~ccifr~tion scheme for cry genes is published by Hofte and Whitely, 1989, Microbiol. Rev., 53:242, and genes are divided into four classes and several subcl~cc~!s, by the structural cimil~riti~s and incecticidal spectra of the encoded proteins. The four major classes are those encol..l-~c~ g the Lepidoptera-specific (I), Lepidoptera- and Diptera-spe~ific (II), Col~yl~ld-sr)ecifir (m), and Diptera-specific (IV) genes.

The Lepidoptera-specific genes (cryI) encode 130 to 140Kd molecular weight proteins which ~rc--m~ tr in biy~-d --idal crystalline inclusions during the sporulation of B.t. The cryI

WO 94/256~ 5 9 3 % 3 PCT/EP94/01249 genes can be ~licting~liched from other cry genes by SG~IU~,IICC homology (>50% amino acid identity). Three of these genes, cryIA(a), cry-LA(b), and cIyIA(c), show more than 80%
amino acid identity and have l}l~ ,Çolc been con~ red as a se~ SU1)~;1VU~. The more recently ~ ntifiP-l cryIB, cryIC, and cryID genes differ from each other and from the cryL~
genes. The CryL~, CryIB, and CryIC ~lvle~ns in crystal plGp~alions have been distinguished in 29 strains of 11 seloly~s by using 35 monoclonal antibodies as shown by Hofte et al.
(Microbiol. Rev. 53:242-255 (1989)).

The Lepidoptera- and Diptera-specific class inrlll~es genes which encode 65Kd proteins which form cuboidal in~lllcionc. The first cryIIA gene was cloned from B.t. subsp. kurstaki HD-263 and e~l~ssed in R~cill-lc ...~x,-t~ " Cells producing the CryIL~ protein were toxic for the lepidopteran species ~oliothic vileSCe,lls and Lv---~ dispar as well as for larvae of the dipteran Aedes ae~VPti.

The Coleoptera-specific class encode gene products which are active on Coleoptera species and the ~l~teills are about 70Kda. At least three Cole~lGld-specifir B.t. strains have been lescribe-l B.t. tenebrionis, B.t. san die~o, and B.t. EG2158. The strains produce lholllboidal crystals cont~ining one major protein.

The Diptera-specific class of cryIV genes is col~osed of a rather h~tel~ge.leous group of Diptera-specific crystal protein genes. The cytA and four other genes were isolated from the same 72Mdalton (Md) plasmid present in strains of B.t. isl..elensis. The cryIVA, c~yIVB, cryIVC, and c~yIVD genes encode ~rulG;ns of 135, 128, 78 and 72Kd, ~ ,ly. These proteins ~cc~mhle tog~ ,. with the 26Kd cytA gene product, in ovoid crystal complexes.
A crystal complex with the same or a similar protein colllposiLion has also been observed in the B.t. morrisoni PG-14 strain. Toxicity tests with p-~ll~alions of cryIV class crystal proteins, derived either from B.t. i~l~rl n~;c or from lccc~lllh;ll~ E. coli or Racilh~c are, to various e~trnts, toxic against larvae of some mosqllitn species.

Since the original cl~scifir~tic)n by Hofte and Whitely a nulll~er of novel cry genes have been cloned and their nucleotide sequences d~t~ ....;ne-l A ~rr~ t cl~csifir?~tiQrl system has been published by Yamamoto and Powell, 1993 "R~rillllc thllringi~ncic Crystal Proteins pps 3~2 ~O 94/25611 ~ 15 9 3 ~ 3 PCT/EP94/01249 in Advanced F.n~;..e~ c;d Pestic~i~les", ed. Leo Kim.

Co~ ;ial ~ ~alionS of B.t. are cc,.. ~ ly used on many ~gri( ~lltl-ral crops, shade trees and orn~mPnt~lc to control various insect species and these ~ ionC are applied with the same e~ "-~- nt used for appli~tion of chPmi~ Pcl ;~ s. Methods for ~CsPscing spray coverage are well known to those skilled in the art.

The colll~osilions co...l..;~;..g the hybrid b~ . may be applied as a spray, dust or bait, alone, or in conjunction with ~ald~.it~,s, p~.,ddlu~. or other control ~,oc~lu.~s such as chPmir~l incecticides radiation-in~lucecl st~rili7~tinn, cl-P-Ilo~.lf ;l~ntc, ~h~lu-l,ones, etc.
Stressors may ~nh~n~e the pathogenicity or ~;lival~ chronic infections with the hybrid bacterium of the invention.

Known methods for tran~.ru..,lalion of B.t. include protoplast fusion, protoplast tr~ncfection, tr~nc(hlction, elccLIupo.ation and conjugation-like p.ucPc~es.

EleuL~~o~oldlion is rl~ u~,lllly used for tran~.rullllhlg B.t. due to its simrlicity, speed and effici~n~y. A B.t. shuttle vector was also developed in 1989. The utility of this shuttle vector was first ~ oll~l laled by moving a B.t. crystal toxin gene into a crystal minus (Cry) B.t. strain called cryB with the res--lting tran~.Çu~ t ~A~lessing the 130Kd crystal protein.

Various cloning and e~lession vectors derived from native B.t. pl~cmirlc have been recently developed, for example, shuttle vectors illCOl~lalill~s the B.t. isl- ~lf l.CiC 3.65Mdalton pl~cmi-l and pBR322; pl~cmi~s from B.t. kurstaki HD263, HD73, HDl; pl~cmi~1c from B.t. israelensis and E. COli vectors. One such shuttle vector was used to move a coleuplc.a"-active toxin gene into a B.t. isr~lçncic strain, widening the S~CLIU111 of incecticidal activity to include both Diptera and Colc~l~,la.

A serious problem associated with the use of this technology is the instability or inco---p~lihility b~l~.~n the native and exogelluus pl~cmi-l rl~u~.llly, one or more native B.t. pl~cmirlc are unable to coexist with an exogenous pl~cmid(s) introduced into the bar~e~ m, and the native pl~cmi~l is rapidly lost through se~l~,g,~lion The lifficulty arises WO 94/2~611 ~ ~ ~ 9 3 Z ~ PCT/EP94/01249 when the native pl~cmi~lc contain one or more cry genes to be preserved in the tr~ncgeni-B.t. strain. This problem can be o-rc.cc,.l.e by el;..-in~ g the portion of the B.t. pl~cmi~l vector causing the in-~J...~ ;hilit.,v ~~ the lcco~ inant (or exogenous) and native pl~cmitlc.

Methods of stably introducing exogenous DNA into b~ t~ri~ have been investi~tP(l A B.t.-based, native-c~ hle vector has been used to tl~L. a coleu~ active crymA gene into a B.t. kurstaki strain and the reClllting ~ cg~ strain exhibited high levels of Colc~L~.dn activity while still .el;~ p its wild-type Lepid~t~ activity. Bacteria may also be tldl sro....ed with pl~cmitlc ;.~ p~b!~ of autono...ul,s replir~tion and carrying a sel~c~hlP marker if the pla~smid carries a seg~ of DNA that is homologous to a portion of the host chromosome. In the example above, a pl~smi-l has been shown to interact with the host by a single c-ûsso~ C~ icm that involves pl~cmi~l and homologous host seyuences. The result is an int~t~tl pl~cmid flanked by direct repeat~s of the homologous DNA segm~-nt Such insertions are mllt~g~nir if both ends of the duplicated seg.~ are col.L~..cd within a single ll~nc~ 1inn unit.

Delecluse et al. applied homologous ~o...hil.;.l;on to inactivate the cytA inCÇCti~ protein-encoding gene in B.t. israelçn~ic (Delçcl-lc~ et al., J. Bacteriol. 173:3374-3381 (1991)). An integrational vector co~ g partial cytA sequenres was constructed and homologously recombined with the cytA gene present on the 72Mdalton r~sidc~l plasmid of B.t. i~l P~ ;C
In ~rlition~ Calogero et al. con~ tcd a B. subtilis hlt,gl~ional vector carrying the entire CryIA(c) coding region of B.t. kurstaki HD73 (Calogero, S., et al., Appl. Env. Microbial.
55:446453 (1989)). The pl~cmirl vector was found to express the HD73 cryIA(c) gene.
PCT/US91/05930 (WO/93/03619) describes a l~C-Jllll~ B.t. b~ t~ ... with a shuttle vector carrying an incr~tiri~l gene and a method of ~ ~hlg the lecc...l,inant b~cl~.l,-...-However, neither the general m~tho~s ~rscril~eA above nor the specific references offer anysuggestion that the ~ubl~l of B.t. stability could be solved by cll,.,.~losolllal integration.

The present invention is concerned with the stable ..~;-.t~ e and eA~.~ssion of crystal genes wh~,,cin the cry genes are L~g.~ed into the C~u~Osc~ of B.t. strains. .~ ition~lly ~o 94/25611 - 5~ ~ 5 ~ 3 ~ 3 PCT/EP94/01249 the invention co~ -c the consL--IcLion of B.t. strains with broader host ranges and/or new speçifirhiPs. Specific~lly, the invention col~rc- -c the construction of B.t. strains with high spodoptera activity and retained ~oLt~ ;y against Lepido~t~,.vus insects.

This invention relates to a DNA SG~ t Cv~ ;--g one or more in~ectiri(1P-enro~ling DNA
sequPnr,es capable of being replir~tPd and eA~lcssed in B.t. and a DNA sequence which directs insertion via homologous lecolllbilldlion of the DNA Se~ t into chromosom~l B.t.
DNA.

This invention also relates to a DNA SG~ I which cu.ll~lises one or more incectiride encoding DNA se~lu~nces c~p~hle of being replicated and e~-~lcssed in B.t. and a DNA
sequence capable of randomly illt~ dtil~g into the B.t. ~ n".~.

The invention also inrhldPs a hybrid vector which comprices a vector such as a plasrnid or a shuttle vector and the DNA segm~nt of this invention o~cla~ ly linked thereto.
Also part of this invention is a hybrid B.t. host having h,t~lalcd in its chromosome at least one of the incectiri(l~.-ellr.o~l;ng DNA SC~u.,llCC of said DNA se~E~.. nt This invention also relates to a method of ~lG~alillg the DNA seE;lll~llt of the invention comprising the steps of: obtah~ing a DNA SC~ ce homologous to a cl.lulllosomal B.t. DNA
sequence; and o~ldli~cly linking thereto at least one ineectiridPAencoding DNA sequence so that when B.t. is transformed with the DNA segmPnt or a hybrid vector having the DNA
sequence opeldLi~ly linked thereto the ;..~P~I;ci-lf-cncoding DNA sequence is eA~l~,ssed.

Still another mPthod of ~ ~h~g a transformed B.t. host is provided herein that compriees a) obtaining a DNA sequence capable of randomly integrating into the B.t. chromosome DNA; b) operatively linking to said DNA SG~ cc one or more ineP~ctiri~p-encoding DNA
sequences capable of being replir~SPd and eA~ ssed in B.t.; c) obl~Li.lil.g a DNA se~ .t, d) tran~rolll ing a R~rilll-c thllrin~irnci~ host with the DNA SG,~ f l~t Whe~ the DNA
segment randomly integ.dl~,s into the B.t. host ch.o...oso...~; and e) iCnl~ting the transformed host and wl.~e;~. the in~ectiri~lr encoding DNA s~ ces is eA~.~ss~d as transformed host.

Wo 94/25611 2 ~ 5 93 ~ PCT/EP94/01249 This invention also enco...pAcses the y~ on of a hybrid B.t. host GAyl.,i~sillg at least one exogenous in~ectici(le by transforming a B.t. host with the DNA sbg,n- --t or hybrid vector described above and allowing homologous l-,colllbination to occur and the in~ectiri~le-encoding DNA sequence to becolllc stably illcolyuldted into the B.t. cl~o..losome and icol~ting the transformed host.

Disclosed herein is a broad ~ , incecticirl~l COlu~osilioll comprising the hybrid host of the invention, and a carrier, optionally i~ ;..g o~er incectiri~ products. In one embodiment the incectir~ 1 range of the B.t. may be l,e-eased by transforming B.t. as described above incr,ctir;rle-encoding DNA se~ ,nce remains eAylessible.

Also enr~o-..p~cse~ is a method of ylu~ g a plant from insect rl~m~ge, comrricing applying to the plant or the soil around the plant an effective amount of an ince~tirid~l co..lyosiLion of the invention.

The invention will be further ayp~QI from the following ~l;Cb-l~.;on, including the associated Examples, drawings and Seque-~re I(ilontifir~tionc.

Of the drawings:
Figure 1 describes pl~cmitl pSB210 inclllrling a gram-negaLi~e origin of replication.
Figure 2 shows the derivation of the pSB147 pl~cmirl and its family tree.
Figure 3 ~esr~i~,s pl~cmi~l pSB210.1 inrl~ ing the pSB210 s~llen~es.
Figure 4 describes pl~cmi~l pSB210.2 inrlutling the pSB210.1 sequenres.
Figure S shows a map of the pSB210.3 pl~cmi~1 Figure 6 shows a map of the pSB147 pl~cmi~l Figure 7 depicts the construction of the pSB136 pias-m--id.

The Sequrnre Itientifir~tions are given in Tables 2 and 5, and in Examples 3, 5 and 11.

The present invention i~ o~es upon the narrow in~e~tirifl~l range of the prior art B.t.
Hybrid B.t. strains posssssing more than one incectirid~-encoding gene with broader host ranges may be consL~ ;led by intro~ ring foreign incectiri-l~ c.~rotling genes into the ~93~
~o 94/25611 PCT/EP94/01249 chromcsomPs of known bh~-t~ strains. Accordingly, tbe present invention provides a mPthod of inc~ g the host range of a B.t. strain by incl~;asi~g the nul~ of different in.cecticidal crystal proteins produced by the strain.

Introduced pl~cmi~lc in reco~ubin&~l B.t. strains can cause instability to resident pl~cmiAc of the cell, and the introduced pl~cmiAs tl-- .. cel~,~,s may also be unstable. This often results in loss of eA~l-,ssion of the crystal genes co~ illed in the cell. The present invention cil~;ulll~c.lL~ this problem by introducing a crystal gene into the host chromosome for expression without disLulbiLIg exicting crystal genes contA;..rcl on the host resident pl~cmi~1c.

Accordingly, the h~ ion provides a DNA se~lllc,lt cornpricing one or more incecticit encoding DNA sequences; and a DNA s~u~n~e homnlogous to a chromosomal DNA
sequence of a B.t. wherein said incertiri~lP PnrOriinp DNA seqnenre inserted into the chromosome is replir~te~l and eAyl~ssed in said B.t.

The incectir,ide-r~.~ror1;..g DNA sequence may be any DNA sG~ re enrolling an incectirir1~l protein capable of being e~ ,ssed in a B.t. bh~ t~ Tn~ encoding DNA sequences suitable for use in the invention include but are not limited to cryIA(a), cryIA(b), cryIA(c), cryIB, cryIC, cryID, cryIE, cryIF, cryIIA, cryIIB, crymA, cryIIIB, crymC, cryIVA, cryIVB, cryIVC, cryIVD and cytA genes of any ~ubs~ies and/or strain of B.t. and the incectir~
protein-enro.1ing genes of any strain of B. Iarvae and B. P~ P and all other in~ectirir1~1 protein-rnro-1ing genes known to be ~l.,ssed in bacilli or otber gram-~osili~,~ b~ctrri~
among others. Also s~lh~hle are DNA sc~ n~eS enror1ing incectir,ides such as a-amylase inhibitor, proteinase inhibitor and any other toxins from baçtrri~ among others.
Homologous DNA sequences suitable for use in the DNA seg..~fnt of the invention include any DNA sequence ~ub~ lly homologous to any clho.~oso...~l DNA fra~ nl of any B.t.
species or strain such as those listed in Table 1 above. The homologous DNA sequence permits and directs the integration of the DNA se~ of the invention into the host's DNA
by homologous l~colllbil.ation thereof with b~r-teri~l DNA. When the DNA se~ lt of the invention is provided as a circular, covalently closed DNA segmP~t, homologous .~colllbinalion may occur by means of a single cross-over event b~ ..ccn the host DNA and the homnlogous DNA se~ .re When the DNA se~ is provided as a linear DNA
segment, homologous lG~,olllbindLion may occur by means of a double cross-over event between the host's DNA and the ht mt~logous DNA seql~ r~s fl~nkinf~ the desired incectiride-erlro-ling DNA. Thus, the homologous DNA sequences may be provided as one or two fl~nking DNA sequences. Moreo~ , the DNA se.~ .l of the invention is provided in double stranded and single str~n~led form. The single stran~lec~ form may be obtained by heat or chPmir~l denaturation of the double str~n~lçd form as is known in the art. The double stranded form may be obtained by e.lLyllle restrirtion of the desired sequçnr~ and ligation as is known in the art.

The homologous DNA sequçr~re is homologous to a fragment of the b~ctrri~l chromrJsomto in the range of about 5 bases to about 20 kbases. More ~l~r~ldbly the sequenre is homologous to about ~00 bases to about 10 kbases. Also ~l~r~ d is a DNA sequencehomologous to about 2250 bases of the phospholir~ce C ellcodillg region of B.t. Particularly ~rere.l~d are DNA sequences homologous to B.t. host cL~lllosollle portions outside the endogenous incectiride-producing gene(s). Where the DNA se~lllclll cont~inc a DNA
sequence homologous to the b~cteri~l DNA both S' and 3' of the sequenre encoding the insecticidal protein, in the light of the above, the skilled man will lGCo~ ; the size of the homologous region either side of the incectirj(le encoding region. In this manner, even the addition of a single new gene will increase the insecticidal range of the b~;le.iulll.

The DNA sc~;lll~,nt of the invention may further ccmrrice an origin of replication for a grarn-negative b~ c. ;~ . Any origin of replir~tion capable of functioning in one or more gram-negative b~rteri~l species or strains of the Neisseria, Veillo~Pll~ Brucella, P~t~,ul~lla, Hemophilus, Bordetella, F.c~h. ;cl~i~ Envinia, Shigella, Salmonella, Proteus, Enterobacl~"
Serratia, Azotobacter, Rhizol,uilll, NiL~usolllollas, Nilluba~:t~,., Thiob~rill-lc, Pseudomonas, Acetobacter, Photob~rteri~lm, Z~ll.ol,lonas, Aer~l.l.ol-~c, Vibrio, Desulfovibrio, or Spirillum genera, among others may be used. After cloning the DNA se~ ,t in a gram-nc~livebacterium such as E. coli and transforming a R~cillllc thllringiensiC, the only ~ul~iving insecticidal DNA sequenres will be those integrated into the host's clllu...c-sornr Since the gram-negative origin of replir~ti~n will not function in a B.t. bacterial host, a B.t. host transformed with the DNA se~;"-- nl will neither replicate, nor express the incectiri~e unless 2:L~93~3 ~0 94125611 PCT/EP94/01249 the DNA s~...~ .1 bccc,~ues integrated into the host cLu...-so...r The DNA segment of the invention rnay also further c~ e a s~le~l~hle marker eAp~ssible in a monQcçllul~r organism other than a gram~ e b~t~ ...., a se-lPct~ltle markerexpressible in a gram-posili~,~, b~r-t~rillm, and/or a selP~t~hle marker cA~l~,ssible in a gram-negative and a gram-po~ b~ .......... - A sel~ hlP- marker e~ ssible in a monocf.~llul~r host other than a gram-positive b~ .. ....is defined as any DNA sequence capable of eA~essillg a phelloly~ in a .... l~ocf lllll~r host other than a gram-~osi~ivc; host, that is useful in the detection or selection of the host carrying the DNA se,~ nre A sel~ct~le marker capable of being eA~l~,ssed in a gram-~osili~., bh~-t~ --- is APfinPd as any DNA sequence capable of eA~l~s~illg a phenotype in a gram-posili~e b~cteri~l host useful in the clftPctiQn or selection of a gram-posili~,~, host carrying the DNA sequence. A sçlect~hle marker capable of being eA~l~,ssed in a gram-negdli~ and a gram-~osili~, b~rterillm is defined as any DNA sequence capable of eA~l~s~ing a phflluly~ in a gram-positive and a gram-negative b~rteri~l host useful in the ~letection or sPl~ction of the host carrying the DNA
sequence. In general, ~Y~mplPs are ...;..L~ ~ for drug r~-c:cl~re cllPmir~ c;~l~nre~ amino acid auxoL,u~hy or plotoL.u~)hy, or other ph~ uly~;c v~ri~tionc useful in the selection or detection of mutant or l~co...h;.~h~.l or~ni~..C. The ~ ,sencc of the select~l-le markers facilitates the cloning andlor --~ f--~nre of the DNA seE--~--I of the invention in gram-negative bacteria and illlplu~ ,S the selection andlor ~etertinn of recombinant B.t. bacteria carrying the DNA se~ -.l of the invention.

Further provided herein is a DNA SC~ P~l co~ g at least one incectiri~lp-encoding DNA
sequence capable of being replicated and eA~ ,sed in a B.t. b~rtPri~l host, a~d a DNA
sequence c~able of randomly illt~lalillg into the B.t. host's ~l~ irDNA. ~n~omly integrating DNA sequences suitable for use herein are insertion sey~ res or transposon se~l~.- --res capable of inserting or copying th~mcelves and DNAse.~ ..rPco~ldli~..,ly linked thereto at random loc~tionc in the chromnsom~l or pl~cmitl DNA of a B.t. host. FY~ 5 include transposons, such as Tn917 exemplified below, and TnlS45 and Tn916, all of which are described by Camilli et al. (Camilli et al., J. R~rt~ri~l 172:3738-3744 (1990)) or other gram-posi~ive transposons known in art. ~lthough the eYict~Pnre of randomly integrating DNAse~lu~ces or cAc~ s has been known, it is being applied for the first time to the WO 94/25611 ~ ~ 5 9 ~ 2 3 PCT/EP94/01249 insertion of an incectici~t~l gene in a gram-po~iLivc bact~ri~

Suitably the DNAsegmPnt of the invention co---p~ g a l~ yO50l1 sequence may be carried on a pl~cmil~ vector. Pl~Cmi~lc ayyluylialc for use herein include pTVSlTs and pLTV1, as exemplified below among others. In a ~l~ç~ d emborlimpnt~ f~ w ~ ll c-sensitive pl~cmi~tc are used to select lldn~yosed host cells. Plasmids such as pTVSlTs and pLTV1 are unable to replicate above a certain t~lll~ldlulc. Thus, a DNA seg...- nl carried on a Iclll~laLulc-sensitive pl~cmi~will be ,..~;..I~;n~ in the host at a non-permiccive tcnlyeldLulc only if the DNAsegmPnt Llallsposes into the host genrmP The ~ yosiLion eff~i~Pnry may be increased by selçcting for a rnarker cv..l;~;n~ within the transposable el -- l-t, such as drug recict~nre, amino æid auxoLluy~y or ploLluyhy~ and the like.

In a particularly plc~llcd emborlimPnt. the DNAse~ ,lll of the invention is used to generate multiple L~ il;on events within a single B.t. host. Multiple insertions of the DNA seg.-.- nt into host genomic DNA may be obtained by a rapid tellly~ldtulc upshift in the case of Lelll~ldlul~,-sellsiLi~, pl~smirl vectors. If Ll~syosable cle...~ carrying drug recict~re ..~ are used, inc~ased drug levels will enru~,AgP multiple i,~syosiLion events. The ~A~lition of mitomycin C will also i.lcl~,ase L,d~l.posiLion frequency.
Alternatively, the gram-yosili~ host may be llal-sr~l-lled with an array of difr~l~nt transposable elemPntc in which each el/ 1ll~ n~ carries a unique select~hle marker.

In one embodiment, the Lldr.~yosable cl(~ -n~ of the invention carries all control el,~-l..- .1~
n~cess~.y for host cell eAy,~sjion of the llansyoscd i..~e~ e~nr,o-linYDNA sequ~-n~e In other embo~ , the transposable çl~ n~ may be deci~nP-d to create an operon or gene fusion in which the incectiri-le-enro-ling se-lu~--ce is placed under the L,~s-,.iylional and/or translational control of the host DNA. Operon and gene fusions may be constructed according to the mPtho~lc for Tn917-m~ t~d operon and gene fusions ~lpccrihpd byyol~ngm~n or other mPthotlc known in the art (yo!lngn-~n, P., "Plasrnid Vectors for Recovering and ~xploiting Tn917 Transpositions in R~ s and Other Gram Positive Bacteria", In Pl~cmi~c A Practical A~l).oacll, Handy, K.G., ed. IRL Press 79-103 (1973)).

The Ll~ns~osable ~l~m~.nt of the invention may be utilized in the ~ ~dlion of a transformed ~O 94125611 ~ i 9 3 ~ ~ PCT/EP94/01249 B.t. host eA~l~ssing at least one e~og.--~oll~ inc~ctici(le by O~a~ y linking thereto at least one in~ectirjrl~-encoding DNA sequenre capable of being replir~t~ and eAyl~ssed in B.t. to obtain a DNA se~ nt, so that when B.t. is lldc-.ru--lled with the DNA se~ t the incectirirl~-enrorling DNA sequence b~o..~Fc integrated in the B.t. chromosom~ and may be eAy.~,ssed, transforrning a R~cillllc thllrinpi~ncic host with the DNA seg--.~ and allowing the DNA segment to randomly iL~ late into the B.t. c~u.. ~nsom~, and isolating the transformed host.

The transposable C~ t or DNA seq~ re capable of randomly integrating into the B.t.
genome may be obtained by m~thn(ls known in the art inrh-rling ehzyllle restriction, lig~tion, cloning, and/or ch~mir~l ~.ylltLesis. The i~e~ l gene or DNA sequenre may be obtained and be oyr-ldli~r,~ly linked to the ldudoluly intc~ldtillg DNA se4u, .lCe similarly by methods known in the art.

Transformation may be con~luct~l by for example Lldllsr~lion, cle,-llùyuldlion~ tr~ncdnction or conjugation. Host isolation may be con~luet~A by s~l~el;..g from the sehct~hle marker on the transformed host. In an embo~lim~nt of this invention, the randomly integrated DNA
comprises the Tn917 lldUSpOSOl1.

The incectiricl~l range of B.t. may be h~.,l, ased by ...~ inE the eAyl~ssion of an endogenous incectir~ encoding DNA sequence and o~ldli~r~ ly linking one or more exogenous incectici~l~l genes to the lldllsyosable el~ ".. nt which may be h~colyuldted into the B.t. chromosome.

The DNA seE;...~-t of the invention may be provided ac a hybrid plasmid. It will be appreciated that any pl~cmi~ sequences suitable for carrying the DNA seg.. ~t of the invention may be used in the construction of the hybrid pl~cmi~l Particularly suitable for use in the present invention are plasmids pSB210.1, pSB210.2, pSB210.3, pSB136 and pSB147 described below in FY,.rnrl~s 1, 6 and 11, among others.

The DNA segment of the invention may also be provided as a hybrid shuttle vector for gram-yOSili~ bacteria. Appropriate vectors include any vector capable of self-replication in gram-WO 94/25611 2 1 ~ ~ 3 ~ ~ PCT/EP94/01249 negative b~ctrri~ yeast or any ...~ ocell~ r host in addition to gram-l~osili~, b~cte~ri~ Such shuttle vectors are well known in the art. The utility of this shuttle vector was first demonsLlatcd by movirlg a B.t. crystal toxin gene into a crystal minus B.t. strain called cryB.
The res~llting tran~fullll~t eA~lessed the 130Kd crystal protein. In ~klition, Lereclus et al.
constructed another shuttle vector illCûl~Olalillg pHT1030 B.t. pl~cmi~l and pUC18 to move a cryIA(a) gene icol~t~d from B.t. 407 into the cryB strain (Lereclus, D., et al., FEMS
Microbiol. Lett., 49:417 (1988)). When transferred into a Cry-d,~ , of the 407 strain, the level of c~le;.sion of this toxin incleased ci~.~ir.. a~ly over that seen in the wild-type strain, possibly the result of an in.;lG;~ced gene copy llulllb~.. Miteva et al. constructed a shuttle vector by incûl~ul~-Ling the 3.65~1~h~n plasmid of B.t. isl. cle ,~ic and pBR322 (Miteva, V.I. et al., Arch. Microbiol. 150:496 (1988)). Shuttle vectors constructed using B.t.
rl~cmitlc from B.t. hlrst~ki HD263, HD73, HDl and B.t. i~ Fle~ and E. coli vectors have also been described. One such shuttle vector was used to move a cole,o~leri~l-active toxin gene into a B.t. isl--P-le..~;c strain, widening the s~;LIu~l of incectiri~l activity to include both Diptera and Coleu~tel~ (Crir~mnre~ N., et al., Biochem. J. 270:133 (1990)).
Also provided herein is a B.t. host Cb...~ g at least one incectirjrl~l DNA sequence of the invention stably incol~l~led in its chlulllosollle,. Suitable B.t. hosts include B.t. suLs~cies and strains thereof set forth in Table 1 and those çYIo~nplifi~1 below, as well as any other B.t.
subspecies or strain known in the art. As used herein, the term "host" includes both vegetative and spore forms of B.t. b~rteri~ The stable incol~oldLion of the DNA scg~
of the invention into a host chromosomr is defined as the ~ n~n~e of the DNA SGg---~ ~t within the host C~ul~ .~ some through many g.,.l~,.dtions of ploge~ly and through the sporulation and germin~tion phases of B.t. hosts.

In a preferred embo~lim~nt, the transformed B.t. host culll~l;ses mnltirle exogenous expressible incectjri~1e encoding DNA sequences stably integrated into its chromosome. The multiple sequenrec may comprice any combination of the above dcsclibed insecticide-enro-ling sequences, inrlurling multiple copies of the same incecticjd~-encoding sequence.
In a particularly l~lei~,.lGd clllbo~;...P--t the host is capable of e~ s~h~g two or more different in~ectirir1~1 proteins.

~93~
~0 94/25611 PCT/EP94/01249 It will be appreciated that the DNA SG,~ of the invention may be used to stably incol~oldl~ any exogenous DNA seq- enre into the c~hulllosvlllc of a B.t. host. Exogenous DNA is defined as any DNA which alters the chromosom~l DNA of a B.t. host upon integration into the host's chromosome. The desired DNA SG.Iu~ G may be introduced into B.t. in a similar .~ cr as the incPcticjdP-enrotling DNA sequences described herein.
Accordingly, the invention encvl~p~c~Gs a B.t. host having ~Icvl~vldled into its chromosome an exogenous DNA sequence capable of being replir~tr~ and e~lessed by the host.

The DNA SC~ ll of the ~vellLon may be p~pdl.,d by obl~i..-ug a DNA sequence homologous to a cl~ullloso..,al DNA sequence of a B.t. b~ - ;u---, o~.dLively linking thereto at least one incectirirls enro~ DNA seq~to-nre so that when a Bacillus thllrin~iensis is transfected with the DNA Sf,g..~-n~, the incectiri~lP~ro~ g DNA se.lucncc is e~ ,sscd.

The homologous DNA se.~ n~c may be obt~il.cd by scl~~ g known genomic libraries of B.t. org~nicmc If a genomic library does not exist for the B.t. b~ of interest, one may be constructed by mrthn~c known in the art. Screening mlotho~lc are also known in the art. Once the sequences of interest are d~-t~ they may be excised with restriction cn~ylllcs. If the DNA or peptide sequenr,e is known, the DNA ~ ".. ~.lx may be synth~ci7P-d by methods known in the art. Alt~rn~tively, if the DNA or peptide sequerlre is not known, genomic restriction fragmentc can be used to randomly clone homologous fr~gmrntc.

The incectiridr-encoding DNA sequence may be o~lali~rely linked to the homologous DNA
sequence by joining of the DNA se~u~n~cs so that upon homologous l~coll-~ ation and integration of the ;nce~!;cid~l DNA into the host's clllv...nso...~, the incectiri~le-enrorling DNA is capable of being e~l.c,ss~d in Rs~rillllc !l ;C. In one e,l.lbo~ t the DNA
se~,---~nt co. ~ 'l" ;ces regulatory SG.Iu~ c capable of directing the ~ sc.i~tion and tr~ncl~tion of the ince,ctirid~ Gn~orlinp DNA within the B.t. host. Such reg~ t~ l~r sequences may include promoter, û~lalor~ le~ svl and/or ~nh~nr,er se.lu~nces, I.al~sc.i~lion initi~tion and termination sites, ribosome binding sites, tr~n~l~tion start and stop codQnc, and/or other regulatory sequences known in the art. For eY~nple7 the incectiri~l~-rnro-ling DNA sequence may have o~.d~ ely linked thereto regulatory seque-nres which control e,~p.ession of the incectirjd~-encoding DNA within its native b~- t~ l host.

2 ~

Also within the scope of the invention are DNA se~l,lents ~esign~,~l to create operon or gene fusions within the host's DNA. In the case of an operon fusion the DNA segmPnt may compri~e control cle."~,nL~, capable of directing the translation of the insectiride-enrotling mRNA. The homologous DNA sçq-1~Pnce may be dP~ignPd to illl~gldle the in~Pctirid~P-encoding DNA sequence into an operon within the host's DNA so that upon insertion in the host's chromosome, the in~tiri~ e--rotling DNA sequence is placed under the transcriptional control of the host's operon. In the case of a gene fusion, the homologous DNA may be ~esignPd to integr~tP. the insecticide-enro~ling DNA into a structural gene in the host's chl~ulllosome so that the host's control cl l.-~ direct both the Ll~n~ iQn and the translation of the insecticide-enr,o~ling DNA seq~çnre The techniques for constructing operon and gene fusions are ~srribed by Sambrook et al. (SaQlbrùol~, J., Fritsch, E.F. &
M~ni~tic, T., MolP~ r ~lonin~g A Labo~aloly Manual, Cold Spring Harbor Labc,.,~ y, NY
( 1989)).

Once constructed the DNA se~ of the invention may be isolated by methods known in the art such as cenl.irugation or agarose-gel cle~l.uphoresis, among others.

The method for ~lep&ing the DNA sçE~...- nt of the invention may further comrrise a selectable marker selected from the group cQnc;~ g of those capable of being e*~ssed in a monocellular host other than a gram-posi~ive host, those capable of being eA~l~,ssed in a grarn-positive host, and those capable of being e~ssed in both gram-~,osili~ and gram-negative hosts. The s~lçct~hle marker for a monocellular Ul~ lll iS utilized to clone and purify the DNA scg,l,~nt in such o,E,~ni~...

The sel~oct~ble m~rkrrs of the invention may be o~.a~ ly linked to the DNA seg...- --l by conr~trn~ting the selectable marker to, or inserting the gram-posi~ , selçct~hle marker in, the DNA SCg---~ t SO that, upon insertion into the B.t. host's chro",oso".e, the selectable marker does not h,lc-r~l~ with the cA~l~,ssion of the insect;ri~l~-encoding DNA sequence in the B.t. host. In addition, linkage of a gram-posilive sçl~ct~l~le marker should not inte with the functioning of the sçlçct~l le marker for the cloning organism (the non-gram-L~si~
host), and should be expressible in the B.t. host. In one embotiimPnt a gram-positive selectable marker carries all control cl~ -....ntc nr~cess~ ~ for its eAp,~;,sion. The gram-positive -~O 94/25611 ~ 3 ~ 3 PCT/EP94/01249 select~ble marker may also be l~ci~ned to filnction in an operon or in a gene fusion within the host DNA in a ",al~r,er similar to that ~i~sçrihe~l The method of the invention may further comrrice O~lali~,~,ly linking to the DNA segment described above an origin of replic~tion for the morlocellular organism in which it is cloned.
This organism may be an insect cell, CHO cells, gram-nc~ali~ b~rt~ri~ yeast and the like.
Origins of replication such as those (l~osçr he~ above may be O~;.ali~,_ly linked to the DNA
segment of the invention by placing the origin in a location within the DNA sea~ nt in which it will not disrupt the functioning of any other ck~ in the DNA se~",enL, e.g.
outside the insecticidal DNA and the homologous DNA sequences A B.t. host having stably inco-~l.-~d into its cl~ l- .osrl. .r a DNA se~ enco-ling at least one incectici-l- may be ~ a~d by a) obtaining a DNA segm~ont of the invention;
b) tran~Çul .~ing a B.t. host with the DNA se~",el,l, c) allowing for homologous l~,cc""bi"ation to occur and tne insP~ctiride-encoding DNA sequence to becoll,e stably illcol~ol`~hd into the host's chromnsomP; and d) isolating the transformed host.

B.t. hosts may be transformed with the DNA segn.~ .1 by m~thn-lc well known by one skilled in the art, inrlu~1ing cle~LIo~dlion, L,d-,sr~Lion, ~ .c~)ul-~ ion and conjugation or any combination of these m~ths)tlc Further provided herein is a broad range insectiri~ co~l?osilion comrricin~ the hybrid host of the invention in an insectiridally err~ amount and a carrier thereof.

The co,ll~osilion may contain about 106 to about 10'3 hybrid microorg~nicmc/g carrier, and more preferably about 101 to about 10'1 mi,_loo~ -iC~ /g carrier. However, other amounts are also suitable.

B.t. hosts may be present in the colllposilion in either ~ ., or spore form. Suitable ca~riers are known in the art and an artisan would be able to select those suitable for the WO 94/25611 ' ~.1. 5 9 3 2 3 PCT/EP94/01249 .

present ~ul~ose. Typically, the carriers are inert COl~-~uu lds or col.l~osilions that neitner interact with the host in the ince~tiri-1Al col~.~osilions nor with the plants to be treated.
However, certain carriers may be metabo~ized by the plants or the soil ul~ lls and are thelerule biodegradable. The effe.;Li~enes~. and ~ ~ of the incecti~ Al col~osiLion is enh-Anred by the ~dtlition of carriers such as spreaders, stir'~e~., wetting agents, and incl~ ing corn meal baits, Loco~9 (amine stearate) spray additives, Plyac~, Triton B-1956, polyl,ute"es L-100 and H-35, corn oil, Triton B-1946, and Cellosi7~ QP 4400, boric acid, ~.ulr~L~lL oils, Pinolene~ and otner adjuv~k. ~nown in the art. The in,~ . are ~tlTnixrd and colll~ounded as is known in the art, a~d the coll.~osiLion provided in powder, liquid or aerosol form. The hybrid host may best 'oe pl~ d at low telll~c~dlul~ and thawed prior to use.

The incecticidAl cclllposiLions of this invention may further co~lplise otner incecticj~lAl compounds. Co~ osilions including B.t. are known to 'oe cq...l,AIi't)le witn a wide range of chrrnirAl insectiridec, such as those reported by Herfs and Pf A~n7rnkrankh (Herfs, W., and pflAn7~nkrankh, z, pfl~An7~ l.ll, 72(10):584-599 (1965)). Accordingly the insecticidal coll~osilion of the invention may col-.~lise one or more of the incectirides i~lentif~(1 by Herfs or other insecticidal B.t. hosts known in the art or hybrids thereof ~l~al.,d in^
accordance with this invention.

The invention also provides a method of protecting a plant from insect ~lAm~g~oT comrri~ing applying to the plant or the soil around the plant an effective arnount of the in~ecticjd-Al cc,lllposilion of the invention. M[ethods known in the art for the a~plicalion of coll~le~ial insecticidal microolg~ is--l ~ ~ations are suitable for applying the ins~ctiri~AI col..posilion of the invention.

Typically the present col--~osilion may be applied by spreading about 108 to about 1016 hybrid microGl~ /acre and more pl~fclably about 1013 to about 1014 hybrid micro-org~ni~mc/acre. The colllposilions are best applied by spraying the plants, and subsequent reapplications may also be undertaken.

Specific eY~Amrles are desçrihed hel~ below for ~ulyoses of illustration only and are not ~O 94/25611 2 ~ 3 2 3 PCT/EW4/01249 int~ontl~.~l to limit the invention or any embo-limPnt thereof, unless so ~-;r.~

WO 94/2~611 ~ 1 ~ 9 ~3 ~ 3 PCT/EP94/01249 .

EXAMPLES
Construction of Plasmids Comretent E.coli DH5a (Gibco BRL) and GM2163 (New Fn~l~ntl Biolabs) were p-~,pa.~d by the method of ~ n-l~r (~ lr,r, D.C., "A ]~t-th~l for Cloning Full-Length cDNAin Plasmid Vectors", In Wu. R. and Cros~ , L., Eds., Recombinant DNA part E. Meth.
Enzymol. 154:41-63 (1987)). Plasmids were eYtr~rted from E. coli by the method of Birnboim and Doly (Billlboilll and Doly, "A Rapid ALkaline Extraction Procedure for Screening Recombinant Plasmid DNA", Nucl. Acids Res. 7:1513-1523 (1979)).

The pSB210.2 pl~cmitl which carries the cryIC gene, the B. subtilis ermC gene for clyLlllolllycill le~ nre and the phns~hrJlir~sP C region as descrihed by T ~hn~r et al. as a target for integration (T ~C hn~r et al., "MolP,c~ r Cha~ ion and Sequence of Pl-osl~a~dylinositol-Specific Phosrhnlir~ce C of R~ri~ c thllringienci~, Mol. Microbiol.

3:621-626 (1989)) was constructed in a 3-step process. First, the pSB210 pl~cmi~l shown in Figure 1 was cor.~l,u~ ,d from the pSB140 pl~cmir1 shown in Figure 2 and ~lescrihed below in Example 2 by adding a ml~ltirle cloning site (MCS) at the EcoRI and Hin-lm sites. The MCS was created by ~nn.o~ling oligonucleotides KK14 and KK14B, the sequences of which are described in Table 2 below, which had been pllrifi~d using oliKonucl~tide ~...;ric;~lion cartridges from Applied Bio~y~L~l. s, following the ~ ri u~ 'S directions.

~jO 94125611 ~ ; 9 3 ~ 3 PCTtEP94tO1249 Table 2: sequences of Oligonucleotides SEQ
Narne: SC~ fC (5'-3') Hy~l;.l;L.,.g Gene ID No.
Phosl GGAACGCTACATACTAGTGATAGAGTAG ~l.o~ f!i~ C
Phos4 GCTTGTACACCGCAA~1~ GCATG ~ f~ ¢ C 2 KK14B AGCTTGCGGCCGCGTCGACCCCGGGCCATGGGGiGCCG (MCS) 3 KK14 AATTCGGGCCCCCATGGCCCGGGGTCGACGCGGCCGCA (MCS) 4 GalPI CCACAGTTACA~l~:l~lAGCTCAATTACC cryIC S
GalP2 CCGCTACTAATAGAACCTGCACCA cryIC 6 NHS20 CAATACATTATCCATGGAAAAm~ mAAATATCATG cryIlA 7 NHS39 GAGCAATGAAAGAGTTAGGGCC~_u~ lAAGGTGTCATG c y~A 8 NHS42 GAGTGAATTATGGGGG cryIlA 9 NHS43 Al-l~ JlATTAAACGG cryIIB 10 cryIIAl ACTAl l-1~1~3ATGCGTATAATGTA cryIIA 11 cryIIA2 AATTCCCCATTCATCTGC cryIIA 12 PG2 GAAATCGGCTCAGGAAAAGG ennC 13 PG4 CCTTAAAACATGCAGGAATTGACG ennC 14 PG5 CTATTGGTTGGAATGGCGTG ennC 15 TYIAA GAGCCAAGCAGCTGGAGGAGTTTACACC cryIA(a) 16 TYIAC TCACTTCCCATCGACATCTACC cryIA(c) 17 TYIUN12 ATCACTGAGTCGCTTCGCAl~l 1 113A~l-l-l~-l~ cryI-type5 18 TY6 G~ iGCTATAl~ GTGTCACAGC cryI-type 19 TY13 ACAGAAGAATTGCTTTCATAGGCTC cryI-type 20 TY14 GAATTGCTTTCATAGGCTCCGTC cryI-type 21 Tet3 CAACAAACGGGCCATAAGCTTGTATAAG tet 22 Tet4 GCC~l~u~lAACGGTACCTAAGG tet 23 CPOl.Rev CACCCA~l ~ ACTCGCAGG tet 24 ln the second step, the phos C gene was added to pSB210. The phos C region had been amplified from HD73 total DNA by PCR using primers Phosl and Phos4 descdbed above in Table 2. The PCR product was cloned into the Smal site of pUC18 to consLlu.;L pSB139. The phos C target region was isolated on a 2.2kb blunted-Kpnl, BamHl fragment from pSB139, gel-pudfied and ligated into pSB210, which had been ligest~p~ with Mscl and BamHI and purified using the C;enF~l~ Kit (BiolOl), following the m~nllf~tllrer's directions. The reslllting pla~smid rl~$ign~tPd pSB210.1 and is shown in Figure 3.

The final step was to add a crystal gene. The pSB210.2 pl~cmi-i contains the cryIC gene on a 4.2kb ApaI-NotI fragment from pSB619, described below in Example 3. pSB619 wastli~est~Pd with ApaI and NotI, and the 4.2kb ApaI-NotI fragment was isolated. The 4.2kb ApaI-NotI fragment was ligated to pSB210.1 cut with ApaI and NotI to forrn pSB210.2 which is shown in Figure 4. The pSB210.3 plasmid co~ ins the cryIC gene isolated on a 6kb fragrnent from pSB013 (rlPserihed below in FY~rnrl~. 4) cut with ApaI and NotI. The 6kb WO 94/25611 . ~1 ~ 9 ~3 2 3 PCT/EP94/01249~

ApaI-NotI fragment wæ purified by electroçllltion and ligated to pSB210.1 cut with ApaI and NotI to form pSB210.3 which is shown in Pigure 5. pSB210.3 differs from pSB210.2 in that the cryIC gene is placed behind the cryIIA ~ lU~otcr rather than the native cryIC promoter found in pSB210.2. In both pl~cmitlc, the cryIC gene is followed by the crylA(c) termin~tor.
The pl~cmirl pSB147 was constructed as ~les~-~;hed below in Exam~ple 5. It carries the phospholir~ce C region æ an i.lt~.,lion target, the cryIIA operon, and the ermC gene which Co~ rc ~ c to ~llullly~

The pl~cmirl DNA used in the cle~l~upo,alion e~ lx wæ purified from GM2163, a dam-, dcm-, E. coli strain (Woodcock, D.M., Nucleic Acids Res. 17:3469 (1989)).

Example 2: Construcffon of pSB140 Plasn~id The pSB901 pl~cmitl was constructed to provide an c,~ lyciil resict~nre gene, ermC. To construct pSB901, the ermC gene was icol~ted as a ~int~ /ClaI fr~gmP~t from the plM13 Baciilus subtilis pl~cmid ~ies~;hed by Monod et al. (Monod et al., J. FLactPriol. 167: 138-147(19861) . The ermC ~in~m/ClaI Laglll~,nt wæ ligated to pUC18 cut with Hindm and AccI.
To replace the tetr gene in pBR322 with the ermC gene from pSB901, pBR322 was digested with Aval and the li,-r~.;7~,d vector was treated with the Klenow fragment of E. coli DNA
polymerase I to generate a blunt end. Following Klenow Ll~ , pBR322 was liEestpd with HindIII and the large fragment was purified away from the tet' gene r,ag...--~.t Plasmid pSB901 was digested with Smal followed by Hindm and the rlaglllellL carrying the ermC
SmaI-Hindm fragment was purified. The ermC gene was ligated into the pBR322 Hin~lm large fragment to gcn~,àle pSB140. The derivation of the pSB140 pl~cmid is shown in Figure 2.

F.~ F 3: Construcffon of pSB619 Plasmid The crylC gene icol~tPd as an 8kb EcoRI DNA fragment was cloned into the EcoRI site of Lambda ZAP II vector obtained from Str~t~gPnP. To isolate the gene, a pl~cmi~ prc~aralion of Bacillus thuringipncic aizawai HD229 oblained from the USDA was ~ligestpd with EcoRI, the fragments were s~,~a~d by gel cle~L-v~hol~,sis, and fra~m~ontc of about 8kb were icol~tP~1 from the gel. AllGlllati~ ly~ the cryIC gene can be obtained by following the cloning protocol described by Honee et al. (Honee, G., van der Salm, T., and Visser, B., Nucl. Acids Res.
16:6240 (1988)). The cryIC clone was ~ligest~ in two sepA~,~tP re~rtionc, one with Hindm and -~93~3 ~o 94/25611 PCT/EPg4/01249 KpnI and the other with KpnI and EcoRI. The digestion created a 2.6kb Hindm-KpnI fragment co.~t~it.il-~ the ~Jlolllote~ and N-termin~l cryIC se.~ .rc and a 2.3kb Kpnl-EcoRI fragment contS~ g the C-termin~l seq~l~Pnre and t~Prrnin~tnr. The cryIC gene was l~,col,sl~ ;led by lig~ting the 2.6kb Hin-lm-KpnI ~m~nt to the 2.3kb KpnI-EcoRI fragment in pTZ19R
obtained from Ph~rm~ri~ The unique NcoI site was Pn~in~red at the tr~nSl~tion start site of the cryIC gene. An additional EcoRI site was also Pn~;..f~,c,d right after the stop codon. These restriction sites enable cleavage of the entire coding region of crylC in one continuous fragm~-nt The 3.8kb Hinrlm-EcoRI fragment c~ ini..~ the cryIC plulllu~l and entire protein coding region was then cloned into a pBlllesenrt vector with the PCR gencldted 350bp cryIA(c) termin~tor.

The cryIA(c) le~...;..~tor was obLaincd by PCR using two pli~ synth~si7~d based on the published cryLA(c) sequerlre as follows.
Primerl: GTCTCATGCAAACTCAGG, SEQ ID NO.: 25 Primer2: CTCTGGCGCTCCATCTAC, SEQ ID NO.: 26 A cryIA(c) gene cloned from B.t. kurstaki HD73 was used as the ternrl~te. The PCR ~;ene.ated terminator was cloned in an Xbal site, after 1~ with Klenow to make it a blunt end, of pBluescript KS+(Str~t~en~-) in the same nrient~tion as the T3 ylulllOt~,l. The ~inrlm, EcoRI
fragment COI.l; ini.~g the cryIC promoter and coding region was then cloned into the Hindm-EcoRI sites of pB11~sçrirt KS +. The cloning and se~ r;l-g of cryIA(c) are described by Adang et al. (Adang, M.J., Staver, M.J., Roç~ P- ~ T.A., ~ ~ighton J., Barker, R. F. and Thompso~, D.V., "Ch~;~ Full-length and Trllnr~t~cl Plasmid Clones of the Crystal Protein of Rarillll$ thl-ringj~n~ic subsp. h-rst~ki HD-73 and their Toxicity to ~n~c~ sexta.", Gene 36: 289-300 (1985)). This construct was decign~t~d as pSB619.

F.~ "~ 4: Construction of pSB013 Placmid The HD- 1 strain of B.t. hlr~$t~ki was ob~ined from the USDA. Total DNA was extracted from HD-l using the ASAP kit accor~ g to the protocol from Boehring~r ~l~nnh~im The kin~ced oligonucleotides NHS39 and NHS20 des~-rihed above in Table 4 were used as primers in a PCR reaction to gcn~,~dle from B.t. kurstaki HD-1 total DNA the 1800bp fragment C~nt~ining the entire cryILA operon. Vent pol)~ ."ase was used according to the m~nllf~rt-lrer's WO 94/25611 2 ~ ~ ~ 3 ~ 3 PCT/EP94/01249 ~C~ tinr~ (New F.ngl~nd Biolabs, Beverly, MA). The PCR reaction products were isolated from a gel and ligated into pTZ19R which had been rii~sted with HindII. The lig~tiQ~1 product was used to Il~lSru~ comretPnt E. coli DHSa. The transfol "~s.nni were selected on LB plates cont~;n;..g 7511g/ml ~mpicillin (amp) and 40mM Xgal. Plasmid DNA was scl~ened by ApaI and NcoI digestion and the o~ ion of the 1800bp PCR fr~gm~nt within the pTZ19R mlllticlorling site was drt~....;.~r-(l by AflIII t~ stion A clone with the desired 1800bp fragment olie,ll~Lion was design~ted pSBO09.

pSB070 is a pl~cmid similar to pSB619 that cont~inC the coding region of crymA instead of CryIC. To construct pSB070, the CryIIIA gene from B.t. tenebrionis or B.t. san diego was cloned as described by Herrn~t~-lt C., et al. (TT~ t, C., Gilroy, T.E., Sobieski, D.A., Bennett, B.D. and Gaertner, F.H., Gene 57: 37~6 (1987)).

The 3.0 kb Hindm cont~ining crymA was cloned in pTZ18R (Ph~rrn~ri~). A clone wasselected that had the crymA C-t~min~l coding region ligated to the multiple cloning site sequence co..l~inil-g the EcoRI site. In order to clone crymA in pSB070, a unique NcoI site was er-pinr~red at the translation start site ~ltili7in~ the ATG codon. After the NcoI site was engin~ered, the crymA coding region was excised from pTZ18R with NcoI and EcoRI, and cloned into pSB619, from which the CryIC coding region had been lGlllo~d.

Both pSB009 cor.l;~i..il-g the cryIIA operon L~ in pTZ19R and pSB070 cont~inin~
cryIIIA coding region with the cryIC promoter and the cryIA(c) t~-min~tor were rligest~d with Apal and Ncol. A 5667 bp fragment of pSB070 and the 1800 bp fra~rn~nt from pSBOO9 cont~ining the cryIIA operon were isolated. The L~...rnt~i were ligated together. t'o...l~t~.~t E. coli DHSa cells were tran~runllcd and colonies were sel~orted on LB plates co..l;~;ning 75/,ug/ml ampicillin at 37C overnight. The DNA from twelve colonies was (liEest~d with Afm+NotI to identify the isolate C~ g the desired operon c~cc~tte The pl~smid was decign~ted pSB010.

The cryIC gene was cloned into the pSB010 cryIIA operon c~ccette pSB619 was obtained as described above in Example 3. The full length cryIC coding region was obtained by ~iigesting pSB619 with NcoI, EcoRI and Bgm and icol~ting the 3900 bp NcoI EcoRI fr~gm.ont The ~O 94/25611 ,2 ~ ~ 9 3 2 3 PCT/EP94/01249 operon c~cs~ttto vector, pSB010, was ~ligest~d with NcoI+EcoRI and purified. The 3900 bp cryIC fragment was ligated to the a~pl~liate pSB010 NcoI-EcoRI fr~gm~nt The ligation reaction product was used to transform DHSa and colonies were selected on LB plates cont~ining 7511g/ml ampicillin. The pl~cmi-l DNA from twelve colonies was analyzed by restriction digests (Afm + EcoRI and Afm + Bgm). The plasmid c~csett~ col,t~;";"g the full length cryIC gene dowllsll~ of the cry~A operon was decign~tr-d pSB013.

FYI ~ 5: Constructiton of pSB304 Plasmid pSB304 was obtained by cloning the cryIIA operon from B.t. g~ ri~ HD232, a B.t. strain available from the USDA. To clone the operon, DNA from B.t. g7~ ori~e HD232 was ~ligested with Hin-lm, and fr~gm~ntc of about S kb were pllrifiPd by gel cle~l.uphoresis. The gel-purified fr~gmrntc were ligated with Hin-lm-cut pTZ18R (Ph~rm~ci~) and tr~ncfectr(l into E.coli DH5a. The clone col.lA;~ g cryIIA was probed with a cryIIA-specific oligonucleotide (CCCATGGATAATGTATTGAATAGTGGAAG), SEQ. ID.:27. The clone co.~ g the cryIIA and lacZ genes in the same ol; ~t~lion was chosen. The DNA was purified from the selected clone and a BamHI fragment encol~ c~ g the w~wdllled U~ ,alll sequence of the cryIIA operon was removed to produce pSB304. Further i"Çollll~ion on the sequence of the cryIIA operon and its 5' region can be found in Widner et al. (Widner, W.R., and Whiteley, H.R., "Two Highly Related TncPctiridal Crystal Proteins of R~cillllc thllrin~iensis subsp.
kurstaki Possess Different Host Range SpecifiritiPc"~ J.Bacteriol. 171: 965-974 (1989)).

F.~..."l~ 6: Construction of pSB147 Plasmid pSB140 was obtained as described above in FY~mple 2. Next, the cryIIA operon was added to pSB 140. The source of the cryIIA operon was pl~Cmid pSB304 ~es~ ;hc~l above in Example 5. pSB3()4 co..~ s the cryIIA operon from B.t. g~llPri~ HD232 cloned as a R~m~/Hin-lTTT
fragment in pTZ18R. Plasmid pSB30 and pl~cmid pSB140 were ligest~ with EcoRI and ~TintlT~T The large pSB140 fragment was purified and the cryIIA operon EcoRI-~in-lm fragment was ligated to the large pSB140 fragment to yield pSB141.

The next step was to add an hltcgration target site to the vector. The target site was a fragment of DNA that carried the phosph~titlylinositol-specifi~ pho~holipase-C gene (plc) from the HD73 strain of B.t. kurstaki obt~it.~ from the USDA. This DNA fi~lll~ was iCol~t~cl from WO 94/25611 - ~ 5 ~3 3 ~ 3 PCT/EPg4/01249~

HD73 total DNA using the polyu,~se chain re~ction Total DNA was e~tr~ted from B.t.
kurstaki HD73 using the ASAP kit accolding to the protocol from Boellringer ~S~nnh~im The DNA seq~ nce of the plc region from B.t. strain ATCC 10792 was obtained from ('~nh~nk (~rc~occion number X14178) and is ~s~ribeA by Tprhn~or et al., (Lechner, M., et al., Mol.
Microbiol. 3: 6Zl-626 (1989)). In addition to the plc gene, this 2254bp sequenre col.Lail~ed 454bp u~s~ of the plc gene and 810bp do~usL~ . Two ~ , Phosl and Phos4, described above in Table 2, were decign~ to hybridize to the s~ucnces that flank the plc gene. These pliule~ were used in a polylll~l~se chain reaction with HD73 total DNA temrl~te to gel,~,.dle a 2.2kb fragment carrying the HD73 plc region. The PCR product was treated with the Klenow fragment of E. coli DNA polyL.-~,.ase I and cloned into pUC18 cut with Smal to gcl.clal~ pSB139.

Plasmid pSB139 was Aigest-A with KpnI and Bam~II and the plc region was isolated from the vector sequences. Plasmid pSB141 was also cut with KpnI and BamHi and the resnlting fr~mPntc were ligated with the icol~teA plc region. The res~lltin~ col~sLlu~;l, pSB141.5, carried the pBR322 portion of pl~cmiA pSB141 and the plc region from pSB139.

Next, plasmids pSB141 and pSB141.5 were used to gcne.ale a pl~cmiA that contained ermC, the plc region, and the cryIIA operon. Plasmid pSB141.5 was Aig,octecl with BamHI. Plasmid pSB141 was digested with BamHI and the fragrnent carrying the cryILA operon and the ermC
gene was isolated. The cryIIA/ermC BamHI Lay,lllent was ligated to the li"r~ 1 pSB141.5 to form pSB147. A map of pSB147 is shown in Figure 6 and the derivation of pSB147 is shown in Figure 2.

Example 7: Introduction of Hybrid Plasmid into B.t. by Electroporation Crystal genes were integrated into the B.t. cells by cle~,L~ Ling pl~cmi~ic (clecllotl~nsform~tinn). The pl~cmidc did not contain a gram-posiLi~ origin nccf~c~.y for replication in the cell. Instead tney carried a region of DNA that acts as a target for int~.gr~tion into the chromnsom~, the phos C region; and a se~ hle marker providing reCist~n~e to erythromycin. The pl~cmi~l elecL,u~lated in high con~e -l aLiOllS was forced into the chr~ osollle via a single cross~ver event, which causes a duplication of the target site.

~o 94/25611 2 1 5 9 3 2 3 PCT/EP94/01249 Cl~u...osom~l in~ L~ of strain HD73, using pl~cmi~lC pSB147 and pSB210.2, were obtaincd using this technique. Other strains, h~ ,., proved recalcitrant to clcclruyuldLion~ and could not be transformed at high effi~ ies to allow chromosomal integr~tion to occur. Co...~ .t cells were ylGp~cd by inoc~ tin~ 100ml of Brain Heart Infusion media (Difco) c~ i..g 0.5M sucrose (BHIS) with a white di~yosable loop of cells from a fresh overnight LB plate.
The cells were grown in a 1 baffled flask at 37C and 300rpm to an O.D. of 0.2 at 600nm, after which point, the cells were kept on ice. All wash sollltionc used were cold. Cells were transferred to sterile 250ml bottles and pçll~ted at 6000rpm for 7 min. The cell pellet was washed once in one volume and washed twice in 1/10 volume of 0.5M sucrose, 5mM HEPES
pH7. The pellet was r~3~n~led in a final volume of 10ml of the HEPES-sucrose solution.
Freshly-ylepd~d cells were used for ele~;Llu~ulalion of int,eEla~ive pl~cmi-lc.

Plasmid DNA was mixed with 200111 of c~ t~ .1 cells. Pulse y~"...- t~ ~ for HD73 cells were kV = 1.25, ~F= 3 and Q = ~. After the pulse was deli~ ,d, the cells were transferred to Sml BHIS in a 125ml flask and were allowed to recover at 30C, with ch~kin~ at 250rym for 3 hrs.
For the intcgldtiv~ vector s~llyles~ the cultures were p~llet~tl at 7,000rpm for 5 min and plated on LB with 10,ug/ml el~ llycil~.

pSB098 was used as control plasmid DNA to ~ ---li.-f the tran~rcllllaLion efficierlcy of the ele~;Llupoldtion plucelu-e. pSB098 is a shuttle vector COl~t~ining pTZ19R (Ph~rrn~ci~) and pBC16.1. pBC16.1 is a B. cereus vector constructed by Kreft (Kreft, J., Mol. Gen. Genet.
162:59 (1978)). pTZ19R and pBC16.1 were both ~liges~e~i with EcoRI. The ~ edliGed pl~cmi-1s were ligated into one plasmid, pSB098, in which the ampicillin and tetracycline l~c;~ e genes have opposile polarities.

Competent cells of strain HD73 were cle~tlulldnsformed with pl~cmicl DNA icol~te~ from a dam-, dcm- strain GM2163. The results are given in Table 3 below. Ad~lition~lly strain HDl-51 was transformed with plasmid 210.1 (data not shown).

WO 94/25611 2 1 ~ ~ 3 ~ 3 PCT/EP94/01249~

Table 3: Tra~r~ ~udtion E~ficiency of B. Il,~l~iensis k~ .l~ ID73 F.rr.. ;- ,.c~
Plasmid AmountAmount Number of (t~ fJ.. ~ t~/
g) (,ul) ~ g pSB098 DNA) pSB210.2 9 10 3 3.5x105 pSB147 15 10 82 x lo6 The efflcienry given in the final column of the table was d~t~ fd for each e~ t by ele~;Lropo,aLillg 0.51~1g pSB098 and c~lrul~tin~ the llulll~r of colony-forrning units obtained per llg DNA. This gave an estim~t~ of how well the cells responded to the conditions of the ele~;L,opor~Lion. No transfo""a.,L~ of pSB210.3 were obLained.

The HD73 strain of B.t. kurstaki was obtained from USDA (Bacillus th~Iringier~ Cultures Available from the U.S. D~p~Ll"ent of ~grirIlItllre, USDAIARS ~grirIlltl~ral Reviews and ~n~ ARM-S-30 October 1982).

The transformants, also referred to as r~ co",bill~,L~ or ll~lsr~L~.l~ were analyzed by PCR for gene content. Recombinants of HD73 co,~ the pSB210.2 sequences (HD73::pSB210.2) were screened for the presence of the cryIC gene using primers galpl and galp2 and the ermC
gene using p~illler~ PG2 and PG4. Two of the eight HD73::pSB147 clones were cunfil",cd to have the cryIIA gene using primers cryIIAI and cryIL~2 and the ermC gene with PG2 and PG4. The primer sequences are provided in Table 4 above. A profile of the pl~cmidc showed the HD73::pSB210.2 5 recombinant to be jrlPntir~l to its parental strain, HD73.

Example 8~ ..r..tion of Phage for F~ sp~ stion of Hybrid 1 Phage CP51 was obtained in filter discs ih e~ t~d with infected spores of B.cereus strain 569 according to the method of Thorne (1978), supra. The strain was revived by inocul~ting 25ml NBY (8g Difco Nutrient broth, 3g Difco yeast extract/L) broth cont~ining 0.4% glycerol (NBYG) with one of the discs and growing at 37C for 16 hrs. The culture was harvested, the cell debris spun down at 10,000rpm, and the phage lysate stPriIi7Pd by passing through a 0.45~1M filter and stored at 16C.

~o 94/25611 ~ ii 9 ~3 ~ 3 PCT/EPg4/01249 The titer of the lysate was dete. .~ r~ by assaying against a phage-free isolate of strain 569.
The lysate was diluted 10 and 100-fold in 1% ~ .e. A~ alely 106 cells of 569 were mixed with 100111 of the diluted phage and added to 2ml of TBAB (Difco Tryptose blood agar Base) soft agar. This was plated as an overlay onto Phage Assay (PA) plates (8 g Difco n~lll;P,Ilt broth, 59 NaCl, 0.2g MgSO47H20, 0.05g MnSO4H20, O.l5g ~ ~20/Q, pH 5.9-6.0) which had been dried overnight at room h.lll~.dlul~e. The plates were ;.-e.lb~ l at 30C
overnight and plaques were conntçd To test for ~usc~libility to infection by the phage, a~l.J~;...AIely lo6 cells of each strain of interest (SAl l, SA12, S287 and HD73) were plated as an overlay on PA plates. The surface of the agar was gently touched with an inoclll~ting loop of the phage stock and the plates in~ub~t~d at 30C. The next day cl~oAnng was obs~ d on the cell lawns of all four strains.

FY~mple 9: Propagation of Phage Cells from a fresh overnight plate of HD73::pSB210.2 were used to inoclllAt~ 6ml LB in a 20mm tube. The culture was grown at 37C for 4 to 6 hrs., its optical density dct~ ,l,ed, and the cells diluted with LB to a co~ dlion of 3xlO6cells/ml. NBYG plates were overlayed with 4ml NBY soft agar with O.5ml CP51 phage stock COIIIA;~ 4Xl06 PFU's and either lX106 or 3Xl06 cells. The plates were il.~ l,A~id overnight at 30C, and the phage were harvested in 5ml PA broth. The top agar was macerated in the PA broth and transferred to 18mm plastic tubes. The cell debris was pe~ t~ The lysate, labeled CP210.2, was sterili7~-d by passing through a 0.45~n filter and stored at 15C.

To ~ the titer, 5Xl06 CPU of strain HD73 were mixed with 1001l1 of 10-2 and 10~
ilntion~ of lysate CP210.2 and poured as an overlay on PA plates with 2ml NBY soft agar.
After overnight in~ubAtion at 30C, the 10~ plate had 1200 plaques and the titer was csl;... ~Pd to be 1.2x108 PFU/ml.

FYsmple 10: D~ ation of Conditions for Transduction The methods used for hAnrlling the phage were based on those desr-ibed by Thorne (1978), supra. The colony-forming units (CFU) per ml and the titer of phage stocks in plaque forming units (PFU) per ml of each B.t. strain were ~ -".;"~d by serial dilution.

Wo 94/25611 ~ ~ ~ 9 ~ 2 3 PCT/EP94/0124~

The titers of CP51 phage stocks were d~L~ r~ as follows. 0.1 ml of the phage diluted in 1 % r~Lone and ~lu~ ly 2X107 spores of B. cereus 569 were added to 2rnl of PA soft agar and the inoc~ tçd soft agar was overlayed onto PA agar plates. The overlayed plates were inrub~t~d at 30C for 16 to 20 hrs. The plaques were counted and the PFU/rnl of phage stocks were ~l~te ..-;--~d from the rlilutionc used. The cell conce,.ll~Lions of B.t. cultures were deterrnin~d by standard m~tho~lc used in the art. The results are shown in Table 4 below.

Table 4: Detern~ination of Colo~ies (CFtJ) of B.t. Cells and Stock of Phage Titer (PEIJ) CFU CFU/rnl B. cereus strain 569 5 x 10' B. thurin~isnci~ strains HD73 8.6 x 108 SA11 and SA12 2.6 x 108 S287 1.1 x 107 PFU PFU/ml CP51: 8 x 106 CP210.2: 1.2 x 108 ExamPle 11: Construction of pSB136 Plasmid pSB 136 (described in Figure 7) is an integration vector which facilitates insertion of the cryIC
gene into the B.t. ch~ull~osomp The pSB136 vector carries the cryIC gene, an integration target site, a t.,l,acycline rçsict~nre gene, and a portion of the pBR322 vector. The cryIC B.t.
aizawai HD229 gene and the pBC16-1 B. cereus pl~cmi-l tetracycline recict~nre gene (tetr) were cloned. The integration target site wa~s a fragment of DNA of unknown function from the B.t.
kurstaki HDl cryB chromosome.

The pSB136 pl~cmi-l may be used to place the cryIC gene in the chromosome of any B.t. strain that is not already lcLr~l~;ycline ~ For integration to occur, however, the .ecil.;c.nt strain must have sequences homologous to the int~ tion target and the strain must be efficiently transformed (2 104 tran~ ; per mi-;lu~r~.. tran~Ço---~ g DNA).

Co..~ t~-nt E.coli DH5~x were ~ d by the method of Al~Y~n-l~r (~l~y~ntler (1987), supra).
The transformation was c~ ucted by --~ !I-o~ls well known in the art using Library Ff~lriçnry ~15~3~
~o 94/25611 - - - PCT/EPg4/01249 DH5a Co...l~tc-.l Cells (Gibco, BRL, Life Technologies, Inc., (~ lJùlg, MD).

The selection for transforrn~nte was cQnr11lct~d on LB col.lh~ g 75,Ug/ml ampicillin.
Restriction el~yl~e digestions, li~tionc, ethanol p,~ on, phenol extractions, kinase reactions and the l,eht.~ t of DNA with T4 DNA polylllel~se, calf il~r.~ lk~lin~phosph~t~ee and the Klenow La~lll.,nt of E.coli DNA polyll,~ se I were co~lnct~l by the m.o.tho~ls of Maniatis et al. (l~ni~fi.e,T., et al., "Mol~c~ r Clonin~- A Labo,~tol~ Manual", Cold Spring Harbor Labu~alo,y, Cold Spring Harbor, NY (1982)).

B.t. kurstaki HD1 cry-B is a pl~emi-l cured strain of HD1 desrribe~ by Stahly et al. (Stahly, D.P., et al., Biochem. Biophys. Res. Cornm. 84:581 (1978)). Total DNA was icol~t~r1 from B.t.
kurstaki HD1 cry-B by the following mto.th~ 200ml of 2XTY were inocul~t~d with B.t. and incubated at 30C overnight with baffling at 200 rpm. 200ml of 2XTY were inocul~tPd with 2ml of the above culture and illl-ub~t~ at 30C with baffling at 300rpm. Cells were collected by centrifugation at 10,000 rpm for 5 min. at 4C when the optical density of the culture reached an OD60,, = 0.8 to 1. The cells were washed withTES (TE+100 mM NaCl) andsuspended in 18ml 25% sucrose +25mM TrisHCl (pH8)+25mM EDTA. 2ml of 10mg/ml lysozyme were added to the sucrose solntio~ and mixed gently. The l~ Ul~, was inrl-b~t~l at 37C for 30 to 60 min. and çh~cL~od for protoplasts. 2.2ml of 20% SDS were added, mixed gently and inrub~qted at 50C for 15 min. 5.5ml of 5M NaCl were then added, mixed gently and inr~lb~t~d at 50C for 5 min. and at 4C overnight. The l~ lulG was ce~ ifuged at 10,000 rpm for 10 min. at 4C and the ~u~ placed into 2 tubes. 28ml (56ml total) of cold EtOH were added, mixed gently, ;~ ubA~ overnight at -20C and then cer~LIiruged at 13,000 rpm for 30 min. The ~nGci~ ale was leco~elcd and washed in 70% EtOH. The ~ was then dissolved in 10rnl (20rnl total) of lM NaCl in TE and ;.~rub~ at 4C overnight. The two tubes were then COlll~i lcd into one tube. 200111 of 1 mglml RNase and 1200111 of 10mg/rnl proteinase K were added and the llii~-lulc was inrub~t~ at 37C for 30 min. 20ml of phenol/chloroform we~G added and the ~ ulc was cPntrifuged. The aqueous layer was c~ llectç(l and washed twice more with 20ml of phenol/chlolufollll. 20ml of chlo,ofc,lll~ were added to the aqueous layer and c~ iruged. The aqueous layer was coll~o~tt-d and dialyzed against 2000ml of TE ovemight WO 94/2~611 2 ~ ~ 9 3 ~ 3 PCT/EP94/01249~

The plasmid DNA for cloning was isolated from E.coli cells by ~Ik~lin~. Iysis (Birnboim, H.C.
and Doly, J., "A Rapid Alkaline Extraction Procedure for Screening Rcc~...h;.~nt Plasmid DNA", Nucl. Acids Res. 7:1513-1523 (1979)) or with Qiagen columns obtained from Qiagen Inc.

The construction of pSB136 was divided into the four parts (~r~ .cc is made to Figure 7).
In the first step, the tetracycline reSict~nre gene from pBR322 (which functions in E.coli) was repl~red by a tetr gene filnction~l in Bacilli. Next~ an integration target site was added, a piece of DNA of unknown function jCQI~tÇd from the HDl cryB ~erlr,m~ In step three, a NotI linker was added to farilit~te cloning the cryIC gene. In the final cloning step, the cryIC gene was added to the integration vector. Each of these steps is ~Pscrihç(l in more detail below.

Plasmid pSB206 was constructed by cloning the tetr gene from pBC16 (Bernhard, K., et al., J. Bacteriol., 133:897-903 (1978)) into pUC18. Plasmid pBCl~1 was generated from plasmid pBC16 by removal of an EcoRI fr~gm.ont by the method of Kreft et al. (Kreft, J., et al., Mol.
Gen. Genet., 162:59-67 (1978)). The tetr gene was isolated from pBC16-1 using the poly.ll~ldse chain reaction with primers Tet3 and Tet4 described in Table 4 above. Primer Tet3 introduced a Hindm site U~ ll of the tetr gene a~d primer Tet4 introduced a KpnI site downstream of the tetr gene. The PCR product was inserted into pUC18 at the polylinker cartridge HindII site.

To remove the tetr gene, plasmid pSB206 was tlig~sted with SmaI and ~inrlm To remove the tetr gene from pBR322, this pl~cmi-l was cut with AvaI, treated with the Klenow fragment of E. coli DNA poly~ dse I to ~;e~,elate blunt ends, and then ~ligest~d with Hin-lm The desired fr~gmPnt~ were purified and the pBR322 vector was ligated with the tetr gene from pSB206 to gencl~le pSB131.

An integration target site was then added to pSB131. The source of the target site was a l.lkb DNA fragment isolated from 10 the HD1 cryB gçnom~. This fragment was cloned in pUC18 and the construct was named pSB132. The l.lkb DNA fragment from HD1 cryB was isolated as follows. Total HD1 cryB DNA was restriet~l with Haem or EcoRV and the two digests were mixed and ~u~,jc~;lcd to cle~iL,ol.horesis on an 0.8% agarose gel. Three size 15 fractions ~O 94125611 2 :L 5 9 ~ 2 3 PCT/EPg4/01249 were cut from the gel: (1) O.5kb -0.9kb; (2) O.9kb -1.8kb; (3) 1.8kb-2.7kb.

The DNA fractions (1) and (2) were p-~rifi~d The DNA from fraction (2) was ligated into pUC18 cut with Smal and the resllltinp; clones were char~rt~ri7~ by EcoRI/Hindm digests.
The pl~cmi~ called pSB132 had a l.lkb insert.

The l.lkb cryB fragment was then llansr~ d from pSB132 to pSB131. Plasmid pSB132 was digested with EcoRI, filled by 25 tlc~ n~ with the Klenow fragment of E. coli DNA
Polymerase 1, and digested with ~in~lm Plasmid pSB131 was cut with SspI and ~inrim and ligated with the purified 1.1 kb fragment from pl~cmi~l pSB132 to yield plasrnid pSB134.

A NotI linker was added to pSB134 to fa~ilit~te ~ itinn of the cryIC gene. The sequence of the NotI linkers was pAGCGGCCGCT (New F.ngl~nrl Biolabs #1125, SEQ ID No. 28).
Plasmid pSB134 was digested with Bam~ and blunt ends were gcnelaLed by Llc~ !lt with the Klenow fragment of E.coli DNA polymerase I. The NotI linkers were then ligated to the lin~ri7~cl pSB134 in a 200:1 molar ratio and the res~llting con~ el was named pSB134.5.

The final step was to add the cryIC gene to pSB134.5. The source of cryIC was plasmid pSB619, described above in Example 3. pSB619 carries the cryIC gene from B.t. aizawai HD229 preceded by its native promoter and followed by the B.t. kurstaki 10 HD73 cryLA(c) terrnin~tor. The cryIC gene with the ~lolllot~r and 1~ ol were cloned as an ApaIlNotI
c~csettP in blnescrirt KS(+). To isolate cryIC, pSB619 was cut with ApaI, filled with T4 DNA
polymerase, and digested with NotI. Plasmid pSB134.5 was cut with EcoRI, filled by t with the Klenow fid~ nt of 15 E.coli DNA polylll_~ase I, and then cut with NotI.
The cryIC c~ccett~- was purified from the vector portion of pSB619 and ligated into pSB134.5 to gencldte pSB136.

F.~ ,".l~ 12: Introduction of cryIC Gene into B.t. kurstaki Strains HD1 cryB and IID73 Plasmid pSB136 was constructed as des~ribed in F.Y~mrle 11 above. It co~t~inc the cryIC
gene, the gene encoding ~LIa ;ycline re~ict~n~e from pBC16.1, and a portion of DNA from the HDl CryB chlo..,osom~ of unknown function which æts as an integration target site. These fragm~ntc were ligated into the pl~cmid pBR322.

WO 94/25611 2 :~ ~ 9 3 ~ ~ PCT/EP94/01249~

C~C""l~,t~."t B.t. h-rst~ki HD1 cryB and HD73 cells were ~ d accor~ing to the BHIS
protocol described in FY~mrle 6 above. After delivering the el~fri~-~l pulse, the cells recc)v~.~d in Sml BHIS for 3 hrs. at 37C. The pulse p;~AIl~ t~ ~ for the HD1 Cry B cells were l.O5kV, 25~LF, R = ~. The pulse pa~ for HD73 cells were 1.25kV, 3,uF, R = ~.
Following ele~,~upolalion, the entire culture was pell~tec~ u~nded in a small volume and plated on scleeli~v~ media. pSB098 DNA was used as the standard for dete....i..;..g transform~tion effiri~-nry, and for each e~ ,;...- Qt the err.~ n~-y was e~lessed as colony-forming units (CFU's) per ,ug of pSB098 pl~cmi(1 In the HDl CryB cells, one t~il~ycline-resistant colony was obtained when 7-51lg of the pl~cmi-l pSB136 was elcchu~ te~ into the cells. The overall eMri~nt~y of transformation of the cells was 6 x105 CFU/,ug (using pSB098). This new l~,Cû~ hi n_.~l strain, CryB: :pSB 136, was shown to contain the tetracycline-le~ -re gene and the cryIC gene by PCR analysis described below in Example 13.

CryB::pSB136 was grown in CYS ...~ -... to sporulation. lt had 4X108 spores/ml, compared to SX108 spores/ml for HD1 CryIB in the same e~ t The l~l,a.;y-;line.~ci~l~nce gene was 98% stable through sporulation and germin~tion In HD73 cells, two colonies were obtained when 1511g of plasmid pSB136 was electroporated into the cells in an esl.e,;...~ nt where the overali eff~ n~y was 2X106 CFUllg DNA. Both colonies, deci~n~ted HD73::pSB136, were posi~ for the cryIC gene and the tetracycline-resict~nf~e gene by PCR as des~ril e~i in FY~mrl~. 13 below.

FY~n~PI~ 13: PCR 5~ Of CrYB::PSB136 and HD73::pSBl36 ReCOmbinant Stra;nS
The presence of the introduced cryIC gene and tetracycline recict~nre marker in the CryB::pSB136 and HD73::pSB136 5 .~colllbil.ed strains was conr.. Pd by PCR. Cells from a fresh overnight plate were boiled for 10 min. in 8~1 of a solution Col~ln;ll;llg the nr~eccs., y primers (0.5~11 of 20~M stock solution) and the dNTP mix (1.6111 of 1.25mM stock solution) in 1 x Taq polymerase buffer. Cell debris was pellPtted and 2~1 of a solution co~ ;n;l-g 0.05 unit Taq polymerase in 1 x Taq polymerase buffer was added. Two primer sets were used to screen for the t~acycline recict~n~e gene. The cc"~ ,d~-on of Tet3 with Tet4 produced a 94/25611 ~ 3 PCT/EP94/01249 fragment ~pi-,ki...~tely 1.4kb, and the combination of Tet3 with CP01.Rev gave a fragment appro~im~tP~ly 0.35kb in size. To screen for the cryIC gene, ~lilll.,~ galPl and galP2 were used to produce a 0.8kb size fr~nPnt Primer se.lu~,.lc~s are given in Table 2 above.

F.Y~rnl~le 14: Introduction of cryIC and cryIIA GeneS into B.t. kurstalci Strain HD73 Placmid pSB304 was constructed as ~Psc-~ibed in Example S above. The cryIIA gene wac isolated from pSB304 as a NotI-EcoRI fr~mPnt pSB134.5 was constructed as desr~ in Example 10 above. The cryIIA NotI-EcoRI fragment was ligated to pSB134.5 cut with NotI
and EcoRI to form pl~cmitl pSB134.5.2.

Comret~Pnt HD73 cells were p~p~d acco~dillg to the BHIS protocol ~escribecl in Example 6 above. After delivering the elp~ l pulse, the cells rcco~ ed in Sml BHIS for 3 hrs. at 37C. Pulse palAI~ te~:~ for HD73 cells were 1.25kV, 3,uF, R = ~. Pollowing ele~,huporation, the entire culture was pell~t~l ,.,s~ en-l~ in a small volume and plated on selective media.
As in Example 12 above, pSB098 DNA was the standard for ~let~-.l-...i..g transforrnation efficiency and the 11dI1SrOIIIIhI;On effici~nry was G..~,essed as colony-forrning units (CPU's) per/llg of pSB098 DNA.

Ten colonies were obtai"ed from the ele.,LIo~o~dlion of the HD73 cells with 20~1g of the pSB134.5.2 plasmid. The tran~.ro,l"~Lion efficiency was lx106 CFU/,ug DNA. Two of the tran~re~ L~ proved ~osili~, for the t~-h~c~rcline ,e~ .re and cryILA genes by PCR analysis described in Example 15 below. The two tran~.r~ f'; were rlP~ci~ttocl HD73::pSB134.5.2.

F.Y~mrle 15: PCR Screening of HD73::pSB134.5.2 Recombinant Strain The ~ sence of the introduced cryIIA gene and t~h~clillc l~;C~ re marker in the HD73::pSB134.5.2 lecol~l'bil,ants was collr,lllled by PCR as d~sr~ihed on Example 13. To screen for the cryIIA gene, the plilll~ . cryIL~l and cry~A2 were used to produce a 0.57kb fr~gmPnt Primer sequences a;e given in the Table 4 above.

Example 16: Trancduction of B.t. Strains Generalized tr~nC~luction was cond~ctrd to transfer a crystal gene which had 'neen integrated into the c~ol"oso",e of one strain to tne ~;L,u...oso...r, of a strain not easily transformed by WO 94/25611 21~ 9 3 2 3 PCT/EP94/01249~

elccL,up~"aLion. In these cases one strain co~ g an integrated crystal gene, HD73::pSB210.2, was used as a donor for DNA to tr~nctl~ce several B.t. strains in~lu~ing st ains SA11, SA12 and S287.

Generalized trAncduction as a means of genetic e~rh~nge has been widely used and well chararteri~e~ for E. coli and S. lyph;l~ by Margolin and used so~ at for R~rilluc thnringiçncic as desrribecl by Thorne (1978) (Margolin, "F.cch~rirhi~ coli and Salmonella Ly~hi~ ", Cell. and Mol. Biol., (1987); Thorne, "Tr~ncduc.tion in R~rillus th-lringi.o.rlcic", Applied and En~iro~ l Microbiology, 35: 1109-115 (1978)).

The generalized tr~ncdnçing phage CP51 iC5~1~t~d from soil and used in Bacillus cereus chn".,osomal mapping ~ .f.;...fl.l~ was ol~tail~ed from Thorne, C.B., (Thorne, C.B., "Tr~ncd~lring R~rteriophage for R~cilll-c cereus", J. of Virol., 2:657-662 (1968) and "Tr~ncd~rtion of R~rillllc cereus and R~cillllc z-~ ric", R~ct~riQlogical Reviews,32:358-361 (1968)). Thorne et al. further tested the phage against other strains of Bacilli, inrh-(ling B.
thnringi~ncic as desc,ibed by Thorne (1978), supra.

Cells of strains SAl l, SA12, S287 and HD73 were grown acco,.lillg to the method described in Example 8 above and diluted to ~p~r.~ ly 107 CFU/rnl.

The ,~co",binant strain HD73::pSB210.2, isolate nU111~ 2, was used to propagate phage CP51.
The titer of the resnltin~ lysate, named CP210.2, was e~l;...~ I~A to be 1.2 x 108 plaque forming units (PFU) per rnl. A sterile HA filter (Millipore) was placed on the surface of an LB plate then 100111 each of phage lysate CP210.2 and cells were pirett.ocl onto the filter and gently rnixed using a sterile wire spreader. The plates were in.~ .ted at 37C for 3 hrs. The filters were transferred to LB plates with e.y~lollly~in (lOIlg/rnl), retumed to 37C, and allowed to grow for 36 hrs. The results of the plate tr~n~d~lctions are given in Table 5 below.

~o 94/25611 ~ 9 3 ~ 3 PCT/EP94/01249 Table ~: r~ ltc of Transduction E~ ents Strain CFlJ's plated Mllltir!icity Eryr F.ffisje.n~y of Infection Colonies HD73 1 x lo6 10 2 1.6 x 10-7 SAll 4 x 106 3 4 3 x 10-7 SA12 4 x 106 3 2 1.6 x 10-' S287 1 x 106 40 3 2 x 10-8 The e~lci~n~y is c~ ssed as the nLl-ll~. of elyLl~o.nycin reCiCt~nt colonies ob~il,ed per plaque-fo~ning unit. For HD73, SAll and SA12, 1.2x107 plaque-forming units were plated.
For S287, 4x107 PI;U were plated.

FY~ le 17: Polymerase-Chain Reaction Screening of Recoml-inQ~l~ Strains PCR screel~ g of all .~co..lb~ant strains was done using whole cells as described in Example 13 The c~ ul~yci-l-resistant colonies, denoted by the abbreviation "CP", were analyzed by PCR for gene content co.l.p~,d to wild type strains. The results are displayed in Table 6 below.
Table 6: Gene content of Ir~l~ductants by PCR

Strain: IA(a) IA(b) IA(c) IIA IC errnC
SA1 lWT + + + +
SAl lCP1 + + + + + +
SAl lCP2 + + + + + +
SAl lCP3 + + + + + +
SAllCP4 + + + + + +
SA12WT + + + + - -SA12CPl + + + + + +
SAl2CP2 + + + + + +
S287WT + + + +
S287CP1 + + + + + +
S287CP2 + + + + + +

The recombinants retained the array of crystal genes found in the parental strains. Only the recombinant strains were positive for the p.i...~.~ speçifi~ to the introduced cryIC and ermC
genes. When screening for the cryIA(b) gene, the combination of TY6 and TYl4 probes sc~ above in Table 2) was used initially but this pair showed some cross-reaction with O 94/256~ L ~ 3 PCTIEP9~/01249 the control pl~cmitl pSB210.2, which cont~inc only the cryIC gene. In ~ .se~luent e~
TY13 flPscribe~l in Table 2 above was ~.-l,s~ ed for TY14.

F.Y~ 1~ 18: Comparison of Wild Type and Recombinant B.t. Strain Plasmids The plasmids of the lcco~l~bh~ant B.t. strains were isolated by the ~lk~linP Iysis procedure of Birnboim and Doly (1979), supra, n-nfl;r~f cl as follows. The strains were streaked on LB+tcLld~;ycline and grown overnight at 30C and restreaked on fresh SA (lX Spizizen salts, 1% c~C~-..ino~ri~lC, 5% ~lnros~P, 0.0005mM MnSO4H20) plates, and grown for 3 to 4 hours at 37C. For each strain, 2 to 3 loopfuls of cells were sucpPnfle(l in (100111 TESL 100mM Tris pH8, 10 mMEDTA, 20% sucrose, 2mg/rnl ly~o~ le) on ice and inrUb~tpfl for 15 rnin. at 37C.
200~11 lysis solution ~0.2N NaOH, 1% SDS) was added, mixed delir~tely by tube inversion, and the mixture was inrllh~tP~l for 5 min. at room tf ~ . 150,ul ice cold pot~csillm æetate solution was added and mixed by tube inversion. Next, the solution was centrifuged for 20 rnin at 15000 rpm and 4C. The S~lpf rn~t~nt was l~co~ d with a dis~osable, wide-bore transfer pipet and then added to lml of 100% ethanol and rnixed by tube inversion. The Illi~lUl~ was then centrif~lged for 20 rrun. at 15000rpm and 4C. The s~ e.rn~t~nt was removed by aspiration, and the pellet was le~u~ f~d in 1 ml of 70 Yo eth~nol, mixed by tube inversion and then centliruged for 5 min. at room temp. The s~ was removed by aspiration and the pellet was vacuum dried for 2 min. in a Speedvac. The dried pellet was sucpe~-led in 20111 of TE, incubated on ice for about 15 min., then mixed delicately by tapping the tube on its side.

The DNA was elf~;lluyhoresed in lxTAE, 0.8% agarose at 70V/32mAmp for 3 hrs. A pl~cmitl profile of these ,~,colll~il.ants showed them to be identi~l to their wild-type parental strains, confirminE that they did not carry ullw~lted pl~cmi-lc.

F,~..."l~ 19: Con-~,&r-_on of Wild Type and ~Iybrid B.t. Strain Chromosomal DNA
The chromosomal DNAs of the i~-~f ~ in strain HD73, and tr~nc~ ct~ntc in strains SAl l, SA12, and HD73 were analyzed by DNA to DNA hybri~ii7~tio~ e~ Three probe fra~m~ntc were isolated from pSB139.
(a) A general pho~pholir~ce C (phosC) probe e~tf nr1in~ 1800 bp from BamHI to ClaI
of the known phosC sequence.
(b) Eco left (EL) eYt~nflin~ 850 bp from E~amHI to ~coRI.

~o 94/25611 ,~ l 5 9 3 ~ 3 PCT/EP94/01249 (c) Eco right (ER), a 1427 bp EcoRI fr~gm~nt Chromosomal DNA from wild type HD73 as ~es~ 1 in FY~mpl~ 11 was isolated from 100ml s~mplec of cultures in 2XI~Y ",f~i"", (5g yeast extract, 5g LI~Lone, 2.5g NaClJL) Chromosomal DNA from wild type SA11, SA12 and HD73 and the co~ onding tr~n~ ct~ntC was isolated by using the ASAP kit from Boehrin~r Manheim, acconli.lg to the m~n~lf~rt~lrer's directionc Chlolllnsoll~l DNAs were tligestP~l to completion with EcoRI or ApaI, s~,~dL~d on a 0.8% agarose gel in TBE buffer co..~ g EtBr, depll-in~t~ denatured, neutralized and transferred to Hy-Bond nylon ~.,~ lalle by overnight capillary blotting in 20X
SSC accol.ling to the mefhod of Sambrook et al. (Sam~look et al., "Molec~ r Cloning: A
Labcl~ nll~ln, Cold Spring Harbor Labor~l.ly Press (1989)). The DNA was fixed to the membrane using 0.4M NaOH for 20 min. Southem hybri~li7~tions were ~.rolllled using the Amersham ECL kit acco.dillg to protocol.

The analysis by DNA hybri-li7~tion of EcoRI tlig~st~A DNA from HD73 and HD73::pSB210.2 using the large phosC probe revealed the ~ d 2.4kb and 4.3kb intern~l fragmPnt~ from the integration vector, pSB210.2, but did not d~,rllliLi~,ly show the ch,~o...Qs~ l regions on either side of the integration site or fl~nking regions. A large discl~,~an~;y b~ the dif~.~,nce in intensity of the internal vector bands and the bands which were later det~ Pd to be the ~nking regions inrlir~t~d that multiple integration events may have occurred. Further analysis of the same filter using the EL probe revealed not only the expected int~rn~l EcoRI fr~gm~t~
but also a 1.8kb band in the C~ OSO~ 1 DNA of integrants and wild type samples. This result shows that there is an EcoRI site 1.8kb U~ ll of the EcoRI present within the phosC
gene. Hybridizing with the ER probe showed the internal Ll ~ in the integrant sdlllplcs and an a~plv~ ely 9kb band in both the h~lc~ and wild type DNA, id~ nlirying the next EcoRI site dowlls~lc~ll from the internal phosC EcoRI site.

The pl~sencc of the same EcoRI bands u~,sL,ea~ll and dowlls~ ll of the phosC EcoRI site in both the wild type and all hltc~lahts proves that the integration occurred at the chromosomal phospholipase C region as expected.

A similar Southern blot analysis of the same DNA s~mp'~s digested with ApaI proved that WO 94/25611 2 1 ~ ~ 3 ~ 3 PCT/EP94/01249~

multiple inLegldlions had occurred. Ch,....osom~l DNA from an isolate in which a single integration event had oc-;ulled would show just two bands, each coll~sponding to ApaI
fr~gmFntc e~tenfling from the ApaI site within the integration vector, pSB210.2 to a wild type ApaI site on the chromosomes, either u~J~Llc:~l or dowl~sLl~dlLI of the integration site. Multiple integrations would produce the same u~ ealll and downstream bands plus an additional internal band coll~s~onding to DNA e~t~ g ~L~ l ApaI sites introduced by two tandem ~ c2~aLed vectors.

Southern analysis did show a 10.4kb fi~gTnF nt cc,ll~ onding to the full length of the integrated plasmid, intlir~ting that multiple ;..le~ ;o~i events had occurred in the region. However, the fl~nking ApaI cl~u"-oso-llal fr~gm~nt~ were not obs~ d nor could it be dl,te ...;~ l if more than two integration events had oc~ d. Southern analyses of EcoRI digested DNA from the tr~n~ r,t~ntC, SAl 1 CPl, SAl 1 CP2, SA12CPl and SA12CP2 using the EL and ER probes also revealed 2.4 kb and 4.3 kb internal ECORI bands, in~1ir~ting that the DNA carried in the tr~n~ ring particles was derived from the desired integrated phosC site. These internal bands were not present in the lanes co.~ g wild type SAl l and SA12 DNA. The probes also hybridized to the same size fl~nking bands, 1.8kb and ~ F-lY 9kb, as they did in wild type HD73, HDl-51, and the collG;.~onding illt~la~ e clllu...osu~ s of SAll, SA12, HD73 and HDl-51 are similar in the phosC area. The actual site of crossover events cannot be del~l...inF~cl using these probes.

~.Y~ 20: Stability and Viabilib of Hybrid B.t. Strains The recombinant strains SAl lCPl and SA12CP2 were analyzed for stability. The stability of the introduced genes was dF,te~ ed by growing the strains without antibiotic selection through sporulation and ge~nnin~tiorl The recombinant SAl lCPl and SA12CP2 and wild type SAl 1 and SA12 strains were streaked on LB plates and inr~lh~ted ovemight at 30C. A single colony from each plate was used to inoculate a separate 100 ml CYS culture in a 500ml baffled flask. The cultures were grown at 30C with baffling at 300 rpm. When cultures reached an A600 of 0.8 they were diluted 1:10. The growth of the cultures was lllonilu.~d each half hour to dcte~"~il~e growth curves.
~ollowing the transition from log phase to st~tion~ry phase, the cultures were grown for an .

~O 94/25611 ~ 9 3 2 3 PCTIEP94/01249 ~AAition~l 48 hrs. 1 10 AillltionC were made for each sporulated culture and the dilutions were heated at 65C for 45 .l~ s.

It was ~ I-.Pd that the ~mp'e~ co,~ d ~ i~ately 109 spores/ml. The samples werediluted and plated on LB. The ~ h"r~ of gçrmin~terl spores of the l~colllbhlant strain were colll~aled to those obtained for the wild type. Fifty to one hundred of the colonies were replica-plated onto LB with ~.yil~ulllycin and onto LB alone and ;~ uI,~t~ A at 30C ovçrnight The pelcent~ge of colonies ret~ining the se~ l le marker was A~et~ (l against the number of viable colonies.

The newly introduced genes were found to be 100% stable through sporulation and germin~tion, as d~,tell.-il-cA by the continl~d les;~ cc to e~yllllulllycin and by the ~lesence of the cryIC and ermC genes ~et~te~ by PCR. No ~yolllal~ccJus elylhlvlllycill- resistant colonies were obtained. The rate of growth of these lecolllbillants in CYS was eccerlti~lly the same as their parental strains over the first 8 hrs. 9.3 x 107 and 1.5 x 108 spores per ml were estim~tecl for SAl l (Wl ) and the l~,colllluin.-ul SAl lCP1, ~s~ ,ly. 3.5 x 107 and 3.4 x 107 spores per ml were es~ for SA12(WT) and the n,colllbi,l~ll SA12CP2, l~,s~e~ rely. The introduced genes had no deleterious effect on the viability of the l~,co...hi.l~llt strains.

F.Y~mr)le 21: Expression of Gene Product in Hybrid B.t. Strains To test for gene ex~l~,ssion, 10 ml CYS (lOg c~citon~o, Sg ghlcose, 2g yeast extract, lg KH2PO4, lm1 50mM MgCl2, lrnl 50mM MnCl2, 1 ml 50 mM ZnS04, 1 rnl 50 mM FeCl3, 1 ml 200mM CaCl2/L) cultures of the l~,c~j~..hi~ and parental strains were grown for 36 hrs.
at 30C. 50111 were mixed with an equal volume of 2x sample loading buffer (0.125MI
Tris-HCl pH8, 4% SDS, 0.005% Brolll )phel ol Blue, 20% (v/v) glycerol, 4%(v/v), B
mercapteothanol) and immlo.tli~tely boiled for S min. 2.5, 5, and 10~11 aliquots were loaded on a 10% acrylaIrude gel (Novex) and cle~ ophoresed for 1.5 hrs. at 125 volts.

Expression of the introduced crystal genes could clearly be IlPtected by SDS-polyacrylamide gel electrophoresis of all the l~colllbi~ strains. In the case of HD73::pSB147, a new band at approximately 65Kd was d~o-tect~d in addition to the band at 130Kd seen in the wild-type strain. 65Kd is the size expected for the CryIIA protein. An additional band running at 135Kd, wo 94/25611 2 ~ S ~3 3 2 3 PCT/EPg4/01249 the size expected for the CryIC protein, was seen for HD73::pSB210.2, SAl lCPl, SAl lCP2, SAl lCP3, SAl lCP4, SA12CP1, SA12CP2, S287CPl and S287CP2, and was not seen for wild type HD73, SAll, SA12 and S287 strains. 'I'he l~colllbinant strains co~tin~ d to express the other CryI-type proteins c~ ssed by their parental wild-type strains, det~tecl as a band running at 130Kd.

Example 22: Hybrid B.t. Strain Lethalib Bioassay For most bioassays the sQmrles were grown in lOOml I~ l (5.5% ~ich.,.-~l, 4% Starch, 0.1 % NH4Cl, 0.125% KH2PO4, 0.05% MgS04, 0.001% FeSO~, 0.001% MnCl2/L) in a 500ml baffled flask at 30C for 72 hrs., 300rpm. For bioassay No. 1087, the sQmples were again grown in lOOml Fish Meal in a 500ml baffled flask at 30C, but used a 5% inoculum from a lOOrnl Fish me~ starter culture which had been inoclllQtt~d with a loop of spores from a fresh slant and grown for 6 hrs. at 30C. I'he SAll samples (control) and its l~_colllbinall~ were harvested after 41 hrs., and the SA12 s~ ,les (control) and its l~,cGl~ ants were harvested after 47 hrs. of growth. All s_mples were eYQmint~d for protein e~ ,ssion by ~ lting 1:10 with water, and then treated as the CYS cultures described above in FYQmrle 18. After harvesting, the cultures were stored at 4C.

The recombinant SAll, SA12 and S287 strains grown in Fi~hm~Ql ...t~hl-.,. were assayed against Trichopulsia ni and Spodoptera exigua accol-ling to the following protocol. Samples of the l~cc lllbh~ant strains were mixed with an artificial insect diet col~l~;n;"g 132glL wheat germ, 28g/L casein, llg/L vitamin mix (Moorehead & Co. Van Nuys, CA), 8.8g/L salt mix (BioServ, Frenchtown, NJ), 2.3g/L sorbic acid, l.lg/L methyl paraben, 13glL agar and l.5mllL
f~rrnQki~hyde. The llliAlu~ was then fed to late third instar larvae in~-ub~t~l at 25C. The mortality was recorded after 4 days, and the LC50 was ~ r ~..i..rd by probit analysis as is known in the art.

All the r~ico..-~ Qnt strains had higher activity against S. exigua than the wild type strains from which they were derived. The increase in activity against Spodoptera exigua ranged from 1.6 to 2.2 fold.

The cryIC gene has been introduced into the chll,ll.oso.lles of several different strains of ~O 94/25611 ~ ~i 9 ~ 2 3 PCT/EP94/01249 Ra~ c thllringj~n~ic at a known site using the techniques of ele~;L~LIal~sformation and tr~ncrl~lction with a phage lysate. Por the lcco~ t strains produced by tr~n~luction~ the expression of the cry-IC gene was tlPtecte(l by SDS-PAGE, and the CryIC protein contributed to the bioa~livily against S. exigua. Il~ h~g the cryIC in the chromosome did not cause instability of the resident pl~cmi~lc, and is itself stably ~ d through sporulation and gt~ min~tion.

Example 23: Determination of T~ t~-~ For Inhibition of pLTV1 Replication in B.t.B. subtilis PY1177 (pLTV1) was obt~il,ed from Dr. Phil yollngm~n is described by Camilli et al. (Camilli et al., J. F~ct~.riol 172: 3738-3744 (1990)). pLTV1 DNA was isolated from PY1177 accoçdillg to the m~th~ of Birnboim and Doly (1979), supra. B.t. kurstaki HD73 was transformed with pLTV1 DNA by cle~;LI~opolation as l~s~ in Example 7 above and the transformant was t~ n~t~d HD73 + pLTV1.

The telll~lalulci required to abolish the replication of pLVT1 in B.t. hlr~t~ki HD73 was ~r~e~ fd by two con~e~ hGalllcnl-.. ;~t!~ at dirr~,r~nt t~ ~...tU.~S, the first in liquid m~flhlm and the second on a solid m~lillm accolLng to the m~thod of Bohall, (Bohall, N.A., J. R~rteriology 167: 716-718 (1986)). A flask cc...l;~;..;..g 10 ml of LB tet1O was inocui~t~d with a single colony of HD73 +pLTV1. This plilll~y culture was grown to OD600 = 0.4 at 30C with baffling at 300rpm. The cells were reco~c,ed by ce..l.;rug~tion, washed in LB
(cont~ining no antibiotics) to remove t.,ha.;~cline and ~ ied in 10rnl of LB with no antibiotics. The le~ o(l cells were used to inoc~ t~ (1%) 10ml LB cultures ~l~,..~lllcd to 30, 37, 40 and 42C. After inoc~ tion, the cultures were ..~ ;..rd at their l~,;,~li-/e tclll~ldturcs until the cultures reached an OD6oo value bcl~.~n 0.6 to 0.8. The cultures were then diluted by a factor of 104 to 107 and 100,ul ~liquotc of the lilutior~ were spread in onto LB eryOO5 plates. Each plate was i.~ .b~l~d overnight at the in~ub~tion Lc.ll~ldlur~ of the coll~ ,ullding primary culture. After overnight ;~ ;on, the colonies from the LB eryOO5 plates were replica-p~t~ h~(l onto four dirLl~ntLB plates COI~tZ ;~ g no antibiotics as well as - LBerylO,LB cml2 and LB tet,0 plates. The plates were ;..~ ub~l~-d at 30C overnight and scored the following day for antibiotic sensilivily.

E~ in which the primary cultures were grown in LB liquid which col.~h~ed WO 94/25611 2 ~ ~ 9 ~ ~ ~ PCT/EP94/01249~

tetracycline produced the following results. At the pLTV1 replir~tion-~l.,.;s~;~e tell~ dlulG
of 30C, 20% of the colonies eY~min~d were s~ ~ to el~rlhr~ yei~, chlo~a~ uhenicol and Itl~deycline intlic~tin~ the loss of the pl~cmi~l due to inhibition of replic~tion. At 37C, 98%
of the colonies were sensitive to all three ~ntihiotirc At 40C, 94% of the colo nies were sensitive all three antibiotics and at 42C, 100% of the colonies were sensitive. Fxrerimtonts in which the liquid ~illlal~ cultures cQ~ r-d no tcL,~/cline exhibited heat-in(l-lced plasrnid loss at the same telll~ldlul~s. At the ~,.111~ `'el~1l11G of 30C, t~,h~ycline-free cultures exhibited a 38% pl~cmi~ loss (cignifit ~ntly higher than the 20% loss exhibited by LB + tet cultures inrub~tul at 30C). Tetracycline-free cultures inru~tt~ at 37C, 40C and 42C
exhibited plasmid losses of 94%, 90% and 99%,1~specLivGly. ThelGfolG, it was concluded that plasmid replication of pLTVl was inhibited at 37C or above under the e~ conditions used in this study. Since it can be lost even at its l"~ 1ion-pe....;~ elll~eldLulG, the pLTV1 plasmid appears to be scllle~lldL unstable.

Example 24: Det~ n of Conditions for Tr cp~ci.'ion of pLTVl~Borne Tn917 in B.t.
Retrieving transposed colonie~ is a three-day, three-step procedu,G. This method was first tested with HD73 + pLTV1. Pirst, 10ml of liquid LB c~.t~;t.;..~ ery" cm5 and tet5 was inocnl~tecl with an single colony of HD73 cont~ining pLTV1 and gro~vn to an OD600 = 0-7 at 30C with baffling at 300 rpm. This pl;lll~U,~ culture was then centrif~lged and the pelleted cells were washed in 10ml LB to remove the antibiotics. Two secondary flasks cont~inin~ 100ml LB
cont~ining both eryl and cm6 (but no tet) were inoc~ t~d with 100,ul of the washed plilllal~
culture. One of these flasks was il-- ub at 30C (pf---llS~ ~) while the other was grown at 37C (non-permissive) at 300 rpm overnight.

After ovemight growth, both cultures were diluted and plated onto LB alone and LB ery, cmS
plates. The plates were in~lb~ted overnight at the same telllyGr~lul~s at which the c~ IlGs~onding second~ry flasks had been inrub~t~d After this second overnight heat Llc~
individual colonies from the 37C LB co..t ~in;~g ery, cm5 plates were replica-patched onto LB
alone, LB cont~inin~ ery~ crn5, LB co~t~ining eryl0, LB co..~ g cm~ and LB cont~ining tet~0 plates to d~te~rnin~o what ~.-,~n~ge of the colonies were resistant to tly~ Illy~;hl, chlol~lll)h~nicol but sensitive to te~acycline, inrii~ting that a transposition event had occurred.

2 ~ 3 ~O 94/25611 PCT/EP94/01249 The eryrcmrtetS colonies obt~i"ed were (1eci~nAte(l HD73::pLTV1.

Almost 100% of the HD73 colonies derived from these e~ llF.Il~i with pLTVl showed the transposition of the lacZ gene from pLTV1, as ex~ PCR analysis of the ery'cmftetS
HD73 colonies using ~ llel~ LACNHS1 and LACNHS2 intlir~tecl that the lacZ gene from pLVT1 was present in all cases. Further PCR analysis using L~ TY6 and TY7 indicated that 38 out of 40 transposed colonies retained the native cryIA(c) gene. The primer sequences are provided in Table 7 below.

Table 7: Sequences of Oligonucleotides SEQ.ID No.
LACNHS 1 GGC l-l-l CGCTACCTGGAGAGACGCGCCCGC 29 TY7 CCACGCTATCCACGATGAATGTTCCl'l C 32 NHS21 GATATTTTAGCTCATGATCl'l-l-l'CCTCCTATTAAC 33 The pSB050 plAcmi~l was assembled in order to introduce the cryIIA operon from B.t. galleriae HD232 onto the HD73 genomç The B.t. gAllPriAP strain HD232 was obtained from the USDA.
The entire cryIIA operon from HD232 was isolated as a 4kb BamHI HincII fragment from pSB304 described in FYAmrle 5. The plAcmi~i pLTVl was cut with restriction el~yll,es Smal and BamHI to produce a 20.6kb r~ and tne frAgm~ntc were ligated together to form pSB050. The ligation products were used to L~ L~ the dam-, dcm- GM2163 E.coli strain.
Individual GM2163 colonies co..~ the desired co"sL,u-;l were first sPl~tçd on LB amp75, and then replica-p~trhPcl onto a series of agar plates cc,..li~;..;..g either no antibiotics, amp75, cm7, ery~O or tet,0. Of fifty-five colonies çYAmin~l' five were resistant to tetracycline, ampicillin and e.~ ""ycill intlirAtin~ that the correct fr~nP-nfc had been ligated. All others were sensitive to tetracycline in-lirAting a lack of pLTVl. The ,~ ,l colonies were further screened by PCR ~mplifirAtion of the 1400 bp product b~ .,n the LACNHS1 and LACNHS2 .i",c.~. The sequences of these ~fill~ are shown above in Table 7, and cG,~ ond to sequences which are within the lacZ gene col.~Ail~Ftl in pLTVl. AmplifirAtion with PCR and the NHS37 _nd NHS21 ~ , whose sequences are shown in Table 7 above produced a Wo 94/25611 2 15 9 3 2 ~ PCT/EPg4/01249 region from the e.ylh.ul.,y-cin gene to the end of the first open reading frame of the cryIIA
operon. The DNA from the lesisL~ilt coloniçs was analyzed by restriction analysis with Bgm and those colonies showing the ex~ted PCR results and 2kb, 5.3kb and 16kb Bglll fr~m~ntc were concitl~ored to contain the pl~cmirl dçci~n~t~-d pSB050.

The tran~îolll-dLion of HD73 with the pSB050 pl~cmi(~ was achie~ed by eleeLlopoldLion of the host cells at 1.2kV, 311F, and a reCict~nr-e at ~ ohms with 5~1g of pSB050 DNA isolated from GM2163. The cells were allowed to ~CO~l at the ~issi~., tel~eldLul~ of 30C for three hours in BHIS ...~-li--... with b~fflin~ at 300 rpm. The cells were then conc~nLldted, plated onto LB plates co.~ini~-~ lO~lg/ml tetracycline and i..l-ul~led at 30C overnight. The presence of pSB050 in the ~L,d~;yeline resistant HD73 coloniP-c was co--f . .--~d by PCR analysis using the LACNHS 1 and LACNHS2 primers (1400 bp product) and the NHS37 and NHS21 primers (600 bp product) under the cQntlitionc lecv.. -P~-led by Perkin Elmer-Cetus. These isolates were deci~n~tecl as HD73+pSB050.

F.Y9~ le 26: Introducffon of CryILA Into 50 Mdalton Plasmidc of B.t. HD73 by Tr~ Of pSB0'0 I~rne Tn917 Several HD73 + pSB050 isolates obt~inP~ as des_lil)ed in F.~mple 25 above were used to transpose the cry~ operon from pSB050 onto a large resident plasmid of HD73. The HD73 + pSB050 isolates were inr~lb~tPti at a non-permissive te,ll~r~tul~ and selected for chlor~llphenicol and e~ ulllycin rc~ nre and telldLycline sensitivity. The eryrcmrtetS
colonies obtained were ~lP~ign~tPd HD73::050 in-lir~ting that the t-~ls~osilion event had occurred. The llall~yosilion was cQ~r....~d by PCR amplification of the çYpectçd 600bp fragment b~ cell the NHS37 and NHS21 primers (ery gene to cryIIA) and the 1400bp product between the LACNHS 1 and LACNHS2 primPrs The ~l~,se.lce of an intact cryIA(C) coding region was also col.r.. ~d by PCR amplific~tion with the TY6 and TY7 primers, whose sequences are provided in Table 7 above.

E~"~l~lc 27: E~ ~~~n of C~ (c) and CryIIA Genes in TlP-- ~5~-1 B.t. Strain HD73::050 The microsco~ic observation of HD73 + pSB050 and HD73::050 at lOOOx m~gnifi~tionshowed that both strains produced two crystal types. Both the bi~ l CryIA(c) crystals ~WO 94125611 ~ 1 5 9 3 ~ 3 PCT/EP94/01249 of HD73 and the cuboidal CryIIA crystals, were obs~. ~ed in the HD73+pSB050 and HD73::050 cells. No such cuboidal crystals were seen in the wild-type HD73 cells.

The protein eAprcssion of CryIA(c) and CryIIA in HD73::050 was analyzed by SDS-PAGE.
lOO,ul samples of sporulated cultures (40 to 50 hours old) were pPllPtçA l~sus~ ded in lOmM
EDTA and mixed 1 to 1 on ice with 2x SDS loading and boiled for three minntes. A 10%
pre-cast Novex gel was run and stained with CoomAeciP blue.

The SDS-PAGE analysis revealed the ~" s~ncc of the 135Kd CryIA(c) and the 65Kd CryIIA
proteins. These were confirmPd by Western blot analysis using specific antisera made against CryIA(c) or CryIIA on two sepS~ te blots.

ExamPle 28: Spore Counts and Stability of B.t. Strain ~ID73::050 As a gross intlicAtio~ of the relative health of the cultures, the IIUlll~l of spores per rnilliliter of culture was co,ll~ared in samples of the following B.t. strains: the HD73 wild type, and the HD73 + pLTV1, HD73 + pSB050 and HD73::050 hybrids. The sporulated cultures were treated at 65C for 45 min. to kill any l~ g ~gel~lB~, ceils. Serial dilutions were plated onto LB agar plates, and colonies were collnt~d the following day. Stability of the ~Idh~osed DNA in HD73::050 was ~1cet~ d by plating the spore dilutions used above onto LB agar plates contAining lOIlg/ml tetracycline, lllg/ml e"~llllo"lycin and 7~1g/ml chlc.,dl"~hcnicol or LB without antibiotics. The number of growing colonies with selection was colll~d to the number of growing colonies without selection. The spore counts for HD73::050 were slightly lower than those for the wild type HD73. They ranged from 1 to 2Xl08 spores/ml. Most (i.e., 97 to 100%) of HD73::050 ...~ fd the correct eryr cmr tetS antibiotic l~ re intli-~Ating that the transposed region did not becollle unctAhle and excised from DNA after L,an~osilion.

Example 29: Plasn~id Profile of B.t. Strain HD73::050 The plasmid content of HD73::050 was ~1. t~ ...;.~rd to asses if the llarl~o~ilion event had occurred onto the chromosome or a large size plAcmi~ of HD73. The pl~cmicl pl~,~dlion procedure used was a slight adaptation of the Birnboim and Doly AlkAIine Iysis protocol (Birnboim, H. C. and Doly (1979), supra) as previously lescri~eA in Example 18. The pl~cmirl profile analysis of the DNA ~l~,pdldlions from HD73::050 and wild-type HD73 showed that the WO 94/25611 . 2 ~ 5 9 3 2 ~ PCT/EP94/01249 L,~lsposon had been inserted into two 50Mdalton plQcmi(ls present in the natural HD73 strain.
The gels showed an increase in the molecular weight of the ~l~cmid bands, which make them coincide with the m~lec~ r weight of the lldns~sed DNA. In some HD73::050 isolates the high copy number 50Mdalton pl~cmi~l carrying the cryIA(c) gene was the transposition target.
In other isolates, the lower copy n-llllbe, SOMdalton pl~cmitl was the L~ sposilion target. All other plasrnids within HD73::050, which are also norm~lly present in HD73, showed no change in a~elll mole~ r weight.

F.YS~ e 30: S(~.lLe..~ Analysis of Tr~:~ion in B.t. Strains HD73::050 and HD73::pLTV1 Total DNA s~mpl~-s from wild type HD73, HD73::pLTVl and HD73::050 were plcp~cd using the ASAP kit accolding to the protocol from Boehringer ~nnh~im The DNA was digested overnight with excess BamHI or EcoRI, ele~,L,uphol~sed for 18 hrs. on a 20cm 0.8% TBE
agarose gel and transferred to a Zeta-Probe ~ ..b"~ from Bio-Rad by overnight capillary blot in 20xSSC. The ..-- ...b.~ was then treated and probed as desrribed in the ~mrr.ch~rn ECL
kit. The 1400 bp lacZ gene PCR plod~l~;L ~:ie5~ e~1 in FYZImple 25 above was used to probe the transferred DNA. The bands col,cs~o~ding to the HD73::050 DNA were col,lp~cd to those bands coll~,s~ollding to DNA from wild type HD73.

Southern blot analysis showed that the Lldns~ oso" had integrated into dirrc~ locations on the 50Mdalton pl~cmi-lc No plef~ ,d transposition site was obse.~d. The rest~ tirJn map of pLTVl intlir~ted that the DNA from HD73::pLTV1 con~ fd BamHI L~...f~ of 9kb or larger which hybridize to the probe. Bands of this size l~ s~ the l,,~ posecl portion of pLTVl in one of the 50Mdalton pl~CmiflC Similarly, the HD73::pLTVl DNA cont~ined 14kb or larger EcoRl fr~gmP~tc which hybridize to the probe. In all cases, the ç~ d bands exhibited hybricli7~tion in the Southern analysis. No hyhri~li7~cl bands were of the same size, thus conr~ that the pLTVl Lla"sposilion event oc~wl~d at random places within the HD73 genQrn~ .

Southern blot analysis of the HD73::050 isolates showed the expected bands of 12kb or larger for BarnHI digestion and 17kb or larger for EcoRI ~ Pstion The dirr~,-,nce in size of the hybri-li7ed bands ~l~.~n HD73::pLTVl and HD73::050 is due to the ~l~,sence of the cryIIA

wo 9412~611 ~ l 5 9 3~ ~ PCT/EP94/01249 gene wi~in the transposed region of HD73::050. This COI~ llS that the transposed cryIIA
gene was inserted randomly within the HD73 genome.

F~ "l~ 31: T A th~ of B.t. Strain HD73::050 Fresh overnight colonies of HD73::050 and wild type HD73 were separately inoc~ ted into 500ml of the CYS ",~.1;,.... ~les(ribed by Y~l~lulo and h~.,st~d by centrifugation and allowed to grow for 55 hrs. at 30C with b~Ming at 300 rpm (Yamamoto, T. 1990. ACS
Sylll~osiulll Series 432: 46-6Q). The cells were ~ rd in 1/20volume of Buffer A (SmM
Tris pH8.0,0.25% Triton), and the cell lysate was clu;LIuphol~sed on 8% Novex SDS-PAGE
gels. The concentration of the CryIA(c) protein was ~il,tl-l..inrd by densitometer sc~nnin~.
Nineteen two-fold dilutions were made in Buffer A and the amount of CryIA(c) in ppm was c~lrnl~tr~l for each ~ tion Known ~-~-n~ of protein were mixed with the insects' diet and fed to late third instar Trichoplusia ni and Spodoptera exigua larvae, the larvae were inrub~ting for 4 days at 25C and their mortality was then scored.

The bioassay results inrlir~t~cl that the HD73::050 hybrid had higher activity than the wild type HD73. The results with T. ni showed that the wild type HD73 exhibited an LC50= 3.5ppm while the HD73::050 exhibited an LCso= 2ppm. The results with S. exigua showed an LC50=~
475ppm for wild type HD73 and an LC50= 225ppm for HD73::050.

The present invention may be ~u----~ ed by the following clauses l-~nl~d 1 and 2 and is defined by the clims appended ~t.- n~r~
1. A DNA se~...- ~.t compricing a) one or more incectiricie~ncorling DNA seqluen-es capable of being replic~t~d and exp~ssed in Bacillus thurin~i~n~ic and a DNA seqnenre homologous to chromosomal R~r.illuc thurin~iensis DNA wL~,r~by said homologous DNA se~ e directs insertion of said DNA
segment into the chn,...oso...~- and wl.~re~ said incectirid~o-enro~ling DNA sequence is inserted into the R~ c thurin~iencic chromosomal DNA; or b) one or more incectiri(l~ encoding DNA se~ ,..ce capable of being replicated and expressed in Bacillus thllrin~iencic and a DNA se~lu~llce capable of randomly integrating into chromosomal Bacillus thllrin~iensis DNA wh~,..,by said DNA seg... nt is stably integrated into the chromosomal DNA inrlllAing said incectici~nro~1ing DNA seq~en~e.

~1~93~3 2. A method of ~r~alillg a transformed R~rill-lc Ih...;,-p;f.~i.c host comprising a) obtaining a DNA s~u~,nce either h-)mologous to chromnsoïn~l Bacillus thnrin~i~ncjc DNA or capable of randomly integ~tin~ into chlu~-.osom~l Bacillus thllrin~i~nsis DNA;
b) o~ ,ly linking to said DNA seq~ nre one or more imectiride-encoding DNA
sequences;
c) obtaining a DNA seg..~ - .1;
d) Ll~lsr ,lllling a R~cill-lc tL.~ n~ic strain wLe..,~ the DNA se~ t is inccl~uldled into the chr~lllosolllal DNA; and e) icol~ting a tran~r~ led host wL~ ~ the incecti~ide ~n~otling DNA sequence is stably integrated into the host cl~ losomal DNA and is capable of being e~lessed and replil~ted in the host.

O 94/25611 ~ 1 ~ g ~ ~ 3 PCT~EP94/01249 ~yu N~ LISTING

(1) GENERAL INFORMATION:
(i) APPLICANT:
~A) NAME: Sandoz Ltd (B' STREET: Lichtstrasse 35 (C CITY: Basel (D STATE: BS
(E, COUN'1'KY: Switzerland (F) POSTAL CODE (ZIP): CH-4002 (G) TELEPHONE: 061-324-1111 (H) TELEFAX: 061-322-7532 (I) TELEX: 96 50 50 55 (A) NAME: Sandoz Patent GmbH
(B) STREET: Humboldstrasse 3 (C) CITY: Loerrach (E) COUN'1'KY: G~ ~
(F) POSTAL CODE (ZIP): D-79540 (A) NAME: Sandoz Erfindungen Verwaltungs GmbH
(B) STREET: Brunnerstrasse 59 (C) CITY: Vienna (E) C~UN 1nY: Austria (F) POSTAL CODE ~ZIP): A-123S
(ii) TITLE OF lNv~NllON: DNA segment comprising gene encoding insecticidal protein (iii) NUMBER OF ~yu~N~S: 34 (iv) COMPUTER READABLE FORM:
(A) MEDIUM TYPE: Floppy disk (B) COMPUTER: IBM PC compatible (C) OPERATING SYSTEM: PC-DOS/MS-DOS
(D) SOFTWARE: PatentIn Release #1.0, Version #1.25 (EPO) (2) INFORMATION FOR SEQ ID NO:1:
(i) ~QU~N~ CHARACTERISTICS:
(A) LENGTH: 28 base pairs (B) TYPE: nucleic acid (C) STR~N~ N~:~S: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) (iii) ~Y~ul~llCAL: NO
(iv) ANTI-SENSE: NO

(xi) S~:UU~N~: DESCRIPTION: SEQ ID NO:1:

(2) INFORMATION FOR SEQ ID NO:2:
(i) ~:Uu~N~: CHARACTERISTICS:
(A) LENGTH: 28 base pairs (B) TYPE: nucleic acid (C) STR~Nl)~:l)N~:~S: single (D) TOPOLOGY: linear 2 ~ 3 (ii) MOLECULE TYPE: DNA (genomic) (iii) ~Y~OIn~ CAL: NO
(iv) ANTI-SENSE: NO

( Xi ) ~U~N~ DESCRIPTION: SEQ ID NO:2:

(2) INFORMATION FOR SEQ ID NO:3:
( i ) ~UU~N~ CHARACTERISTICS:
~A) LENGTH: 37 base pairs (B) TYPE: nucleic acid ( C ) STRl~N~ CS single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) (iii) nY~Oln~:llCAL: NO
(iv) ANTI-SENSE: NO

( Xi ) ~U N~ DESCRIPTION: SEQ ID NO:3:
AG~ll~CGGC CGC~lCGACC CCGGGCCATG G~GG~CG . 37 (2) INFORMATION FOR SEQ ID NO:4:
( i ) ~Q~N~ CHARACTERISTICS:
(A) LENGTH: 38 base pairs (B) TYPE: nucleic acid (C) STRAN~N~SS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) (iii) ~Y~Oln~llCAL: NO
(iv) ANTI-SENSE: NO

( Xi ) ~ U b N~ DESCRIPTION: SEQ ID NO:4:
AATTCGGGCC CCCATGGCCC ~GG~.CGACG CGGCCGr~ 38 (2) INFORMATION FOR SEQ ID NO:5:
:uu~: CHARACTERISTICS:
(A) LENGTH: 29 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) (iii) ~Y~Oln~llCAL: NO
(iv) ANTI-SENSE: NO

~xi) ~:yu~: DESCRIPTION: SEQ ID NO:5:

Sû

~93~
0 94/25611 PCT~EP94/01249 (2) INFORMATION FOR SEQ ID NO:6:
(i) ~yU N~ CHARACTERISTICS:
(A) LENGTH: 24 base pairs (B) TYPE: nucleic acid (C) ST~AN~ l)N~:~S: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) (iii) HYPOTHETICAL: NO
(iv) ANTI-SENSE: NO
(xi) ~Uu~ DESCRIPTION: SEQ ID NO:6:

(2) INFORMATION FOR SEQ ID NO:7:
UkN~ CHARACTERISTICS:
(A) LENGTH: 40 base pairs (B) TYPE: nucleic acid (C) ST~AN~ N~:~S: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) (iii) hY~O~ CAL: NO
(iv) ANTI-SENSE: NO
(xi) ~:yu~N~ DESCRIPTION: SEQ ID NO:7:
CAATACATTA TCCATGGAAA AL-C~l~tll AAATATCATG 40 (2) INFORMATION FOR SEQ ID NO:8:
(i) ~:QD~N~: CHARACTERISTICS:
(A) LENGTH: 39 base pairs (B) TYPE: nucleic acid (C) STR~N~ N~:~S: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) (iii) ~Y~u~ CAL: NO
(iv) ANTI-SENSE: NO
(xi) ~U~N~ DESCRIPTION: SEQ ID NO:8:
GAGCAATGAA AGAGTTAGGG CC~~ lAA G~l~lCATG 39 (2) INFORMATION FOR SEQ ID NO:9:
(i) ~Q~ N~: CHARACTERISTICS:
(A) LENGTH: 16 base pairs (B) TYPE: nucleic acid (C) STR~Nl~ )N~ S: sin~le (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) (iii) ~rYOln~:llCAL: NO
(iv) ANTI-SENSE: NO

W O 94/25611 2 1 5 ~ ~ 2 ~ PCT~EP94/01249 (xi) ~yu~N~ DESCRIPTION: SEQ ID NO:9:

(2) INFORMATION FOR SEQ ID NO:10:
( i ) ~Uu~N~ CHARACTERISTICS:
~A) LENGTH: 16 base pairs (B) TYPE: nucleic acid (C) ST~ANI)t~ :.C.S single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) (iii) ~Y~Ol~llCAL: NO
(iv) ANTI-SENSE: NO

(xi) S~Qu~N~ DESCRIPTION: SEQ ID NO:10:
Allll~lATT AAACGG 16 (2) INFORMATION FOR SEQ ID NO:ll:
( i ) ~U N,~'~ CHARACTERISTICS:
(A) LENGTH: 24 base pairs (B) TYPE: nucleic acid (C) STRAN~ S: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) (iii) ~Y~Ol~:llCAL: NO
(iv) ANTI-SENSE: NO

(xi) ~Qu~ DESCRIPTION: SEQ ID NO:11:

(2) INFORMATION FOR SEQ ID NO:12:
(i) ~Qu~-~ CHARACTERISTICS:
(A) LENGTH: 18 base pairs (B) TYPE: nucleic acid (C) STRANnFnNF~S: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) (iii) HYPOTHETICAL: NO
(iv) ANTI-SENSE: NO

(xi) s~:yu~ DESCRIPTION: SEQ ID NO:12:

(2) INFORMATION FOR SEQ ID NO:13:
:Q~ CHARACTERISTICS:
(A) LENGTH: 20 base pairs (B) TYPE: nucleic acid 2 `~ ~9~23 W O 94/2~611 PCT~EP94101249 (C) S~ AN~ l)Nl4~ single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) (iii) AY~O~A~ CAL: NO
(iv) ANTI-SENSE: NO

(xi) ~uu~ DESCRIPTION: SEQ ID NO:13:
GAAATCGGCT rA~r~AAA~GG 20 (2) lN~Ok~ATION FOR SEQ ID NO:14:
(i) ~yU~ CAARACTERISTICS:
(A) LENGTH: 24 base pairs tB) TYPE: nucleic acid (C) ST~ANn~nN~ S: single (D) TOPOLOGY: linear ~ii) MOLECULE TYPE: DNA (genomic) (iii) ~Y~GlA~.llCAL: NO
(iv) ANTI-SENSE: NO

(xi) ~uu~N~: DESCRIPTION: SEQ ID NO:14:

(2) INFORMATION FOR SEQ ID NO:15:
( i ) ~yU~N~ CHARACTERISTICS:
(A) LENGTH: 20 base pairs (B) TYPE: nucleic acid (C) STRAN~:~N~:SS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) (iii) AY~ulA~l-lCAL: NO
(iv) ANTI-SENSE: NO

( Xi ) ~QU~N~ DESCRIPTION: SEQ ID NO:15:
CTAll~ll~ GAAlæ C~l~ 20 (2) INFORMATION FOR SEQ ID NO:l6:
(i) S~UU~ CHARACTERISTICS:
(A) LENGTH: 28 base pairs (B) TYPE: nucleic acid (C) STRANnF.nN~..~S: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) (iii) AY~OlA~llCAL: NO
(iv) ANTI-SENSE: NO

WO 94/25611 PCT~EPg4/01249 2~59323 (xi) ~:QU~N~: DESCRIPTION: SEQ ID NO:16:
GAGcr~Arr~ GCTGGAGGAG TTTACACC 28 (2) lN~Ok~ATION FOR SEQ ID NO:17:
:Uu~N~ b CHARACTERISTICS:
(A) LENGTH: 22 base pairs (B) TYPE: nucleic acid (C) sTRANnFD~F~s single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) (iii) ~Y~O~ llCAL: NO
(iv) ANTI-SENSE: NO

(xi) ~U~N~ DESCRIPTION: SEQ ID NO:17:

(2) lN ~Oh~ATION FOR SEQ ID NO:18:
(i) ~yU~N~: CHARACTERISTICS:
(A) LENGTH: 33 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) (iii) nY~u~ lCAL: NO
(iv) ANTI-SENSE: NO

(xi) ~U~N~ DESCRIPTION: SEQ ID NO:18:
ATCACTGAGT CG~lCG~AT GTTTGACTTT CTC 33 (2) INFORMATION FOR SEQ ID NO:19:
(i) ~uu~ CHARACTERISTICS:
(A) LENGTH: 29 base pairs (B) TYPE: nucleic acid (C) STRAN~:~N~SS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) (iii) ~Y~ul~:llCAL: NO
(iv) ANTI-SENSE: NO

(xi) S~ ~N~ DESCRIPTION: SEQ ID NO:19:
G~iC~lGGCT ATAlC~liCG TGTCACAGC 29 (2) INFORMATION FOR SEQ ID NO:20:

( i ) ~QU~N~: CHARACTERISTICS:
(A) LENGTH: 25 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single O 94/25611 ~ 1 ~ 9 3 ~ 3 PCT~EP94/01249 (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) tiii) ~Y~Ol~llCAL: NO
(iv) ANTI-SENSE: NO

(xi) ~:yu~NC~ DESCRIPTION: SEQ ID NO:20:
ACAGAAGAAT ~l~lll~ATA GGCTC 25 (2) INFORMATION FOR SEQ ID NO:21:
(i) ~yU~N~ CHARACTERISTICS:
(A) LENGTH: 23 base pairs (B) TYPE: nucleic acid (C) STRAN~ )N~:~S: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) (iii) ~Y~Ol~llCAL: NO
(iv) ANTI-SENSE: NO

(xi) ~:Q~N~ DESCRIPTION: SEQ ID NO:21:
GAATTGCTTT rA~AGGCTCC GTC 23 (2) INFORMATION FOR SEQ ID NO:22:
(i) ~yu~N~ CHARACTERISTICS:
(A) LENGTH: 28 base pairs (B) TYPE: nucleic acid (C) STRAN~N~SS: single (D) TOPOLOGY: linear (ii~ MOLECULE TYPE: DNA (genomic) (iii) HYPOTHETICAL: NO
(iv) ANTI-SENSE: NO

(xi) S~YU~N~: DESCRIPTION: SEQ ID NO:22:

(2) INFORMATION FOR SEQ ID NO:23:
(i) S~YU~N~ CHARACTERISTICS:
(A) LENGTH: 23 base pairs (B) TYPE: nucleic acid (C) STRAN~ N~ S: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) (iii) HYPOTHETICAL: NO

(iv) ANTI-SENSE: NO

(xi) S~YU~N~: DESCRIPTION: SEQ ID NO:23:

WO 94/25611 ~ I PCTAEP94/01249 GCC~l~l~lA ACGGTACCTA AGG 23 (2) INFORMATION FOR SEQ ID NO:24:
( i ) ~U N,~'~ CHARACTERISTICS:
tA) LENGTH: 21 base pairs (B) TYPE: nucleic acid (C) sTRANn~nN~s: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) (iii) ~Y~Ol~:llCAL: NO
(iv) ANTI-SENSE: NO

(Xi) ~UU N,~ n~-~RTPTION: SEQ ID NO:24:

(2) INFORMATION FOR SEQ ID NO:25:
( i ) ~'~ UU NU~ CHARACTERISTICS:
(A) LENGTH: 18 base pairs (B) TYPE: nucleic acid (C) STRAN~ l)N~ S: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) (iii) HYPOTHETICAL: NO
(iv) ANTI-SENSE: NO

(Xi) ~Uu NC~' DESCRIPTION: SEQ ID NO:25:

(2) INFORMATION FOR SEQ ID NO:26:
( i ) ~EUu NC~ CHARACTERISTICS:
~A) LENGTH: 18 base pairs (B) TYPE: nucleic acid (C) STRANl)~ N~:~S: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) (iii) ~Y~ul~ CAL: NO
(iv) ANTI-SENSE: NO

(xi) ~yu~ DESCRIPTION: SEQ ID NO:26:

t2) INFORMATION FOR SEQ ID NO:27:
(i) ~UU~N~ CHARACTERISTICS:
(A) LENGTH: 29 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear ~g32~
W O 94125611 PCT~EPg4/01249 (ii) MOLECULE TYPE: DNA (genomic) (iii) ~Y~o~ cAL: NO
(iv) ANTI-SENSE: NO

(xi) ~yu N~ DESCRIPTION: SEQ ID NO:27:

(2) INFORMATION FOR SEQ ID NO:28:
(i) ~yu~ CHARACTERISTICS:
(A) LENGTH: lû base pairs (B) TYPE: nucleic acid (C) STRAN~ N~:~S: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) (iii) ~Y~Ol~lCAL: NO
(iv) ANTI-SENSE: NO

(xi) ~uu N~ DESCRIPTION: SEQ ID NO:28:
AGCGGCC~l 10 (2) INFORMATION FOR SEQ ID NO:29:
(i) ~yu~ CHARACTERISTICS:
(A) LENGTH: 30 base pairs (B) TYPE: nucleic acid (C) STRAN~ -N~ S: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) (iii) nY~Ol~llCAL: NO
(iv) ANTI-SENSE: NO

(xi) ~Uu~N~ DESCRIPTION: SEQ ID NO:29:
GG~lllCGel ACCTGGAGAG ~rGCGCCCGC 30 (2) INFORMATION FOR SEQ ID NO:30:
(i) ~u N~: CHARACTERISTICS:
(A) LENGTH: 30 base pairs (B) TYPE: nucleic acid (C) STR~N~ N~:~S: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) (iii) n~Oln~ CAL: NO

(iv) ANTI-SENSE: NO

(xi) ~yu~ D~rRTPTION: SEQ ID NO:30:
CCAGACCAAC TGGTAATGGT AG~ CCGGC 30 2 ~ 5~
~2) INFORMATION FOR SEQ ID NO:31:
YU~ CHARACTERISTICS:
(A) LENGTH 29 base pairs (B) TYPE nucleic acid (C) STR~N~ N~ : single (D) TOPOLOGY: linear ~ii) MOLECULE TYPE DNA (genomic) (iii) AY~O1A~ 1CAL NO
(iV) ANTI-SENSE: NO

(Xi) ~YU~.~ DESCRIPTION: SEQ ID NO:31:
~1C~1~G~-1 ATATCATTCG TGTCACAGC 29 (2) INFORMATION FOR SEQ ID NO:32:
(i) ~U~N~ CAARACTERISTICS:
(A) LENGTA: 28 base pairs (B) TYPE: nucleic acid ( C ) STRp~NI -14:1 )1~1 I':C~S: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE DNA (genomic) (iii) AY~O1Ar11CAL NO
(iV) ANTI-SENSE: NO

(Xi) ~YU~N~ DESCRIPTION: SEQ ID NO:32:
CCACGCTATC CACGATGAAT ~1"1~U11C 2 8 (2) IN~ORMATION FOR SEQ ID NO:33:
(i) ~YU~NU~ CHARACTERISTICS:
(A) LENGTH: 35 base pairs (B) TYPE nucleic acid (C) STl~NI11 NNf.c~s ~ingle (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) (iii) ~Y~U~Ar11CAL: NO
(iV) ANTI-SENSE: NO

(Xi) ~YU~NU~ DESCRIPTION SEQ ID NO:33 GATATTTTAG CTCATGATCT l-ll~ulC~lA TTAAC 35 (2) lN~U~ ~TION FOR SEQ ID NO:34 QU NU~ CAARACTERISTICS:
(A) LENGTH: 20 base pairs (B) TYPE: nucleic acid (C) STRAN~N~SS single (D) TOPOLOGY: 1 inear (ii) MOT~F~rUrF~ T~YPE DNA (genomic) ~W O 94/25611 2 15 9 a 2 3 PCTAEP94/01249 (iii) nYrvln~llCAL: NO
(iv) ANTI-SENSE: NO

(xi) ~ UkN~: DESCRIPTION: SEQ ID NO:3~:
Q TTACGCAT TTGrA~TA~C 20

Claims (9)

1. A linear DNA segment comprising at least one insecticide encoding DNA sequence capable of being replicated and expressed in Bacillus thuringiensis, wherein the regions both 5' and 3' of the said sequence comprises nucleotide sequences homologous to sequences present in Bacillus thuringiensis chromosomal DNA so that the said insecticide encoding DNA
sequence is capable of being inserted into the bacterial chromosomal DNA, or a circular DNA segment comprising at least one insecticide encoding DNA sequencecapable of being replicated and expressed in Bacillus thuringiensis, wherein a region either 5' or 3' of the said sequence comprises a nucleotide sequence homologous to a sequence present in Bacillus thuringiensis chromosomal DNA so that the said insecticide encoding DNA
sequence is capable of being inserted into the bacterial chromosomal DNA.

2. A DNA segment according to Claim 1 further including an origin of replication from a gram negative bacterium and a selectable marker.

3. A hybrid vector comprising the DNA segment according to Claims 1 and 2.

4. A Bacillus thuringiensis host comprising the DNA segment of the preceding claims.

5. An insecticidal composition comprising an insecticidally effective amount of a host according to Claim 4 and a carrier therefor.

6. A method of preparing a transformed Bacillus thuringiensis host comprising the steps of introducing the vector of claim 3 or the DNA segment according to either of claims 1 or 2, into a Bacillus thuringiensis strain, and isolating the resulting transformants wherein the insecticide encoding DNA sequence is stably integrated into the host chromosomal DNA and is capable of being expressed and replicated therein.

7. A method according to Claim 6 further comprising transducing the transformed host and preparing a recipient Bacillus thuringiensis including a) exposing the Bacillus thuringiensis host of Claim 6 to a transducing phage;

b) allowing said phage to replicate in said host wherein one or more insecticideencoding DNA sequences integrated in the host chromosomal DNA are incorporated into said phage; and c) introducing said insecticide encoding DNA sequence from the phage into a recipient Bacillus thuringiensis wherein said introduced insecticide encoding DNA sequence is stably incorporated into the chromosomal DNA of said recipient and is expressed.

8. A method according to Claims 6 and 7 wherein the Bacillus thuringiensis host and recipient are selected from strains of Bacillus thuringiensis kurstaki.

9. A method according to Claims 6, 7 or 8 wherein the insecticide encoding DNAsequence is the cryIC sequence or a sequence homologous thereto.