CA2128415A1 - Protective effects of mutated superantigens - Google Patents

Abstract

The present invention includes a method for preventing or treating the toxic effects of a superantigen. A subject is treated with a molecule which interacts with specific V.beta. elements of T
cells in a manner similar to that of a native superantigen. The molecules of the present invention are mutated or modified superantigens which elicit antibody production without inducing T cell proliferation.

Description

'YO 93/14634 2i 3 ~ ~ 415 PCI`/US93/00839 PROTECTIVE EFF}5CT~ OF MUTATED SUPERANq~IGE~7;

FIELD OF T~IE INVEN$ION
S This invention relates to methods for preventing and treating antigen-mediated and antigen-initiated diseases. Specifically, it relates to providing protection against superantigen pathogens by administration of molecules which are modified or mutated superantigens which elicit a antibody response against the superantigen without having the ~athological effect of the superantigen. The molecules of this invention may also interact with the V~
elements of T cell receptors in a way which leads to modifications in the way T cells respond to an antigen.

: BAC~G~OUND OF ~E INVENTION
: The vertebrate immune system evolved to protect vertebrates from infection by microorganisms and large 20~ parasites. ~:The immune system responds to antigens in one of two ways: (l) humoral antibody responses, médiated through B cells, involving the production of : protein:antibodies which circulate in the bloodstream : a~d bind sp~ecifically to the foreign antigen which ~ i~duced;them.: The binding of the antibody to the ; : : antigen makes it çasier for phagocytic cells to ingest the antigen and~often~activates a system of blood : proteins~:~co11ectively: called complemen~, that helps ~: ~ destroy the ~ntigen; and (2~ cell-mediated immune responses, mediated through T cells, involving the production~of specialized cells ~hat react mainly with ~ Poreign ~antigens~on:~the surface of host cells, either ;~; killing the host~cell: if the antigen is an infecting :: virus or induc:ing other;host cells, such as :35 macrophages,:~to:destroy the~antigen (Molecular Biology of the CeIl ~1~83), B. Al~erts et al. ~eds), chapter ::
. 17, pp. 952).~ ~
The production of antibodies requires a number of .~ preceding events to occur which lead to stimulation of .

WO93/14634 PCT/US93/00~

~ 4~ -2-B cells producing the antibodies. One of the key even~s involved in the processes leading to antibody production is that of antigen recognition. Antigen recognition requires the participation of ~hymus (T) cells.
T cells have antigen-specific receptors on their surfaces, termed T cell antigen receptors ~TGR).
Before T cells can recognize protein antigens, the antigens must be presented on the surface of antigen-presenting cells~ The antigens must first be processedby macrophages or other antigen presenting cells.
These cells essentially swallow antigens and chop them into peptides which are displayed at the cell surface in combination with major histocompability complex (MHC) molecules.
: The major histocompatibility antigens are a fam.ily of an~igens encoded by a complex of genes called the : major histocompa~ibility complex. ~HC antigens are ~xpr~ssed on the cells of all higher vertebrates. In ;: 20 man they are called HLA antigens ~human-leucocyte-associated antigens) because they were first demonstrated on léucocytes. There are two principal~
cl~sses o MHC mol~cules, class I and class II, each comprising a:set of cell-surface glycoproteins. The two classes of MHC antigens stimulat~ different su~populations of T cells. MHC class Il molecules are involved in most responses to pathogens. In contrast, NHC class I molecules are invol~ed when the pathogen is a ~iru5 or when a malignant cell is involved. When MHC
class I is involved, antibody stimulation does not ~ result; rather,: the interaction of MHC class I
: ~ ~ processed antigen and T~cell leads to lysis of cells ~: infected with the pathogen.
The processed antigen peptide fits in a cleft on ~: 35 an MHC molecule. Once an antigen i5 displayed, the few :~ : T cells in the body that ~ear receptors for that particular pep~ide bind that complex. Most T cells ~ ~L 2 ~
~/093/14634 P~T/US93/00839 recognize antiyens on the surface of cells only in association with sPlf-MHC glycoproteins expressed the same cell surfaceO
The ability of the T cell to complex with the processed antigen and MHC complex is dependent on the T
cell receptor (TCR). The TCR consists of two protein chains, ~ and ~ Each chain contains a constant and a variable domain. The variable domains are encoded in two (~ or three (~) different gene segments ~variable (V), diversity (D), joining (J)) (Siu et alv (1984) Cell 37:393; Yanagi et al. (198S) Proc. Natl. Acad.
Sci. USA 82:3430). In each T cell, the combination of V, D, and J domains of both the a and ~ chains participates in antigen recognition in a manner which is uniquely characteristic of that T cell and defines a unique binding ~ite. See, Marrack et al. (lg88) : : Immunol. Today 9:308; Toyonaga et al. (1987) Ann. Rev.
Immunol, 5:585; Davis (1985) Ann. Rev. Immunol. 4:529;
- Hendrick e ~1. (1982) Cell 30:141; Babbitt et al.
~20 (1985) Nakure 317:359; Buus et al. (1987) Science ~ 235:1353; Townsend et al. (1986) Cell 44:959; ~jorkman : et al~ (1987) Nature 329:506). Generally, both the~
and ~ chains are involved in recognition of the ligand formed by proc~ssed antigen and MHC.
When T:cells are stimulated by an antigen, they divide and differ n iate into activated effector cells that are responsible for various cell-mediated immune reactions. At least three dif~erent reac~ions are carried out:by T cells~ ytotoxic T cells specifically kill foreign or virus-infec~ed vertebrate : cells; (2) helper T cells help B lymphocytes; and (3) suppressor T cells supress ~he responses o.f specific l l s .
~ecently, it has been shown that a novel class of antigens, termed "superantigens'l, are able to direc~ly : stimulate T cells by binding to a particular V~
element, that is, the variable domain sf the ~ chain of Wog3/1~ ~ 2 8 4~S PCT/US93/0083 the TCR (Kappler et al. (1987) Cell 49:~63; Kappler et al. (1987) Cell 49:273; MacDonald et al. (1988) Nature 332:40; Pullen et al. (1988) Nature ~:796; Kappler et al. (1988) Nature 332:35; Abe et al. (1988~ J. Immunol.
140:4132; White et al. (1989) Cell 56:27; Janeway et al. (lg89) ~mmunol. ~ev. 107:61; Berkoff et al. (1988) J. I~munol. 139:3189; Kappler et al. (1989) Science 244:811). Unlike recognition of conventional peptide antigens, the other components of the T cell receptor : 1~ (i.e., D~, J~, V~, Ja) appear to play little role in the superantigen binding. Superantigens, while : generally stimulatory to T cells, appear to interact specifically with particular V~ elements present on the stimulated T cell. Since the relative number of V~
genes is limited, many T cells within an individual will bear a particular V~ element, and a gi~en ;~ superantigen is therefore capable of interacting with a : large fraction of the T cell repertoire. Thus, depending on the freguency of th2 responding V~
;20 populationts), ~-30% of the entire T cell repertoire could be~st~imulated by a superantigPn, whereas the responding~frequency to a conventional antigen is : usually much less than 1 in 1,000. Although superantigens interac~ with class II MHC molecules, :~; : 25 they sppear to act as::intact proteins rather than as :~: peptides, that is, they do not appear to bind within : the conventional:peptide binding groove. Instead, they seem to interact with amino acid residues that are on the outer walls of the binding cleft. Xnown superantigens and~references to their sequences and structures are listed in Table I.
TWO distinct classes of superantigen have been described. The first was noted nearly 20 years ago, : when Festenstein showed marked responses in mixed :~: 35 lymphocyte reactions between certain ~HC identical strains. The stimulating antigens were called minor lymphocyte stimulating (Mls) antigens (Festenstein '~93/14634 PCT/US93/00839 (1973) Transplant Rev. 15:6~) to differentiate them from MHC antigens. These supexantigens are encoded by endogenous retro~iral genes (Palmer (1991) Curr. Bio.
1:74). The presence of these genes in the mouse leads to a marked deletion of responding T cells, creating potentially large holes in the animal's T cell receptor repertoire (Pullen et al. (1988) suPra)~ The second set of superantigen is represented by a growing list of bacterial and viral proteins, capable of producing a ~0 variety of pathological effects after injection (Marrack & Kappler (1990) Science 248:705).
Sta~hYlococcus aureus ( S . aureus ), a commcn human pathogen, produces several enterotoxins, designated as SEA (staphylococcal enkerotoxin A) through SEE, which can be responsible for food poisoning and occasionally shock in humans; ÇMarrack & Kappler (1990) suPra;
Bohach et al. ~1990) Crit. Rev. ~icrobio. 117:251).
So~e S. aureus isolates also produce toxic shock syndrome toxin-l (TSST-1~), which has been implicated in the majorit~ of cases of human toxic shock syndrome as well as the related exfoliative toxins (ExTF~, which are associated with the scalded skin syndrome. ;~
S~ptococcus Ey3yg~ or group A streptococcus, ; another common human pathogen of the skin and pharynx, al~o produces~toxin~ with superantigenic properties (Abe~et al~. (1991) J. Immun. 46:3747). These have been designated~strep~ococcal erythrogenic toxins A-C
(SPEA-C).
The amino acid sequence of the S._aureus toxins 30~ exhibit soma homology, but also exhibit marked dif~erences (S e~ Bentley et al. (1988) J. Bacteriol.
70:34; Jones~et_al. (1986) ~. Bacteriol. 166:29; Lee et al. (1988) J. Bacteriol. 1~:2954; Blomster-Hautamaa et al. (1986) J.~Biol. Chem. 261:15783). S. aureus ~ has the ability to stimulate powerful T cell proliferation responses in the presence of mouse cells bearing MHC class II type molecules ~Carison et al.
:: :

WO93/14634 PCT/US93/008.

2~ J'~ ~5 .

(1988) J. Immunol. 140:2848; White et al. (198g) Cell 56:27). The S._aureus proteins selectiYely stimulate murine cells bearing particular V~ elements.
The binding of toxins to class II M~IC molecules is a prere~uisite for T cell recognition, but the process is much more permissive for superantigens than that . seen with conventional antigens. While peptide antigens are very dependent on allelic MHC residues for binding, the superantigens bind to a wide variety of allelic and isotypic forms of MHC class II molecules ::~ (See, Hermann et al (1989) Eur. J. Immunol. 19:2171;
Herman et al. (1~90) J. Exp. Med. 172:709; Scholl et al. (1990) J. Immunol. 144:226; Molleck et al (1991) J. Immunol. 146:463)~. While T cells rarely recognize peptide antigens ~ound to self-NHC (allo-MHC) molecules, individual T cell clones can respond to ; ~:: toxins bound not only to various allelic forms of MHC, but also to different class II isotypes and even to xenogenic class II molecules.~ Such observation~
~ suggest that superantigens:bind at a relatively conserv d site outside the allelically hypervariable : groove thought to~bind conventional peptide antigens~.
Superantigens may contribute to autoimmune d:lseases, in which components of the immune system ;25 a~tack normal tissue. : The process of deletion of T
: cells respon~ive to self, potentially harmful self-reactive ~ ells,::is called t~lerance or negative : selection (Kappler et al. (19873 Cell 49:273; Kapper et : al. (1988) Nature ~ :35; MacDonald et al. tl988) ~ature 332::40; Finkel~et al.: (1989) Ce~l 58:1047). The immune system normally deletes~ self-reactive T cells, but occasionally a few appear to es~ape the surveillance mechanism. It has been su~gested that the : ability of superantigens to arouse 20 percent of a ~:~ 35 person's T cell repertoire~could lead to undesirable replication of the few circulating T cells that recognize self (Johnson et al. (1992) Scientific ' 212~
~V~93/146~ PCT/US93~00~3g American 266:92). T cells bearing certain V~ types have been implicated in various autoimmune conditions, including arthritis and multiple sclerosis. These findings imply that the destructive cells might be activated by a superantigen that binds to the identified V~ types (Johnson et al. (1992) supra).
Autolmmune diseases are a result of a failure of the immune system to avoid recognition o~ self. The at~ack by the immune system o~ host cells can result in a large ~umber of disorders, includi~g such n~ural ; diseases as multiple sclerosis and myasthenia gravis, diseases of the joints, such as rheumatoid arthritis, attacks on nucleic acids, as observed with systemic lupus erythematosus, and such other diseases associated 15 ~ with various organs, as psoriasis, juvenile onset diabetes, Sjogren's disease, and thyroid disease.
These diseases can have a Yariety of symptoms, which can vary from minor and irritating to life-threatening.
For example, rheumatoid arthritis ~RA) is a chronic, recurrent inflammato~y disease primarily involving joints, and affects 1-3% of North Americans, with a female to male~ration of 3:1. Severe RA patients ten~
to exhibit extra-articular manisfestations includiny ~asculitis,~muscle atrophy,~subcutaneous nodules, ; 25 l ~ adenopathy,~ splenomegaly, and leukopenia~ It is estimated that about 15% of RA patients become :: :: : :
` completely incapacitated.
Several lines`of evidence suggest that T cells :
specific for self~antigens may play a critical role in 30 ~ the initiation of autoimmune dlseases. In the case of RA, the linkage of the disease to the DR4 and DRl alleles of~the class ~II genes of MHC and the findings tha~ sometimes oligo lonal, activated CD4' T cells in synovial fluid and tissue of affected joints ~Stastny et al. ~1976) Engl. J.~Med. 298:869; Gibofsky et al.
(1978) J. Exp. Med. 14~:1728~; McMichael et al. (1977) Arth. Rheum. 20:1037; Schiff et al. (1982~ Ann. Rheum.
~ : :

W~93/146~ PCT/US93/008.` ~
!,5 Dis. 41:403; Duquestoy et al. (1984) Hum. Immunol.
10:165; Legrand et al. (1984) ~m. J. Hum. Genet.
36:690; Gregerse et al. (1987) Arth. Rheum. 32:15;
Burmester et al. (198~) Arth. Rheum. 24:1370; Fox et al. (1982) J. Immunol. 128:351; Hemler et al. (1986) J.
Clin. Invest. 78:696; Stamenkoic et al. (1988) Proc.
Natl. Acad. Sci. USA 8$:1179) sug~est the involvement of CD4+, ~TCR-b~aring, class II-restricted T cells in the disease. This view is supported by the finding that par~ial elimination or inhibition of T cells by a varie~y of techniques can lead to an amelioration of disease in certain patients (Paulus et al. ~19773 Arth.
Rheum. 20:1249; Karsh et al. (1979) Arth. Rheum.
~:1055; Kotzin et al. (1989) N. Eng. J. Med. 305:976;
lS Herzog et al. (1987) Lancet ii:l461; Yocum et al.
~1989~ Ann. Int. Med. 109:863).
U. S. patent application Serial No. 07/732,114, herein specifically incorporated by refsrence, establ~shes that specific V~ elements may be used to diagnose for an autoimmune dis~ase~ specifically the presence of a higher percentage of V~14~ T cells in synovial ~luid may be used to diagnose R~.
Many in~estigative efforts have focused on dev~loping methods for the treatment of autoimmune diæeases. For example, European Patent Publication 340 1~9, entitled autoimuune~d_sease treatment, and U.S. Patent ~o.
~,550,086, issued October 29, 1985 to Reinherz et al~, entitled Monoclonal_antibodies that recoani2e human T
~ , des~ribe a method of detecting a particular se~uence of the variable region gene of T cell receptors associated with a particular disease and ~; ~ treating the disease with antibodies to that se~uence.
; U.S. Patent No. 4,886,743, issued December 12, 1989 to Hood et al~, entitled: Diaanostic reaqents based on un~iue sequences within the variable reqion of the T
cell receptor and uses thereof, describes a method of ~093/146~ ~1~ 8 ~ ~ 5 PCT/US93/OOX39 diagnosis diseases based on the presence of T cells with a unique sequence in the V~ region associated with a specific disease. PCT Patent Application Publication WO 90/06758 describes a method for detecting specific V~ regions associated with RA, specifically, V~3, v~s, and V~lO, and for the treatment of RA with monoclonal antibodies which recognize V~3, V~g, and V~lO.

Immunity An animal that has never been exposed to a pathogen has no specific defenses against it. However, the animal can be immunized against khe pathogen by injecting it with a non-virulent form of the pathogen with a similar chemical structure as the pathogen but lS without the ability to cause the pathological effect.
The animal wilI pr~duce anti~odies specific against the non-virulen~ form o~ ~he:pathogen, and these antibodies can protect the animal against ~ttack from the virulent pathogen.
~: 20 ; BRI~F 8n~YXRY OF T~IN~ENTION~
The present invention includes a method for preventing the toxic effe ts of~a superantigen by : ~ treatment with a molecule, wherein said molecule :~:elicits antibody production without inducing T ce~l activation.~
: The~present invention also includes molecules consisting of mutated or modified deri~atives of : superantigens.
~ ~The present~inventlon~further includes a method of modifying T cell response elicited by an antigen comprising adminlstering a molecule which in~eracts with:either the V~ element alone or both the ~ and chains of T céll~receptors (TCR).
The molecules of this invention can function by ~: leading to deletion or inactiYation/desensitization of : : : ` :

.

WO93/146~ PCT/US~3/0083 2,~2~

at least one or more subpopulations of T cells which present a particular V~ element.
To prevent the in vivo toxic effçct of superantigen requires an exact understanding of how their effect is achieved. Prior to this invention, while it was known how superantigen interact with T
cells, the manner in which a subject animal developed a pathological condition and whether a pathological condition would develop was not well understood.
Various observations suggested that any of a number o~
mechanisms could be the cause of the toxicity.
It has now been found that the pathological condition mediated or initiated by a superantigen can be prevented or treated by administration of the mutant superantigen molecules of the present invention~
Administration of the mutant toxins of the present invention may cause antibody production against the mutant molecule. Some of these antibodies also react with the normal non-mutated toxin. Tharefore, when the immunized individual is confronted with the normal : toxin, these cross-reactive antibodies react with the : normal toxin and inhibit its toxic activity.

BRI~ DE~RIP~ION OF ~E FIG~RE~
FIGURE 1 is ~ schematic ribbon drawing of the three dimensional structure of SEB. Region 1 ~residues 9-23), region 2 (residues 40-53), and region 3 (residues 6~-61) are differentiated by shading. Sites : 30 identified as involved in MHC or TCR binding are shown.
: Residues identified by mutational analysis as important to MHC andjor TCR binding are indicated.
:~
FIGURE 2a show~ the SDS-PAGE analysis of 2 ug of recombinant SEB purified from E. coli and wild-type SEB
purified from S. aureus cultures. Molecular mass markers (in kD): ~-phosphorylase, 94; bovine albumin, ~0 93/14634 ~12 8 4 ~ 5 PCr/US9310~839 69; ovalbumin, ~5; carboxylase, 30: soybean trypsin inhibitor, 21; lysozyme, 14. FIGURE 2b shows the SDS-PAGE analysis of SEB binding to DR on ~G2 cells.
Molecular mass markers (in kD): bovine albumin, 69;
ovalbumin, 45; chymotrypsinogen, 27; soybean trypsin inhibitor, 21; myoglobin, 17; lysozyme, 14.

FIGU~E 3 shows the sequences of the SEB mutants.
Dashed lines indicate identity to unmutated SEB. The positions of the oligonucleotide~ used to generate the SEB mutants are also shown.

FIGURE 4 shows the binding of SEB and SEB mutants to DRl-bearing lymphoblastoid line LG2 cells.
F~GURE:5 shows stimulation of T cell hybridomas by : region 1 SEB mutants. Preparations of purified SEB or the region 1 mutants were tested for their ability to stimulate a collection of T cell hybridomas bearing of ~he the V~ elements known to xecognize SEB: KS-20.15 (V~7),~KS-6.1 (V~8.2j, ~S-47.1 (V~8.3), K~6-57 (V~8.1).
: .
: FIGURE 6 shows~stimulation of T cell hybridomas by region 2 SEB mutants. Preparations of puri~ied SEB
2S :were tested as in:Figure 5.

FIGURE 7 shows stimulation of T cell hybridomas by reglon 3 SEB ~utants.~Preparations of puri~ied SEB
: were tested as in Figure 5.
: 30:
FIGU~E 8 shows the effects of SEB and its mutants in vivo. Groups~ of three mice were. weighed and then given balanced salt~solution ~BSS) containing nothing, O ug (left), or 100 ug (right~ of rec~binant SEB or the mutant SEBs BR~257 or BR-3S8.

':

W093/14634 PCT/US93/00~
2~2~ 4~ -12-FIGURE 9 shows the protective effect of mutant ~oxins against challenge with SEB. Mice received dsses of either saline or BR-257 three months prior to challenge with wild-type SEB.

DET~I~E~ D~CRIPTION OF THE IN~NTI9N
The molecules of the present invention may be effective in different ways i~ preventing or treating antigen mediated or initiated diseases. Some of the di~ferent ways in which the molecules of the present invention may be effective inrlude modification of the T sell response and production of antibodies which pro~ide protection against pathogens. Specifically, this invention presents a method of preventing or treating superantigen-mediated or superantigen initiated diseases. The method of this invention generally involves preparing mutated superantigen :~ molecules by methods known in the art and described : herein, identifying antigen mutants able to bind eithe~
0 MHC or TCR, and testing for ability to prot~ct against expo ur to ~he n~n-mutated superantigen.
The pr~sent inv~ntion describes the ~easibility of the above-outlined approach in achieving protection against a known superantigen. Mutants of recombinant~-~
Staph~lococca~ ~er~Erp~o~in B (SEB3 were prepared and : :purifi~d as described in Ex~mples l-4 below. SEB
~ut~nts able~to bi~d MHC molecules or TCR were ~elected ~y examining the binding of mutant SEB molecules to ~: HLA-DRl homozygo~s lymphoblastoid line L~2 cells and stimulation of ~ cell hybridomas bearing di*ferent V~
elements. The SEB mutànt BR~257, which bound ~G2 cells :~; in a manner indistinguishable from that of non-mutated SEB and did not stimuIa*e T cell hybridomas, injected into experimental animals 3 months prior to exposure to ~ 35 SEB provided complete protection against the toxic : effects of SEB. Similar results were obtained in ~: primates.
: .
S~BSrlTUlE SHEE~

`~93/14634 2 1 2 ~ PCT/US93/0083 Although the present disclosure describes : production of mutated SEB molecules able to protect animals agains~ subsequent challenge with SEB, the methods of the present in~ention are equally applicable to o~her superantigens.
ThP ability to use the occurrence of specific V~
elements to diagnose aukoimmune diseases, as discussed in detail above~ may be combined with the present invention as a method of detecting and treating autoimmune diseases mediated by superantigens~ The existence of a superantigen-mediated disease may be determined by a "footprintl' analysis, e.g., by determining if there is an alteration in V~ elements in a disease state. The finding of al~erations in V~
:: ~ 15 elemen~s, such as the increase in V~14' T cells in : ~ s~novial fluid in RA,: suggests the presence of a superantigen-mediated disease. Techniques known to the art may then be applied in order to isolate and identify the implicated cuperantigen. The V~ footprint : 20 : ~ay ~e compared against that of a known sup~rantigen for possible~implication of that superantigen in initiation~or:proliferation of the disease. There ma.y a: ~ear~h for genes coding for a superantigen when a : : virus ox bacterial infection is associated with the S~ initiation~of the:~disease. On~e a suparantigen is identified~or;isolated, the method of the present vention may be~applied to~produce a mutant ~, ~ superantigen molecule capable of conferring protection against~exposure to the superantigen.
: 30 ~ Various terms are used in this specification, for which it may be~helpful to have definitions. These are ; ~ provided herein,~and should be borne in mind when these ~;~ terms are used in the following examples.
;~ : As described above, the ~ey event in an immune response is the interaction of ~HC molecules with ~: antigens to form a complex presented to T cells.
Generally, the T~cell response is quite specific, with .

WO93/14634 PCT/US93/008~

o2,~

only very limited subpopulations of T cells responding to specific complexes of anti~en and MHC molecules.
The response generally requires interaction of most ox all of the components of the T cell receptor. In certain circumstances, however, the presented antigen need only interact with the V~ element of the receptor, all other components are essentially irrelevant. This means that the antigen can, and does, react with a much greater array of T cells than is normally the case.
The molecules of this invention may interact with the V~ elements of T cell receptors in a way which leads to modifications in the way T cells respond to a superantigen. "Modifying T cell responsiveness" means that the mutant molecules are able to change the manner in which the subject's T cells respond when provoked by the administered molecule, or to an antigen administered concurrently, previously, or afterward.
For example, it i5 believed that early in the ; development of T cells, certain subpopulations interact with presented antigens and are deleted. The molecules of this inv~ntion can function in this manner, i.e., by leading to deletion or inactivation/desensitization of at least one or more subpopulation of T cells which present a par~icular V~ element.
~In a par*icular embodiment of the present invention, the molecules modify the T cell response without changing the B cell response that would normally occur in the sub~ect under con ideration.
This t~pe of material is useful, for example, for providing passive~immunity to a subject, or serving as a vaccine. When superantigèn derivatives are used, these derivatives are-no l~onger superantigenic, as they ~- wiI1 not provoke a restricted T cell response, but~will ::
still serve as antigens in that they generate a B cell response. The superantigen derivatives of the present inventi~jn are a~le *o elicit normal antibody production against the superantigen protein.
:: :

~093/14634 ~ 4 1~ PCT/US93/00~39 The molecules of the present invention may also be seen as competitors for other antiyens. If the molecules described herein interact with MHC elements otherwise required for generation of a full scale response to an antigen or superantigen, they may prevent or reduce the extent of that response.
The molecules of the present invention may also be viewed as "enhancers" in some instances, where an individual's T cell responsiveness is impaired or weakened by any of a number of causes. Via administration of the molecules encompassed by the present invention, the T cell populations of the individual can be greatly expanded.
The term "modifying T cell responsiveness" as used lS herein is always relative to a second element ~e.g., an antigen), and; always refers in particular to responsivenes~ of T cells presenting a particular V~
element as part of their T cell re~eptors, other compone~ts of the receptors being essentially irrelèvant. ~
The molecules of the present invention contain, at least, an amino acid sequence of sufficient size to bind~to an MHC moleculeJ The rest of the molecule may consis~ of ami~o acids, or may con~ain carbohydrate or 2S 1ipid~structures.~
"Reducing~ responsiveness" is construed to also include deleting~the~portion of T cells expressing a particular V~ element.
'~Superantigen derivative~' as used herein refers to a molecule whose structure, at the least, contains an amino acid sequence~su~stantially identical to an amino acid sequence presented by a superantigen or portions of a superantigen required for binding to either the MHG or the T cell.
"Modified" superantigen derivative (or fragment), differs from "muta~ed" superantigen derivative (or fra~ment). The term "modified superantigen" is defined WO93/1~634 PCT/US93/00~3' .

?,~.?~ 4~ j to refer to molecules which contain an amino ac.id sequence identical to an amino acid sequence of superantigen, but contain modifications not found in the superantigen molecule itself. For example, if a superantigen contains amino acids 1-250, a "modified' superantigen derivative may contain a sequence identical to amino acids 50-75, positioned in between stretches of amino acids not found in the native superantigen molecule. Additional modifications may include, for example, differing or absent glycosylation patterns, or glycosylation where there normally i5 none.
'IMutated'' superantig4n refer to structures where the actual amino acid sequence of the mutation has been : 15 al~ered relative to the native form of the molecule.
For example, if a superantigen contains amino acids 1-250, a mutated superantigen may include amino acids 50-~8 an~ 72-75 which are identical to the corresponding nativ~ sequence~ but differ in amino acids 69-71~ The : 2Q difference may be one of "substitution" where different amino acids are used, "addition" where more amino acids are included so that the sequence is longer than the native form, or "deletion" where the amino acids are missing. :
: 25 "Vaccine" refers t~ a formul~tion when administered to a subject provokes khe same type of response typical of vaccines in general, e.g., active immunological prophylaxis. The vaccine may contain adjuvant, or~other materials.
It is known that the class of molecules known as superantigens interact with particular V~ regions of T
cell receptors, leading to massive proliferation of particular T cell su~populations. This interaction, which assumes prior interaction between an MHC molecule and the superantigen, is almost completely independent : of any other region of the T cell receptor.

~-~093/146~ 2 1 2 ~ PCT/US93/00839 In connection with the interaction of MHC and peptide, it must be noted that MHC molecules are available in a variety of "phenotypes1', and different phenotypes are specific ~or various presented peptides and antigens. For example, HLA-DR is known to be associated with presentation of SEB. Thus, different MHC phenotypes will be of value for different antigens, but determination of HLA phenotype and correlation to : presentation of a particular antigen or antigen famil~
10 i5 well within the skill of the artisan in this field.
:Thus, this invention involves the modification of the T cell response via admini~tration to a subject of a mole~ule which interacts with both an MHC molecule and at least one ~ e~ement on T cell receptors. This interaction may a~ffect:the T cell response in any number of ways. Perhaps the most elementary manner of af~ecting the response is one where a molecule interacts with the~MHC molecule, preventing the binding ; of other molecules to~th~ MHC. If th~ competing 20~ `moIecule has been modified:or does not naturally pr~voke proliferation of T cells, then there will be a lessening or elimination of the~response because molecules such~as~ normal antigens:or superantigens cannot form the reguisite complex with the MHC to Z5 gene~xate a T cell~proliferative response.
Another mannér:o modify~ing the T cell response is : : via l'desensitizlng"j "inactivating", or '1anergizing"
the T cells. This mechanism involves interaction of MHC molecule, antigen, and T cell receptor, with subsequent down regulation or inactivation of the T
;: cells. This mechanism is more~common in mature ~: ~ subjects~than the~deletion phenomenon, which occurs in :fetal su~jects.~The latter phenomenon is one where via :~ : interaction of the three units, various subpopulations of T cells are in ~act removed from the organism.
The modif~ication of the T cell response can also involve stimulatlon of T cell subpopulations.

WO93/146~ PCT/U~93/00~ ;
4i~

Knowledge of the mechanisms described herein permits the artisan to administer to a subject a material which interacts with the MHC and a particular subpopulation of T cells, where proliferation of the T cell subpop~lation results. This approach is particularly .desirable in the treatment of conditions where a particular V~ subpopulation or subpopulations are associated with a pathological condition, such as an autoimmune disease.
It should be understood that an immune response, when fully considered, includes both a B cell and a T
cell response. One zspect of the invention involves the use of molecules which modify the T cell response without modifying the B cell response. Such makerials ~:~ 15 are especially useful as ~accinPs, as discussed below.
~;: The molecules of the invention ~re pre~erably, but : : not exelusi~ely, superantigen derivatives. These derivatives may be modified or mutated, as discussed a~o~e. Thesa~ or any other mole~ules used herein, are administered in an:~amQunt sufficient to madify the T
: cell response in the manner described. The amount of : material used wil~l vary, depending on the actual m~terial, the response desired, and the subject matter of ~he treatment.
The molecules~may also serve as vaccines. These ~ vaccines confer protec~ive immunity on the subject in :~ that they generate~a ~ cell response without the full T
cell response normally associated with the normal form of the molecule. Example 7 shows one manifestation of this effect for SEB.~ Again, depending upon the parameters within the control of the knowledge of the artisan, including the condition being treated, the V~
~ molecule to be regulated, and so forth, the material : chosen for the vaccine is up to the artisan. The vaccine may contain other materials which are normally found in vaccine compositions, including adjuvants, carriers, etc.

`~`'V093/14634 2 1 2 ~ 4 1 ~ PCT/US93/00839 --19~
The mode of administration of the materials described herein may vary as well, including intravenous, intraperitoneal, and intramuscular injections, as well as all of the other standard methods for admin}stering therapeutic agents to a : subject.
The inven~ion also discloses how to make.
particular mutants us~ful in the foregoing methodologies, including isolated nucleic acid sequences coding for mutants, cell lines transformed by : these and the vectors and plasmids used therefor, as well as the isolated mutant molecules, inc~uding mutant superantigens.
;~ Other applications of the invention described lS herein will be apparent to the skilled artisan and need not be repeated here.
: The terms and expressions which have been employed are used as terms of description and not of limitation, and~there is no intention in the use of such terms and : expres ions~of excluding any equivalents of the features shown and~described or portions thereof, it being recognized:tha~ ~arious modi~ications are ~5 possible within the~scope of the invention.
Polymerase Chain Reaction IPCR) and standard 25~ : ~ molecular biological methodologies, described in : Example l, were used in the construction and expression of- recombinant SEB. SEB mutants were generated in one of two ways, as described in Example 2. The first way : introduced random mutations along the entire length of ~he SEB gene. :A~second method introduced random mutation~ in approximately 60-75 base-defined r~e~ions ~ of the SEB gene.:;;Initial ident~fication of potential : mutan* SEBs tested the lysate from transfo~mants for the presence of functional toxin by stimulation of :murine ~ cell hybridomas bearing different ~ elements in a human DR-expressing ceLl line. Lysates negative for T cell hybridoma stimulations were tested for the W~93/146~ PCT/US93/008~
~,~2~

presence of SEB with the use of monoclonal antibodies (mAbs) against SEB (Example 3). Transforman~s producing non-functional SEB were sequenced and the mutation identified. Transformants producing mutant SEBs were grown, mutant SEBs purified as described in Example 4. Analysis of the location and effect of the mutation was performed. Since binding to MHC ~lass II
molecules is a prerequisite for toxin recognition by T
cells, the ability of mutant SEBs to bind human MHC
antigen HLA-DRl was tested as described in Example 5.
Mutant SEBs, such as region 3 mutants, were produced which selectively stimulate some, but not all, of the hybridomas bearing specific V~ elements stimulated by the non-mu*ated toxin. Thus, the mutated superantigens : 15 of the present invention may be used to sel~ctively stimulate only some of the T cell populations stimulated by the wild-type superantigen.
~ ~ ~ Three regions were identified in the N-terminus :~ ~ . part of SE8 that a~fect MHC and/or TCR binding (Example 20: 4 and Figure lj. Mutations in region 1 (residues 9-23) : affected both MHC and TCR binding. The results ~:: suggested that 23N~was particularly important. When ;~
the s~quences of the S. aureus enterotoxins are aligned for maximum homology ~Marrack & Kapple (1990) supra), 25 ~ this residue is conserved~among all of the enterotoxins and toxic shock ~oxin as~well. The mutations in region 2 (residues 41-53~drastically reduced the ability of the toxin to bind to:MHC class II with a similar effect on their ability to stimulate T cells. About half of the mutations inv~l~ed F44. Again, this residue is : conserved among all the enterotoxins, indicating that this residue probahly plays a critical rol~ in the ~: binding of all of~ the toxins to MHC. Interestingly, :~ none of the mutations in either region 1 or 2 completeIy obliterated toxin binding to MHC, and in both cases the T cell-stimulating ability of the mutants could be recovered by adding a large excess of 093/14634 2 ~ PCT/US93/~0~39 toxin. Mutations in region 3 (60N, 61Y) did not affect binding of the toxins to MHC, but did affect their interaction with two V~s, 7 and 8.1. This V~-specific effect suggests that these amino acids are important for interaction with some, but perhaps not other, TCR
V,~s .
: The toxicity of mutant SEBs in anima~s was tested as described in Example 6. Mice were injected with either bala~ced salt solution (BSS), recombinant SEB, ~: 10 or region 1 SEB mutants at F44 (BR-3~8) or at N~3 (BR-257). Mice receiving 50 ug of either mutant SEB were ind~stinguishable from those receiving BSS, while those receiving recombinant SEB died within 5 days.
The ability of mutant SEB to provide immune 15~ protection from SEB was tested in vivo (Example 7).
ice receiving loO ug o~ mutant SEB 8~-257 three months prior:to challenge with SEB were ~ully protected from ; ; t~e toxi~ effect of SEB, whereas those animals not injected with~B~-257 died 4-5:days after challenge with SEB. Similar results were obtained with primates.
Mutant:SEB BR-358~and BR-257 were either ineffective or much less effect;ive~in eliciting an emetic response i~n monkeys (Example 7).
Example 8~describes~.he application o~ the aboYe 29 : procedure to~the SEA~toxin:and the production of a SEA
mutant~whicb behaves~the~same as the corresponding SEB
mutant.
~: :
Example 1. Construction and Expression of 30 ~ R~c~mbinant SEB.
: Polymerase~chain~Reactlon~(pcRL. PCRs (Saiki et : al. (1988~ Science:~232:487) were performed using Ampl:iTaq recombinant Taq polymerase and the DNA Thermal ~;~ Cycler from Perkin~Elmer Cetus (Norwalk, CT). ~0-30 ~ ;35 cycles were performed with~l-min denaturing and - ~ annealing steps~, and an extension step of 1 min for ~ synthesis ~ 500~bp and 2 min for those > Soo bp.

:

Template concentrations were 1-10 nM and oligonucleotides primer concentrations were 1 uM. The concentration of the dNTPs was 200 uM, except when attempting to introduce mutations, where the concentration of one of the dNTPs was reduced to 20 mM.
SE~ Construct. The gene for superantigen SEB was overexpressed in E. coli as follows. A linearized plasmid containing the genomic SEB gene (Ranelli et al.
(1985) Proc. Natl. Acad. Sci. USA 82:5850) was used as a te~plate in a PCR utilizing oligonuc~eotide primers that flanked the portion of the gene encoding the mature SEB without the signal peptide. The 5' primer was (S~Q ID NO~

TAGGGAATTCCATGGAGAGTCAACCAGA-3' This primer contains an EcoRI site which places the SEB gene in-frame with the LacZ gene when cloned into plas~id pTZ18R (Pharmacia Fine Chemicals, Piscataway, NJ). This oIigonucleotide primer also con~ains an NcoI site which adds an ATG between the LacZ gene ~ragment and the beginning of the SEB gene so that the SEB gene could be moved easily to other plasmids carrying its own initiation ATG. The 3' pr.imer containe~ a HindIII site after the termination co~on of~the SEB gene (SEQ ID NO~2):

5'-AGCTAAGCTTCACTTTTTCTTTGTCG-3' The PCR fragmant was digested with EcoRI and HindIII and Iigated into EcoRI/HindIII-digested pTZ18R.
Qoli XLl-Blue (Stra~agen, La Jolla, CA) was transformed with the plasmid, a single transformant picked, and the insert (pSE82) was sequenced to check that it had no mutations.
Upon induction the pSEB2 construct led to overproduction of mostly cytoplasmic SEB (~ 10 ug/ml of ~0~3/1~634 2 1 2 8 ~1 ~ PCT/US93/00839 broth). However, rather than producing a LacZ/SEB
fusion protein, the bacteria produced a protein with the same apparent molecular weight as secreted SEB from S. aureus (Fig. la). Either the LacZ portion of the fusion protein was cleaved in vivo from the majority of SEB or the ATG introduced between LacZ and SEB was a more efficient translation initiation site than that of LacZ.

Example 2. Generation o~ SEB Mutants.
SEB mutants were generated in one of two ways.
One way introduced random mutations along the entire length of the SEB gene. To do 50, the SEB construct of Example 1 was prepared but PCR was performed with concentrati~ns of either dATP or dTTP reduced 10 fold ~: in order to increa~e Taq polymerase error rate (Innis et al. (1988) Proc. Natl. Acad. Sci. USA ~5:9436~.
This reduces the product amount 5 10 fold. Products of the two reactions were combined, clon~d into pTZ18R as described in Example 1, and individual transformants were screened for mutant SEB as described in Example 3 for BR~mutants. Of approximately 400 toxin-produci~g : transformants screened, 10 were identified as functional mutants by their reduced ability to : 25 stimulate T cel~s. Low concentrations of dCTP and dGTP
were triéd as well, but less reduction in product resul~s and no:mutants were detected in screening approximately:200 transformants .
A second PCR method was used for introducing random mutations in approximately 60-75 base-defin~d ~ regions of the~EB gene. The following oligonucleotide ; primers t~ (SEQ ID No:3:j:~ B (SEQ ID NO:4~, and C (SEQ
ID NO:5~) positioned as~shown in Figure 2, were synthesized with each position containing 1% each of the three incorrect bases:

A-: 5'ATTCCCTAACTTAGTGTCCTTAATAGAATATATTAAGTCAAAGTATAG
AAATTGATCTATAGA3' B~: 5'AGCTAGATCTTTGTTTTTAAATTCGACTCGAACATTATCATAATTCCC
GAGCTTA3' C+: 5'CCGGATCCTAAACCAGATGAGCTCCACAAATCTTCCAATTCACAGGCC
5TGATGG~AAATATGAAAGTTTGTAT3' These mutant oligonucleotides served as primers in a PCR reaction with either a vector (A and B) or internal SEB (c) oligonucleotide as the other primer, and the SEB gene as the template. Each molecule of synthesi2ed SE~ fra~men~ was predicted to have 2-3 random base mutations in the region corresponding to mutant primer. Mutant fragments were incorporated into the SEB gene, either alone or with another fragment containing the 3'-portion of the gene as mixed template in a PCR reaction to resynthesized a full length SEB2 gene (Ho et al. (1989) ~ene 77:51; Pullen et al. (1990) Cell 61:1365). Alternativelyr this was accomplished by digestion with appropriate restriction enzym~s and ligation into pSEB2 from which the corresponding region had been removed~
DNA Se~a~encing. Plasmid inserts were sequenced directly by the dideoxynu~leotide method of Sanger et ak (1977) Proc. Natl. Acad. Sci. USA 74:5463, using Sequanase (U~S. Biochemical Corp., Cleveland, OH) and a modifica~ion for double stranded supercoiled plasmid templates (Weickert and Chambliss (1989) in Editorial Comments, U. S. Bioch2mical Corp., Cleveland, OH, pg.
5-6.
Exa~ple 3. Screenina of Transformants for SEB
Mutants.
Anti~SEB Monoclonal Antibodies (mAbs)~ 10 mAbs specific for at least five epitopes of SEB were produced by standard methods from B10.Q(~BR~ immunized multiple times with SEB. One of these antibodies, B344.1f was used both for ~uantitation and immunoaffinity purification of SEB and SEB mutants.
B344.1 is an IgG1 that was chosen because initial ,93/14634 2~ 15 PCr/US93/00839 characterization showed that it had a high affinity for SEB, bound equally well to all of the SEB functional mutants, could detect and immunoprecipitate SEB bound to MHC class II molecules, and did not block T cell recognition of SE~ bound to DR (data not shown).
ELISA for S~B. The amount of SEB in preparations wad determine~ by ELISA. Microtiter wells were coated overnight with a solution of 6 ug/ml natural SEB (Sigma Chemical Co.l St. Louis, MO). The wells were then incubated with 25% FCS and washed throughly~ Var~ous concentrations of known and unknown SEB preparations were added to the wells as inhibitor followed by a constant amount of anti-SEB antibody (polyclonal rabbit anti-SEB(Toxin Technvlogy, Madison, WI) in BR
::. :15 experiments and monoclonal anti-SE8, B344, in BA, BB, and BC experiments). After 1 hour, the wells were : washed thoroughly, and the bo~nd antibody was detected by ~tandard techniques using alkaline phosphatase : :coupling either to goat anti-rabbit IgG (5igma Chemical ~ Co.j or to p-nitrophenyl phosphate as substrate. The : OD of the reaction at 405 nm was related to the dose of inhibitor and the~concentration of he SEB in the unknown estimated by computer analysis of the data.
, Initial Screeninq_o~_P~tentiallY Nutant 5EB. For ~:
25: primary screening,~totaly lysàtes were prepared as described from individual transformants containing a potentially mutant SEB gene. Aliquots of each lysate were tested for the presence of functional toxin by stimulation of murine T cell hybridomas bearing ~/~
receptors~with either V~7 or V~8.3, using human DR- :
: expressing cell lines as presenting cells. Lysates deficient in stimula~ing either of these hybridomas were assayed for~:the presence of SEB protein to rule out mutations affecting the level or the ~ull length of the SEB produced.~: Plasmids from those producing proteins were sequenced to locate the mutation the sequences of the mutants are shown in Figure 2.

W093/14634 PC~-/US93/00~39 4~

The Taq polymerase error-induced random mutants (BR) were clustered in three regions (1, 2, 4), all in the NH2-terminal 93 amino acids of the molecule (except an additional conservative mutation in one case, BR-374, in the COOH-terminal half of the molecule). As predicted by their method of generation, all but one of these mutations involved a nucleotide substitution of A
to G or T to C, and only one silent mutation was found elsewhere in their sequence~ (data not shown).
Additional mutants were generated in region 1 or 2 with mutant oligonucleotide C or A (BC, BA mutants). Region 3 was ori~inally discovered as a single mutant (BA-62) involving the last amino acid covered by oligonucleotide A. The mutant had a different : : 15 phenotype than the other BA mutants. Additionalmutants were produced in this region with mutant ~: ; oligonucleotide B (BB m~tants). Mutations in region 4 were eliminated from ~urther analysis, because it was felt that interfering~with the conserved disulfide : 20 forming cys~eine at position 93 could have far reaching unpredictabIe~effects.~ In~addition, several mutants were not further characterized either because they ~.~
involvéd more than~one region (Br-474~ BA-72), produced ~ highly degraded toxin (BR-267), or were identical to an ; ~ 25~ already exist$n~ mutant:(BA-50).

Example 4~ Preparation of Recombinant SEB.
For initial screening, individual colonies of transformants picked~from agar plates were transferred ~: 30 to well`s of 96-well microtiter plates containing 100 ul ~ of 2XYT and carbenicillin. A replicate plate was :~ prepared except that the media con~ained 1 mM IPTG as ~:: well. Both were~incubated overnight at 37C with shaking. 50 ul o* glycerol was added to each well of 3S the first plate,:whi~h was mixed and then stored at -: 70OC... To prepare SEB-containin~ lysates, each well of ~ the second plate received 50 ul of HNM buffer (10 mM

~93/146~ ~ PCT/US93/00839 Hepes, pH 7.0, 30 mM NaCl, 5 mM MgC12) containing 3 mg/ml lysozyme and 300 ug/ml DNAse I. The plate was incubated at 37C for 15 min, frozen, thawed three times, and centrifuged to pellet debris. The supernatants were trans~erred to a new plate and tested for the presence of SEB both by ELISA and T cell hybridoma stimulation. Th~s method produced preparations containing 0.3 and lO ub/ml of SEB.
'l'o produce purified mutant SEB, transformants were recovered from the 9~-well plate stored at -700C.
Bacteria from overnight cultures ( 1 vol ) containing IPTG were collected by centri~ugation, resuspended in a 1:10 vol of HNM buffer containing 1-2 mg/ml lysozyme and lO ug~ml DNAse I, and frozen and thawed three times~ The suspension was c~ntrifuged at 15,000 g for 2 0 min to remove bacterial debris, and the supernatant : was harvested and f iltered ( 0 . 2 u) . The f iltrate was passed through a colum~ containing a 1: 50 volume of Sepharose 4B beads coupled with 2-3 mg/ml of a mAb to ~: 20 SEB (B344). The beads were washed thoroughly with PBS
: ~ and the toxin was eluted with O.l M glycine-~Cl (pH
~ 2:.7) and neutralized w~ith l M Na2CO3. The SEB was : : concentrat~d to l mg/ml and its buffer çhanged to BSS
using CentriconlO microconcentrators (Amicon Corp., Denvers, MA). This method yiel~ed 3-lO mg of toxin per : liter of bacteria} cul~ure.~ SEB and its mutants p~oduced in this manner were ~ 95% pure as judged by SD5-PAGE. Region l SEB mutants are listed in Table II, region l and 2 mutants are listed in Table III, and : region 3 mutants~are listed~in Table IV.
:The ~utations described all in~olve a nucleotide substitution of A to G, or T to C, which would be predicted by the methodology used for their generation.
When mutations were generated using mutant ol~gonucleotides C or A, these mutations were ~concentrated in amino acids 9-23 (Region l), or 41-53 (Region 2) of the SEB sequence ~Table III).

4 PCT/US93/00839:

When the oligonucleotide primer B was used, the mutants listed in Table IV were generated.
Amino acid 93 is cysteine in normal SEB. To that end, mutations in this region were not considered further because of the poten~ial interference with disulfide binding~ Thus, mutants BR-30 and BR-311 were eliminated.
Those mutants containing changes in more than one region (NOT more than one mutant), i.e., BR-474 and BA-7~, were also eliminatedt as was BR-267l because the toxin was highly degraded. BA-50 is a know~ mutant and was not studied further.

: ~ Structural Studies of SEB.
The three-dimensional crystal structure of SEB, perhaps the most widely studied member of the : staphylococcal enterotoxins, has been recently reported~; : (Swaminathan et al. (1992) Nature 359:8~1). A
sche~atic drawing of SEB is shown in Figure 1. The SEB
molecule cQntains t~o domains. The first is composed o~ residues 1-120 and the second of residues 127-239.
As discussed above, three regions have been identi~i~d ~ ~ (Ka pl~r et al.~(l992) J. Exp. Med. 175:387~ in the N-: ; : te~minus part of the SEB that affect ~HC class II ~:binding and/or T cell activation. In each of the regions the specific amino acids that are responsible ::
were determined.~ Some of the identified residues : affect both ~HC class II binding and T cell activation,whereas other affect only the latter. As superantigen-MHC class II binding:;is a prerequisite for T cell activativn, residues affecting MHC class II binding will also influence T cell activation, thus no T cell binding information can be inferred from them. But they do provide information about MHC class II binding ~: ; 35 sites on the superantigen. On the other hand, those residues that influence T cell activation but not MHC

.

~.J93/146~ ~ ~ 8 ~ I ~ PCT/USg3/00839 class II binding are likely to be in the T cell binding site on SEB.
Region l, defined as the stretch of amino acid residues from 9-23, is bifunctional as it affects both TCR and MHC class II binding. Mutations in this region included residues in positions l0, 14, 17 and 23, as either a single or a double mutation (Table II).
Asparagine at residue 23 ~N23) i5 on the a-helix, ~2, with the side chain pointed towards the solvent. It is the most important residue, being conserved among all staphylococcal enterotoxins and critical for TCR
activation. Only five mutations at posi~ion 23 affected MHC class II binding, but all of them affected TCR activity. Mutations at residue 14 and 17 affected both MHC class II binding and TCR activation. Residue ~ Sl4 is on a very short a-helix ~al) and is exposed to ::: the sol~ent whereas Fl7 is locat@d at the other end of aI. The locations of Sl4, Fl7, and N23 (Figure l) on ~ the surface of ~he toxln are fa~orable ~or making : 20 critical: contacts~ with MHC class II molecules and/or : ~ V~. Residue Fl7~points inwards and lies in a loop sandwiched between two other loops, of residues l74-~79 and 203-209~ This sugg~sts that its replacement by serine (Fl75~ may have introduced structural changes 25: :which reduce MHC~class II binding and cytokine production. The~association of Sl4 (on ~l) with MHC
class II binding, and N23 (on a2) with TCR activity, reveals the structural bas~is underlying the bifunctional role of region l. Although the region consists ~f a small number of sequential amino acids, :there are distributed on separated but adjacent elements of the secondary structure ~hat are engaged in . different functions. The proximity of ~l and ~2 is consistent with the suggestion (Kappler et al. (1992) supra) that the amino acids in region l are situated in the trim~lecular complex near the junction of ~ and MHC class II.

W093/14~34 PCT/US93/0083 Region 2 is defined as residues 40-53 and was sugges~ed to be important in all staphylococcal enterotoxins in mediating binding to MHC class II.
About half of the mutations in this region involved the conserved residue F44 (Table III). Other mutations involved residues 41, 45, 48, 52, and 53. These changes affected MHC class II binding and consequently the TCR activation. Thus, this re~ion is probably specific for MHC class II binding. Residues 48-52 are in ~-strand ~2. Resid~e F44 is on a tuxn connecting ~1 and ~2 with the side chains exposed to solvent. It is situated favorably ~or engaging in critical hydrophobic binding contacts with MHC class II.
Region 3 is made up of ~wo residues, 60 and 61, : 15 and mutation of either one af~ects the TCR activation but not MHC class II binding. Residues 60 and 61 are ~ in the loop connecting ~2 and ~3 and are exposed to : : solvent ~Table IV).

~: 20 Example 5. Bindinq of Mutant SEB to H~-DR.
Since binding to M~C class II is a prerequisite . for toxin recognition by T cells, the mutations coul~d~
: have affecte~ either the ability of ~he toxin to bind : to DR molecules or the recognition of this complex ~y the TCR-a/~. To~help distinguish these two possibilities, the HL~-~Rl homozygous lymphoblastoid line LG~ was used (Gatti and Leibold (1979j Tissue-Antigens 3:35). l2sI-labelled LG2 cells were incuba~ed with or without 50 ug/ml recombinant SEB for 2 hours at 37C. A cell free lysate was prepared in 1% digitonin and incubated for 4 hours at room temperature with Sepharose beads~coupled with 3 mg/ml B344 anti-SEB I~b.
The beads were washed thoroughly, and the labeled bound material was analyzed by SDS-PAGE under reducing conditions (Laemmlli (lg70~ Nature 22Z:680) and autoradiography. As a control, beads bearing the anti-DR mAb, L243 (Lampson and Levy (1980) J. Immunol.

2~3~1~ PCT/US93/00839 -31~
125:293) were used ~1/20 the volume of lysate used with the anti-SEB beads).
SEB binds to DR molecules on LG2 ~Figure 2b).
Immunoa~finity-purified toxins were prepared and assessed for their ability to bind to LG2 using flow cytometry with the same anti-SEB mAb used to purify the SEB and its mutants. 3 x 104 LG2 cells were incubated in 100 ul of tissue culture medium overni~ht at 37C
with vrious concentrations of SEB or its mutants. The cells were washed ~horoughly and incubated for 30 min at 4C with approximately 1 ug/ml of the anti-SEB mAb, B344.1. The cells were washed again and incubated for 15 min at ~C with fluoresceinated goat anti-mouse IgG1 (Fisher Scientific Co.). The cells were washed again .~nd analyzed for surface fluorescence of the cells corrected for the fluorescence seen with the secondary reagent alone v.s the amount of toxin added. The : ~esults, shown in Figure 4, are presented for mutations in each of regions ~1, 2, and 3.
~: 20 ~he binding by four of the region 1 mutants to LG2 : ~ . was indistiDguishabl~ from that of unmutated SEB. The : ~ o~her three mu~ants were reduced in their binding capacity by approximately 100 fold~ These resulks suggest that residues between 14 and 23 within region 1 are important in MHC ~inding. Five of the seven mutations involved residue 23N. In only one case (BR~
291, 23N-S) did this mutation reduce MHC binding.
These results suggest residue 23N may be important in ~ both MHC binding and V~ in~eraction. Region 2 mutants all bound poorly to LG~, approximately l,OOO times poorer than SEB, lndicating that region 2 defines a stretch of amino acids, especial~y 44F, important in binding of the toxin to class II MHC. Region 3 mutants were essentially unaffected in binding to LG2, strongly suggesting that this two-amino acid region ~60N, 61Y) is important in V~ interaction.

W093/146~ PCT/US93/00839 fl ~

Example 5. Effect of Mutations on T Cells Bearin~
Di~ferent V~ Elements.
The SEB mutants were originally identi~ied because they stimulated either a V~7' or a V~8.3' T cell hybridoma poorly. To assess the effect of the SEB
mutations on T cell recognition in more detail, the purified mutant toxins were retested at various doses on additional T cell hybridomas bearing each of the four murine ~ elements known to recognize SEB (V~7, V~8.1-3, (White et al (1989) supra; Callahan et al.
(1989~ su~a; Herman et al. (1991) su~ra). Varying concentrations of toxins were incubated at 37~C
overnight with 3 x 104 DR~ cells in 200 ul of tissue culture medium. 5 x 104 T cell hybridomas of requisite V~ specificity were added in 50 ult and the mixture incubated overnight. Response of T cell hybridomas was ; measured as IL-2 secre ed, following Kappler et al.
1981) J. Exp. Med~. 53:1198 and Mosmann (1983) J.
Immunol. Meth. 65:55. The results are shown in Figures 5-7.
Among ~he region I mutants (Figure 5), the five involving 2~3N (~BR-257, BR-291, BC-6, BC-66, BC-88) stimulated all; ~f the hybridomas poorly, d spite the fact ~hat four of these bound to D~ as well ~s unmutated SEB did. These results indicate that re~idue 23N is~ an~important amino acid for V~ interaction1 but because the fifth mutant i m olving this amino acid, BR-291, bound poorly to MHC, this amino acid may in~luence ~HC bindingias well. The other two regions 1 mutants also s~imulated poorly. In the case of BR-75, this may have been due primarily to its poor binding to DR, but the effect o~ the BR-210 mutation was several orders of magnitude greater~on T;cell stimulation than on binding to DR. Taken together, these results are evidence that during T cell recognition of SEB bound to DR, the amino acids 1n region l are situated in the trimolecular .' ~ r ~93/146~ PCT/US93/00839 ~ 28'11~

complex at the junction between V~ and MHC, so that individual residues may interact wi~h either component.
The mutations in the other regions produced less complicated phenotypes. All of the region 2 mutants were defective in stimulation of all of the T cell hybridomas, regardless of the V~ element in their receptors ~Figure 6). There were small differences, but in general the effect of mutations on stimulation was about the same as that seen on DR binding. These results were consi~ent with the conclusion that mutations in region 2 primarily affect DR binding.
The two-amino acid region 3 mutants were the most discriminating (Figure 7). Despite the fact that random mutants in a 20-amino acid strech flanking this region were generated, all mutations affecting functisn ; were found in these two amino acids. These mutants failed to stimulate the hybridomas bearing V~7 and V~8.1, but not V~8.2 or~V~B.3. To insure that this prop~rty ~as not peculiar to these particular hybridomas, the toxins~were tPsted with f our other T
cell hybridomas: one V~7' . two V~8.1~, and one V~8.3'.
The results~were indistinguishable from those in Fi~re ~ 7~(data not shown).~

;~ ~ 25 Example 6. R~egyirement for T Cell Interaction for In Vivo Effects of SEB.
The question of how important the superantigen properties of the bacterial toxins are to their in vivo toxic effects is~unresolved. Previous experiments by the inventors suggested;that the toxicity of SEB in mice was related~to its ability to stimulate T cells in ~a V~-specific manner, since the toxi-~ effect of SF,B was direc~ly related to the frequency of T cells bearing the relevant V~ elements (Marrack et al. (1990) J. Exp.
Med. 71:455). However, the ability of some of S
aureus~toxins to bind to class II on monocytes and stimulate the production of cytokines such as TNF and 6~ PCT/US93/00839 ~a 4~

IL-l (Parsonnet (1989) Rev. Infect. Dis. 1:263) opens the possibility that direct monocyte stimulation may be sufficient to account for much of the toxin pathology in some situations.
To test this idea, mice were injected with various concentrations of region I mutant BR-257, which binds v ry well to class II MHC but does not stimulate T
cells except at extremely high levels. Unmutated S~
and mutant BR-358, which like all of the region 2 mutants binds very poorly to class II MHC, were used as contrsls. To minimize the effects of LPS, which might contaminate the preparations, C3H/HeJ mice were used, a strain defective in LPS responsiveness. Since rapid weight loss is one of the most obvious immediate toxic effects of SEB in mice (Marrack et al. (1~90) suPra), the mice were weighed daily after the injection on day O. ::
Groups of three mice were weighed and then given balanced salt solution (BSS) containing either nothing, S0 ug, or 100 ug o recombinant SEB, mutant SEB BR-257, or mutant SEB BR-358. The mice were weighed daily at the same time of~day until they died. The results a~r~
shown in Figure 8. R~sults are presented as the ~: average perGent change from the starting weight for the survivirlg mice. ~
Mice given:either 50 or 100 ug of recombinant SEB
l~st weight rapidly over 3-4 days, and all of the mice were dead by day 5. Mice gi~en mutant BR-35~ showed no effects and were indistinguishable from those given BSS
~ 30 alone.~ Mice given 50 ug of BR-2~7 were unaffected as : : well; however~ those given 100 ug of BR-257 showed a ;~ slight weight loss ~ followed by recovery.
~:~ These results confirm that in mice the majority of : the toxicity of~SEB is dependent on its ability to stimu~ake T:cells, suggesting ~hat T cell-derived lymphokines themselves or those produced by other cells activated by T ~cells are very important in the mode of :

~93/14b34 ~ 2 8 g l 5 PCT/US93/00839 action of this toxin. However, the small effect of BR-257 at the higher dose raises the possibility of a contribution from class II-bearing cells directly stimulated by bound SEB without T cell involvement.

Example 7. Protective Effect of SEB Mutants.
The protective effect of SEB mutants was tested.
In these experiments, mice received doses of saline solution or l00 ug BR-257 three months prior to a challenge with wild-type SEB. On the day of the challenge ~day "0"), the mice received 50 ug of SEB
intraperitoneal. Weight change and survi~al were measured. Results are shown in Figure 9.
All mice whi~h had received the control died 4-5 days after challengs with SEB, whereas there was a protectiYe effect shown in the mice which had been immunized with the SEB mutant.

; Example B. Production of SEA Mutants and Their Prote~tive Effects in Animals.
Staphylococcal enterotoxin A (SEA) mutants were produced according to the procedures described above;~
Superimposing the amino acid se~uence of SEA on that o f SEB, it has;been bound that a mut2tion at po~ition 45 inhibits SEA's ability to bind to MHC, in a similar manner to that observed with the position 45 SEB
mut~nt.
iSimilar studies were conducted with primates.
Monkeys received either wild~type SEB, or either of the 30~ ~ reion l SEB mutants BR-257 (mutated at F44) or BR-358 (mutated at N23), and the induction of an emetic response assessed. Both mutant SEB molecules were either ineffective or much less effective in inducing an emetic response in primates, than wild-type SEB.
These results confirm that the method of producing mutant superantigen described in this disclosure is applicable generally to all superantigens, and provides W093/146~ PC~IUS93/00~39 ~8 ~5 -36-a method of protecting patients from the pathological effect of superankigens.

,-~

2 ~L 2 8 ~ 1 ~ PCI/US~3J00839 ) 93/14634 _ j _........... ~c _ ._ ,~oo ool a'~ ~ ~ ~Dl O l ~ ~o-o ~ ~ . ~ I
~D U' I t~ - ~ In . ~ ,4 C~ C ..o I
o ~ ~2 i u~ ~ a) ~ ,, m ~ ~ a~ ~ ~ co I
o ~ , 1~ ~ l~t` I t~ ~ .~n O o ~ ~, , ln ~1 I

~ao ~ 1 a ~u ~

~ ~ . o~ ~ â~ . ~ ~ ~ _ X 0~
~ \~ r ~ _ ~ ~ ~ a ~ S~ O ~ ~ u~
~ r @ ~ ~v_~ o ~ ~ ¦ o c v ~ c r o ~: ~

~ ~ zloxlo' lo Ioo~l '1 1 lu.ol V~ ¦ ~ ~ ~ ~ ~ l i ~ .~ ~
~----- ~: ----~ ~u: ~ ~ ~ ~ :; ~ : ~o ~ oo ~ ~
: I ~, ~ : I ~ ~ ~, ~ ~
. I ~ . ~1 ~n ~
p~ : : l: ` ~: ~xo ~x'E~ 1~ :~

E-~ !~ J ~ = _ 5~ __ ___ ~= ~
:` ; ~ ' W093/146~ PCT/US93tO0839 TABLE II. REGION 1 SEB MUTANTS.
_ ~
Mutant Name Position Change(s) _ _ _ __ , BR-75 F17 Phe-Ser l . _ I
BR-210 514 Ser-Leu _ _ _. I
BR-257 10, N23 _Asp-Asn; Asn-Asp j BR~291 NZ3 Asn-5er BR-358 F44 Phe-Ser I _ _ _ BR-374 D48, 160 Asp-I
BR-30 Y91 Tyr~Cys I _ _ __ I
¦ BR-3~1 C93 Cys-Arg ¦ BR-474 _ 46, C93Tyr-Ser; Cys-Arg BR-267 F44, 54, 55Phe-Ser; Lys-Arg; Asp-Val ~ _--_ _ _ ____ TABLE III. REGION 1 AND 2 SEB MUTANTS GENERATED WITH
T~T OLIGONUCLE ~ _ _ _ :Mutant Name ¦ Posltion Change(s) ¦ _ BC-6 _ N23 _ Asn-Ile BC-66 N23 Asn-Tyr _ _ , . .
BC-88 N~3 Asn-Lys l __ _ ~ _ ~ I
: BA 3 F44 Phe-Cys l __ ~ _ _ _ _ I
: BA-15 ~ L45 _ ;_ Leu-Val _ : B~-24 41, 53 Ile-Arg; Gln Val l ~ ~ _ I
_ 31 _ :46, 52 _ Tyr-Leu; Ser-Phe BA~50 F44 Phe-Ser _ __ _ ~
: BA-53 F44,~_43_ _Phe-Leu: Ile-Arg BA-62 Y61, 189 Gln-Ser: Ile-Arg BA-72 ~45, N60 Leu-Tyr; Asn-Lys _ _ _ ~ .

rABLE IV. REGION 3 SE3 ~ ~
! Mutant Name Position Chang (s) : BB-14 ~ ~
: BB-21 N60 Gln-Asn _ BB-47 Y61 Tyr-Gln , ~

Claims (9)

-39-

1. A method for preventing the toxic effects of a superantigen by treatment with a molecule, wherein said molecule elicits antibody production without inducing T
cell activation.

2. The method of claim 1 wherein said molecule is a mutated superantigen.

3. The method of claim 1 wherein said molecule is a modified superantigen.

4. A molecule comprising a mutated superantigen.

5. A molecule comprising a modified superantigen.

6. A method of modifying T cell response elicited by an antigen comprising administering a molecule which interacts with specific V.beta. elements of T cell receptors (TCR).

7. The method of claim 6 wherein said molecule is a mutated superantigen.

8. The method of claim 6 wherein said molecule is a modified superantigen.

9. A method for treating the toxic effects of superantigen by treatment with a molecule, wherein said molecule elicits antibody production without inducing T
cell activation.