CA2130997A1 - Early antigen for autoimmune diabetes - Google Patents

Abstract

Antigens associated with the .beta. islet cells that activate T-cell populations in inducing type I diabetes are disclosed. These antigens are useful in diagnosis and therapy of type I diabetes.

Description

~093/1672~ ~ L3~g9~ PCT/US93/01716 EAR~Y ANTIGEN FOR AUTOIMMUNE DI~BETES

This work was supported in part by a grant from the National Institutes of Health. The U.S. Government has certain right~ in this invention.
~echnical Pield -The invention relate~ to factor~ useful in diagnosis and therapy of type I diabetes. More specifically, it concerns markers in ~ islet cells that mediate T-cell proliferation and stimNlation associated with induction of the disease.
, Back~round Art Type I diabetes is known to be a chronic auto-immune disea~e that manifest~ itself early in life. Thi8 condition, a}so called insulin-dependent diabete~
mellitus (IDDM) is considered a hereditary di~ease although nonfamilial forms also occur. The nature of the genetic cont$ol, of type I diabetes ha~ been studied in detail. It appear~ clear that gene~ assoçiated with the ma~or hictocompat~bility complex (MHC) are involved in the hereditary tran~m~sQion of the di~ea~e tWicker~
et al., Exp ~ed (1987) 1~:1639-1654). Sev~ral groups have demonstrated a correlation between the ab~ence of an a~p~rtic reQidue at po~ition 57 of the ~-chain in the human H~A-DQ class II MHC encoded glycoprote~n and the occurrence of the disease (Parham, P. Nature (1990) 345:662-664; Todd, J.A. et al., ~S~ 1987) 32~:599-604; Morel, P.A. e~ al., ~ g,L~, 8~ =L~ 1988) 85:8111-8115).

W093/1672~ PCT/US93/0171~

The most ubiquitou~ly used model for the human fonm of type I diabetes i~ the nonobese diabetic (NOD) mouqe model. The NOD strain of mice was ariginally selected by Makino, S. e~ al., ExD Anim (Tokyo) (1980) ~2:1, for its predi~position to develop a spontaneous fonm of diabetes. The disease as it manifests itself in - this model i9 similàr to that found in humans. There is a progressive infiltration of the pancreatic ielets by mononuclear cells, mostly of T-cell origin, long prior ~o the onset of the ~ymptoms of the disease which leads to the destruction of the insulin-producing ~-cells. This occurs in the similar ~B rat model system (see below) as long as 8 weeks before the onset of IDDM. It ha~ been demonstrated that the NOD disease is controlled by at least three genes, one of which segregatee with the MHC
(Hattori, M. et al., ~SiS~9~ (1986) 21~:733; Prochaska, M. et al., Science (19871 ~d:286; Wicker, ~. et al., ~D Med (1987) 65:1639 ~supra)).
In the course of the disease, the insulin-producing ~-cells of the pancreatic islets are selectively destroyed; other endocrine islet cells, a cells, such as those that produce glucagon or somatostatin are unaffected. The destruction of the ~-cells is mediated in part by T-cell proliferation, in an induction phase, resulting in the production of effectors of the ~-cell destruction, such as cytotoxic antibodies, natural killer cells, macrophage and lymphokines (Castano, ~. et al., Ann Rev Immunol (1990~ ~:617-679).
Thus, in general, the onset of type I diabetes is believed to involve an induction phase common to~both normal and autoimmune respon~es, which involves an initial acti~atlon of helper CD4+ T-cell~ by engagement of the T-cell antigen receptor (TCR) wlth MHC class II
associated peptides presented on antigen-presenting cells (APC). This acti~ation results in secretion of , ~

-~!0 93/1672~; PCI'/US93/01716 r~ 1 3 0 ~3 9 7 lymphokines which in turn activate the effector ~-cells, cytotoxic T-cells, natural killer cell~, macrophage, and the l~ke. Indeed, it has been shown that removal of the CD4+ T lymphocytes from the circulation u~ g an anti-CD4 antibody (GKl.5) blocks the development of type I
diabetes in the murine model system (Shizuru, J.S. et al., Science (1988) ~Q:659-662).
The involvement of T-cells in the progress of type I diabetes has also been verified by showing that autoimmune diabetes can be transferred to nonsusceptible strains using splenocytes from NOD mice (Wicker, ~.S. et al., Diabetes (1986) ~:855-860); and the showing that autoreactive T lymphocytes can cause diabetes in NOD mice (Reich, E.-P. et al., Diabetes (1989) 38:1647-1651).
- 15 Pancreatic islet-specific T-cell clones have also been prepared from NOD mice by HaskinR, K. et al., Proc Natl Sc1 USA (1989) 86:8000-8004 and Nakano, N., et al., J Exp Med (1991) 173:1091-1097.
Using the NOD mouse model, ~ehuen, A. et al., Imm~Ql (1990) ~4:2147-2151, demon~trated tha~ the humoral anomalies in the NOD strain are disco~nected from the occurrence of diabete~ and insulitis. Nevertheless, attempts have been made to ident~fy the antigen associated with type I diabetes by identifying proteins 2S that bind to autoantibodiet pre~ent in IDDM-affected sub~ects. All of these antigens are thus present at the effector level, and may or may not be assQciated with the progresq of the condition.
~aekkeskov, S. et al., ~cience (1984) 224:1348-~350, showed that antibodies to a 64 kd i~let cell protein were present in B~ xats (which spontaneously develop a type I diabetes analogous to that in h~lmPn~) for as long a~ eight weeks before the on~et of IDDM, and suggested that the antibodies could be used to predict an immune reaction against pancreatic ~^cells. The putative Wo93/1672~ ~ ~3 0 3 ~ 4- PCT/US93/0171~

autoantigen waq subsequently characterized by this group to be a glutamic acid decarboxylase (GAD) which i~
involved in the synthesis of ~-aminobutyric acid (GABA), an inhibitory neural transmitter (Baekkeskov, S. et al., Nature (1990) ~47:151-156). In addition, a molecule cress-reactive with the 6S kd heat shock protein (hsp65) f My~Q~acterium tuberculosis was shown to be a ~-cell antigen immunoreactive with diabetes-associated autoantibodies in the NOD mouse model by Elias, D. et al., Proc Natl Acad Sci USA ~1990) ~7:1576-1579. These authors suggested that the hsp65 antigen could be used to induce diabetes or to vaccinate against diabetes, using the principle that proteins administered in adjuvants tend to be immunogenic, while the same proteins in - 15 soluble fonm are tolerogenic. Indeed, a ~inistration of hsp65 in immunogenic or noni7mmunogenic fonms was reported to produce re~ults consistent with this principle.
Castano, ~. et al. in an unpublished 7manuscript, described the use of antibodies fram a prediabetic patient as probes to screen a rat islet ~gtll expression library and identified a colony which produced a protein immunoreactive with these antibodies. This colony was found to contain an insert which encodes a 136 amino acid fragment of carboxypeptidase-H (enkephalih converta~e). Eurther, the sera u~ed to ~creen the library were shown to react with a 52 kd antigen correspond~ng to the molecular weight of the me7mbrane fonm of carboxypepti~a~e-H.
In addition to the 64 kd GABA carboxylase, the hsp65 antigen, and the 52 kd carboxypeptidase-H, which react with autoantigens a~sociated with type I diabetes, it is also known that autoantibodie3 to insulin are present in subjects affected by this condition.
Hu7man T-cell clones which are spec~fic for insullnoma cell antlgens have been prepared by Von Yllet ' ~093/l672~ 5 ~1309a'! pcT/us93/nl7l6 et al., Eur J ImmNnol (1989) 19:213-216. These T-cell clones were prepared using rat insulinoma membrane~ a~
antigen, and generating the cell lines from peripheral blood mononuclear cells of patients with recent on~et of S the disease. In addition, it has been shown that T-cell clones from a type.I diabetes patient respond to an integral membrane component of the insulin secretory granules which has been purified 5000-fold and shown to have a noner of molecular weight 38 kd (Roep, BØ et al., ~ture (1990) 345:632-634).
All of the foregoing antigens are believed to be associated with the effector phase of type I diabetes.
None of the foregoing has been demonstrated to be as~ociated with the initial activation of CD4+ T helper lS cell induction phase. The~e antigens are found after the onset of symptQms of IDDM.
Thus, in all of these extensive ~tudie~, only antigens which are evidenced by factors present after the onset of the disease or very shortly preceding it have been identified. The present invention provide~ antigens which are responsible for the very early inductive stages .:. in .the development of this condition. These antigen~ are useful in diagnosis and design of immunotherapy.

Disclo~ure of the Invention Antigens associated with the initial T-cell induction pha~e leading to the onset of type I diabetes have now been identified. These antigens are u~eful for the early diagnosis of the development of the di~ease and also can be used in immunotherapy of su~ceptible s~bjects.
In one aspect, the invention i~ directed to an antigen having a molecular weight in the range of 30-60kd nonmally present in mammalian, particularly human or murine, pancreatic islet ~-cell cytosol and/or membranes, ~ .
, . . . ~

W093/1672~ PCT/US93/0171~
9 ~ - 6-and to antibodies or T-cells specifically immunoreactive with this antigen. Human protein~ with this activity have molecular weights of about 37 kd, 41 kd and 51 kd, as detenmined by HEPC; murine proteins have molecular weights of about 36 kd, 42 kd and 55 kd as determined by gel electrophoresis. In other aspects, the invention is directed to methods to diagnose susceptibility to type I
diabetes by asse~sing subjects for the presence or absence of antibodies or T-cell~ responsive to thi~
antigen. In other aspects, the invention is directed to methods to prevent the onset of type I diabetes by rendering subjects unresponsive to the antigen of the invention and by blocking immNne re~ponse to the antigen using peptide subunits thereof alone or in combination with immune modulating agents.

~rief De~cription of the Drawin~s Figure l i8 a bar graph showing the results of a T-cell proliferation a~say with respect to various insulinQma extracts.
Figure 2 is a bar graph which shows the effect of the presence and absence of antigen-presenting cells on T-cell proliferation.
Figure 3 shows a nitrocellulose blot of one-dimensional gel electrophoresis of in~ulinoma membrane protein~ assayed for the ability of these fractions to ~timulate the proliferation of T-cells from NOD mice.
Figure 4 show~ an elution pattern of high performance electrophoxetic chromatography (HP8C) performed on a murine in~ulino~a extract as~ayed with respect to T-cells isolated from NOD mice of ~ariou~
ages.

-J~`/O 93/1672~ 7 ~ ~ 3 o ~ ~ 7 PCT/US93/01716 Figure 5 shows the HPEC eluti~n pattern of murine insulinoma whole cell extract3 a~ assayed using NOD-mice T-cells.
Figure 6 shows the distribution of T- cell proliferation stimulation activity between membrane and cytosol fraction~ of a murine in~ulinoma.
Figure 7 show~ the results of two-dimen~ional gel electrophoresis of a murine insulinoma extract as a~Qayed for the ability to stimulate proliferation of T-cells obtained from 30 day old NOD mice.
~ igure 8 shows the HPEC elution pattern of the whole cell extracts of human islets as assayed by the response of NOD splenocytes.
Figures 9A and 9B show the analyeis of antigen-- 15 containing extracts separated by molecular weight distribut~on using the T-cell clone~ LN-7 and LN~aM
respectively.
Figures lOA and lOB show stained pancreata from a control mouse and from a mouse administered the T-cell - 20 clone ~N-7.

~ode3 of ~arryinq Out the Invention The invention provides antigen~ as~ociated with early event~ connected with the i~ductive pha~e of type I
diabete~. ~8 ~uch, the antigen~ of the i~ve~tion offer the opportunity for early ~creening of i~dividuals developi~g the di~ease and offer the o~portu~ity for i~tervention to prevent it9 developme~t and/or perpetuation.
The antige~s of the invention are obtainable from mammalian, such as the exemplified mNrine or huma~, pancreatic islet ~-cells or cell lines derived therefrom.
Cross species reactivity of the relevant antigens has been demonstrated, and there appear~ to be significant homology between the mNrine and human antigens. Thus 2~ 30 39 - 8- PCr/US93/0171~i similar a~tigen~ are belie~ed present and isolatable from ~ lets of other mammal9, such as bovine, porcine, ovine, feline and the like.
The antigens may be obtained from eit~er the S membrane fraction or the eytosol fraction of i~let ~-cells or their derived eell line~, or the related neuroblastoma or other neuroendoer~ne eells. The antigens are present in both non-suseeptible individuals and in individual~ suseeptible to type I diabetes.
merefore, the eells used as a souree of the antigen~
need not be derived from affeeted subjeets.
The antigens m2y initially be prepared by extraetion and f~aetionation of the native material from the ~-eells or their derived eell lines, but may more eonveniently be prepared using reeombinant teehniques from the eneoding DN~. Provision of the native protein in purified and isolated fonm permits the decign of probes useful for retrieval of the eDNA encoding the~e antigens. In addition, expreYsion libraries obtained i~, for example, ~gtll and transformed into E~ SQLi ean be ~ereened for the ability of the expression produets to effeet proliferation of T-eells obtained from murine model~ for type ~ diabete~, ~uch as NOD mice. Antibodie~
immNnoreaetive with the antige~s may al80 be u~ed to ~ereen expre~io~ librar~es.
~

The an~igens of the invention may be prepared by ~uitable extraction of pancreatic ~ i~let eells from mammalian sub~ects, e~pecially human or mNrine ~ubjects, or from cell l~nes derived therefrom. The antigen~ are present in the cytosol and/or membrane fractions of ~-cell~ of both type I diabetes-susceptible sub~ects a~d sub~ects not ~usceptible to IDDM. In addition, tumor cell lines derived from ~-cells such as insulinomas may ~-~0g3/1672~ PCT/~S93/01716 h~ 1 3 U ~
be used a~ starting materials. It ha~ also been shown hereinbelow that at least one of the antigens is present in a human neuroblastoma cell line and human islets.
Extraction i9 generally conducted by homogenizing the cells in the presence of appropriate membrane buffer at about pH 7-8; removing the cellular materials by centrifugation, recovering the supernatant, and then centrifuging the supernatant at high speed to obtain the membranes, as the pellet and the cytosol as the supernatant. Whole cell extracts may also be used.
general procedure for preparation o~ membranes is described by Fava and Cohen, J ~iol_Chem tl984)~2:2636-2645.
The extract i~ preferably then subjected to separation using generally known technique~, including gel filtration, anion exchange chromatography, polyacryla~ide gel ele~trophoresis, and other standard procedures. Active fractions are recovered.
The fractions may be assayed for activity by assessing their ability to effect the proliferation of T-cells obtai~ed from type I diabetes-susceptible sub~ects, including the NOD mouse or T-cell lines derived therefrom, using a standard T-cell proliferation assay.
One such assay utilizes labeled thymidine incorporation 2S as a measure of proliferation and i8 generally conducted as fol~ow~:
The T-cell preparation is obtained from single-cell suspensions from ~pleen, lymph node~ or PB~ taken from naive (untreated) NOD mice. Dead cells and red blood cells are removed by Ficoll gradient centrifugation by spinning in the gradient for 25 minute~ at 2SOO rpm at room temperature. m is provides an enriched lymphocyte population and contai~s antigen presenting cell~ tAPC).
e T-cells and APC are plated at 0.25-0.5 x 106/well in 96-well U-shaped plates (Costar) and incubated with the , ~ .

~ ~3 0 ~ o PCT/~S93/017l~

sample to be tested at varying concentrations for 72 hours at 37C, 5% CO2. The plates are then pul~ed with 1 ~Ci of tritiated thymidine per well and incubated or an additional 16 hours. The cell~ are then harvested u~ing S a microcell harvester (Skatron) and counted. Enhanced uptake of the labeled thymidine indicates increased cell proliferation. In lieu of the foregoing, cloned T-cell lines can be used in the assay, along with separately added APC.
The recovered fractions may then further be purified using standard protein purification techniques.
A particularly useful technique which results in ~irtually pure protein is two-dimensional gel electrophoresis. The fractions or extracts are adjusted to 1~ Triton X-100, 15% glycerol and 6~ ampholines, pH

3-10. I~oelectric focu~ing i8 then performed according to the method of O'Farrell, ~.H. J B~ol Chem ~1975) ~Q:4007-4021. The resulting one-dimensional separation i8 then followed by loading each region onto a 10~
SDS-PAGB gel and electrophoresis conducted according to ~aemmli, U.R. Nature ~1970) ~2~:680-6~5.
~ he fractions identified are then recovered in purified and isolated form. They can be further characterized by determination of amino acid seguencé and by retrieval of the encoding gene from cDNA libraries prepared by re~er~e transcription of ~-~slet mRNA or from a genetic library. The DNA librarie~ are prepared u ing standard technique~, and can be screened u~ing probes designed on the basi~ of to~al or partial amino acid sequence of the recovered antigen. The recovered DNA
can, in turn, be used as a probe to reco~er DNA encoding the corresponding antigens in other species.
In addition to recovering the. gene(~) encoding the antigen(~) using DNA probes, the ~tarting cDNA
library may be prepared as an expression library in, for 093/l672~ PCT/US93/01716 3 0 ~ ~1 '.t example, ~gtll, and the library then ~creened using techniques which detect the ~ynthesized antigen. Two means for screening the library to detect the antigen produced are particularly preferred.
In one method, antibodies prepared against the isolated antigen can be used ~n screening the library in conventional techniques. In a second method, the library may be screened by as~e~sing the ability of each of the clones contained therein to produce an antigen which stimulates proliferation of T-cells obtained from type ; diabetes-susceptible individuals, including NOD mice.
Tho~e colonies that produce proteins capable of stimulating this proliferation contain the gene encoding the stimulatory antigen.
- 15 Upon identification of one or more clones containing a DNA encoding the antigen, a8 described above, DNA can be isolated fram the clones and the relevant inserts sequenced and/or rec~vered a~d used in the subsequent production of the antigen. The seguenced DNA and/or its de~enerate coding forms can be partially or completely independently synthesized for use in such expression systems.
For recombinant production of the antigens, the encoding DNA is ligated into expression systems campatible with a convenient ho~t. A wide variety of host sy~tem~ a~d control ~eguences operable in said ho~t are now available in the art. Suitable host~ include prokaryotes such as E~ cnl; and eu~aryotes such as yeast, a~ian cells, in~ect cell~, mammalian cells, and plant cells; more recently, whole plant or animal organism~
have also been used. Technigue~ for constructing expression syst~ and transfonming appropriate hosts with the constructed systems are by now standard in the art.

~, , WOg3/16725 l~g~ 12- PCT/US93/0171 For production of the desired antigen, the recombinant host cell~ transformed with an expression system containing the gene encoding the antigen operably linked to control sequences are cultured under conditions which permit the expre~sion of the encoding DNA, and the antigen i9 recovered from the culture using standard procedures. Construction syst~mq may be employed which result in secretion of the antigen, which can then be recovered from the medium, or the antigen may be produced intracellularly, which will necessitate lysing the host cells.
The ~-islet cell antigens of the invention, when isolated and characterized, provide sequence information for identification of peptides associated with interaction with the TCR on the helper T-cell~.
The~e pep~ide segments are contiguous sequences of at least about 7 amino acids that are associated with the MHC class II glycoprotein present on the surface of antigen-presenting cells, resulting in a complex that interact~ with the TCR. The relevant peptides can be systematically identified by testing overlapping regions of the sequenced antigen in the presence of antigen-presenting cells in T-cell proliferation assaye conducted as described above. Technigue~ for such a screen aré
included in the report by ~ickli~g, J.~. et al., Eur J
Immunol ~submitted 1991, in press). Pept~de~ with modified structures can then be designed which retain their ability to complex with the MXC class II
glycoprotein but fail to effect reaction with the TCR by assessing the ability ~f the~e mod~fied peptides to inhibit the T-cell proliferation in the pre~ence of known acti~atorQ in this assay. Peptide modifications include extensions, deletions and substitutions, and combinations thereof. Peptides that inhibit proliferation are successful candidates.

~::

~093/1672~ ~ PCT/US93/01716 -13- ~f1 3 ~ 9~?'i' aa~
Several forms of a convenient assay are de~cribed herein, depending on whether the as~ay i8 directed to a purified antigen, a T-cell clone, or an antigen preparation. In general, all assays may be performed in microtiter wells wherein each well contains l0,000-30,000 T cells, about l05-l06 histocompatible antigen-presenting cells, and the antigen (for crude extracts this amounts to about 0.3-20 ~g/ml). However, for more purified antigen, lesq antigen would be required; for splenocyte preparations used as a ~ource of T cells, the APCs are already contained in the original preparation. Variations of the nature and amounts of cell~, hi~tocompatible APC~, and antigen will be understood as routine matters of optimization and experimental design. If tritium uptake i8 to be used as a measure of proliferation, a conven ent protocol is incubation for 72 hours in a suitable culture med~um ~uch as RPMI-1640 supplemented with 5~ FCS, l0 U/ml l0-~trep, and 200 ~M ~-glutamine, or other appropriate medium for T-cell proliferation as i~ understood in the art. The cell culture is then pul~ed with, for example, 1 ~Ci/well of tritiated thymidi~e and the cells are harve~ted 6-l6 hours later and counted.
O~her method~ of measuring T-cell proliferation and var~atio~s of thè ~oregoing protocol are known in ~he art.

Generation of T-Cell I~L~nes Spleen or lymph node cells from nai~e famale 30-40 day old NOD mice were stimNlated in ~tro with insulinoma (B23720, see below) antigen extracts or irradiated insulinoma cell~. Either whole cell extracts or the extracts from membranes or cytosol were used at a protein concentration of l0~g/ml. Alternatively, .

w093/l672~ ~,39~ - Pcr/usg3/ol7!~ ~

irradiated insulinoma cells (5000 cells/ml~ in RPMI
medium containing 1~ NMS, Pen-Strep, glutamine and l~g/ml Leuko-A ean be u~ed.
The spleen or lymph node cells used a~ a source S of T-eells were incubated at 37C, 5~ C02 for 3-4 days, then washed and requspended in RPMI medium eontaining 10~ -FCS Pen-Strep, glutamine and 15~ rat Con-A supernatant or 20 U/ml rMI~-2 ~Genzyme)(eomplete medium), and ineubated for 5 days. Stimulation of the T-eell line~ was repeated 2-3 time~ in cycles of ~-9 days: (3-4 day~ with the antigen in the above ~eomplete~ medium and 5 days ~n eomplete mediu ~ rI~-2 at 20 U/ml without antigen).
Single eell eloning of the T-eell line was -~
performed in eomplete medium in the presenee of lO ~g/ml antigen (or 5000/ml live irradiated insulinoma eells) with o.sxlo6 ~rradiated spleen eells ~as APC) in 96 well plate (Costar flat bottom 1/2 area). Seven days later the elones were restimulated again with the antigen ~ APC
as above. ~0-14 day8 afterwards, the wells were seored for positi~e growth. Growing T eell e}ones were traDsferred to 24 well Costar plates and expanded.
The eells were te~ted for proliferation using 20,000 T eells with 0.5 x 106 irradiated splenie (2000 R) antigen-presenting eells in an a~say based on labele~
thymidi~e i~orporation. Culture~ of the T-eells and APC
eells were ~et up in triplieate in the presenee of ant~gen extraets ~0.3-20 ~g/ml) and ineubated for 72 hours, then pulsed with l ~Cs/well of tr~tium-labeled thymidine (Amersham, Ine.) and harvested 16 hours later.
The incorporated radioactivity wa3 determined using a ~-plate scintillation counter and re~ult~ expressed as mean cpm of incorporated thymidine. Standard deviation~ were less than lO~. A number of T-cell clone~ were obtained, including LN7 and ~N~aM T-cell clones.

~093/1672~ 4~ 1 3 ~ 9 ~ ~ PCT/US93/01716 T-cell clones were picked from the wells, restimulated as above, and expanded for specificity tests.

S Antibody Production m e antigens including protein antigens of the invention and the relevant peptide fragments can be administered to mammalian subjects in standard immunization protocol~ to prepare antibodies ~pecifically immunoreactive with the antigen or peptide subunit thereof. Techniqu~s for conferring immunogenicity on peptide subunits by conjugation to carrier~ ie well known in the art. The protein or carrier-coupled peptide is injected into a suitable subject, preferably in the - 15 presence of adjuvants, and the progress of immunization c~n be monitored by detection of antibody tite~s in the pl~sma or ~erum. Standard E~ISA or other immunoassays may be used with the immunogen as antigen to assess the level~ of`antibodies.
The antisera are separated from the red blood cells and can then be used as polyclonal preparations or antibody-~ecreting cell~ from the immunized host may be immortalized u3ing ~ta~dard technique~ to obtain cell lines that secrete mo~oclonal antibodie~ immu~ospecif;c for the antigen~ or subun~t thereof. The antibodies per se may also be ~eparated from other plasma protein~. In addition to the polyclonal and monoclonal preparations, immunologically reacti~e and specific fra~meatq ~uch as Fab, Fab~, and the like, are also useful in immunoassay techniques and are included in the antibodiea of the in~ention. These antibodies or fragment~ may be purified using standard techniques.

WO93/1672~ 3~ -16- PCT/US93/0171 ,Proanosis for Onset of Ty~e I Diabetes The antigen~ of the invention can be used in early detPction of 8ubj ects who are developing type I
diabete~. The antigens themselves are present in both normal and susceptible individuals; however, only those individuals developing IDDM produce helper T-cell~ who~e proliferation is stimulated by the presence of these antigens. Thus, in one approach to early prognosis, T-cells obtained from the subject to be tested are used in the standard T-cell proliferation assays de~cribed hereinabove to test for their response to the antigenQ of the invention. Sub~ects whose T-cells proliferate in these aq~ays are developing the disea~e.
It is not at present known whether these - 15 individuals produce antibodies to the early antigen~ of the invention; availability of these antigens will permit the presence or absence of these antibodies to be ascertained. In the event that sub~ect individuals are show~n to produce antibodies prior to the onset of the condition, the use of the antigen to detect the presence , or'absence of these antibodies can also be used as a prognostic tool. Standard immunoassays for the detection of the presence or absence of these antibodie~ are well known, and a variety of protocols involvi~g a variet~ of labels can be used.
.

Thera~
The availability of the antigens of the invention offers the pos~ibility of novel therapeutic methods for blocking,the development and preventing the onset of type I diabetes. Current strategies are extremely aggressive and employ ~mmune system depressants in general. A more benign therapy is offered by the invention antigens which can be admini~tered under non-~ ~ 35 immunogenic conditions that render the subject ; :~:

~vO 93/1672~ 3~ ~ ~ r~l PCl`/US93/01716 unresponsive to the antigens rather than eliciting animmune response thereto. General techniques for administration of tolerizing doses of antigens or relevant peptides thereof are known in the art, ~ncluding introduction in the absence of adjuvant and administration in soluble form. Use of the identified peptides that form complexes with MHC cla~s II
glycoprotein on the ~urface of antigen presenting cells and activate T-cells may also be employed for inducing unresponsiveness, and a~m;nistration of small peptides may be more amenable to this technique.
In addition to the known routes of $njection subcutaneously, intravenously, or intraperitoneally, the antigen or peptides of the invention may be administered - 15 using other modes of formulation suitable for peptide-containing cou.~ositions including transmucosal and transdermal fonms of administration, and when properly formulated, by oraI dosage. Suitable foDmulations that i~clude phanmaceutically acceptable excipients for introducing intact peptide~ or proteins to the bloodstream by other than in~ection routes ~as well as by in~ection) can be found in Reminaton~ Phar~ ceutical 55iSDS~ late8t edition) 8aston, PA. In partl~ular, pumps which provide the act~ve ingredient in ~ may be u~ed.
The antigen~ of the invention may be administered alone or in concert with anti-CD4 antibodies or other CD4 blockers and/or other immune modulati~g substances. This approach to conferring tolerance is disclosed in U.S. Pate~t~ 4,681,760 and 4,904,481. In this approach, the antigen and the anti-CD4 antibodies or immunoreactive fragments are administered concomitantly.
By ~concomitant~ administrat$on is meant ~ithin a time fr~m~ which permitc the anti-CD4 component to block the helper T-cell re-pon~e to the antigen. The nature of , .

W093/1672~ 39~ - PCT/US93/0l7!~

~concomitant~ in this sense is described in the above-referenced U.S. patents, incorporated herein by reference.
Finally, therapeutic methods that utilize modified peptides that behave as antagonists capable of binding the MHC class II glycoprotein but resulting in a complex which is not interactive with the T helper cells can also be used. Modes of administration and formulation for these peptides are similar to those described above.
As the antigen~ of the invention provide a relatively benign mode of intervention to prevent the onset of IDDM, the methods of prognosis also provided may be employed as a screening tool applied universally to '- 15 infants and/or children. T~e assay methods described herein reguire only a small blood sample; this provides a relatively noninvasive screen. Individuals who test positive by virtue of the ability of their T-cells or antibodies to respond to the antigens of the in~ention can then be treated as described above to prevent the progression of the disease.
- ~ The followin~ examples are intended to illustrate but not to limit the invention~
, ~
E~m~
AbilitY of B-cell Extracts to Effec~
Proliferation of NOD T-Cells Test extracts were prepared using the method of ~ava and Cohen, ~ ~iol Chem (1984) ~2:2636-2645.
Briefly, confluent cell layer~ were washed three times with phosphate buffered sali~e in the ab~ence of calcium and magnesium ion. The remaining liquid was asp~rated after the last wash and membrane buffer which consists of 20 mM HEPES, pH 7.5, 1.5 mM M~C12; 1 mM EGTA; 1 mM PMSF
and~l ~g/ml ~eupeptin was added. The cells were scraped .,, ~ .
., , :~

~!093/l672~ -19-.~ 1 3 ~ 3 ~ 7 into the buffer and homogenized ~Dounce) and the homogenate wa~ centr~fuged at 2s00 rpm in a Sorval S31 Centrifuge for 10 minutes at 4C. The pellet was discarded. The supernatant was used a~ a ~whole cell extract~ or centrifuged for 30 minutes at 48,000 xg to separate the membrane from the eytosol. The membrane-eontaining pellet was suspended in 20 mM HEPES and Erozen - at -70C. The cytosol supernatant was also retained for te~ting.
Similar extractions to obtain membrane fraetions and eyto~ols were eondueted with respect to the murine insulinoma eell line B23720 the glucagonoma panereatie ~-eell line and the human neuroblastQma line SY5Y (Goya, ~., et al., Neurochem Re~ (1991) ~:113-116).
The eyto~ol fraetion of the insulinoma cells was further subjeeted to high perfonmanee eleetrophoretie ehromatography (HPEC) using the Applied Biosystems, Inc.
HPEC 230A system. (The extraets are believed to contain proteins derived from membrane as well as cyto801, and eontain 400 ~g total protein as subjeeted to HPEC.) For HPEC the extraets are ad~usted to a final eoneentration of 7.5 mM tris-phosphate pH 7.5, 0.25~ SDS, 15~ glyeerol, and then loaded onto a 10~ SDS-trie phosphate tube gel (3.5 x l0 em) and eleetrophoreRed in a tris-phosphate buffer ~ystem. The protetn~ were eluted from the bottom of the gel into 7.5 mM tri~-HCl, pH 7.5;
as~ayed for protein eoneentratton and analyzed on a 12.5~
SDS polyaerylamide gel. 80% of the protein was recovered in theae fraetions.
These fraeti~n~ that induced the proliferative re~ponse in the a~say de~cribed below were pooled. These fractions eorre~ponded to a molecular weight range of 30-60 kd and are labeled C-pool I in Figure 1. The C-pool I
and the eorre ponding pools obtained from the ~eytosol~
extraets (also eontaining some membrane portion) of the WO93/167~ ~3~ 3 -20- PCT/US93/0171~-a-cells and human neurobla~toma cell~ (labeled a-pool and NB-pool in Figure 1, re~pectively) were compared using the T-cell proliferative assay wherein T-cells were prepared from the spleens of unprimed NOD f emale mice of S 3-30 days of age. The T-cell preparation was obtained a~
described hereinabove wherein single cell suspensions were prepared, in this case from spleen and lymph nodes, and clarified by removing dead cells and red blood cells using Ficoll gradient centrifugation. The resulting preparation contains a full range of T-cell types, a~
well as antigen presenting cells.
As described above, the lymphocyte preparation at each age was plated at 0.25-.5 x lo6 cells per well in 96 well U-shaped plates. The lymphocytes were obtained - 15 from unfractionated (untreated) spleen and contained B-cells and macrophages as a source for APC. The splenocytes for each age group represented a pool of 3-8 mice. The wells were incubated with the protein fractions (l0 ~g/ml). The reaction mixtures were incubated for 72 hours at 37C at 5~ C02 and the plates were then pulsed with 1 ~Ci of tritiated thymidine per well and incubated for an additional 16 hours. The cells were harvested and counted.
The results are shown in Figure l. As ~hown in the figure, RPMI medium alone did not stimulate thymidine uptake in thi~ assay under any condition~, nor did any of the extract pools stimulate the proliferation of T-cells derived in the manner described above from either BAL~/c or C57Bl mice. This shows that response is ~pecific to T-cells from NOD mice. Further, the pool from the alpha cells shows no stimulation. These mice do not develop type I diabetes-like symptoms. The susceptibility to simulation of T-cells from NOD mice was tested at various ages from 8-28 days.

-~093/1672~ PCT/US93/01716 -2~13U~'.~''I

As shown in Figure 1, the C-pool I derived from ~23720 murine insulinoma (~ islet~) was stimulatory to T-cells from very young mice as well as from older mice.
The human neuroblastoma-corresponding pool stimulated proliferation at all age~. However, the a-pool was not capable of stimulating NOD T-cell proliferation, showing a ~-cell-specific antigen. Controls using PHA as an inducer showed the expected levels of stimulation of T-cells from all of NOD, ~ALB/c and C57Bl/6 strains.
The T- cell assay described above was modified by remo~ing antigen-presenting cell3 from the test NOD
T-cell preparation and assessing the effect of the various extracts in the presence and absence of APC as well as in the presence of fixed A*C.
In this T-cell preparation, a single-cell suspension of spleen cell~ from NO~ mice was passed over a nylon wool (Robin ~ab) c~lumn (Juliu~ et al., Eur J
Immunol (1973) ~:645) to enrich for T-cells and deplete B-cellQ, plasma cells and accessory cells. The cells were incubated in the column ~or 45 min at 37C in complete medium (RPMI, lO~ FCS) and then washed slowly with a large volume of medium. An average of 15-25~
yield was obtained, and the resulting cell~ contained no effecti~e ~PC. For samples run in the presence of APC, the APC were pre~ared from irradiated (4000 R) NOD spleen cells; fixed AEC were prepared by ~reating A*C with 0.1%
glutaraldehyde for 60 sec.
As shown in Figure 2, the pre~ence of a~tigen-presenting cells i8 required to elicit a re~po~e either in the pre~ence of ~ i~let cyto801 extract~ or huma~
neurobla~toma cell cytoqols. Extract~ from a-cells failed to elicit signifi~ant respon~e both with and without the presence of APC. Using whole-cell extracts as the ~ource of antigen, either APC or APC that had been fixed only 4 hour~ after incubation with antigen were `1~3~9 ~ ' - 22- PCT/US93/0171~

required for the ~timulation of T-cell proliferation by either the in~ulinoma extract or the human neuroblastoma SY5Y extract.
A~ shown from the foregoing results, human antigen (derived from the neurobla~toma liIle) i~ cro~-species-reactive with the NOD T-cell preparatio~, and the antigen derived from both ~ i~lets and the human cell line requires the presence of antigen-presenting cell~ in order to be effective in stimNlating thymidine upta~e.
ExamDle 2 Purification and Characterization of t~ B Islet 8xtract A. Murine Insulinoma.
'- 15 The membrane proteinq extracted from B23720 insulinoma were subjected to size separation using SDS-PAGE, using 2 mg total load per gel. The elution pattern is shown as a nitrocellulose blot in Figure 3. A~ shown i~ Figure 3, discrete peaks at molecular weights 37.8, 41.9 and 55 were observed; it i~ believed that the ~mall peak at 108.7 is a multiple of the 55 kd peak. The elution pattern shown in Figure 3 is presented in terms of the count~ per minute ob~erved of thymidine uptake by the spleen~derived T-cell~ from 30-40 day old ~OD mice.
The cyto301 ~raction from mouse i~8uli~0ma ~23720 prepared as de~cribed i~ ~xample 1 wa~ ~ub~ected ~o high performance electrophoretic chromatography ~HPBC), conductad as d2scribed in Example 1. These results are shown in Figure 4. Elution patterns assayed with respect to T-cell~ deri~ed from NOD mice of ~arious ages i8 shown. As ~een in Figure 4, the proliferation respon~e _or the ~arious fraction~ increases steadily over a period of 17-5~ day~.
The whole-cell extract of the rat insulinoma was al~o sub~ected to HPEC under the conditions described '~093/1672~ PCT/US93/0171h 23 ,~ 1 30.{3~

above. Figure S shows the elution pattern as determined by the proliferative responqe of the insulinoma-specific T-cell line NOD-F40 prepared from the spleen of a 40 day old female NOD mou~e using the method described S hereinabove. Three peakq of activity are ~hown.
A~ i~ apparent from the foregoing result~, the antigen appear~ to be present in what are purportedly cytosol extracts, whole-cell extracts and membrane extracts of the murine insulinoma. Figure 6 shows a comparison of the relative activities of the antigen in each extract as assessed using NOD-F40 T-cell line proliferation. As shown in Figure 6, the ma~ority of the antigen appears to be present in the membrane.
~he membrane fraction of the insulinoma - 15 prepare~ as described in Example 1 wa3 ~ubjected to two-dimensional electrophoresis. The samples were ad~usted to 1% Triton X-100, 15% glycerol and 6~ ampholines, pH 3-10. Isoelectric focusing in one dimension was performed according to O'Farrell, P.H., J Biol Chem (1975) ~Q:4007-4021, and after thi~ procedure, the gele were removed from their gla~ tubes and loaded onto a 10% SDS
phage electrophoresed a~cording to ~aemmli, U.R., Nature (1970) 227:680-685. The result~ are shown in Figure 7;

B. Human ~31et~ ~
Using the p~ocedures described in Example 1, whole-cell extracts of human i~lets were obtained. HPEC
performed on ~hese extrac~s using the methods described above re~ulted in the elution profile shown in Figure 8, confinming that the corresponding ~uma~ antigen(s) have molecular weight~ in the range of 30-60 kd. The elution profile of Figure 8 was determined using fresh splenocytes from 40 day old female NOD mice.
.

W093/1672~ 3~t~ ~ -24- PCT/US93/0171 As shown in Figure ~, the human i~let extract contains three distinct peaks; one at about 37 kd, one at about 41 kd, and one at about 51 kd.
The distinct nature of the three proteins was studied using a panel of T-cell clones prepared as described hereinabove. First, T-cell lines established from lymph node cells of 30-day-old NOD female mlce, selected on whole cell extracts of the insulinoma, exhibited a T-cell reactivity Rimilar to that of unprimed NOD lymphocytes -- that i8, there were three peaks of response corresponding to the three antigen peaks in the 30-60 kd region. However, following two cycles of antigenic restimulation, T-cell lines cloned by limiting dilution showed differences in the antigen to which they responded. m e T-cell clone ~N~CM responded to the antigen of approximately 51 kd (Figure 9A), and the clone ~N7 responded to the antigen of approximately 37 kd (Figure 9B). m us, the individual peaks of T-cell activity presumably correspond to distinct proteins as opposed to multimers or degradation products.

- ExamDle 3 To distinguish the antigens of the invention from other proteins obtainable from islets, the standard thymidine incorporation as~ay described above was used, - with the te~t an~igens at 10 ~g/ml and cultures of 1-3 x 105 cells per well of ~ingle cell female mNrine NOD
splenocyte suspensions prepared in the RPMI-based medium.
The results are shown in Table 1.

~ ;' . .

~'0 93/1672~ PCI/US93/01716 ~ ~ 3 1~
TABLE 1.

3~-Thymidlne lncor~oratlon Antlg~s _C~MI S.D.
wholo cell extract~
beta insulinoma 31553l1862 alpha glucagonoma 1012l3~
islets (NOD mice) 13416~2178 islets ~human) 29032~2090 pa~creatlc hormones rat insulin 899l105 bovine insulin 958~87 C-l peptide (mouse) ~54~119 C-1 peptide (rat) 997~6B
glucagon 1002~95 somatostatin 765~74 r comb~D~t ~roteln~ :
hsp65 1078~329 hsp70 932l119 carboxypeptidase-H 559~121 PM-1 669~9B
GAD-65 99~25 GAD-67 155~17 peripherin 67~78 , ", -, ,, , _ .
'.

The data in Table 1 ~how that ~-insulinama, islets fr~m NOD mice, and i~lets from humans are successful in ~timulating thymidlne incorporation into ~plenocytes.
Extracts of a-glucagonoma are not. Other pancreatic hormones, including insulin, C-peptides, glucagon and somatostatin, are also not active. A1RO iDactive are heat shock protein (hsp~ 65, hsp70, carboxypeptidase-H, PM-l, GAD-65, GAD-67 and peripherin. None of these protein~ are capable of showing the stimulatory effect of the islet extracts.
; The proteins listed in Table 1 as recombinant protein~ were prepared as follow~. The cDNA encoding W093/l672~ ~ ~3~g ~ -26- PCT/U593/0l7l~

human hsp65 was cloned by PCR using polyA+ RNA isolated from human EBV-transformed B cell line, post-incubation at 42C for 2 hr. Following reverse transcription, the hsp65-encoding fragment was amplified by PCR using the primers 5~-CGGGG~TCCGCCAAAGATGTAAAATTTGGTGCAGATGCC and 5'-GTCCTCGAGTTAGAACATGCCACCTCCCATACCACCTCC (30 cycle~ of 30 sec at 94C, 30 sec at 55C and 1 min at 72C). The cDNA encoding human carboxypep-tidase-H, PM-l (gifts from G. Eisenbarth) and huma~ hsp70 (ATCC/clone pH 2.3), were cloned into expression vector pTrc99A (Aman, E., et al., Gene (1988) ~2:301-315) (His6) which was constructed by insertion of a synthetic DNA fragment encoding BiX
histidine residues into the polylinker of the pTrc99A
expression vector, to encode protein tagged with six ~- 15 histidine residues at the N-tenminus. Plasmid constructs were transformed into E. coli-Tgl ~supB hsd~lac-proAB)F'ttraD36prQAB~lacIqlacZ~ M15] and protein expression was induced by addition of IPTG to the culture medium. Bacteria were lysed in 100 mM Tris pH ~.0, 6M
GuHC~, and insoluble material was rem~ved by centrifugation at 40 ~g for 30 m~n. Recombinant proteins were purified using Ni-NTA-agarose (Qiagen, Chatsworth, CA) in the presence of 6M GuHCl and dialyzed against PBS.
Protein concentration was determined using BCA assay 2S (Pierce). Mouse GAD-65, GAD-67 and peripherin expressed in baculoviru~ sy~tem were gift~ from Dr. Roland Tisch (H. McDe~itt lab, Stanford).

Exam~le 4 ili~y of T-Cell Clonea to Stimulate In~u~
The T-cell line ~N-7 was stimulated with insulinoma antigen, and three days later 2-5 x 106 stimulated cells were injected intraperitoneally into 3-week-old NOD female mice. Four weeks later, the pancreata were removed, fixed in fonmalin buffer, and ~`1O 93/1672~ -27 ~ ¦ ~ U ~ S r~ PCl/US93/01716 stained with hematoxylin and eosin. Pancreata from age-matched NOD female mice were used as controls.
The results of this experiment are shown in Figure~ lOA and lOB. Figure lOA represent~ the control;
Figure lOB represents the mou~e injected with LN-7 T
cells. The injected mice showed acceleration.of destructive insuliti~, as compared to controls. Similar results were obtained with ~N~aM T cell clones.

"

~ .
, ~

.
- :
,~
~, :
,

Claims

Claims 1. An antigen in purified and isolated form, which antigen is isolatable from pancreatic islet .beta.-cells and which antigen has a monomer molecular weight in the range of about 30-60 kd and is capable of stimulating the proliferation of NOD murine T-cells in the presence of antigen-presenting cells.

2. The antigen of claim 1 which is isolatable from human pancreatic islet .beta.-cell membranes, and has a molecular weight of about 37 kd, 41 kd or 51 kd as determined by HPEC; or which is isolatable from murine pancreatic inlet .beta.-cell membranes and has a molecular weight of about 36 kd, 42 kd or 55 kd, as determined by gel electrophoresis.

3. A peptide fragment of a protein antigen of claim 1 which fragment binds to the MHC class II-encoded glycoprotein on antigen presenting cells (APC) to form a complex wherein said complex is recognized by NOD murine T-cells or a modified form thereof which binds to the MHC
class II-encoded glycoprotein on APC to form a complex, wherein said complex is not recognized by NOD murine T-cells.

4. A recombinant DNA in purified and isolated form which encodes a protein antigen of claim 1; or a recombinant DNA which encodes a protein antigen of claim 1 included in an expression system capable of expressing said encoding DNA when contained in a host cell, which expression system comprises said encoding DNA operably linked to control sequences compatible with said host.

5. A recombinant host cell which contains the expression system of claim 4.

6. A method to produce a protein useful in therapy and diagnosis of type I diabetes which protein is isolatable from pancreatic inlet .beta.-cells and which protein has a monomer molecular weight in the range of 30-60 kd and is capable of stimulating the proliferation of NOD murine T-cells in the presence of antigen-presenting cells, which method comprises culturing the cells of claim 5 under conditions which permit the expression of said encoding DNA; and recovering the protein from the cell culture.

7. Antibodies or immunologically reactive fragments thereof specifically immunoreactive with the antigen of claim 1, which antibodies or fragments are in purified and isolated form; or are contained in a composition substantially free of red blood cells; or are substantially free of plasma proteins; or are monoclonal antibodies.

8. A method to identify an individual developing type I diabetes which method comprises contacting T-cells obtained from said individual with the antigen of claim 1 under conditions of a T-cell proliferation assay; and determining the ability of said T-cells to proliferate in the presence of said antigen;

so as to identify an individual whose T-cells proliferate under these conditions as developing type I
diabetes.

9. A method to identify an individual developing type I diabetes which method comprises contacting serum or plasma obtained from said individual with the antigen of claim 1 under conditions whereby antibodies immunoreactive with the antigen of claim 1 will form a complex; and detecting the presence or absence of said complex;
so as to identify an individual providing serum or plasma capable of forming said complex as developing type I diabetes.

10. The antigen of claim 1 in nonimmunogenic form or the peptide of claim 3 for use in preventing development or progression of Type I diabetes.

11. The antigen of claim 1 in nonimmunogenic form or the peptide of claim 3 in combination with an immune modulator for use in preventing development or progression of Type I diabetes.

12. A pharmaceutical composition useful in preventing the development or progression of type I
diabetes which comprises as active ingredient the antigen of claim 1 in nonimmunogenic form or the peptide of claim 3 in admixture with a pharmaceutically acceptable excipient, and optionally further containing an immune modulator.

13. The composition of claim 12 wherein said immune modulator comprises anti-CD4 antibodies or immunoreactive fragments thereof.

14. A composition free of red blood cells which is enriched in T-cells responsive to the antigen of

claim 1.