CA2136705A1 - Method of screening for polymorphisms - Google Patents

Abstract

A method of screening for polymorphisms involving amplifying selected nucleotide sequences on nucleic acids from at least two different individual sources under suitable conditions. The amplified nucleotides sequences are reacted with a series of restriction endonuclease enzymes to produce reaction products. The reaction products are separated and visualized and compared to identify polymorphisms.

Description

B&P File No. 7298-004/LMK 213 6 7 05 Title: Method of Scr~ening for Polymorphisms FIE:LD OF THE lNVlSN 1 lON
The invention relates to a method of screening for polymorphisms.
RAr-R~ouND OF THE INVENTION
There is extensive variability in the DNA of the human population due to nucleotide substitutions, insertions or deletions. A DNA site that varies from one individual to another is referred to as a polymorphism.
Techniques have been developed to compare sequences of DNA
to determine if the sequences are identical or if they differ in one or more nucleic acids. These techniques have practical application in the diagnosis of genetic disorders, forensic techniques, human genome mapping, paternity and maternity testing and genetic variation, linkage analysis, cell chimerisation studies allowing for donor/recipient cells to be monitored after transplant, the analysis of tumour cells and tumours for molecular abnormalities, testing for the purity and stability of cell lines, and agricultural applications, in particular, animal and plant pedigree analysis.
The restriction fragment length polymorphism (RFLP) technique (Southern E. (1975) J. Nol. Biol. 98:503-517) has been used to detect polymorphisms. The technique involves digesting a sample of DNA with restriction endonucleases which are enzymes which recognize specific sequences in DNA and catalyze endonucleolytic cleavages yielding DNA of defined lengths. The DNA fragments from the digestion are separated on an agarose gel according to their molecular size, transferred to a membrane, and hybridized with a labelled probe to identify a particular nucleic acid sequence. Differences among individuals in the lengths of a particular restriction fragment are referred to as restriction fragment length polymorphisms (RFLP).
Kan and Dozy (PNAS 75:56531-5635, 1978) report 2136~

RFLPs produced by HpaI cleavage of human ~-globin gene and an apparent association between a 13.0 kb variant of the normal 7.6 kb fragment and sickle haemoglobin mutation.
These RFLPs were detected by comparing Southern blots of HpaI restricted cellular DNA from individuals with normaI
haemoglobin, sickle cell trait and sickle cell anaemia probed with a radiolabelled ~-globin cDNA probe.
Botstein et al, Am J. Human Genet (1980) 32:314-331, have proposed using RFLPs to construct a genetic linkage map of the human genome. The principle of the mapping system is to develop using recombinant DNA
techniques, random single-copy DNA probes capable of detecting DNA sequence polymorphisms in restriction endonuclease digests of an individual's DNA. The probes will define loci which can be used for linkage analysis in human pedigrees. The loci can also be arranged into linkage groups to form a genetic map.
RFLPs have been used to identify genes associated with disease. Generally a disease gene is located based on the premise that a RFLP closely linked to a gene would be inherited with the gene. The inheritance of numerous RFLPs in families having the disease can be traced using random cloned DNA fragments from a human gene library as probes. An RFLP which is found to be inherited along with the disease indicates that the RFLP and the disease gene are closely linked.
Particular polymorphisms have been correlated with certain diseases or disorders. For example, the following diseases have been mapped by linkage studies using RFLP techniques: Huntington's Disease, (Gusella et al Nature 306:234-238, 1983); Duchenne's muscular dystrophy, (Nurray et al., Nature 542-544, 1982); X-linked Retinitis Pigmentosa, (Bhattacharya, Nature 309:253-25, 1984); adult polycystic kidney disease (Reeders et al., Nature 317:542-544, 1985); cystic fibrosis, (Tsui, et al., Science, 230:1054-1056, 1985). U.S. Patent No. 4,801,531 to Fossard describes a probe and a detection method for identifying polymorphisms which are highly predictive of the development of atherosclerosis.
Restriction fragment length polymorphisms have been used for typing the Human Leucocyte Antigen (HLA) system (U.S. Patent No. 5,110,920 to Erlich). The method generally involves digesting DNA from an individual with a restriction endonuclease that produces a polymorphic digestion pattern with HLA DNA, then subjecting the digested DNA to a labelled DNA hybridization probe that hybridizes to the HLA DNA sequence involved in the polymorphism. The resulting hybridization pattern on the genomic blot of an individual is then compared to a stAn~rd pattern obtained using the same endonuclease and DNA probe.
RFLP markers have been used in plant studies.
EPO published patent application No. 0 317 239 describes a method and device for detecting and analyzing restriction length probe hybridization patterns using fluorescing labels and light emission detection technology. Genomic DNA samples to be tested are digested with an appropriate restriction enzyme which will create polymorphic fragments. The polymerase chain reaction is performed using chromophore-tagged primers which are constructed using sequence information from a cloned probe previously known to reveal polymorphisms through conventional Southern blot analysis, and the polymorphic pattern of the test DNA is revealed by exciting the chromophores to fluoresce and detecting the florescence.
Broad et al., U.S. Patent No. 5,098,824, disclose polynucleotide sequences which are capable of selectively hybridizing to fragments of Equidae DNA, and methods of identifying polymorphism in Equidae using the sequences.
Specific DNA probes for detecting hypervariable regions of a human chromosome have been disclosed. U.S.
Patent Nos. 4,980,461, 5,026,837 and 5,077,400 to Litt describe DNA probes which are homologous to at least a portion of a hypervariable DNA region D2S3 located at chromosome 2q35-37, a hypervariable DNA region located on chromosome 16q22-q24, and a hypervariable DNA region located on chromosome 17(17pl3), respectively, in the human genome.
Jeffreys et al (Nature 316:76-79, 1985) have disclosed that tandem repeat regions of DNA, referred to as minisatellites, which are dispersed throughout the human genome, are often highly polymorphic due to variation in the number of short tandem repeats in a minisatellite. The repeat sequence in a subset of human minisatellites share a common 10-15 base pair core sequence. A probe complementary to a repeat sequence can be used to detect highly polymorphic minisatellites. The probe however, detects repeat sequences that occur throughout the entire human genome and give rise to very complex genomic blotting patterns which are often difficult to interpret.
Polymorphisms have been analyzed by polymerase chain reaction amplification of target sequences. The amplified oligonucleotide products have been analyzed by separation using gel chromatography and their ability to hybridize with probes. Jeffreys et al, (Nature 354:
November 21, 1991) describe a modified PCR technique for analyzing minisatellite regions. The technique known as minisatellite variant repeat mapping (MVRM or MVR-PCR) uses at least one primer which is targeted at a sequence in the DNA flanking a hypervariable loci and at least one targeted within the hypervariable loci.
WO 92/18646 (Application No. PCT/GB92/00709) describes a repeat sequence that occurs in hypervariable loci of human genomic DNA and its use as a target for application of genetic analysis techniques such as RFLP
and MVRM.
Newman and Aster (U.S. Patent No. 5,091,302) describe methods for analyzing polymorphisms associated with platelet or red blood cell alloantigens. Amplified 21367~)S

DNA generated from red blood cell or platelet mRNA is analyzed by differential restriction endonuclease digestion (DRED), allele-specific oligonucleotide probing (ASOP) and ligase-mediated gene detection (LMGD).
DRED analysis involves determining the alloantigen phenotype by cleaving a particular polynucleotide segment using an enzyme. DRED may be used if a particular amplified cDNA segment contains a previously identified sequence variation that distinguishes an allele of a polymorphism and this sequence is recognized by a restriction endonuclease. ASOP
analysis according to conventional techniques, involves synthesizing labelled oligonucleotide probes that will hybridize under appropriate conditions to a specific amplified cDNA segment that contains a nucleotide sequence that distinguishes one allele from other alleles of a red blood cell or platelet membrane glycoprotein. In LMGD
(Landegren et al, Science 241:1077-80, 1988), a pair of oligonucleotides are synthesized that will hybridize adjacently to each other on an allele-distinguishing cDNA
segment. Each of the probes is labelled with a different labelling agent, and when the probes hybridize to the allele-distinguishing cDNA segment, the probes can be ligated together by addition of a ligase. Both types of labelling are observed together after the probes are isolated from the cDNA segments. Where the probes bind to a nucleotide sequence which differs from the allele distinguishing cDNA segment, the probe pair is not ligatable and both types of labelling are observed separately after the probes are isolated from the cDNA
segments.
A form of polymorphism known as short tandem repeats (STRs) or microsatellites (for example, (TG)n repeats) has been detected using the polymerase chain reaction. Litt and Luty, (Am. J. Hum. Genet. 44:397-401, 1989) used the polymerase chain reaction to amplify a (TG)n microsatellite in the human cardiac actin gene.

213670~

Weber and May, (Am. J. Hum. Genet. 44:388-396, 1989) characterized 12 polymorphic (TG)n microsatellites and they used PCR to reveal polymorphism of (TG)n repeats in the gene for insulin-like growth factor I.
Denaturing gradient gel electrophoresis (DGGE) and single-stranded conformational polymorphism (SSCP) analysis which make it possible to detect single base changes in DNA, have been used to identify polymorphisms (Orita et al. 1989, PNAS U.S.S. 86:2766-2770 Sheffield V.C. et al., Am. J. Hum. Genet. 50:567-575, 1992, Gray, M.R., Am. J. Hum. Genet. 50:331-346, 1992). DGGE is based on the observation that sequence differences in DNA
fragments often cause them to migrate differently in denaturing gradient gels. A comparison of the melting behaviour of sets of DNA fragments from different genotypes in denaturing gels will reveal fragments with sequence differences since these fragments will have altered gel positions.
Orita et al. (PNAS U.S.A. 96:2766-2770, 1989) used single stranded conformation polymorphism (SSCP) to detect mutations in nucleic acids. SSCP involves amplifying wild-type and mutant target DNA by PCR, denaturing the amplified products and electrophoresing the denatured products side by side through a non-denaturing polyacrylamide gel. The two single-stranded DNA segments from the denatured products assume a three dimensional conformation dependent on the primary sequence. Sequence differences may be determined by differential migration of the single strands. PCR products may then be analysed by sequence analysis to determine the exact nature of the mutation.
Kreitman, M. and Aguade N., (PNAS USA, 83:3562-2563, 1986) describe a technique for detecting polymorphisms which involves a modification of the classical Southern Blot technique. Individual samples of DNA are separately digested with restriction enzymes which recognize four nucleotide sequences, the digestion 213670~

products are electroblotted from a gel onto a membrane and a hybridization probe is used to identify a known polymorphism.
Poduslo S.E. et al, Am. J. Hum. Genet. 49:106-111, 1991 amplified segments of a single DNA of theproto-oncogene KIT and the insulin-like growth factor-1 receptor gene IGFlR, digested the amplified segments separately with frequently cutting (4bp recognition sequence) restriction enzymes, resolved the products on polyacrylamide gels and identified polymorphisms on the two genes.
SUNMARY OF T~ INVENTION
The present inventors have developed a method of screening for polymorphisms. Point mutations in a restriction endonuclease enzyme site and insertion/
deletion mutations may be identified using the method of the invention. The method takes advantage of the efficiency of amplification techniques such as PCR and the highly accurate recognition ability of restriction endonuclease enzymes. The method permits for the screening of polymorphisms without running single stranded conformation polymorphism (SSCP) or temperature gradient gel electrophoresis (TGGE) and/or direct sequencing of the DNA from individuals. The method is also sensitive for low frequency polymorphisms and accordingly it may be very useful for genetic association studies in comparison with high frequency polymorphisms. The method requires m in;~l amounts of restriction endonuclease enzymes, and allows testing of large numbers of enzymes many fold greater than used in the traditional RFLP procedure using Southern blot analysis. The method also allows for the detection of polymorphisms in single copy genes of very complex genomes, such as those found in plants where traditional Southern blotting techniques require extremely high specific activity of the DNA probe. Further, the method allows for the screening of several sequences throughout a gene, or the screening of different sequences on 2l367ns different genes simultaneously. The method of the invention by digesting amplified products with a series of restriction endonuclease enzymes provides a wide range of sizes of fragments. This permits the selection of optimal size fragments facilitating the detection of insertion/deletion mutations.
The major advantage of the method of the invention is that it is 'non-parametric', i.e. there is no need to adjust a large number of variables (parameters) for different target sequences. The technique can be applied to a relatively wide range of PCR product sizes, from less than 100 bp to more than one kilobase, with the same degree of efficiency. In addition, the approach does not require switching techniques from the DNA polymorphism detection step to the adaptation of the new polymorphism to the large scale genotyping format. The same primers, identical PCR conditions, and the informative restrictive enzymes can be immediately applied to a large-scale polymorphism analysis.
The method of the present invention has many practical applications. The method of the present invention may be used to detect polymorphisms associated with human, animal, or plant characteristics and disease.
The method can be used to screen populations for known polymorphisms. For example, the method of the present invention may be used to screen populations for polymorphisms associated with conditions such as Huntington's Disease, (Gusella et al Nature 306:234-238, 1983); Duchenne's muscular dystrophy, (Murray et al., Nature 542-544, 1982); X-linked Retinitis Pigmentosa, (Bhattacharya, Nature 309:253-25, 1984); adult polycystic kidney disease (Reeders et al., Nature 317:542-544, 1985);
cystic fibrosis, (Tsui, et al., Science, 230:1054-1056, 1985); familial polyposis coli, multiple endocrine neoplasia, and atherosclerosis (U.S. Patent No. 4,801,531 to Fossard). The method may be particularly useful in screening populations which have multiple polymorphisms 213670~

associated with a condition such as insulin dependent diabetes mellitus (Lucassen A. M. et al., Nature Genetics, 4:305, 1993), peripheral neurofibromatosis, central neurofibromatosis, Charcot-Narie-Tooth disease and Alzheimer's Disease.
The method of the invention can also be used to screen populations for unknown polymorphisms. For example, using the method of the invention, a PCR-based SmaI RFLP
associated with D4 dopamine receptor was identified. The D4 dopamine receptor is of significant interest for research of neuropsychiatric disorders and psycho-pharmacology. The method may also be used to screen for polymorphisms in the nucleic acid sequences identified pursuant to the Human Genome Project.
Broadly stated the present invention relates to a method of screening for polymorphisms in one or more selected nucleotide sequences on nucleic acids pooled from at least two different individual nucleic acid sources comprising:
(a) amplifying one or more selected nucleotide sequences on nucleic acids pooled from at least two different individual nucleic acid sources under suitable conditions to produce amplified nucleotide sequences;
(b) reacting the amplified nucleotide sequences with a series of different restriction endonuclease enzymes to produce reaction products, the restriction endonuclease enzymes being selected so that they cut at different restriction endonuclease enzyme sites;
(c) separating and visualizing the reaction products;
(d) comparing the reaction products obtained for each restriction endonuclease enzyme and identifying restriction endonuclease enzymes which cleave the amplified nucleotide sequences thereby detecting polymorphisms in the selected nucleotide sequences, in the absence of probes specific for the polymorphisms.
In order to confirm the presence of a 2l367ns polymorphism the method may additionally comprise the steps of:
(e) amplifying the selected nucleotide sequence on a nucleic acid from one of the pooled individual nucleic acid sources from step (a) under suitable conditions to produce amplified nucleotide sequences;
(f) digesting the amplified nucleotide sequences with a restriction endonuclease enzyme identified in (d) to produce restriction fragments;
(g) separating and visualizing the restriction fragments; and (h) detecting cleaved amplified nucleotide sequences for the restriction endonuclease enzyme thereby confirming the presence of a polymorphism.
A polymorphism detected in accordance with the methods of the invention may be used as a marker for association and linkage studies in human, animal, plant or microbial genetics.
The invention also relates to a reagent kit useful in performing the methods of the invention comprising a series of restriction endonucleases selected so that they cut at different restriction endonuclease enzyme sites, and the necessary reagents for digesting amplified nucleic acids, and/or all the reagents required to amplify the nucleic acids and suitable supports useful in performing the method of the invention.
These and other aspects of the present invention will become evident upon reference to the following detailed description and attached drawings. In addition, reference is made herein to various publications, which are hereby incorporated by reference in their entirety.
DESCRIPTION OF THE DRAWINGS
The invention will now be described in relation to the drawings in which:
Figure 1 is an autoradiogram showing restriction endonuclease enzymes having restriction sites within the human DRD4 gene identified using the method of the 21367~S

invention;
Figure 2 is an autoradiogram confirming that SmaI reveals a polymorphism on the human DRD4 gene;
Figure 3 is an autoradiogram showing the separation of deleted and undeleted alleles;
Figure 4 is an autoradiogram showing the tyrosinase TaqI polymorphism revealed using the method of the invention;
Figure 5 shows the nucleotide and deduced amino acid sequence of the human dopanime D4 receptor gene and cDNA; and Figure 6 shows an alignment of the putative amino acid sequence (single letter code) of the human D4 receptor with the human and rat D1 and D2, and rat D3 receptors where the amino acids conserved between the D4 and the other dopamine receptors are boxed and putative transmembrane domains are indicated by bars and labelled in Arabic numerals.
DETATT.Rn DESCRIPTION OF THE INVENTION
As hereinbefore mentioned, the present invention relates to a method of screening for polymorphisms in selected nucleotide sequences from nucleic acids from at least two different individual sources. The method involves amplifying one or more selected nucleotide sequences on nucleic acids pooled from at least two different individual sources under suitable conditions to produce amplified nucleotide sequences. The amplified nucleotide sequences are reacted with a series of restriction endonuclease enzymes to produce reaction products. The reaction products are separated and visualized. The reaction products are examined to identify restriction endonuclease enzymes that reveal polymorphisms.
In the first step of the method of the invention, one or more nucleic acids from at least two different individual sources are pooled and amplified. The nucleic acids that may be analyzed by the method of the 213670~

invention include double or single stranded DNA or RNA, preferably DNA. In the case of single stranded DNA or RNA, a complementary strand should be synthesized. The nucleic acids may be from any source including viruses, microbes, bacteria and higher organisms such as plants and ~n i ~1 S
or from cloned DNA or RNA. Preferably, genomic DNA from different individual sources such as human genomic DNA, is analyzed by the method of the invention.
Nucleic acids may be obtained from source material according to established procedures such as those described in Maniatis, T., Fritsch, E.F. and Sambrook, J.
Molecular Cloning, A Laboratory Manual. Cold Spring Harbour, N.Y. , 1982, and by Chesney R.H. et al, J. Mol.
Biol. 130:161-173, 1979, Dellaporta, S.L. et al Plant.
Mol. Biol. Reporter 1:19-21, 1983, Jeffreys A.J. et al, Nature 314:67-73, 1985, Murray, M.G. Nucleic Acids Res.
8:4321-4326, 1980, Kan Y.W. et al, PNAS USA 75:5631-5635, 1978, Taylor, J.M., et al, Nature 251:392-393, Kan Y.W. et al, N Eng J med 297:1080-1084, 1977 and Law, D.G. et al, Gene 28:153-158, 1984, all of which are incorporated herein by reference.
The number of individual sources of nucleic acids which are used in the method of the invention will be selected based on the population frequency of a selected allele using the procedures described by Skolnick and White, (1982 Cytog. Cell Genet. 32(1-4):58-67)), which is incorporated herein by reference. If a polymorphism is expected to be very rare, the number of individual sources may be increased appropriately. For example, genomic DNA from unrelated individuals, for example 19 DNAs (10~1 of concentration 50ng/~l each) may be analyzed by the method of the invention. It will be appreciated that with a sample size of 19, the probability of missing a polymorphic allele having a population frequency of 0.1 is less than one in 50; for an allele with a frequency of .05 it is less than one in 7. If 4 or 9 samples of DNA are used these probabilities are .43, 213670~

.66, and .15, 0.4 respectively, (Skolnick and White, 1982 Cytog. Cell Genet. 32(1-4):58-67)). Low frequency alleles could be useful for population haplotype analysis or for association studies to detect a gene associated with a particular disease, or desired trait in an agricultural stock.
The individual sources of the nucleic acids will generally be selected depending on the application of the method. If the method is to be used to screen for a polymorphism associated with a particular disease, the nucleic acids may be from several individuals affected with the disease and several individuals without the disease. Nucleic acids from selected individuals for anthropological or evolutionary studies may also be analyzed using the method of the invention.
The nucleic acids are used as a template for amplifying one or more selected nucleotide sequences in the nucleic acids. Preferably, a nucleotide sequence(s) having a region(s) with a previously known sequence in an individual is selected for amplification. The nucleotide sequence(s) may be amplified by cloning using techniques known in the art such as described in Maniatis, T., et al., supra. For example, the nucleotide sequence(s) may be amplified using plasmid amplification in a host cell such as a bacteria. RNA amplification with transcript sequencing (RAWTS) and genomic amplification with transcript sequencing (GAWTS) which use a phage promoter sequence 5' may be used to amplify a nucleotide sequence(s) (Sommer, S.S. et al., PCR Protocols: A Guide to Methods and Applications, Academic Press, Inc. 1990 at pages 197-205). A nucleotide sequence(s) may also be amplified using the polymerase chain reaction which is described in more detail below.
The requirements of the polymerase chain reaction for amplifying a nucleic acid sequence are described in Nullis el al., U.S. Pat. No. 4,863,195 and Nullis, U.S. Patent No. 4,683,202 which are incorporated 213670~

herein by reference. Conditions for amplifying a nucleic acid template are described in N.A. Innis and D.H.
Gelfand, PCR Protocols, A guide to Methods and Applications M.A. Innis, D.H. Gelfand, J.J. Sninsky and T.J. White eds, pp3-12, Academic Press 1989, which is also incorporated herein by reference.
The process described by Mullis et al. amplifies any desired specific nucleotide sequence contained in a nucleic acid or mixture thereof. The process involves treating separate complementary strands of the nucleotide sequence to be amplified with two oligonucleotide primers which are extended under suitable conditions to form complementary primer amplification products which act as templates for synthesizing the same nucleotide sequence in a subsequent cycle. The primers are selected so that they are sufficiently complementary to the two strands of each specific nucleotide sequence to be amplified. The cycles of the PCR reaction may be carried out sequentially or simultaneously and they may be repeated until the desired level of amplification of the nucleotide sequence is obtained.
Primers which may be used in the method of the invention are oligonucleotides i.e. molecules containing two or more deoxyribonucleotides or ribonucleotides, of any selected sequence which occur naturally as in a purified restriction endonuclease digest or are produced synthetically using techniques known in the art such as for example phosphotriester and phosphodiester methods (See Good et al Nucl. Acid Res 4:2157, 1977) or automated techniques (See for example, Conolly, B.A. Nucleic Acids Res. 15:15(7): 3131, 1987). The primers are capable of acting as a point of initiation of synthesis when placed under conditions which permit the synthesis of an amplification product which is complementary to a nucleic acid strand i.e. in the presence of nucleotide substrates, an agent for polymerization such as DNA polymerase and at suitable temperature and pH. Preferably, the primers are sequences that do not form secondary structures by base pairing with other copies of the primer or sequences that form a hair pin configuration.
The sequence of a primer may be selected by computer or selected from a gene bank. The method of the invention only requires that sufficient sequence information be available to construct primers which are capable of amplifying a selected nucleotide sequence and it does not require sequence information for the polymorphism.
The primer may be single or double-stranded.
When the primer is double-stranded it may be treated to separate its strands before it is used to prepare amplification products. The primer is preferably an oligo-deoxyribonucleotide and contains between about 7 and 25nucleotides.
The primers may be labelled with detectable markers which allow for detection of the amplified products. Suitable detectable markers are radioactive markers such as P-32, S-35, and H-3, luminescent markers such as chemiluminescent markers, preferably luminol, and fluorescent markers, preferably dansyl chloride, fluorescein-5-isothiocyanate, and 4-fluor-7-nitrobenz-2-axa-1,3 diazole, enzyme markers such as horseradish peroxidase, alkaline phosphatase, ~-galactosidase, acetylcholinesterase, biotin, or digoxigenin.
It will be appreciated that the primers may contain non-complementary sequences provided that a sufficient amount of the primer contains a sequence which is complementary to the nucleotide sequence which is to be amplified.
The nucleic acid polymerase used in a PCR
amplification step in the method of the invention is selected depending on the nature of the nucleic acid to be amplified. For example, DNA polymerase such as the Taq polymerase obtained from the thermophilic bacterium Thermus aquatics or other thermostable polymerases may be 21367~S

used to amplify DNA template strands. Reverse transcriptase may be used with RNA nucleic acid templates.
The polymerase generally extends the primers in the 3' direction in the presence of nucleoside triphosphate substrates.
The nucleoside triphosphate substrates are used as described in Nullis el al., U.S. Pat. No. 4,863,195 and Mullis, U.S. Patent No. 4,683,202, and in N.A. Innis and D.H. Gelfand, PCR Protocols, A guide to Nethods and Applications M.A. Innis, D.H. Gelfand, J.J. Sninsky and T.J. White eds, pp3-12, Academic Press 1989. The substrates can be modified using methods known in the art.
For example, the substrates may be labelled with detectable markers to facilitate identification of amplified products. Examples of detectable markers are radioactive markers such as P-32, S-35, I-125, and H-3 or chemiluminescent markers. The substrates may also be biotin labelled (See Langer et al, PNAS USA 78:6633-7, 1981 which is incorporated herein by reference) or labelled with a photoactivatable analogue of biotin tForster et al, Nuclei Acids Res. 13:745-761, 1985). A
mobility-shifting analogue of a natural nucleoside triphosphate substrate may also be employed in the method of the invention (See U.S. Patent No. 4,879,214 which is incorporated herein by reference). Labelling with a mobility-shifting analogue is expected to enhance resolution particularly where PCR products are close together in the polymorphic digestion pattern.
The conditions which may be employed in the amplification step of the method of the invention using PCR are those which permit hybridization and amplification reactions to proceed in the presence of the nucleic acid and appropriate complementary hybridization primers.
Conditions suitable for the polymerase chain reaction are generally known in the art. For example, for DNA
templates the PCR utilizes ~ polymerase (GeneAmp Kit, Cetus) as the polymerization agent, and each cycle 21367Q~

consists of the following: denaturation at 90 to 100C for 5-120 seconds, preferably 20 seconds; annealing at 35 to 72C (may vary depending on the primers' length and AT/GC
ratio) X 5-120 seconds; and extension at 65 to 75C X 5 5 seconds to 5 minutes. Using 25 to 35 cycles of this preferred method, the DNA nucleic acid is generally amplified to easily detectable amounts.
The primers used in the amplification step may be labelled with a detectable marker or the nucleic acids 10 may be amplified to a desired level and a further extension reaction may be performed to incorporate nucleotide derivatives having detectable markers such as radioactive labelled or biotin labelled nucleoside triphosphates as described above. The detectable markers 15 may be analyzed by electrophoretic separation, laser detection, colorimetric methods or other techniques known in the art.
Following amplification of a nucleotide sequence(s) in the nucleic acid, the amplified nucleotide 20 sequences are reacted with a series of different restriction endonuclease enzymes. The method of the invention employs class II restriction endonuclease enzymes that cleave the nucleic acids at specific nucleotide sequences. Restriction endonuclease enzymes 25 that produce both blunt end and sticky end fragments may be used in the method of the invention. Suitable restriction endonuclease enzymes which may be used in the method of the invention are described in Sambrook, J., et al., Nolecular Cloning, A Laboratory Manual, Second 30 Edition, Cold Spring Harbor Laboratory Press, 1989, Chapter 5, Enzymes Used in Molecular Cloning which is incorporated herein by reference. Restriction endonucleases enzymes are commercially available for example from New England Biolabs (approximately 140), 35 Boehringer Mannheim (approximately 100), Gibco BRL
(approximately 70) and Fermentas (Lithuania) (approximately 80) (See Table 1 for a listing of restriction endonuclease enzymes available from Fermentas). It will be appreciated that rare restriction endonuclease enzymes may be used in the method of the invention.
The number of different restriction endonuclease enzymes used to digest a given amplified nucleic acid product will vary depending on the polymorphism information content required and the inherent variability of the DNA at a given site. However, employing a larger number of enzymes will permit the rapid identification of restriction endonuclease enzymes that produce polymorphic digestion patterns for the locus or loci being investigated. A strategy for selecting restriction endonucleases is set out in Example 4.
The restriction endonuclease enzymes are preferably applied as a pool of enzymes. A pool of enzymes may comprise enzymes grouped according to their activity in a particular buffer system. For example, a pool may comprise AluI, BsmAI, ClaI, ASuI, RsrI, KSp6321, EamllO51, SacI, HindII, MspI, SplI, AvaIII and SmaI which are active in a Tris-acetate bovine serum albumin (BSA) buffer.
Enzymes may also be grouped based on their specificity for a specific site and the frequency of the site in the nucleic acids to be screened.
The reaction of the amplified nucleotide sequences with the restriction endonuclease enzymes may be carried out under suitable conditions for endonuclease activity. For example, the digestion may be carried out in an aqueous medium buffered to a pH of about 6 to 8 and at a temperature of about 20 to 45C, preferably physiological pH and temperatures. Some restriction endonuclease enzymes may require the presence of other agents for activity. For example, certain ions such as magnesium, sodium or potassium and factors such as BSA may have to be included in the medium.
The amount of amplified nucleotide sequences required in the reaction mixture will depend on the method of visualization selected. Typically the amount of nucleotide sequences in the reaction mixture will be in the range of between about lng to l~g. Where the amplified nucleotide sequences are labelled with a radiolabel, the amount used in the method will be determined by the radioactive energy of the product. If ethidium bromide is used the amount of DNA required is approximately 50ng, and where autoradiography is used the amount of DNA is about 1 ng.
The amount of enzyme used in the reaction mixture will depend on the restriction endonuclease enzyme selected. The amounts used in the method are generally very low and a series of enzymes at about 1/20 of their standard concentrations may be used. Generally, the concentrations of each of the enzymes is in the range of .1 to 5U/~l. An enzyme activity of about 0.1 U has been demonstrated to provide complete digestion after 10-30 minutes.
The next step in the method of the invention is to analyze the reaction products for potentially polymorphic restriction fragment patterns. The reaction products are separated preferably by molecular size, using techniques known in the art. Electrophoresis according to standard practice as described in Sambrook, J. et al (Molecular Cloning A Laboratory Nanual Cold Spring Harbour Laboratory Press, pp.6.3-6.9, 1989 which is incorporated herein by reference) may be used to separate the reaction products and any controls, and supports such as gel sheets or slabs, for example, polyacrylamide, preferably 3 to 6%
polyacrylamide, agarose or other polymers are typically used as the supporting medium. Low concentration gels are more useful for long amplification products (1200-9OObp) and high concentration gels for shorter DNA fragments (200-300 bp). Suitable conditions are employed to effect the desired degree of resolution of the reaction products.
For example, where a polyacrylamide gel is used it may be run for 2 to 4 hours to separate strands of different lengths. If radiolabelled substrate is used in the amplification step, it may be preferred to load the samples on a nondenaturing polyacrylamide gel because separation of two different strands of the same allele that have two different mobilities can simulate additional informative bands. However, it is preferred to use denaturing gels since they provide clearer bands.
In order to ensure that one is observing all signals that are informative in the polymorphic restriction fragment, it may be necessary to dilute the amount of digested amplified nucleic acid product to be loaded on the gel by the number of chromosomes (for autosomes, two times the number of individuals) analyzed in the pool. This procedure will demonstrate for reference purposes the approximate signal strength that would be observed if only one chromosome contained a polymorphic allele. Faint signals found on the gel run of the digested products are compared to this basic unit of signal as a means to identify whether or not at least one polymorphic allele is present in the gel lane. This reference procedure is performed by loading on a few marker lanes a sample diluted by the number of chromosomes in the pool of individuals. For X and Y linked genes it should be recalculated according to the number of pooled DNA from males and females. It is useful to load labelled size markers on the same gel to permit estimation of the size of the reaction products. For example labelled DNA size markers such as pBR322/HaeIII and pBR322/HinfI may be loaded in several lanes of the gel. Undigested amplified nucleotide sequences may also be used as a control in the analysis.
To avoid PCR/RFLP artefacts due to non-specific amplication, the specific major nucleotide sequence band is cut from the gel and reamplified with the same original primers to produce only specific amplified nucleotide sequences (See discussion above and see Maniatis et al., supra for general method). The reamplified specific 2136~n~

nucleotide sequences are then digested with the restriction enzymes and the reaction products are analyzed on a polyacrylamide gel.
After separation of the reaction products, the products are identified on the support using techniques known in the art. Fragments labelled with a radioactive marker may be visualized by placing an X-ray film in direct contact with the support so that a pattern of bands of exposed film are produced in the positions corresponding to the labelled products. Preferably the X-ray film is exposed to the support for 5 to 20 hours.
Where the reaction products are labelled with a chemiluminescent marker the exposure time would be greatly reduced. Reaction products labelled with a fluorescent marker may be detected by a linear photodiode array detector. The duration of the exposure will depend on the intensity of the control signal. Preferably, the reaction products are labelled with a radioactive marker and are detected using polyacrylamide gels by autoradiography or non-radioactive scanning (using Applied Biosystems or Pharmacia equipment). Where radioactive or chemiluminescent markers are used FUJI~ electronic film could be used on the gel.
Electrophoresed reaction products may also be transferred to membranes such as nylon membranes, using electrotransfer, vacuum blotting, or preferably capillary blotting. The material transferred to the membrane may then be detected by hybridization. (See Vignal A., et al., Methods in Molecular Genetics, Vol. 1, Chromosome and Gene Analysis ed., K.W. Adolph). For example, amplified nucleotide sequences may be reacted with a series of different restriction endonuclease enzymes, separated by polyacrylamide gel electrophoresis, blotted on a nylon membrane and the reaction products detected by hybridization to labelled primers. The results are obtained as images on films after photographic exposures of hybridized films.

The patterns produced by the reaction products of the pooled nucleic acids are compared to identify polymorphic restriction sites within the amplified nucleotide sequence. Generally, digests having polymorphic restriction sites corresponding to point mutations within the amplified nucleic acid will show smaller and generally fainter signals. If the sum of the lengths of the fragments observed in one lane is greater than the undigested size of the amplified product, the restriction endonuclease is potentially informative. Multiple fragments are generally produced by 4 to 5 bp recognition site enzymes. If the polymorphism is the absence of a restrictive endonuclease site, the signal band will be larger.
Each of the putative informative enzymes may then each be tested with one of the nucleic acids from the original nucleic acids analyzed. The nucleic acid region of interest is amplified from the nucleic acid sample of an individual as described above and the amplified nucleotide sequences are digested with the putative informative enzyme. The digested amplified nucleotide sequences from the nucleic acid samples of each individual are separated and visualized as described above. For example, the amplified nucleotide sequences may be separated on an appropriate support for example an agarose gel, and the amplified nucleotide sequences are identified by for example staining using a nucleic acid stain such as ethidium bromide.
Fragments containing polymorphisms may be isolated and sequenced using techniques known in the art (See for example, Sambrook et al, supra; Sanger and Prober et al., Science 238:338-341, 1987 re DNA sequencers utilizing laser induced fluorescent detection and chemical modification of DNA fragments to attach fluorophores).
The reagents suitable for applying the method of the invention to detect polymorphisms may be packaged into convenient kits providing the necessary materials packaged 213670~

into suitable containers. For example, such kits may include a series of restriction endonuclease enzymes and/or the necessary reagents for digesting amplified nucleic acids and/or the reagents required to amplify nucleic acids in a sample by means of the methods described herein. The kits may also include suitable supports useful in performing the method of the invention.
Preferably, the kit contains a relatively large number of restriction endonuclease enzymes (50 to 150) used separately or pooled according to their digestion conditions.
The methods and kits of the present invention have many practical applications. For example, the methods and kits of the present invention may be used to screen for unknown polymorphisms associated with human, ~nir-l or plant characteristics and disease. More particularly, the methods and kits of the invention may be used to screen for polymorphisms in functional DNA sequences in a group of affected individuals which are rare in control unaffected individuals. Traditionally, detection of new polymorphisms is accomplished by testing DNA panels of unrelated unaffected individuals. The methods and kits of the present allow the rapid testing of many groups consisting of a large number of affected individuals, and thereby increasing the chance for detection of disease specific polymorphisms that may be common in the affected population, but rare in the unaffected group.
The methods and kits of the invention may be used to identify and detect variants in genes controlling size, yield, and nutritional value of agricultural plants.
The polymorphisms identified using the method of the invention may be used as markers in genetic mapping.
For example, it can be applied to the genetic mapping of expressed sequence tags described in the National Institutes of Health, Venter et al. U.S. Patent Application. Expressed sequence tags have been found for several thousand brain and liver cDNAs and the majority of them (more than 80%) have no sequence homology with already cloned and mapped human genes. Only about one percent of the expressed sequence tags contain polymorphic microsatellites, and genetic mapping of the rest is an unsolved problem.
The polymorphisms identified using the method of the invention may also be used as markers to detect certain chromosome segments. Nucleic acids identified as potential markers may also be used to make recombinant clones expressing particular antigens which may be useful for diagnostic purposes, for making antibodies, or for therapy.
The methods and kits of the invention may be used to screen for known polymorphisms associated with human, Anir~l, or plant characteristics and disease. For example, the method of the present invention may be used to screen populations for polymorphisms associated with conditions such as Huntington's Disease, (Gusella et al Nature 306:234-238, 1983); Duchenne's muscular dystrophy, (Nurray et al., Nature 542-544, 1982); X-linked Retinitis Pigmentosa, (Bhattacharya, Nature 309:253-25, 1984); adult polycystic kidney disease (Reeders et al., Nature 317:542-544, 1985); cystic fibrosis, (Tsui, et al., Science, 230:1054-1056, 1985); familial polyposis coli, multiple endocrine neoplasia, and atherosclerosis (U.S. Patent No.
4,801,531 to Fossard). The method may be particularly useful in screening populations which have multiple polymorphisms associated with a condition such as insulin dependent diabetes mellitus (Lucassen A. M. et al., Nature Genetics, 4:305, 1993), neurofibromatosis, Charcot-Marie-Tooth disease and Alzheimer's Disease.
The methods and kits of the present invention may also be used alone or in conjunction with conventional methods for screening for known or unknown polymorphisms.
The following non-limiting examples are illustrative of the present invention:

2136~Q5 EXAMPLES
Example 1 A new two allele PCR-based SmaI RFLP was revealed in the human DRD4 gene employing the method of the invention. More particularly, a 0.7 kb fragment in the 5'-region of the DRD4 gene including the first exon (Van Tol et al., Nature 350:610-614, 1991 and see Figures 5 and 6 herein showing the sequences of the human dopamine D4 receptor) was amplified in pooled DNA from 14 individuals by the polymerase chain reaction (PCR). The direct primer (d4 al: 5'-AGATACCAGGTGGACTAGGG-3') was derived from nucleotides -421 to 402, and the reverse primer (d4 a2:
5'-ACCTCGGAGTAGACG~AG-3') from nucleotides 286 to 267 of the sequence. This amplifiable region was GC rich (75%), which required the use of 7-deaza-2'-dGTP (Pharmacia) and dimethyl sulphoxide (DMSO) according to standard methods (Innis, 1990, PCR Protocols: A Guide to Methods and Applications. New York. Academic Press. 1990, pp 54-59).
The reaction mixture contained 100ng of genomic DNA, 0.5~M
of each primer, 200~M of dATP, dCTP, dTTP, 100uM of dGTP
and 100uM of 7-deaza-2'-dGTP and 10% of DNSO in a total volume of 25~1. Thirty cycles comprised of denaturation at 95C for 20 sec, annealing at 56C for 20 seconds and elongation at 72C for 30 sec, with a final extension step at 72C for 5 min, were performed using a DNA Thermocycler (Perkin Elmer Cetus 9600).
Restriction enzymes do not cut DNA synthesized with 7-deaza-2'-dGTP, and a second PCR without 7-deaza-2'-dGTP was carried out. One ~1 of amplified DNA PCR mix served as template for the second PCR run, conditions of which were identical except the concentration of dGTP was increased to 200~M, no 7-deaza-2'-dGTP was used, the concentration of dCTP was reduced to 50~M, and 20~Ci of p32 dCTP was added.
Radioactive amplified product was digested separately by 40 different restriction endonuclease enzymes ( Aat I, Acc I, Alu I, Apa I, Ava I, Ava II, BamH

21367Q~S

I, Ban I, Bcl I, Bgl II, BstE II, Dde I, Dra I, EcoR I, Hae III, Hind III, Hinf I, Hinc II, Hha I, Hpa I, Mbo I, Mlu I, Msp I, Nde I, Nhe I, Nru I, Pst I, Pvu I, Pvu II, Rsa I, Sac II, Sau3AI, Sma I, Sph I, Stu I, Taq I, Xba I, Xho I). The concentration of the enzymes used was from 0.1 to 1.0 Units. Digestion products were analyzed in a polyacrylamide gel (6% denaturing polyacrylamide gel size 40 x 30cm, 3 hours at 1600V). The majority of the enzymes had no restriction sites in the amplified DNA fragment.
Figure 1 shows that SmaI generated three bands corresponding to 700 bp, 400 bp and 30Obp within the 5'DRD4 region (See arrows), and it was considered to be an informative enzyme for a polymorphism.
The procedure was repeated using SmaI to confirm that the restriction site was a polymorphism. In particular, a 0.7 kb fragment in the 5'-region of the DRD4 gene including the first exon was amplified in DNA from each of the individuals in the original pooled sample using the method described above. A restriction enzyme buffer was added directly to the PCR mixture (lx concentrated) and the amplified DNA fragment was digested with 1-2 units of SmaI enzyme (New England Biolabs) for 3 hours. Digestion products were analyzed in a 2.5~ agarose gel.
As shown in Figure 2 the polymorphic SmaI
restriction site is known to be located in the 5' non-coding region of the human DRD4 gene. In the presence of the SmaI site (allele A1), two restriction fragments of sizes approximately 0.4 and 0.3 kb were observed (See arrows). In the absence of the SmaI site (allele A2) a fragment of 0.7 kb was detected (See double arrow). The coding region does not contain any SmaI sites, but at least one SmaI restriction site exists in the non-coding 5'region of the gene.
Frequency/Alleles: Estimated from 100 unrelated Caucasians.
A1 (0.4kb+0.3kb):0.95 213~705 A2 (0.7kb):0.05.
Heterozygosity:0.095; PIC=0.09.
Chromosomal Localization: The DRD4 gene has been localized to chromosome llp 15.5 (Gelernter et al., Genomics 13:208-210, 1992), between the genes for Tyrosine Hydroxylase and H-ras (Petronis, A et al, Genomics 18:161-163, 1993).
The D4 dopamine receptor is of interest in research of neuropsychiatric disorders and psycho-pharmacology primarily based on the fact that the D4receptor binds the antipsychotic medication clozapine with higher affinity than does any other dopamine receptor.
Furthermore, in the third exon of this gene, there is an unusual 48bp repeat sequence polymorphism that produces variable affinities for clozapine (Van Tol et al., Letters to Nature, 358:149, 1992). The SmaI RFLP serves as a valuable marker for genetic linkage and association studies between DRD4 and various neuropsychiatric dlseases .
Example 2 The above method described in Example 1 reveals insertion/deletion polymorphisms. In Figure 1, three to four bands were observed at the 0.7 kb level. If all the 0.7 kb fragments are of identical length, there should be a maximum of two bands if the different strands of the same DNA fragment are moving along the gel at different speeds. Amplified 5'-DRD4 fragments were tested separately using the procedures described in Example 1, without adding any restriction enzymes, and in four cases a shorter allele was detected (Figure 3). Homozygous individuals have two bands and heterozygous individuals have three bands (the polymorphsim is contained in four bands (See arrows) but 2 overlap in the autoradiogram shown in Figure 1).
Example 3 A known tyrosinase polymorphism, a TaqI polymorphism at the CCAATT box of the human tyrosinase (TYR) gene, was identified using the method of the invention. The 5' promoter region of the human tyrosinase gene (TYR) was amplified using the method as described by Oetting W.S. et al., Nucleic Acids Research, 19:5800). In particular, thirty five cycles of PCR were performed in 100~1 volumes containing 200 ng of pooled genomic DNA, 1 ~M of each primer and 2.5 U Taq DNA polymerase, 2 mM dATP, and dGTP
and 0.5 ml dCTP and 10 ~Ci of p32 dCTP within the standard reaction mix. Each cycle consisted of 1 min at 94C, 1 min at 50C and 1.5 min at 72C generating a 973-bp fragment.
The primer sequences were as follows:
5'end 5'-GGAAAAACAATATGGCTACA-3' 3' end 5'-TCTTCCTCTAGTCCTCACAA-3' A restriction enzyme buffer cont~ining 15 different restriction endonuclease enzymes were added to the amplified fragments. The digestion products were analyzed on a non-denaturing polyacrylamide gel. Two bands of approximately 774 bp and 199 bp were seen in the Taq I
digestion lane. Analyzing each individual DNA separately in the presence of the polymorphic site two fragments of approximately 774 bp and 199 bp were detected. In the absence of the TaqI site, a fragment of 973 bp was detected. Figure 4 shows the Taq I polymorphism (See arrow).
Example 4 Strategy for Selection of Restriction Enzymes (REs) Some principles for predicting the relative efficiencies of different REs for detecting DNA
polymorphisms were proposed by Wijsman (Wijsman, E.M., 1984, Nucleic Acid Research, 12, 9209-9226). The model was developed assuming that the optimized list of enzymes is used for Southern blot-hybridization based DNA
polymorphism detection. Although the guidelines for making rational choice for the list of REs were developed, they could not be applied widely because the most informative enzymes were 4-bp recognizing enzymes, and they cut DNA to relatively short fragments beyond the 213670~

Southern blotting resolution. Except for the observation that the most valuable REs are MspI and TaqI which recognize a mutation-prone dinucleotide CG (Cooper, D.N., Youssoufian, H., Num. Genet. 78:151-155, 1988), polymorphism detection data to date have been empirically based on the frequency of RFLPs for the 10 to 20 most common REs (Human Gene Mapping-9.5; 1988). The cost of each enzyme has also been a determining factor in regard to how often that enzyme was used to screen for polymorphic sites.
Principles which are discussed herein for selection of restriction endonucleases in the method of the invention include (1) RFLPs due to loss and gain of a restriction site, (2) overlap of the restriction recognition sites for different enzymes, and (3) the smallest detection fragment.
A detailed investigation was performed directed toward defining the most optimal usage of REs. The analysis was based on known human DNA sequences that are larger than five kb (retrieved from EMBL Release 37) with a total combined length of 2,848,305 base pairs. The program for the sequence analysis was written and performed on a 486DX2-66MHz computer. Two rounds of analysis were performed. In the first one, it was assumed that the degree of mutability for all four nucleotides is identical, and the informativeness of a RE depends most on the frequency of its restriction sites (RS). In the second analysis, in addition to the frequency of restriction sites and the degree of overlap between restriction sites, a new parameter of the mutability for each nucleotide was included.
Selection of Restriction Enzymes without Evaluation for Different Degrees of Mutability The starting point for RE selection was to determine what proportion of a DNA sequence is comprised of restriction sites (RSs) of a given RE. A systematic analysis of more than 150 REs (REBASE, January 1994, New 213670~

England BioLabs) was carried out. The enzyme which had the largest degree of DNA sequence coverage (coverage means the number of nucleotides in the sum of RSs in the given DNA fragment divided by the length of the DNA
fragment) was ScrFI (RS is CCNGG). The number of nucleotides, mutations of which would lead to disappearance of the RSs for ScrFl was 77,432 in a 2.848 Mb length of summed human DNA sequences. In this case the analysis was directed to DNA mutations that led to the RS
disappearance. In other words, the RS was present in the wild allele, and it was assumed that it was absent in the mutated allele.
An opposite situation is absence of the RS in the wild type and appearance of the RS in the mutated allele. For ScrFI, there are four potential variants for the RS, i.e. NCNGG, C_NGG (where _ is not C), and CCN_G, CCNG_ (where _ is not G). In the majority of the cases N
does not mutate at all but in some rare occasions it might change into some other nucleotide. If _ mutates, the average probability that it mutates into the required nucleotide (C in the first two cases and G in the last two cases) and creates a full RS is 1/3. According to calculations, the DNA coverage due to PRS for ScrFI was 46,642.3 nucleotides, and the total number of nucleotides in RSs plus PRSs was 124,074.3. In addition, a degree of overlap between the ScrFI sites should be evaluated. In the case of ScrFI, a sequence consisting of hexanucleotide CCCGGG formally has two restriction sites for this enzyme, but these two sites are overlapping (CCCGG and CCGGG).
Mutated second C and second G will change both RSs, although only one restriction event is required to detect the mutation. According to calculations, 2.6% of all 124,074.3 nucleotides in the ScrFI sites were overlapping, and the rest 97.4% represent the actual number of DNA
coverage. Total DNA coverage due to ScrFI sites in the tested 2.845Mb was 4.24%.
The overlap of RS was extended to all enzymes in the calculations. Starting from the second RE, in addition to the above discussed self-overlap, the degree of overlap with other REs was evaluated for all candidate REs in their RSs and PRSs. The top enzyme ScrFI has no competitors in the sense of DNA coverage except itself, while HaeIII uses only 72.4% of its potential informativeness and the remaining 27.6% have been covered by the more informative enzymes. For non-palindromic RS
recognizing REs, e.g. MboII, BsmAI, both variants of the 5'-3' direction DNA recognition site were calculated separately and added up. According to the data, the enzymes including ScrFI, Tsp509, DdeI, AciI, NlaIII, MseI, AluI, HaeIII, MboII, HinfI,,BslI, DpnII, BfaI, BsmAI, HphI, Csp6I, FokI, NlaIV, MwoI, BsrI, BbvI, Bspl286, BsaJI, BsmFI, TaqI, Mspi, HhaI, MslI, BsrDI, Sau96I, should be able to detect more than 50% of the nucleotide variation in a given DNA sequence.
Two other aspects were evaluated in the analysis. First, the smallest detectable fragment in the PCR-RFLP technique is significantly smaller in comparison to the smallest detectable fragment in the Southern blot-hybridization. A 3-4% agarose gel allows a clear separation of alleles with a difference of 30-50 bp when the wild type varies from 150 to 600 bp. The average length of DNA fragment of the most frequent cutter ScrFI
was about 140 bp. Only a minority of restriction fragments (including the polymorphic ones) are shorter than 30 bp, and the chances to identify two different ScrFI alleles are quite high because the size of an average fragment exceeds the minimal detectable difference almost five times. The second aspect was the price of each enzyme. The simulation analysis showed that only a small part of RFLP detection information is lost when the candidate enzymes were limited to no more than 50 US cents per unit.

213670~

Selection of Restriction Enzymes with Evaluation for Different Degree of Mutability In addition to the DNA coverage by real and potential restriction sites plus the overlap between the sites for different enzymes, the second simulation study included a nucleotide mutability parameter. It was shown that A, C, T, G nucleotides have a different mutation rate, and it depends significantly on the surrounding nucleotides (Conner, B.J. et al; 1983, PNAS USA 80:278-282). Based on the accumulated information on human DNApolymorphisms, coefficie nts were provided for the relative dinucleotide mutabilities for both 5' and 3' flanking nucleotide (Cooper D.N. et al., 1993 Human Gene MUtation.
BIOS Scientific Publishers, pp. 109-161). In our calculations the coefficients were used in order to evaluate the probability for each specific restriction site to convert into a non-restriction site and vice versa. Some mutability coefficient transformation from dinucleotides into trinucleotides was required in order to avoid the ambiguity due to the 5' or 3' flanking nucleotide. For example, in the case of 5'- TCG -3', the mutabilities of C in TC are as follows: C->A = 0.34, C->G=0.42 and C->T=1.38 (total 2.14), while C in the CG
combination has a significantly higher degree of mutability: C->A=0.64, C->G=0.45, and C->T= 13.27 (total 14.36). In addition, the mutability in the G in the complementary 5'- CGA -3' strand should be evaluated. In order to include the individual mutability data, the total mutability coefficients were calculated for central nucleotides for all 64 trinucleotide permutations. In the next step, the mutabilities for all 2,848,305 base pairs were added up, and a similar analysis as in the first simulation study was performed. As opposed to the first run, instead of the physical DNA coverage with restriction sites, a ratio of mutabilities for each individual enzyme's restriction sites versus the mutability of the total 2.848 Nb DNA strand was evaluated. The list of 213fi70a optimal enzymes obtained was similar to those identified based on frequency of restriction sites. Both sets of enzymes are able to detect approximately the same number of polymorphisms (53.7% without assuming mutability and 56.3% with mutabilities).
Although the probability to detect polymorphism for the CG recognizing enzymes is higher, the frequency of these CG sequences was significantly lower in the genome in comparison to other dinucleotides. Other studies have shown that in the given 2.848 Mb DNA sequence the observed frequency of CG dinucleotide is only 1/3 of the expected.
It looks like there is an equilibrium between the di- or tri- nucleotide mutability and their frequency in DNA.
Example 5 Testing of the known ETS-2 MspI PCR-RFLP
Genomic DNA at a concentration of 50ng/~1 from 10 individuals was pooled together and the pooled DNA
template was used in PCR. Primers for the ETS-2 MspI RFLP
(Avramopoulos, D. et al. 1993, Genomics 15, 98-102) were GCACAGCTAATTCTACTCAC and TGTTAAGGGATTCTGAGAAC. PCR
consisted of 200ng of the pooled genomic DNA, lxPCR buffer tPerkin Elmer) with 2.0~M MgCl2, 200~M of each dNTP, 10pmoles of each primer and 1.0U of Taq polymerase (Perkin Elmer). The DNA template was denatured at 94C for 6 min, followed by 24 cycles of 95C for 30 sec, 57C for 30 sec, and 72C for 30 sec. Approximately 2~g of DNA was generated, and aliquots of 0.2~g which corresponded to 10~1 of PCR volume were digested with a series of restriction enzymes ((1) HphI, 2) BfaI, 3) MscI, 4) AluI, 5) MspI, 6) BslI, 7) HinfI, 8) ScrFI, 9) MseI, 10) HaeIII.
Digestion was performed in a total volume of 50~1, containing 12.5~1 of the PCR reaction, 5~1 of 10x reaction buffer for each enzyme, and 5-10U of restriction enzyme.
The digestion products were loaded on a 3% agarose gel and electrophoresed for 2h at 100V. In one of the lanes (MspI) two bands can be seen: a band corresponding to the intact PCR product size, and a smaller band which represents a 213~70~

putative alternative allele. Analysis of individual DNA
samples with the informative enzyme MspI was performed in the same way except individual DNA templates were used instead of pooled DNA.
Example 5 Detection of the HinfI PCR-RFLP in SNAP 25 The same pooled DNA as described above in Example 4 was used for the analysis of DNA polymorphism within the 700 bp SNAP 25 gene fragment. Primers for SNAP
25 were CAACTCGATCGTGTCGAAGA and AAGCATGAAGGAGCTATCTTGC.
PCR was performed according to the protocol: lOOng of the DNA template, lx Perkin Elmer PCR buffer, 1.5mM MgCl2, 200 ~M dNTPs, lOpmoles of each primer, and 1.5U Taq polymerase in a total volume of 12.5~1. Initial denaturing was at 95 for 5min, followed by 30 cycles at 95 for 45 sec, 60 45 sec, and 72 for 45 sec. Digestion of PCR products was performed as described above for the ETS-2 MspI PCR-RFLP
(restriction enzymes used were 1) ScrFI, 2) NlaIII, 3) DdeI, 4) HaeIII, 5) AluI, 6) MboII, 7) NlaIV, 8) HphI, 9) MseI, 10) FokI, 11) BfaI, 12) HinfI, 13) MscI, 14) HhaI, 15) BglI). The putatively informative enzyme HinfI was applied for digestion of individual PCR products.
Having illustrated and described the principles of the invention in a preferred embodiment, it should be appreciated to those skilled in the art that the invention can be modified in arrangement and detail without departure from such principles. Ne claim all modifications coming within the scope of the following claims.

21367Q~

TABI~S 1 Alphabetic List of Fermentas MBI Restriction Endonucleases and corresponding commercially available Analogues F~n~ntJ~BI Proto~yp Spec~cl~t C ~ v-ll-bb' ,~' -Eruyn- (s~ ~3~) Acc651 GlGTACC (Kpnl), Asp7181 (Kpnl) - GGTAClC
Alul Ahl AGJ~cT +
A/w211 Hg/AI G(T/A)GCIT/A)lC HgiAI, AspHI
A/w261 BsmAI Gl~;IC(N l/sl BsmAI
A/~41 ApaLI GlTGCAC ApaLI, Snol, Vnel BamHI BamHI GlGATCC Bstl Bc/l Bcll TlGATcA Fbal Bcnl Caull CC-(C/G)GG Ncll ~dl Byll BG~ S3Ç
Bo/ll B9111 AlGATcT
Bpu1-021 Espl GClTNAGC Espl, Ce/ll BseNI Bsrl AcTGG(N)1p1l Bsrl Bsh123ffl fnvDII CGlCG FnuDII, Accll, Bs?UI, Mvnl, Thal Bsh12851 Mcn CGPuPylCG Mcrl Bsp681 Nrul TCGlCGA Nnul, Spol Bsp1191 Asull TTlcG M Asull, Bpu141, BstBI, Csp451, Lspl, NspV, Stul Bsp1201 GlGGccc (Apsl) (Apd) GGGcclc Bsp1431 Sau3AI _GATC Sau3AI, Mbol, 8spAI, Dpnll, Kzo91, Ndell Ssp14311 //sell purcGclpy /taell Bst11071 Snal GTAlTAC +
Bsu151 Clal ATlcGAT C/al, Banlll, Bscl, Bsp1061, BspDI
Bs~ll //aelll GGlcc Haelll, BssCI, Pall Cfr91 Xmal CICCGGG Xmal, (Smal) Ctr10l Cfr10l PulCCGGPy Bsfil Ctt131 Asul GlGNCC Asul, NsplV, Sau961 Ctr421 Sacll CCGClGG Sacll, Kpn3781, Kspl, Mral, Str3031, Sstll Cpol Ftsrll CGlG(A/r)CCG Rsrll, Cspl Csp61 GlTAC (Flsal), (AÇal) (Psal) GTlAC
Dral Ahalll mlMA
Eam11041 Ksp6321 ~ N)ll4l Ksp6321, Earl EamllO51 EamllO51 C~ Nl~ lc Ec/13611 GAGlCTC (Sacl), (Sstl) (Sacl) GAGCTlC
Eco241 HolJII GPuGCPylC Banll Eco311 Eco3 11 GGlCI~;11)1l5l Bsal Eco321 EcoRV GATlATC EcoRV
Er,~471 Avdl GlG(A/rCC Avall, Bmel81, NspHII, Slnl Er,d7111 Ecd7111 ~GClGcT
EooS21 Xmalll clGGccG Xmalll, Eaol, EdXI
Eco571 Eco571 CTGAAG(N)16/14l -Eco641 ~tglCI lilGPyPuCC Banl Ero721 PmaCI CAclGTG PmaCI, BbrPI, Pm/l Eco811 Saul CClTNAGG Saul, Aocl, Axyl, Bse211, Bsu361, Cvnl, Mstll Eco881 Aval ClPyCGPuG Aval, Nsplll Er~11 BstEII GlGTNACC BstEII, BstPI, EcoO651 Eco1051 SnaBI TAClGTA SnaBI
Ecol301 Styl ClC(AtT)(A/T)GG Styl,BsJT1l, EcoT141 2136~5 TABLIS 1 -- CONT'D
F. MBI Protottfpe Speclflcltf C _ 1~ av ll-bte Enzyme (5 ~ 3 ) Eco1471 S~ul AGGlccT Stul, Aa~l, Pme551 EcoO1091 Drall PuGlGNCCPy Drall, (Pssl) EcoRI EcoRI GJ,AATTC +
Ehel GGClGCC (Narl), (Bbel), (Kasl), (Nunll) (Narl) GGlCGCC
Esp31 Esp31 CG I C I ~,(N)1 /sl +
Gsul Gsul CTGGAG(N)16/14~ Bpml Hin11 Acyl GPulCGPyC Acyl, Ahall, Bbill, BsaHI, Hin61 GlCGC (Hhal), (Cfol), HinPll (Hhal) GCGIC
Hincll Hirrotll GTPylPuAC Hinotll Hirrdlll Hinotlll AlAGCTT +
Hir1fl Hinll GlANTC +
Hpal Hpal GTTlAAC +
Hpall /tpall ClCGG Hapll, Mspl Kpnl Kpnl GGTAClC (Asp7181), (Acc651) Kpn21 BspMII TlCCGGA Acclll, BspEI, Mrol Mbol Mbol ~GATC BspAI, Bsp1431, Dpnll, Kzo91, Ndell, Sau3AI
Mboll Mboll GMGA(N)U71 +
Mlu I Mlu I A~CGCGT +
Mph11031 Avalll ATGCAlT Avalll, EcoT221, Nsil, (Ppu101) Mspl Mspl ClcGG Hpall, Hapll Munl Mfel ClAATTG Mfel Mval BstNI CCl(A/T)GG BstNI, (EcoRII), Apyl, TspAI
Ncol Ncol clcATGG +
Ndel Ndel CAlTATG +
Notl Notl GClGGCCGC +
Pael Sphl GCATGIC Sphl, B~ul Pfl2311 Spll ClGTACG Spll, BsiWI
Ppu101 AlTGCAT (Avalll), (EcoT221), (Nsil), (Mph11031) (A val 11 ) ATGCAlT
Psp511 PpuMI PuGlG(A/T)CCPy PpuMtl Pstl Pstl CTGCAlG +
Pvul Pvul CGAT`ICG BspCI, Xor,tl Pvull Pvull CAGlCTG +
Sall Sa/l GlTCGAC +
Scal Scal AGTlACT - +
Sdul Sdul G(G/AtT)GC(C/AlT)lC Bmyl, Bsp12861, Nspll Smal Smal CCClGGG (Cfr91), (Xmal) Sspl Sspl AATlATT +
Taql Taql TJ~cGA TthHB81 Van911 PflMI ccAliNNlllNTGG PflMI
Vspl Vspl ATlTAAT Asel, Asnl Xbal Xbal TlCTAGA +
Xhol Xhol ClTCGAG BstVI, Ccnt. PaeR71, Sbl C . ly available restriction c. ,.,tv" ~ t~ are cited from: Roberts, R.J. and Macelis, D., Nucleic Aads Res., 19, ru~ t. 2077-2109,1991.
The enzyme in ~ Itl,- - has dihterent cleavage soeci~icity than Fem~ntaJ MBI one.
+- - only prototype is . 1~ available.
Pu=GorA;
Py=CorT;
N=G, A,TorC.

Claims (18)

1. A method for screening for polymorphisms in one or more selected nucleotide sequences of nucleic acids pooled from at least two different individual nucleic acid sources comprising:
(a) amplifying one or more selected nucleotide sequences on nucleic acids pooled from at least two different individual nucleic acid sources under suitable conditions to produce amplified nucleotide sequences;
(b) reacting the amplified nucleotide sequences with a series of different restriction endonuclease enzymes to produce reaction products, the restriction endonuclease enzymes being selected so that they cut at different restriction endonuclease enzyme sites;
(c) separating and visualizing the reaction products;
(d) comparing the reaction products obtained for each restriction endonuclease enzyme and identifying restriction endonuclease enzymes which cleave the amplified nucleotide sequences thereby detecting polymorphisms in the selected nucleotide sequences, in the absence of a specific probe for the polymorphisms.

2. The method as claimed in claim 1 which further comprises (e) amplifying the selected nucleotide sequence on a nucleic acid from one of the individual sources from step (a) under suitable conditions to produce amplified nucleotide sequences;
(f) digesting the amplified nucleotide sequences with a restriction endonuclease enzyme identified in (d) to produce restriction fragments;
(g) separating and visualizing the restriction fragments; and (h) detecting cleaved amplified nucleotide sequences for the restriction endonuclease enzyme thereby confirming the presence of a polymorphism.

3. The method as claimed in claim 2 additionally comprising detecting the presence or absence of the polymorphism in an individual by reacting a nucleotide sequence comprising the polymorphism with nucleic acid from the individual.

4. A method as claimed in claim 1, wherein in step (a) nucleic acids from at least ten different individual nucleic acid sources is pooled.

5. A method as claimed in claim 1, wherein in step (a) the selected nucleotide sequence is amplified using at least two oligonucleotide primers which are capable of producing at least one amplification product which is complementary to the selected nucleotide sequence in the presence of nucleoside triphosphate substrates and a nucleic acid polymerase.

6. A method as claimed in claim 4, wherein the oligonucleotide primers or nucleoside triphosphate substrates are labelled with a detectable marker.

7. A method as claimed in claim 3, wherein the nucleic acid is a deoxyribonucleic acid, the nucleoside triphosphate substrates are deoxyribonucleoside triphosphate substrates and the nucleic acid polymerase is a DNA polymerase.

8. A method as claimed in claim 1, wherein in step (b) the amplified nucleotide sequences are digested with 50 to 150 restriction endonuclease enzymes.

9. A method as claimed in claim 1, wherein in step (c) the restriction endonuclease enzyme products are separated on the basis of size.

10. A method as claimed in claim 5, wherein in step (c) the restriction endonuclease enzyme products are separated by electrophoresis through a polyacrylamide gel matrix or agarose gel matrix.

11. A method as claimed in claim 1, wherein the nucleic acid source is selected from the group consisting of plants, animals and microbes.

12. A method as claimed in claim 1, wherein the nucleic acid source is human.

13. A method as claimed in claim 3, wherein the nucleic acid source is humans affected with a particular disease.

14. A method as claimed in claim 1, wherein the nucleic acid source is plants having a common characteristic.

15. A reagent kit useful in performing the method of claim 1, which kit includes a series of restriction endonucleases and the necessary reagents for digesting amplified nucleic acids, and/or all the reagents required to amplify the nucleic acids and suitable supports useful in performing the method of the invention.

16. A method for screening for novel polymorphisms in one or more selected nucleotide sequences of nucleic acids from at least two different individual nucleic acid sources comprising:
(a) amplifying one or more selected nucleotide sequences on nucleic acids from at least two different individual nucleic acid sources under suitable conditions to produce amplified nucleotide sequences;

(b) reacting the amplified nucleotide sequences with a series of different restriction endonuclease enzymes to produce reaction products, and wherein the restriction endonuclease enzymes are not known to be associated with a polymorphism on the nucleotide sequences and they are selected so that they cut at different restriction endonuclease enzyme sites;
(c) separating and visualizing the reaction products;
(d) comparing the reaction products obtained for each restriction endonuclease enzyme and identifying restriction endonuclease enzymes which cleave the amplified nucleotide sequences thereby detecting polymorphisms in the selected nucleotide sequences, in the absence of a specific probe for the polymorphisms.

17. A method for screening nucleotide sequences from individuals for the presence of an SmaI polymorphism located in the 5' noncoding region of the DRD4 gene comprising:
(a) amplifying the 5' region of the DRD4 gene including the first exon of the nucleotide sequences under suitable conditions to produce amplified nucleotide sequences;
(b) digesting the amplified nucleotide sequences with SmaI to produce restriction fragments;
(c) separating and visualizing the restriction fragments; and (d) detecting cleaved amplified nucleotide sequences thereby confirming the presence of the SmaI
polymorphism.

18. A substantially pure single stranded DNA probe that is complementary to a SmaI polymorphism which is a 0.7 fragment of the 5'noncoding region of the DRD4 gene.