CA2126455A1 - Liver fluke vaccine and polypeptides useful for same - Google Patents

Abstract

ABSTRACT

Peptides obtainable from a species of Fasciola comprising the following sequence:

Description

J ? io?er~e~ J~ c pCt,l 21264~ j ~ V.~CCI~-E .-~ POLYPEPTIDES USEFUL FOR SA~

5 The present in-ention relates generally to a vaccine and more particularly to a vaccine useful in reducing spread of the liver fluke parasite and to polypeptides useful for sarne. The present invention also relates to a method of reducing spread of infection of liver fluke.

10 Bibliographic details of the publications referred to in this specification are collected at the end of the description. Sequence Identity Nurnbers (SEQ ID NOs.) for the nucleotide and amino acid sequences referred to in the specification and figures are defined following the bibliography.

15 Throughout this specification, unless the context requires otherw~se, the word "comprise", or variations such as "comprises" or "comprising", will be understood to imply the inclusion of a stated element or integer or group of elements or integers but not the exclusion of any other element or integer or group of elements or integers.
cDNA clones "ICEA" and "ICEB" referred to in Australian provisional application No. PL7109 filed on 5 February, 1993 and from which the present application cl~ims priority are re-n;~ned herein "Fhcatl" and "Fhcat2", respectively.

25 Helminths such as trematode parasites (flukes) are a major cause of economic loss in domestic animals as well as causing serious disease in humans (Haroun and Hillyer, 1986). The major trematodes of economic or public health importance areFasciola hepatica, Fasciola gigantica, Fasclola magn iz, Schis~osorna bovis, Schis~osorn~z matthel, Schis~osoma mansonl, Schistosoma haema~obium, Schisrosoma japonlcum, 30 Paramphistomum mlcrobothium, Gigantocotyle explan ,ztum, Dicrocoellum dendriticum, ~urytrema pancreaticum, Paragonimuswestermani, Clonorchissinensisand Opisthorchis viverrini (Spithill. 1992). Infection of hurnans by S. mansonl, S. haema~obium, S.

y~rJ~03 p \operie~h~ ~;ICpCL~ 2 1 2 6 ~ 5 ~

japo~Zicum~ C sinensis. O. ~ivemni, F. I~epatica, F. gigantica and P. westermani is common in developing countries. Sch~stosoma spp. infect over 200 million people and cause disease by depositing parasite eggs in the tissues of the host causing a granuloma~ous immune response (McManus et a1, 1993). The life cycles of all S trematodes involve the release of eggs from adult parasites. These eggs produce a miracidia that invades the intermediate host (mollusc) leading to the eventual release of forms infective to marnmalian hosts. Fascioliasis is caused by infection with the trematode parasite Fasc~ola hepa~ca This infection is of particular economic importance to industries involving ruminant animals such as sheep and cattle where 10 fascioliasis causes wasting, death and reduced wool and egg production (Haroun and Hillyer, 1986). A vaccine that reduced parasite egg production would lead to reduced transmission from one infected host to other hosts and, in the case of Schistosoma spp., reduce human disease. However, there are cu ently no defined vaccines for prevention of any fluke infection (Spithill, 1992; McManus et a~ 1993) 15 and, in particular, which target worm fecundity.

Until recently, methods of control relied heavily on the use of anthelmintic chemicals ~ith only limited success. In Australian Patent Application No. 50283/90, significant progress was made in the development of a liver fluke vaccine by describing a 20 vaccine comprising glutathione S-transferase (GST) derived from adult worms of E.
hepatica. Despite the effectiveness of this vaccine, it is important to continue the development of alternative liver fluke vaccines especially those which target different aspects of the worm's life cycle.

2~ In work leading up to the present invention, an investigation was conducted into the use of helminth cathepsin proteases and in particular trematode cathepsin proteases and even more particularly cathepsin proteses, derived from Fasciola species as potential vaccine candidates. It has now been surprisingly discovered that vaccines based on such proteases are effective in reducing worm viability and/or fecal egg 30 counts and, therefore, worm fecundity. The vaccine also results in reduced egg viability. The vaccine of the present invention, therefore, will reduce spread of liver fluke in grazing animals since fewer viable eggs will be shed by the animal thus ~O O ? oper li ~c pc~3 2 1 2 S l ~

- 3 -reducing contarnination of the pasture. The subject vaccine is also of considerable en~ironmental importance by reducing the need to spray infected pastures with potentially ha;~ardous chemicals. It has been further surprisingly discovered that the cathepsin proteases comprise one or more hydroxylated proline residues.
s Accordingly, one aspect of the present invention contemplates a peptide and in particular an isolated polypeptide comprising a sequence of amino acid residues wherein said sequence includes, in a contiguous seq~lence, amino acid residues:
Gln-Xaa-Xaa-Xaa-Xaal-Xaa-Cys-Trp-Xaa-Xaa-Xaa2 (SEQ II:) NO. 23) 10 wherein Xaa is any amino acid residue; Xaa~ is Gly or Glu; and Xaa2 is Ser, Thr, Ala or Gly; said polypeptide further characterised by its ability to induce an immune response in a host against a helminth. Preferably, the helminth is a trematode.
Preferably the trematode is a species of Fasciola such as but not limited to .F.hepa~ica, F. gigantica or F. magna The most preferred species is F. hepa~ica The15 Fasciola species may be in the mature state or in the newly excysted larval stage.

The present invention is particularly directed to a polypeptide capable of inducing an immune response in a host which results in reduced worm viability and/or fecal egg counts.
Generally, . the polypeptide is a cathepsin protease, cathepsin protease-like polypeptide or a polypeptide having cathepsin protease-like properties. A cathepsin protease or like polypeptide .is characterised inter al~a by an active site defined by conserved residues at three regions in the molecule. The cathepsin protease may be 25 in mature form or in a precursor form. The cathepsins consist of a family of sequences termed cathepsin B, H, L, S and G which vary in their degree of overall sequence identity.

Preferably, the host is a marnmal. Preferably, the mammal is a livestock animal such 30 as but not limited to ovine or bovine species. Most preferably, the immune response is a protective immune response against worm fecundity.

~J0~03 ~:\oper\ejhli~ c.pct,~ 2 1 2 6 ~ 5 ~

Accordingly, another aspect of the present invention contemplates a peptide or pol~peptide derived from or comprising a cathepsin protease isolatable from a Fasciola species and capable of stimulating antibody production in a suitable host against a cathepsin protease from Fasciola hepatica. Preferably, the antibody S response results in reduced worm viability and/or fecal egg counts.

The polypeptide of the present invention is conveniently a cathepsin protease isolatable from a species of Fasciola selected from F. hepa~ka, F. gigan~ica and F.
magna and most preferably F. hepa~ica or a part, fragment or derivative thereof or is a fusion molecule comprising a said cathepsin protease or a part, fragment orderivative thereof and which polypeptide is capable of stimuiating antibody production in a suitable host against a Fasciola species cathepsin protease. Such fusion molecules may comprise fusions of two or more of the same or different cathepsin proteases or parts, fragments or derivatives thereof, or fusions of one or more cathepsin proteases or parts, fragments or derivatives thereof ~vith another -protective molecule, such as, but not limited to, glutathione-S-transferase (GST) of F. hepatica. The polypeptide may be isolated from immature (e.g. newly excysted larval stage) or mature Fasciola species although the mature organism is the ~ ~ -preferred source. For convenience, reference hereinafter to "F. hepat~ca" should be considered to include all species of Fasc~bla (e.g. F. gigantica, F. magna). ~ ~
:' The terrn "polypeptide" is used in its broadest sense and for convenience includes peptides, polypeptides, proteins, glycoproteins and fusion molecules. The polypeptide is generally in isolated form or recombinant or synthetic form. When25 in isolated form, the polypeptide has undergone at least one purification or isolation step. Preferably, however, the isolated molecule is in a form suitable for use in a vaccine and/or represents at least 5%, preferably at least 20%, more preferably at least 35%, still more preferably at least 55-60%, even more preferably at least 75-80% or yet even more preferably at least 90-100% of a composition relative to other 30 components Ihe percentage content is conveniently measured by, for example, weight, activity, antibody reactivity or other like means.

1) 0~ p \op~\e;n ~ c pc s 21 2 6 ~ ~ ~

The present invention extends to non-naturally occurring (i.e. synthetic) derivatives of the subject polypeptides including derivatives which incorporate non-naturally occurring amino acid residues or chemical equivalent, homologues or analogues ofn.~turally occurring amino acid residues.
s Preferably, the polypeptide has at least one proline residue modified to a 3-hydroxy or 4-hydroxyproline. More preferably, the proline residue is 3-hydroxy proline.
Furthermore, where the polypeptide is a mature size cathepsin protease, it has a molecular weight determined following SDS-PAGE of about 25-30 kDa and more 10 preferably about 26-28 kDa. However, the molecular weight may vary depending on uhether the polypeptide is a precursor cathepsin pro~ease or a paIt, fragrnent or derivative thereof.

The peptide or polypeptide according to this aspect of the invention may be used 15 in~er alia as an active immunogen in a liver fluke vaccine. The cathepsin protease useful in the vaccine may be a single molecule (including a fusion molecule) or may comprise a mixture of cathepsin proteases. Where there is a mixture of proteases isolated from Fasciola species (eg F. hepatica, F. gigantica or F. magna), or isolated from other helminths (e.g. trematodes) preferably at least one of said proteases 20 contains a hydroxylated proline residue but more preferably about 10-20% and even more preferably about 20% of the cathepsin proteases carry at least one hydroxylated proline residue. Reference hereinafter to "Fasciola" species includes reference to helminths in general such as trematodes and which contain the novel proteases of the present invention. Where the vaccine comprises a single cathepsin 25 protease isolated from a Ea~Q~ species or a fusion molecu~e thereof, then preferably at least one and more preferably at least 10-20% of the proline residues are hydroxylated at the 3 or 4 position, or even more preferably at the 3 position.
Furthermore, the vaccine may comprise an immunogenic fragment of a cathepsin protease separately or a fusion molecule between two or more such immunogenic 30 fragments. In addition, such an immunogenic fragment or fusion molecule may be fused to another protective moleucle, such as GST.

? ;~r~ J l ~lc ~c ~ 2 1 2 ~

Alternatively, the cathepsin protease may be synthesised by recombinant means in~hich case there may or may not be hydroxyJation of proline residues. According to this embodiment, the vaccine comprises at least one recombinant cathepsin protease which may or may not carry a hydroxylated proline residue.
s The recombinant cathepsin protease may have an amino acid sequence substantiallyidentical to the naturally occurring sequence or may contain one or more amino acid substitutions, deletions and/or additions thereto provided that following such alterations to the sequence, the molecule is still capable of eliciting an immune 10 response against the naturally occurring cathepsin protease from a specie~ ofFasciola, such as F. hepatica, F. gigantica or F. magn~ Such an immune response preferably results in reduced worm viability and/or reduced egg counts. A similar immunogenic requirement is necessary for any fragments or derivatives of the cathepsin protease whether made from the recombinant molecule or the naturally 15 occurring molecule. Accordingly, reference herein to a "cathepsin protease" is considered reference to the naturally occurring molecule, its recombinant form and any mutants, derivatives, fragments, homologues or analogues thereof pro~ided that such molecules elicit an immune response against the naturally occurring molecule from a species of Fasciola such as F. hepatica. The term "cathepsin protease" also 20 extends to a fusion molecule between ~vo or more cathepsin proteases or with other similar molecules related by amino acid sequences, as well as to fusion molecules ~ith other protective molecules such as GST.

Most preferably, the polypeptide for a Fasciolavaccine has an amino acid sequence 25 substantially as set forth in SEQ ID NO. 2 (Figure 9A) or SEQ ID NO. 12 (Figure 9B) or SEQ ID NO. 24 (Figure 12) or an N-terminal sequence as set forth in SEQ
ID NO. 21 or SEQ ID NO. 22 or ha~,ing at least 40%, preferably at least $0%, more preferably at least 60%, still more preferably at least 70-80% and even still more preferably at least 90% similarity to the amino acid sequence or to a region or part 30 of the amino acid sequence provided the polypeptide can stimulate antibodies to a cathepsin protease from a species of Fasciola such as F. hepatka Preferably, theantibodies reduce worm viability and/or reduce fecal egg counts.

4~0~0~ p:~operiejhliv~u~ac.pc~7 2 ~ 2 ~
, Accordingly, another aspect of the present invention provides a polypeptide which:
(i) is a cathepsin protease or like molecule;
(ii) is isolatable from Facciol-a species; and (iii) comprises an amino acid sequence having at least 40% amino acid sequence S identity to all or part of the amino acid sequence set forth in SEQ ID NO. 2, SEQ ID NO. 12 or SEQ ID NO. 24.

In a related aspect, the polypeptide which:
(i) is a cathepsin protease or like molecule;
10 (ii) is isolatable from Fasciola species; and (iii) comprises an amino acid sequence having at least 40% arnino acid sequence identity to all or part of an N-terminal amino acid sequence as set forth in SEQ ID NO. 21 or SEQ ID NO. 22.

15 Preferably, the helminth is a trematode as hereinbefore described and is mostpreferably a species of Fasciola such as F. hepatica or F. gigan~ica.

In this context, a "part" is at least five and more preferably at least ten contiguous, arnino acid residues. Preferably, the Fasciola species is F. llepatica. Preferably, the 20 E~inla species is in its mature form although the present invention extends to cathepsin proteases from a newly excys~ed larval stage parasite.

Furthermore, the present invention extends to any related polypeptides having cathepsin protease-like properties such as those in the cathepsin farnily of proteases 25 from other animal or plant cells which are capable of eliciting the appropriate immune response against a naturally occurring cathepsin protease from Fasciola.
The present invention also extends to cDNA encoding the polypeptide of the present invention and preferably having a nucleotide seq~ ~nce as set forth in SEQ ID NO.
1 (Figure 9A) or SEQ ID NO. 11 (Figure 9B) or being substantially similar to all or 30 a part thereof. "Substantially similar" has the same meaning as above. A "part" in this context is a contiguous series of at least 15 nucleotides and more preferably at least 25 nucleotides.

03.p:\oper\ejh Li~Duvac.pc~ 8 21 2 6 ~ 5 5 According to ~his embodiment, there is provided a nucleic acid molecule comprising a sequence of nucleotides; nch:
(i) encodes a cathepsin protease;
(ii) is isolatable from a helminth species; and S (iii) hybridises under low stringency conditions to all or part of the nucleic acid sequence set forth in SEQ ID NO. 1 or 11 or to a complementary forrn thereof.

The helminth is preferably a trematode and more preferably a species of Fasciola10 such as but not limited to F. hepatica, F. gigan~ica or F. magna The nucleic acid molecule may be RNA or DNA, single stranded or double stranded,in linear or covalently closed circular form. For the purposes of defining the le~el of stringency, reference can conveniently be made to Sambrook e~ al (1989) at pp15 387-389 which is herein incorporated by reference where the washing step at paragraph f 1 is considered high stringency. A low stringency is defined herein as being in 0.1-0.5 w/v SDS at 37-45C for 2-3 hours. Depending on the source and ~;
concentration of nucleic acid involved in the hybridisation, alternative conditions of stringency may be employed such as medium stringent conditions which are 20 considered herein to be 0.25-0.5% w/v SDS at 2 45 C for 2-3 hours or high stringent conditions as disclosed by Sarnbrook et al (1989~.

Preferably, the Fasciol~ species is F. he~a~, Preferably, the Fasciola species is a mature organism although the present invention extends to Fasc~olaorganisms in the 25 newly excysted larval stage.

The present invention further extends to a composition of matter comprising recombinant and non-recombinant forms of the cathepsin proteases of the present invention including their fragrnents, derivatives and the like. - -01 \oper e r -i 2 ~ 2 ~Ille present invention is predicated, in part, on the discovery that vaccination of animals with a preparation of one or more cathepsin proteases leads to a reduction in fecal egg counts resulting in a sig~lificant decrease in worrn fecundity. There is

5 also a reduction in egg viability. This has the result of reducing pastoral contarnination and thereby reducing spread of infection of the parasite since less viable eggs are shed by the animal into the environment. The present invention extends to any animal capable of being infected by or carrying the parasite and is particularly directed to rurninant animals such as sheep and cattle.
According to this aspect of the present invention, there is contemplated a method for reducing spread of a helminth parasite, said method comprising administering to an animal susceptible to infection with said parasite an effective arnount of a polypeptide derived from or comprising a cathepsin protease isolatable from a 15 helminth for a time and under conditions sufficient for the animal to developantibodies to said cathepsin protease. Preferably, the helminth is a trematode and is more preferably a species of Fasciola such as F. hepa~ica, F. gigan ica or F. magn~L
The species of Fasciola is most preferably in the mature state.

20 The polypeptide is preferably a cathepsin protease as hereinbefore described and may or may not have at least one hydroxylated proline residue. The vaccine may be a mixture of purified or partially purified cathepsin proteases including a product extracted, excreted, secreted or otherwise released from the helminth. Such a product is termed herein to "regurgitate" from the parasitic worm. Although not 'S intending to limit the present invention to any one hypothesis as to mode of action, it is proposed herein that antibodies to the cathepsin protease result in reduction in fecal egg counts and, therefore, a reduction in worrn fecundity. There is also areduction in viability of excreted eggs.

30 The cathepsin protease(s) may be administered by any convenient route such as by oral, intravenous~ subcutaneous, intradermal, intrarnuscular, intraperitoneal, suppository or intranasal administration.

0~ ~ op~r~e ~ c.~c ~o 2 3 ~

The present invention, therefore, provides a vaccine composition comprising an immunogenic effective arnount of one or more cathepsin proteases as hereinbeforedescribed and one or more carriers and/or diluents acceptable for veterinary use.

S The active ingredien~ of the vaccine composition comprising one or more cathepsin proteases or active immunogenic fragments thereof are contemplated to exhibit excellent activity in stim u ating antibodies in the target animal when administered in an amount which depends on the particu ar case. The variation depends, for example, on the animal and the cathepsin protease. For example, from about 0.5 ug 10 to about 20 mg, preferably from about O.S ~g to about 10 mg and even more preferably from about 1 ,ug to about 1 rng of cathepsin protease or combined total of cathepsin proteases per animal per dose may be administered. Dosage regima may be adjusted to provide the optimum therapeutic response. For example, several divided doses may be administered daily, weekly, monthly or in other suitable tirne lS intervals or the dose may be proportionally reduced as indicated by the exigencies of the situation. The active compound may be administered in a convenient mannersuch as by the oral, intravenous (where water soluble), intramuscular, subcutaneous, intranasal, intradermal or suppository routes or implanting (eg using controlledrelease molecules). Depending on the route of administration, the active ingredients 20 which comprise one or more cathepsn. proteases may be required to be coated in a material to protect said ingredients from the action of enzyrnes, acids and other natural conditions which may inactivate said ingredients. For example, the low lipophilicity of the cathepsin protease will allow it to be destroyed in the gastrointestinal tract by enzymes capable of cleaving peptide bonds and in the 25 stomach by acid hydrolysis. In order to administer the vaccine by other than parenteral administration, the cathepsin protease will be coated by, or administered with, a material to prevent its inactivation. For example, the cathepsin protease may be administered in an adjuvant, co-administered with enzyme inhibitors or in liposomes. Adjuvant is used in its broadest sense and includes any immune 30 stimulating compound such as interferon or other cytokines. Adjuvants contemplated herein include resorcinols, non-ionic surfactants such as polyoxyethylene oleyl ether and n-hexadecyl polyethylene ether. Conveniently, the adjuvant is Freund's Cornplete 9~oJ p ;oper\e~n ~ c pc~l I 21 2 or Incomplete Adjuvant. Enzyme inhibitors include pancreatic trypsin inhibitor, diisopropylfluorophosphate (DEP) and trasylol. Liposomes include water-in-oil-in-water CGF emulsions as well as conventional liposomes.

5 The active compounds may also be administered in dispersions prepared in glycerol, liquid polyethylene glycols, and/or mixtures thereof and in oils. Under ordinaryconditions of storage and use, these preparatior~, contain a preservative to prevent the growth of microorganisms.

10 The pharmaceutical forms suitable for injectable use include sterile aqueous solutions (where water soluble) or dispersions and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersion. In all cases the form must be sterile and must be fluid to the extent that easy syringability exists.
It must be stable under the conditions of manufacture and storage and must be 15 preserved against the contaminating action of microorganisms such as bacteria and fungi. The carrier can be a solvent or dispersion medium containing, for example, water, ethanol, polyol (for exarnple, glycerol, propylene glycol, and liquid polyethylene glycol, and the like), suitable mixtures thereof, and vegetable oils. The proper fluidity can be maintained, for example, by the use of a coating such as 20 lecithin, by the maintenance of the required particle size in the case of dispersion and by the use of surfactants. The prevention of the action of microorganisms can be brought about by various antibacterial and antifungal agents, for exarnple, parabens, chlorobutanol, phenol, sorbic acid, thormerosal, and the like. In manycases, it will be preferable to include isotonic agents, for example, sugars or sodium 25 chloride. Prolonged absorption of the injectable compositions can be brought about by the use in the compositions of agents delaying absorption, for example.

Sterile injectable solutions are prepared by incorporating the active compounds in the required amount in the appropriate solvent with various of the other ingredients 30 enumerated above, as required, followed by filtered sterilization. Generally,dispersions are prepared by incorporating the various sterilized active ingredient(s) into a sterile vehicle which contains the basic dispersion mediurn and the required ~126~
~JU~o3 p:\oper:~h!~ c pct~!~

other ingredients from those enurnerated above. In the case of sterile powders for the preparation of sterile injectable solutions, the preferred methods of preparation are vacuum drying and the freeze-drying technique which yield a powder of the active ingredient plus any additional desired ingredient from previously sterile-5 filtered solution thereof.

When the cathcpsin protease or mixture thereof is suitably protected as described above, the vaccine may be orally administered, for example, with an inert diluent or with an assimilable edible carrier, or it may be enclosed in hard or soft shell gelatin 10 capsule, or it may be compressed into tablets, or it maybe incorporated directlywith the food of the diet. For oral therapeutic administration, the active compound may be incorporated with excipients and used in the forrn of ingestible tablets, buccal tablets, troches, capsules, elixirs, suspensions, syrups, wafers, and the like. Such compositions and preparations should contain at least 1% by weight of active 15 compound. The percentage of the compositions and preparations may, of course, be varied and may conveniently be ben,veen about 5 to about 80% of the weight of the unit. The amount of active compound in the vaccine compositions is such that a suitable dosage will be obtained. Preferred compositions or preparations according to the present invention are prepared,so that an oral dosage unit forrn contains20 bet veen about 0.5 ug and 20 mg of active compound.

The tablets, troches, pills, capsules and the like may also contain the following:
a binder such as gum gragacanth, acacia, corn starch or gelatin; excipients such as dicalciurn phosphate; a disintegrating agent such as corn starch, potato starch, alginic 2~ acid and the like; a lubricant such as magnesium stearate; and a sweetening agent such a sucrose, lactose or saccharin may be added or a flavoring agent such as peppermint, oil of wintergreen, or cherry flavouring. When the dosage unit forrn is a capsule, it may contain, in addition to materials of the above type, a liquid carrier.
Various other materials may be present as coatings or to otherwise modify the 30 physical form of the dosage unit. For instance, tablets, pills, or capsules may be coated with shellac, sugar or both. A syrup or elixir may contain the active compound, sucrose as a sweetening agent, methyl and propylparabens as `(J ? \oper\e~h!i~fl~lc?c~i~ 2 ~

preservatives, a dye and flavoring such as cherry or orange flavor. Of course, any material used in prep~ing any dosage unit forrn should be pharmaceutically pure and substantially non-toxic in the arnounts employed. In addition, the active compound m a~ be incorporated into sustained-release preparations and formulations.
5 Conveniently, the vaccine is administrable with the animal feed, such as grain. The vaccine composition may be incorporated into a grain base or may be topically applied to feed grain.

As used herein "carriers and/or diluents suitable for veterinary use" include any and 10 all solvents, dispersion media, aqueous solutions, coatings, antibacterial and antifungal agents, isotonic and absorption delaying agents, and the like. The use of such media and agents for pharrnaceutical active substances is well known in the art.
Except insofar as any conventional media or agent is incompatible with the active ingredient, use thereof in the vaccine compositions is contemplated. Supplementary 15 active ingredients can also be incorporated into the compositions. The latter is particularly contemplated as far as the present invention extends to multivalentvaccines or multi-component vaccines.

The vaccine composition of the present invention may comprise in addition to one20 or more cathepsin proteases, one or more other active compounds such as otherantigens obtainable from liver fluke or other parasites, immune enhancing agentsand/or medicaments for veterinary use. The vaccine composition may also contain mor~ ~an one variety or family of protease or may contain a partially purified E.
hepatica regurgitate. The vaccine may alternatively contain or may additionally 25 contain a fusion molecule between two or more cathepsin proteases or immunogenic fragments thereof, or between a cathepsin protease or an immunogenic fragment thereof and another protective molecule such as GST.

The cathepsin protease or antigenic fragment thereof m~y also be delivered by a live 30 delivery system such as using a bacterial expression system to express the cathepsin protease in bacteria which c~n be incorporated into gut flora. Alternatively, a viral expression system can be employed. The present invention extends to antibodies to er ~,n...~ C.;~ J
2126~5~

the cathepsin protease or antigenic fragrnents thereof. Antibodies may be monoclonal or polyclonal and are useful, for exarnple, in purifying cathepsin proteases or related molecules from Ea~Qla species such as from F. hep~a or E.
g~a s The present invention extends to a method of purifying a cathepsin protease or related molecule from a helminth, preferably a trematode and more preferably a Fasciola species e.g. F. hepatica or from another biological sarnple comprising applying a regurgitate of the helminth or apply~ng the biological sarnple to an affinity 10 column comprising a cathepsin protease reactive antibody or other suitable ligand.
The colurnn effluent can be further processed by, for exarnple, SDS-PAGE and/or ion exchange chromatography. Alternatively, a regurgitate or other biological sarnple is concentrated by ultrafiltration and subjected to molecular sieving and the material with the desired molecular weight removed.
Yet another aspect of the present invention contemplates a diagnostic assay for helminth infection of an animal said method comprising screening for antibodies to the cathepsin proteases as hereinbefore described. The assay may alternatively involve screening for cathepsin protease antigens using monoclonal or polyclonal20 antibodies. The most convenient forrn of test is an ELISA but the present invention extends to any suitable forrn of assay.

The present invention is further described by reference to the following non-limiting Figures and/or Examples.
ln the Figures:

Figure 1 is a photographic representation demonstrating cathepsin proteinase activity in adult F. h~patica A 50 fold concentrate of adult regurgitate (track a) and neat 30 adult regurgitate (track b) were resolved by SDS-PAGE and the proteins visualised by silver staining. Proteolytic activity of neat adult regurgitate was detected in gelatin SDS-PAGE gels on the addition of dithiothreitol (2mM DDT) in lane (d) but only J ~. e. ~ C. i~C I
2 ~ i 5 weakly ~ithout Drr (lane c).

~igure 2 shows molecular sieving of the regurgitate of adult F. hepatica worms, Appro.Yimately lmg of concentrated regurgitate was passed down a gel permeation 5 colurnn (Exarnple 1). Panel A: Chromatographic profile of the elution monitored at 280nm (1.0 AUFS). Peaks are numbered according to order of elution. The area of collection of one minute fractions of peaks S and 6 is indicated. Panel B: SDS-PAGE analysis (followed by silver staining) of the one minute fractions of peaks 5 and 6. 5% of each fraction was loaded in reducing sarnple buffer. Panel C: Western 10 blot analysis (using ovine F. hepa~icacathepsin proteinase antiserum) of the fractions, loading 1% of each fraction in reducing sample buffer.

Figure 3 shows anion eYchange chromatography of the cathepsin proteinases of theregurgitate of aduJt F. hf~ Material from peaks S and 6 from Figure 2 was 15 pooled, concentrated and applied by FPLC to a Mono Q colurnn in 20 mM
ethanolarnine (pH 9,0; Buffer A). The colurnn was eluted with buffer B (buffer A +
2M NaCI) delivered by a discontinuous gradient which was held at 5.5% and 13%
buffer B, Panel A: Chromatographic profile of the elution of proteins from the Mono Q colurnn. Elution was monitored at 280nm (1.0 AUFS) and 13 fractions were 20 collected as indicated. Panel B: SDS-PAGE analysis of fractions 1-13 followed by silver staining. Approximately 1% of each fraction was loaded in reducing samplebuffer. Panel C: Western blot analysis (using the ovine F. hepatica cathepsin proteinase antiserum) of fractions 1-13. Approximately 1% of each fraction was loaded in reducing sarnple buffer.

Figure 4 is a photographic representation of a gel analysis of Mono Q fractions of cathepsin proteinases under non-reducing conditions. Approximately 1% of fractions 2-5 from Fig 3A was loaded onto the gels and separated by non reducing SDS-PAGE. Proteins in the SDS-PAGE gel were detected by silver stain and the 30 cathepsin proteinases were detected by the ovine antiserurn in the Western blot.

~J~ .p:\oper\ejn.Li~ c ;~cl~;s 2 1 ~ 5 FiglLre S is a photographic representation of SDS-PAGE analysis of the purified cathepsin proteinases under non-reducing (NR) and reducing (R) conditions. An aliquot of lO~g of protein was loaded in each lane and visualised by silver stain.
s Figure 6 is a graphical representation Or ELISA analyses of antibodies to cathepsin proteinases of F. h~a during the course of the trial. Individual sera from bleeds at .~eeks -6 (first immunisation), -2 (boost), -1 (one week prior to challenge), and weeks 4 and 12 post-infection were measured by ELISA for anti-cathepsin proteinase 10 activity (see Example 1). Panel A follows the development of anti-cathepsin proteinase titres in the infected control sheep. A maximurn titre of 10,000 was achieved by one animal at week 12. Panel B monitors the development of anti-cathepsin proteinase titres in the immunised sheep over the 18 weeks of the trial.
A maximum titre of 225,000 was obtained by one anirnal at week 12.
~::
Figure 7 is a photographic representation showing tvo dimensional SDS-PAGE ;
analysis of purified excretory/secretory cathepsin proteases of adult F. h~a Isoelectric focussing in the first dimension was conducted over a pH range of 2.S-7.0 with 30~g purified proteases. Proteins were detected in the second dimension (15%
20 w/v SDS-PAGE) by silver stain. The lane (R) is a single dimensional reducing SDS-PAGE run of the cathepsin protease preparation.
:
Figure 8 is a graphical representation showing pH optirna of the excretory/secretory cathepsin proteases of adult F. h~ Total enzyme of 15 and 30ng was added 25 to 100mM Tris and 100mM phosphate buffers, respectively. The assay was performed over the pH range indicated using the lluorogenic substrate, Z-FR NMeC, as described in Example 2.

Figure 9A: Peptide alignrnent with the predicted arnino acid sequence and the 30 nucleotide sequence of Fhcatl. The nucleotide sequence of the Fhcatl (ICEA) cDNA is 1075 bases in length. The predicted amino acid sequence begins at methionine (nucleotide 25) and ends at phenylalanine (nucleotide 1002). The direct ~JU~O~ p:\oper\eJhl~uvac.pct 17 ~ 2'I 26~1~S' N-terrninal sequence (N-term) is also mapped to the Fhcatl primary sequence.
Peptides were deri~ed from chymotryptic (CT) and endo-Glu-C (GC) digests of purified F. hepa~ica excreted cathepsin proteases.

5 Figure 9B: Representation showing the nucleotide sequence and predicted amino acid sequence of another cathepsin protease (Fhcat2 [ICEB]) ~rom liver fJuke.

Figure 10: Alignrnent of the arnino acid sequences of the Fhcatl preproprotein, human preprocathepsin L (HIJMCATL: P07711), bromelain (P14518), hurnan 10 preprocathepsin H (HUMCATH: P09668),hurnan preprocathepsin B (HUMCATB:
P07858),and a S~tosomathiol cathepsin (SchistoB: N21309). (Genbank accession numbers are indicated within the brackets). Functionally conserved arnino acids are boxed to show the similarity among these sequences.

15 Figure 11: N-tenninal sequences of the excretory/secretory cathepsin proteinases of adu]t F. h~ Sequences were generated either by direct N-terminal amino acid sequencing or from peptides isolated from an endoGlu C digest of the same material (Material and Methods). Alignrnents were found to the N-tennini of bromelain (Ritonja e~ aL 1989) and papain (Drenth e~ al. 1971), several mammalian thiol 20 cathepsins (bovine cathepsin S (Wiederanders et al. 1991), mouse cathepsin B (Chan et al.1986), hwnan and mouse cathepsin L (Mason et al.1988; Joseph et a~ 1988) and to Trypanosoma cathepsin proteinases (Mottrarn et al.1989, Eakin et al.1992).

Figure 12: Amino acid sequence of the FhcatB1 sequence and alignrnen~with Hurnan25 Cathepsin B; Schistosoma manson~ Cathepsin B; Hurnan Cathepsin L; Fasc~da )u~ca Cat 1 & 2. Gaps in the Fhcat B1 sequence indicate sequences to be confirrned. Bolding indicates identical residues between the sequences.

O~ p: \ oper \ e jhli~c pcL I 8 ~ ~ 2 ~

EXA~IPLE 1 DEVELOPI~ ~ OF VACCINE
, .
5 1. ~Iaterials and l~,~ethods Pa~es~
Metacercari2 were maintained by passage through the interrnediate host snail LymnQea tomen~os~ The original isolate derived from an infected sheep in 10 Lancashire, U.K., (designated herein as "Compton 2") was purchased from Compton Paddock Laboratories (Surrey, U.K.) and is maintained by passage through the local snail host and Merino sheep as the mammalian host. -~

Gel a~szs:
15 Various preparations of regurgitate and its extracts were analysed in reducing conditions on 15% w/v SDS-PAGE (Laemmli, 1970) and the proteins visualised by silver stain (Morrissey, 1981).

Proteinase activity in adult regurgitate was visualised by gelatin gels (Dalton &
20 Heffernan, 1989). Briefly, gels were prepared as for norrnal SDS-PAGE (Laemmli, 1970) except for the co-polymerisation of gelatin (0.1% w/v) in the resolving gel.
Prior to electrophoresis, the gels and running buffer were cooled to 4C to reduce enzymatic activity during the run. Samples were mixed 1:1 with non-reducin~ SDS-PAGE sample buffer and loaded onto gels without denaturation. After 25 electrophoresis, the gels were incubated in two 30 minute changes of 0.1M sodium citrate (pH 4.5) containing 2.5% v/v Triton X-100, followed by a final incubation in 0.1M sodium citrate (pH 4.5) (containing 2rnM dithiothreitol (Dl-r) when appropriate) for 1 hour at 37 C. Gels were stained with 0.1% w/v Coomassie Blue(in 50% v/v methanol, 40% v/v acetic acid, 10% v/v distilled water) for 15 minutes 30 and then destained in 7% v/v acetic acid. -~ ~ ~ r~ v' ~

J ~ \ O pe r ~ c . pc ~ ` 9 -' 21~S~5 ~- 19 -Western blots were prepared as described (Burnette 1981), electrotransfers beingconducted in a Biorad Minitransblot Module over 90 minutes at l50V at 4C in precooled (-20C) transfer buffer. The blotted nitrocellulose filters (Scheicher and S Schuell, Dassel, West Gerrnany) were blocked in 5% Blotto-PBS/Tween for 1 hour.
After washes in PBS/Tween, antisera diluted in PBS/Tween were applied to filtersfor 18 hours (on a rocking platform) at 4C. Following further washes, species specific Ig horseradish peroxidase conjugates (Silenus, 1:400 in PBS/Tween) wereadded to the blots for 2 hours (RT), and the enzyme-immunocomplexes finally 10 visualised by reaction with 4-chloro-1-naphthol (Sexton et al., 1990). The ovine antisera to F. hepatica cathepsin proteinase was prepared as described below Therabbit anti-bromelain serum was obtained from the Yictorian Institute of Animal Science, Attwood, Victoria 3049, Australia.

15 Ant~en Pn~t~n F~ciola hepa~ica cathepsin proteinases were purified from the regurgitate of mature worms. Adult fluke harvested from the livers of sheep infected with the Compton 2 strain, were washed three times in warm (37C) PBS and were incubated for 2-4 hours in Basal Eagles mediurn (Flow Laboratories, Melbourne) supplemented with 20 10mM glutamine (Flow Laboratories) and buffered with 0.06% w/v NaHC03 (pH
7.5) at 37C in 5% v/v C02. The mediurn was then decanted and frozen (-20C) till required. On thawing, the regurgitate was clarified by centrifugation (10,OOOg, 30 minutes, 4 C), vacuum filtered on a 0.45l1 filter, and then Ultrafilterea to a 40-50 fold concentrate (Minitan Ultrafiltration System, Waters-Millipore, Bedford, MA)25 using a pre-equilibrated 10 kDa cut-off membrane (Minitan Plates: NMWL, Millipore, Bedford, MA) for 8 hours at 8psi. During ultrafiltration reservoirs were kept on ice. Typically, 21 batches were concentrated to 40-50rnl retentate. Due to batch to batch differences in protein concentration, more dilute retentates compared to other retentates were further concentrated by vacuum centrifugation (Savant 30 Instruments, Hicksville, NY).

~- .?~ J er e r~ c;l~ 2 1 2 6 ~ 5 5 .~olecular sieving was conducted on a precalibrated Superose 6 column (Pharmacia) by FPLC (Pharmacia). The column was pre-equilibrated by an overnight wash in 0.6M NaCI, 10mM Tris (pH6.0) and samples for separa~ion were dialyzed overnight S in this buffer. Aliquots (lmg) of the concentrated regurgitate were microcentrifuged and filtered before delivery on the column by FPLC at 0.4m1/min. Runs were conducted over 80 min using a 280nm detector to monitor elution. Material eluting under the 30kD peak was collected, pooled and in preparation for anion exchange was dialyzed against water (overnight, 4C) to reduce the salt content and then 10 concentrated 5-10 fold by vacuum centrifugation (Savant). This concentrate was further dialysed into 20mM ethanolamine (pH 9.0) overnight at 4C. A Mono Q
column (Pharmacia) was also pre-equilibrated overnight in the same buffer.
Subsequent to microcentrifugation and filtration, up to Sml of ~he dialysate wasloaded onto the anion exchange column. Elution of the protein components occurred 15 during a programmed run which allowed for a 5 minute isocratic step (in Buffer A:
20 mM ethanolamine (PH 9.0)) and then a programmed gradient which delivered salt onto the column at 14mmol/min from buffer B (Buffer A ~ 2M NaCI). At 5%
buffer B, the gradient was paused to allow elution of the first major peak, and then returned to normal program.
Material in the first peak eluted from the ion exchange runs was dialyzed against distilled water and concentrated 5 fold by vacuum centrifugation and then further dialysed. A radioiodinated tracer of this material was prepared by the Chloramine T method (Sonda and Schalamonit 1970). The radiolabelled tracer was mixed with 25 the dialysate to give a specific activity of 5-10 x 104 cpm/~ug protein. The mixture was denatured in non-reducing SDS-PAGE sample buffer and loaded onto preparative 15% w/v SDS-PAGE gels. On completion of the run, the~ gels were dissembled, wrapped in plastic, fluorogenic markers added, and exposed to X-ray film (XAR-5, Eastman-Kodak, Rochester, NY) for 30-60min at RT. Using the 30 markers as a guide, the 26 kD radioactive band was excised, fragrnented and boiled in 1% w/v SDS in 10mM Tris (pH 8.0) for 30 min. The suspension was diluted to 0.1% w/v SDS and then rotated overnight at RT. After allowing the contents to Y~ o3~:\oper`~ein~ uvac~pcl.2l 212 6 ~ ~ ~
_ . .

settle, the supernatant was removed, and the gel pieces washed in 0.1% w/v SDS in 10 mM Tris (pH 8.0). Gel pieces were then resuspended in the same buffer and eluted for a further 24 hours. This second eluant was pooled with the first eluant and then precipitated with 9 volurnes of acetone at -20OC. The pelleted precipitate S was resolubilised in 200~11 1% w/v SDS, 20 mM Tris (pH 8.0) and pooled w~th resolubilised precipitates from other gel runs. The pooled material was acetone precipitated. As all the contents from a batch of concentrated regurgitate was processed, all acetone precipitates were resolubilised in 1% w/v SDS, 10rnM Tris(pH 8.0) and then precipitated with volumes of ethanol. The pelleted precipitates 10 were resolubilised in 100% TCA and diluted to 10% v/v TCA on addition of water (4C) and left on ice for 1 hour. The TCA pellets were twice washed in acid-ethanol and then ethanol to remove the last traces of salt and SDS. Samples of this material were finally checked for purity and the protein content estimated on non-reducing SDS-PAGE gels which were silver stained.

Antisera to the cathepsin proteinase was produced by immunising 5 Merino wetherswith approximately 70~1g of apparently pure proteinase generated from adult regurgitate. For this preparation of antigen, the purification procedure was based 20 on that of Coles and Rubano (1988). Regurgitate (from 8-48 hour cultures of adult fluke) was clarified by centrifugation and chilled. Cold ethanol was added dropwise (2.2 ml/min) into mixing chilled regurgitate (300-400ml at 0-2C), until a finalethanol concentration of 60%v/v was achieved. .The solution was equilibrated at -20C for 18 hours and then pelleted at 6,300g (30min, 4C). The supernatant was 25 then taken up to a final concentration of 75% v/v ethanol, equilibrated overnight at -20C, and clarified (as above). The pellet was washed in 100% ethanol and resuspended in water. This material was examined by silver stained SDS-PAGE for a complex of bands at 28kD known to contain cathepsin proteinase activity (Colesand Rubano, 1988). If the preparation was deemed irnpure due to the presence of 30 other species, the material was subject to gel purification with the addition of a radiolabel trace of apparently pure material. These steps were perforrned similar to that described in the previous section. Ten such preparations were completed to ~~i ? ~op~r~Jn~ ac ?ct~_ 21 ~
-yield of appro~amately 500~g of material containing only the 28kD complex~

For primary immunisation approximately 2501~g protein was homogenised with Freund's Complete Adjuvant (FCA)(Commonwealth Serurn Laboratories, (CSL) 5 Melbourne, Australia) to be subcutaneously (s.c.) injected into five Merino wethers.
Approximately 30~g of 28kD protein was injected. A second imrnunisation with 401~g of the purified 28kD material in Incomplete FCA (CSL) occurred 4 weeks later. Sera from these animals were collected after a further 4 weeks and pooled in equal volumes to be used as a reagent to detect the presence of cathepsin proteinases.

Merino wethers (5 year old) were obtained from farms free of liver fluke in New South Wales (Australia). Individual animals were screened for F. hepatica eggs in their faeces and for low serological cross reactivity to a F. hepatrca extract as 15 analysed by ELISA (described below). Ten animals were immunised (s.c.) with 12011g purified cathepsin proteinase in water, mixed ~,vith an equal volume of FCA
(CSL) six weeks before infection (week -6). Four weeks later (week -2), this same group was boosted (s.c.) with 90~g of purified antigen mixed with Incomplete FCA(CSL). These animals and a further 10 unimmunised controls were challenged by 20 intraruminal delivery of 300 metacercariae in water two weeks after the boost (week 0). Animals were maintained on open paddocks which were free of liver fluke.
Blood samples were taken at weeks -6 (prebleed and immunisation), -2 (boost), -1, 0 (challenge), 4, and week 12. Animal health was monitored by assessment of parasite induced anaemia by estimation of red blood cell haemoglobin (van Karnpen 2S and Zijlstra, 1961) determined on a Cobas MIRA automatic analyser (Roche, Basel, Switzerland). Sera were collected and stored at -20C till analysed.

At 14 weeks post challenge, fecal samples were collected from all sheep which were then humanely slaughtered to obtain the livers and gall bladders. Worms were 30 collected from the liver tissues, bile ducts and gall bladders. The egg mass from the gall bladder were also collected. Fecal egg counts (FEC) were performed as described (Sexton, et al. 1990).

~J')'03,p:\oper\ejh.Liv~ac.pc~23 21 2 6 ~ S 5 5~
Animals were exarnined for prior exposure to F. hepa~ica or any other parasite that would elicit high levels of crossreactive antibodies by ELISA analysis of serum antibodies tO a ~hole Fasciola extract. In this assay, polyvinyl rnicrotitre plates 5 (Immuno-Maxisorp plates, Nunc, Denrnark) were coated overnight at 4C with a 1/2000 dilution of adult worm Iysate (Wijffels, et al., 1992) in coating buffer (O.lM
Na2CO3, pH 9.5). Sheep sera were initially diluted to 1:500 in Blotto-PBS/Tween (5% w/v skim milk powder, 0.05% v/v Tween 20 (Sigma) in PBS, pH 7.2) and titered out on the plate by serial 2-fold dilution. After an incubation of 1 hour at 10 37C, plates were washed in PBS/Tween and a Donkey anti-sheep Ig horse radishperoxidase conjugate (Silenus, Melbourne, Australia) diluted 1:2000 in Blotto-PBS/Tween was applied for 1 hour at 37C. Subsequent to a further wash and addition of substrate solution (lmM 2,2-azinobis(3-ethylbenathiazole sulphonic acid (ABTS), Sigrna) in 62mM citric acid/76 mM Na2HPO4, pH 4.0, supplemented with 15 0.03% v/v H2O2), colour development was measured at 414nm using and automatedTitertek Multiskan spectrophotometer (Flow Laboratories). Anirnals with high serum titres (3-5 fold above the mean) were rejected for use in the trial which usually equated to 10% of any sheep population with no history of exposure to F. hepatic~
Throughout the trial development of antibodies to F. hepat~cacathepsin proteinases was monitored by ELISA. Antigen from a very dilute solution (1:16,000 in coatingbuft^er) of adult regurgitate concentrate was adsorbed onto microtitre plates (Nunc) overnight (4 C). After a 1 hour blocking step (Blotto-PBS/Tween at RT), sera were 25 titered out from 1:1000 by 2-fold dilution (in PBS/Tween) and incubated overnight at 4 C. The anti-sheep Ig conjugate was applied for 4 hours at RT prior to readout with ABTS. Titres were determined by direct comparison to individual prebleeds which were similarly assayed over the same dilution range. Titres were deterrnined as the highest serum dilution with 0.1 absorbance unit above the sarne dilution of the 30 prebleed.

~J')'~)l p \operie~ ac.pc~'~ 21 2 6 ~ 5 5 Concentrated and ultrafiltered regurgitate was used as the antigen in preference to untreated regurgitate due to the detectable presence of host (sheep) immunoglobulin fragments in this latter material. Presumably, ultrafiltered regurgitate contained 5 reduced levels of these fragments. Furthermore, the use of purified cathepsin proteinase as antigen revealed no advantage in sensitivity or specificity over the regurgitate concentrate In this assay.

Egg Vlab~
10 The contents of the gall bladder were collected and stcred at 4C in Alfoil-covered glass containers until samples could be further processed. Eggs were separated from the bile contents by several washes in tap water. A final suspension in water was incubated (in the dark) at 27-29C for 14 days. The suspensions were then exposed to an incandescent light source for 20 minutes. To assess viability, 10 drops of 1%
15 w/v Lugol's iodine solution was added to a 25ml sample of the suspension, and the contents assessed under microscope for hatched miracidia and for viable eggs (i.e.
those with eye spots); eggs with no sign of differentiation were considered as not viable.

20 2. Preparation of a Cathepsin Protease Vaccine SDS-PAGE analysis of total adult liver fluke regurgitate followed by silver staining revealed a distinct complex of 2-3 bands at approximately 28-30 IcDa (Fig. 1, tracks 25 a and b). It was considered possible that this complex or a component of it was responsible for the proteolytic activity detected in the same preparation at a similar position in the gelatin gel (Fig. 1, tracks c). This gelatinolytic activity is greatly enhanced by addition of dithiothreitol which suggested the presence of a cathepsin proteinase (Fig 1, track d).

:~;
`?: ~r ~r"~ ;;x ~ 21 2b ~ ~

The putative cathepsin proteinases were purified from concentrated regurgitate using several chromatographic procedures. A fifty-fold ultrafiltration concentrate wasapplied to a gel permeation column in a high salt Tris buffer (pH 6.0) and partially 5 resolved into 5 major peaks (peaks 1-5) and a minor lase eluting peak (peak 6, Fig.
2A). Use of the high salt buffer and slightly acidic pH allowed best separation of peaks 5 and 6 from the earlier eluting peaks. Reducing SDS-PAGE analysis of one minute fractions of peaks 5 and 6 revealed the presence of a 28kD component in all fractions (Fig. 2B). Clearly frac~ions from peak 5 rather than peak 6 contained far 10 more of the 28kD species. Lower molecular weight species (~ 10-14 kD~ were also detected in the early fractions (1-5), some of which may represent contaminatingproteins from peak 4. Western blot analysis of the fractions from peak S and 6 using the ovine antiserum to cathepsin proteinase revealed an immunodominant species at 281cD in all fractions and the most intense staining coincided with fractions from 15 peak 5 (Fig. 2C, tracks 1-5). Lower molecu~ar weight species at 17kD, 15kD and 14kD were also detected by the antiserurn in most of the fractions although theywere less easily discerned in the later fractions, probably due to less material in these fractions. It was assumed that these species represented breakdown products of the cathepsin proteinases, and appeared to coincide with the lower molecular weight 20 species visualized in Fig. 2B.

As there was no apparent difference in the antibody reactive material under peaks 5 and 6 (Fig. 2) these fractions were pooled and, after appropriate dialysis andconcentration, were subjected to anion exchangé chromatography. Holding the salt25 gradient at 5.5% buffer B (lOmM NaCI in 50mM ethanolarnine (pH 9.0)) resultedin elution of a major group of proteins well separated from higher salt eluting components (Fig. 3A). SDS-PAGE analysis revealed that the first major cluster of5-7 peaks contained very little protein at the 28 kD region and the most intensestaining appeared at 14 and 1S kD region (Fig. 3B tracks 1-5). However, Western 30 blot analysis of these fractions detected components at 17,15 and 14 kD which were reactive to the cathepsin proteinase antiserum (Fig. 3C) and was consistent with the material collected from the gel permeation step (Fig. 2C). The lower molecular weight species appeared to represent the breakdown products of the cathepsin proteinases. However, the difference in staining intensity of the 28 kD species and other components between these two techniques seemed incongruous and warranted further investigation.
S .
When the material in fractions 2-5 of the major cluster of anion exchange peaks (Fig 3A) was resolved on non-reducing SDS-PAGE gels and visualized by silver staining, low molecular weight species at 14 and 15 kD were still detected although the 26-28 kD region was staining more intensely (Fig. 4 left panel). This result suggested the 10 presence of far more protein in the 28 kD region of the gel than had been indicated by the reducing SDS-PAGE analysis (Fig. 3B). However, when the non-reduced preparation was examined by Western blot the 14 and 15kD species were not found to be antibody reactive and only species at 26kD and larger were now detected with the antisera. It was apparent that a contaminating protein had co-eluted with the 15 cathepsin proteinases in both the molecular sieving and anion exchange procedures so that in reducing SDS-PAGE gels, the contaminant appeared to give rise to products that were obscured by fragments of the reduced and denatured cathepsin proteinases. The shift in migration of the major form of the cathepsin proteinases between reducing and non reducing SDS-PAGE gels suggests internal disulphide 20 bonds in which some forrns of the proteinases give rise to lower molecular weight products on reduction.

To ensure that the cathepsin proteases were purified, the major eluting peak from the ion exchange runs was dialysed, concentrated and separated by preparative SDS-25 PAGE in non-reducing conditions using a trace label.

Vaccir~on trial w~ purjfied cathepsul prr~tewuc ~f F. hepati~a.
Ten animals were immunised (over two injections 4 weeks apart) with a total of 2101~g of cathepsin proteinase purified from adult F. hepaticaregurgitate. A control 30 group of 10 sheep were not immunised. Two weeks later both groups were challenged with 300 metacercariae of F. hepaticadelivered by intraruminal injection.
Development of serum antibodies to fluke cathepsin proteinases was monitored by C~l~ O~ ?:\~per ~ n ~ ~ ~aC pC~ 2 1 2 6 4 5 5i .~ , - 27 - ;
ELISA. As seen in Fig. 6 (Panel A), all individuals in the infected control group generated low levels of antibodies to the cathepsin proteinases 12 weeks post infection. The specific antibody profile of the immunised animals appropriately detected the primary and secondary responses to immunisations (Fig. 6, Panel B).5 At four weeks post-challenge, nine out of ten individuals in the immunised group had increased antibody titres to the Fasciola cathepsin proteinases; half the group showed a marked increase. Late into infection, at week 8, these antibody levels were sustained or increased in 8 out of 10 animals.

10 Worm Fe~nd~
Table 1 summarises the worm burdens and final FEC of the trial animals. lhe control group returned worm burdens over the disperse range of 34-99 adult worms, causing an arithmetic mean of 69.6 and a large coefficient of variation (c.v.) of 33%.
The spread of worm burden data was even more severe for the imrnunised group, 15 yielding an average worm count of 79.3 adult fluke per sheep with a standard deviation of 42 (c.v. = 53%). Clearly, immunisation with the fluke cathepsin proteinases under the regime used does not reduce burdens after 14 weeks of infection with F. hepatica metacercariae. However, FEC were markedly affected inthe vaccinated group. Average fecal eggs/gram faeces excreted in this group (20620 + 86) were 70% reduced as compared to controls (700 + 377) and this difference was statistically significant (p c 0.05) using Tukey's multiple range test. As with the worrn burden data, coefficients of variation were large, 54% and 42% for the control group and the vaccinates respectively, but there was little overlap in the spread of the two groups.
When worm burdens and FEC are taken together to determine egg/grarn faeces per worm, the vaccinates show a 67% reduction in worrn fecundity. However, the largevariances of these incorporated parameters cause a correspondingly large c.v. in the worrn egg output figures, 68% and 56~o for controls and vaccinates, respectively.
30 Arithmetic means were 11.1 egg/g/worrn for controls compared to 3.10 egg/g/worm from the vaccinated group. This difference was significant (p~0.05) using Tukey's multiple range test.

`i-~ 3 ?: .o;~er` e,hliv~ cpc~
2126~5 Egg ~labd~y Eggs from the gall bladder were collected and assessed for viability (Table 2).
Comparisons made between the controls and vaccinates show that with an average egg ~ability in the vaccinates of 38% + 39%, there is a reduction of 56% in egg s viability from this group.

ANALYSIS OF CAl HEPS~ PROTEASES IN VAC~I~E OF EXA~LE 1 10 1. Materials and Methods Gel AnD~
Sodium dodecyl sulphate polyacrylamide gel electrophoresis (SDS-PAGE~ (Laemmli, 1970) analyses were carried out on 15% w/v gels which were silver stained 15 (Morrissey 1981). For two dimensional gel analysis, 30~1g of the purified cathepsin proteases was applied to an isoelectric focusing gel (O'Farrell, 1975) in the first dimension (incorporating Pharmacia ampholytes pH 2.S-5 and pH 5-7 mixed at a ratio of 1:2). SDS-PAGE was conducted in the second dimension using 15%
reducing conditions and the gel silver stained (Morrissey, 1981). Western blot 20 analysis using an ovine cathepsin protease antiserum was conducted as previously described in Exarnple 1. Whole auke Iysates were prepared as described Wijffels et al. (1992)-Pu~Dn ~f F. he~ c~sin pnXea~
25 The cathepsin proteases were essentially purified from adult liver auke regurgitateby the procedure described in Exarnple 1.

P}~n c~f Pep~ides ~ .
Peptides were generated from several digests of purified F. hepatica cathepsin 30 proteases. Several peptides were produced from a digest using endoproteinase-Glu-C (endo-Glu-C; Boehringer-Mannheim, Germany). Peptides GC3.1, 15.2, 20.2 and 21.2 were products of a digest of the cathepsin proteases purified as described above.

'-; - 'J3 p: ~!;)er .~,h~ ;.?c~ ~
2126~

Approximately 2011g of the cathepsin protease preparation was S-pyridylethylated and coprecipitated (in acetone) with 2C~o w/v endo-Glu-C. Digestion was perforrned at 370C for 9 hours in 100,ul of 0.1M NH4C03 (pH 8.0, C02). On completion of digestion the mLxture was dried down by vacuurn centrlrugation and resolubilised in 5 6M guanidium HCI (in lOmM Tris (pH 8.0)) and injected onto a C18 Nova-Pak reverse phase column (Waters-Millipore, Milford, MA). Peptides were resolved with a 5-60% acetonitrile (AcN) gradient (in 0.1% trifluoroacetic acid (TFA)) delivered by HPLC at 0.5 ml/min (Waters 625 LC System). Elution was monitored at 214nm and high absorbance peaks collected by a timed loop. The contents of selected 10 peaks were repurified on the same system using a 0-40% AcN (in 0.1% TFA) gradient.

To obtain larger peptides, a chymotryptic digest was performed on lOO~g of purified protein that had not been reduced and alkylated. Digestion was performed over 4 15 hours but otherwise was conducted as described Wijffels et al. (1992). Ensuing peptides were purified and refractionated on a C8 Nova-Pak (Millipore-Waters) reverse phase column using 5-60% AcN (in 0.1% TFA) gradient delivered by HPLC
at 0.5 ml/min. This digest yielded the chymotryptic peptides CT13.2 and CT11.3.

20 Two other chymotryptic peptides, CT21.2 and CT13.3 were obtained from a digest of the same preparation of cathepsin proteases described in Exarnple 1. The chymotryptic digest was performed as previously described (Wijffels et al. 1992).
Peptides were purified as for the endo-Glu-C digest.

25 Purified peptides were dried by vacuum centrifugation prior to N-terminal sequencing conducted by a Model 471A Protein Sequencer (Applied Biosystems Inc.
(ABI), Foster City, CA). PTH-arnino acids were resolved by a gradient of 5%
tetrahydrofuran (in 50.1 mM sodium acetate (pH 3.9)) and 100% AcN (ABI) delivered by HPLC at 1 ml/min onto a Spheri-5 isoPTH reverse phase column 30 (ABI).

?~ ope~ e,.~ ?.~l; ~c~ ~U
21~6~

Err~2~ Ass~
Solutions of purified cathepsin proteases were assessed for proteolytic activity by a fluorogenic assay based on that of BarTett (1980). Reactions proceeded in a lml s volume with final concentrations of 250,uM substrate,2mM DTT, lOOmM buffer and0.05% v/v Brij 35 with 15-SOng total purified enzyrne. The mixture was incubatedfor 25 minutes at 37 C, and immediately followed by addition of lml 0.1% v/v Brij 35 and fluorescence determined by a fluoresence spectrophotometer (Perkin Elmer Model MPF-3) set with emission and excitation wavelengths of 352 and 440nm 10 respectively. To deterrnine the inhibitory effect of various agents, the enzyme was preincubated with buffer, DTT and inhibitor for 10 minutes at RT prior to addition of substrate. Substrates (N-CBZ Phe-Arg 7-arnino-4-methyl coumarin (Z-FR NMeC) and N-CBZ arginine 7-amido-4-methyl coumarin (Z-R NMeC)) and inhibitory reagents (phenyl methyl sulphonyl fluoride (PMSF), iodoacetamide (L~A), leupeptin, 15 antipain, aprotinin, and E-64 (trans-epoxysuccinyl-L-leucylamido (4-guanidino) butane)) were all purchased from Sigma with the exception of EDTA which was obtained from BDH.

Imm~ ~f cDNA libmnes 20 A AZAP F. hepatica cDNA library was plated on a lawn of Eschenchia coliBB4 cells at a density of 50,000 plaque-forming units (pfu) per 150mm L-Broth agar plate.
Approximately S x 105 pfu were screened for expression of ICE of F. hepaticausing the Protoblot method as described in the Protoblot Technical Manual purchased from PROMEGA (Madison, USA). The libraries were screened with a pooled 25 sheep antiserum raised to the purified ICE of adult F. hepa~ica at a dilution of 1 /600. Filters were blocked in a buffer containing 10mM Tris HCl, pH8.0, 150mM
NaCl, 0.05% v/v Tween 20,1 ~o w/w gelatin. Positive plaques identified in a primary screen were picked, replated at a lower density and rescreened with the ovine antiserum until individual positive plaques ~- re identified.

'~JI~'O~,p:~oper~e,hl~ .~acpc~, 1i - 3~1 - ~i 5 l~olation and sequen~u~ qf cDNA ins~s Phagemid ONA containing cDNA inserts from positive AZAP phage clones was isolated by excision in vivo of the pBluescript phagemid under the conditions 5 recommended by Stratagene (La Jolla, USA). Phagemid DNA was extracted by the method of Birnboim and Doly (1979). DNA sequencing of cDNA inserts was performed by the chain termination method (Sanger et al, 1977) after the plasmidDNA was denatured by treatment with NaOH.

10 2. Analysis of Cathepsin proteases Hete~enei~ qf ca~epsin pn)tea~es qf F~epatica The heterogenous nature of the excreted/secreted cathepsin proteases of F. hepatica was initially observed in the gel permeation profiles. Under conditions of high salt 15 and slightly acidic pH, the majority of the cathepsin proteas ~ elute under one peak with a small proportion eluting slightly slower causing a second minor peak. Only fractions of the later half of the major cathepsin protease peak and the most of the minor peak were collected in an attempt to obtain cathepsin proteases free of other proteins. These fractions were analyzed by non-reducing SDS-PAGE and revealed 20 a dominant protein complex at 26 IcD in all fractions. Fraction 1 contained other low molecular weight species. When those fractions containing only the 26 kD
species were pooled and further characterized by Western blot and SDS-PAGE
under reducing and non-reducing conditions, heterogeneitywas apparent. Within the reduced preparation was a predominant couplet of 28kD and less intensely staining 25 species of 14, 15, 17 and 20 kD whereas the non-reduced material was relatively homogenous with a major complex at 26 kD.

Two dimensional SDS-PAGE analysis of the purified excretorytsecretory cathepsin proteases resolved into several components at 28 kD, with at least three closely30 migrating, dominant species and 4 minor species of higher pI (Fig 7). Lower molecular weight species (at 20 and 15 kD) were also detected but at the same plas the 3 most prominent components suggesting they are ei~her fragments o~ forms )'O~.p ~oper\ejn,~ ac pc~3~ 21 2 6 ~ 5 ~

of the cathepsin proteases which are disulphide linked oligomers or products of ~uto-proteolysis of the intact polypeptide.

En~na~ cha~a~s~n ~ F. h~ica CO~lh~5in p~teases 5 Of the two fluorogenic substrates (N-CBZ Arg NMeC and N-CBZ Phe Arg NMeC) ~ested for sensitivity to the proteolytic action of the purified proteases, only N CBZ
Phe Arg NMeC proved susceptible and was used in all further enzyrnatic characterisation. There was no detectable activity on N-CBZ Arg NMeC even at high concentrations of the enzyrne. In deterrnining the pH optirnum of the cathepsin 10 proteases, activity was highly influenced by the buffer ion used. A pH ma~m~n of 7.2 was achieved in 100 mM phosphate, and activity was detected over a broad pH
range (pH 6.5-9.0; Fig. 4). An average km of 46~1M was derived by a Michaelis-Menten plot for this group of cathepsin proteases (100mM phosphate, pH 7.45). Inthe Tris buffer, and using half the enzyme concentration, a pH maximum was not 15 determined, with activity increasing in alkaline conditions (Fig. 8).

The inhibition assays revealed that the cathepsin proteases were highly sensitive to very low concentrations of the classic inhibitors of this class of proteases (Table 3), although IAA was least effective with only 74% inhibition at a 100~M concentration.
20 PMSF had a very slight inhibitory effect, whereas aprotinin and EDTA caused no decrease in activity. DTT was found to be an absolute requirement for activity (Table 3).

25 An adult F. hepat~ca expression cDNA library was screened with the ovine anti-cathepsin protease serurn. High levels of reactivity was observed and after extensively absorbing the antisera with E. coli, approximately 0.1-1% of the library was still positive. Nine randomly selected positive clones were purified and their cDNA inserts were partially sequenced. They were all found to be identical in 30 sequence at their 3' end. The insert of the largest clone, Fhcatl was sequenced in both strands and on analysis revealed an open reading frame that extended fr-~nucleo~ides 2S to 1002 (Fig. 9A). The predicted open reading frarne encodes a .?:\o~er~ejhliv~u ~c pc~
~ 21264~

putative protein of 326 arnino acids in length which has homology to members of the thiol cathepsin f~rnily of cathepsin proteases (E.C. 3.4.22.-) (Fig. 10). The putative Fhcatl preproprotein has 44% homology to hurnan preprocathepsin L and 39%
homology ~ith preprocathepsin H. There was limited homology to hurnan S preprocathepsin B (23%) and cathepsin proteases from Schistosom~ (20%, Fig. 10) and Haemonchus(20%).
,.
The nucleotide and predicted amino acid sequences of another cDNA sequence located in the screen of the cDNA library, Fhcat2, is shown in Figure 9B. It is noted 10 that Fhcat2 has 87~o homology to Fhcatl.

By homology to the mamma .an thiol cathepsins, arnino acids 1-17 of the putativeFhcatl preproprotein encode the Pre region and arnino acids 18-107 encode the Pro region. The Pre and Pro regions are cleaved off to forrn a mature protease of 219 15 amino acids in length. Residues 126-136 of the predicted Fhcatl mature protein contains the thiol cathepsin consensus pattern Q-x(3)-[GE]-x-C-W-x(2)-[STAG] andsubsequently the best homologies to the thiol cathepsins are found on comparisonto the mature polypeptides, with S4% and 44% identity to cathepsins L and H (Fig.
10). Surprisingly, good homologies were obtained with various plant thiol cathepsins 20 (bromelain: 39% (Fig. 10), barley aleurain: 47%, actinidin: 42%, papain: 35%).

To ensure that the cloned cDNA was representative of the secreted/excreted cathepsin proteases of F. hepatica, purified peptides were generated from chryrnotryptic and endo-Glu-C digests of the purified cathepsin proteases. One 25 series of peptides (CT21.2, GC15.2 and CT13.3) overlapped with each other andtheir contiguous sequence ali~ns to positions 188-206 of the putative Fhcatl polypeptide (Fig. 9A). Peptide CT13.3 displayed one site of polymorphism at position 204 where both Tyr and Cys were detected. A second series of peptides (CT13.2 and CT11.3) were also contiguous when mapped to positions 277-291 of the30 predicted amino acid sequ~ ~ of the Fhcatl cDNA (Fig. 9A). CT11.3, in particular has a highly conserved region containing the Asn residue which makes up part of the catalytic triad of the thiol cathepsins (Fig. 9A and Musil et al.1991).
I

~U 03 ? ~Gper\e h li tl~ac pc~l~ 1 2 6 ~ ~ ~

Direct N-terminal sequencing of the purified cathepsin proteases revealed a single major sequence which was representative of N-termini of other members of the thiol cathepsin family (Fig. 11). Endo-Glu-C and chymotryptic digests also yielded S peptides (GC20.2, GC3.1) that could be aligned to the N-termini of thiol cathepsins (Fig, 11) and matched the predicted N-terminus of the Fhcatl polypeptide (Fig, 9A), However the peptide sequence and the direct N-terrninal sequence were n5 identical. In both cases the highly conserved proline close to the N-terminus was present, Similarly, the DWR motif conserved in the cathepsin L and H subfarnilies 10 was intact in the two putative F, hepa~ica N-terminal sequences, Beyond these conservations the sequences differ in several respects, The endo-Glu-C
peptide, (GC20.2), in agreement with the N-terminus of bromelain, has two residues prior to the conserved proline, This peptide terrninated with a Glu at position 9 but 15 it is likely to be contiguous with the peptide GC3,1 which aligns at this exact region with chicken cathepsin L (Fig, 11), This GC20,2 sequence has 78% identitywith the bromelain N-terminus but also has similar levels of homology with cathepsins L and H N-termini, However, the direct N-terminal sequence has only the one residue (valine) prior to the proline in pos;tion two, a feature shared with most thiol 20 cathepsins, This sequence then deviates from most of the thiol cathepsin N-terminal sequences after the DWR region resulting in a lower level of homology to bromelain (61~o) and the cathepsin L subfarnily, H~dules h the exardedl~ed c~hepsi/~ profezuta~5 ~F. hep~4 25 Arnino acid sequencing of peptides GC15.2 and GC20.2 yielded an unusual product at cycles 4 and 3 respectively in the absence of any other phenylthiohydantion amino acid derivatives (PTH-amino acid), Small amounts of an identically eluting product was also detected in N-terminal sequencing runs of the purified preparation~ of the Fasc~ola cathepsins, along with significant arnounts of PTH-proline, Since good 30 homologies of these sequences to regions in other thiol cathepsins (Fig, 10 and 11) suggested a proline would be predicted at these sites, the possibility of a modified proline within these peptides was investigated.

~.iJ'U3.p: ~O?er`~J~ '~aC.pC' ~5 2126~
- 3~ -The most simple modification of proline occurs in the collagen chains where proline is hydroxylated at either C3 or C4 generating 3-hydroxyproline (3-Hyp) or 4-hydroxyproline (4-Hyp) respectively. To determine if the unusual PTH amino acid deri-ed from the Fasciola cathepsin proteases were indeed hydroxylated prolines,both 3-Hyp-PTH and 4-Hyp-PTH derived from the CB6 peptides of the 1 and a3 chains of hurnan type III collagen were chromatographically compared. Partial hydroxylation of proline to 3-Hyp and 4-Hyp has been demonstrated in the a1 collagen chain CB6 peptide which has the sequence: G P/3-Hyp P/4-Hyp G L A G
P P P/4-Hyp. On Edman degradation of this peptide a small arnount of 3-Hyp-PTH
10 was detected at cycle 2 accompanied by large arnounts of PTH-proline, whereas the 2 major adducts of 4-Hyp-PTH are distinctive in cycles 3 and 9. Similarly, we detected partial but more significant modification of the proline to 3-Hyp in the second cycle of sequencin,~, the a3 CB6 peptide (G 3-Hyp/P R G A P G).

15 When the chromatograms of the collagen derived 3-Hyp-PTH are aligned with those of the unidentified Edman degradation product derived from the cathepsin protease peptides, co-elution was obvious. In both these purified Fasciola peptides, PTH-proline was also detected as a minor product, 16% and 12% of total proline. N-terminal sequencing of the purified Fasciola cathepsin proteases, however, indicated 20 that hydroxylation near the N-terminus was a minor event with only lZ and 21% of prolines found in the hydroxylated form in 2 different sequencing runs. These data assurned that both 3-Hyp and proline behave similarly on Edman degradation.
Significantly, no 4-Hyp-PTH was detected in any amino acid sequencing of the Fasc~ola products.

9J0~03.p:\oper\ejh,1ivflwac.pct,36 2 1 2 ~ ~ 5 ~

~ 1~--_ ; _ _ T _ ~ E

3 o ~, ~ 8 ~ ~ ~ ~ ~ o o~x~ o 8 ~1 _ _ ~ . ~ _ ~ J. ~I _ ~ __ E
~ ~ o o o x ~ 'ô ~ ~ ~ o~ , X q` ,7~
_ __ _ _ _ _ _ _ _._ __ . _ ~ c 3 ' o o 7 _ ~ _ ~ ~ ~ ~ O ~ ~ ._ E ~ 1 ~ ~ x 'r ~o r~ ~ 1~ ~ o ~ ' g ~ g _ g 1- 1- _ __ _ _ ~ ~ ~e 3 o~ ~o co ~ ~ oo ~i o 1~ ~ ~ ~.
_ ~ l _ _ _ _ _ _ _ . . . ~3 _ ~ ... ~ X ~ O ~ v. ~ R O 8 ~ æ

t c ~ ~t o~ ~ ~ I~ g~ ~; ~ ~ o ~ t~ y E

_ ~ _ _ _ _ _ _ _ _ ~e~
e E E _ _ _ _ R _ ~ _ ~0 _ 5 ~ ,~ ~ . 3 : ~

~ .

`~JO'03.p: \oper~ejh,Liv~ c ~ .17 2126~S'S

I ~ -.... --~ ~r :
Cbntml Immunized . _ . _ Animal Number %viable Anlmal numbcr %viable I ~. _ . _ . .

I . ~ , . _ _ 392 96 41S 94 _ ~:

I
41' 0 43S S4 420 4S6 g3 433 ~ 4S~ 2 . .. _ ._ - _ . ___ Averagc~ 86 Averagc 38 S.D. 7 S.D. 39 c.v. 8 c.v. 102 %~ducllon 56 geo. mean 86 goo. mean 16 %~duction 81 . . , ___ _ Table 2. Percent cgg viability of con~ls 2n~ cys~inc pto~ease vaccinates.
~Statistical dat~ onthe control g~up excludeis tho~e animals retuming eggs showing dolmancy (i.e. 090 viability).

03.p:~oper\ejh,!iv~ c.i~cL,38 2126~S

Table 3.
.. ., ___ _ Inhibitory Protease Cl~ss Specifiiciq concentation %inhibi~
Re3gent , (phl) PMSF all serine and some cysteine 100 4 , prolcæes _ _ .
E64 all cysteine protcæ~ O.S 9~0 Leupeptin most cysteine and tryp~n- I 93 . . __ lilce s~ine p~ea~ .
iodoacetamide cystienc proteascs 100 739 . 1. 25.0 Aprotinirl sennc p~le ISo~ IOOyg/ml OD
Antip~n trypsin-lil~e scrine and some I 909 cysdene protease~
. .
EDTA metalb ptotcases 1000 O
._ .
No Drr . O , , Inhibidon of F. h~ponca cystcine prote~e~ by known protea~e i~l~i~

Y~ W.p:\oper\ejhii~l~wac.pc~,39 21, S ~ ~ ~

EX~PLE 3 EFFICA~Y OF RECQ~fBI~NT VACCI~E

S The recombinant vaccine trial was performed as described on page 26 except that 120~g of protein was given per dose. Groups of ten sheep received either native denatured cathepsins (Group A), native active cathepsins (Group B), Fhcat2 (Group C), Fhcatl (Group D) and Fhcat1+2 (Group E). Group & received PBS alone whilst Group E were the uninfected controls.
1. Purification o~ Native active and Native denanlred cathepsin proteases rom Fasci~a h~a Adult flukes were isolated from experimentally infected sheep and washed in PBS
(3 x 10 minutes) and then were incubated in RPMI at 37 C for 2 hours. This extract was frozen at 20 C and when needed thawed at 4 C. The extract was centrifuged at 10,000 xg to remove eggs and particulate material before filtering on a 0.45 micron filter. A Minitan concentrator (Millipore) with a 10,000 Dalton molecularweight cutoff membrane was then used to reduce the volume of the filtrate from approximately 2 litres to approximately 100 mls. This solution was further concentrated and simultaneously dialysed against 50 mM Tris pH 7.5, lM NaCl (Buffer 1), to 1 ml using a microprodicon concentrator using a 10,000 Dalton 3 molecular weight cutoff membrane. Gel filtration chromatography was carried out using Buffer 1 and a Pharmacia FPLC with a Superose 12 column at a flow rate of 0.25 ml/minute and 1 ml fractions collected. These fractions were analysed usingSDS-PAGE and Western blotting on reducing and non-reducing gels, as well a zyrnogram analysis. Fractions that showed homogeneity by these criteria were used for preparing the antigen for vaccination. Antigen that was to be given to Group A
was incubated in 1% w/v SDS for 30 minutes and then acetone precipitated and resuspended in PBS.

~IA ; ~

*
J ', ;~: ~ o?er \ e,n..~
21264~
- ~o -2. Production of clones expressing recombinant Fhcatl and F~cat2 DNA encoding the mature cathepsin was amplified from Fhcatl and Fhcat2 containing pl.~smids using the following primers: ICEF 5' 5 ACAGCTCGAGGATCCGGCTGTACCCGACA 3' (SEQ ID NO. 19); ICER 5' CTCGAGGATCCTATCACGGAAATCGTGC 3' (SEQ ID NO. 20). The PCR
products were cut with Ba~Il and then ligated into the BamHl site of pET15b (Novagen, USA). The ligated plasmid DNA was transformed into the E. colistrain BL21 (DE3)pLysS. Following transformation the cells were plated on L Broth agar 10 plates containing ampicillin (20 I~g/ml) and chloramphenicol (25 ,ug/ml).
Recombinant clones were screened for their ability to express Fhcat by the follo~ving manner. Individual colonies were picked and used to inoculate one ml of L-Broth containing ampicillin (20 ~g/ml), chloramphenicol (25 l~g/ml) and 1 mM IPTG and grown at 37C for 3 hours after which the cells were collected by centrifugation.
15 The cell pellets were then resuspended in sample buffer (Laemmli,1970) and heated to 95 C for 5 minutes before being loaded onto 15% w/v polyacrylamide gels. After electrophoresis the gels were stained in Coomassie blue. Clones expressing an . , .
abundant protein of approximately 30 kDa were selected. Western blot~ing using asheep anti-cathepsin antisera confirmed that the selected clones expressed 20 recombinant Fhcat.

Purification of recombinant Fhcat protein Clones encoding the mature form of E:hcatl or 2 were grown overnight in 10 mls of L-broth containing ampicillin (20 I~g/ml) and chloramphenicol (25 ~g/ml). They 25 were then inoculated into 200 mls of L-Broth containing arnpicillin (20,ug/ml), ,chloramphenicol (25 ,ug/ml) and 1 mM IPTG and grown at 37 C for 3 hours. The cells were collected by centrifugation (10,000g for ten minutes) and then the cell pellets were resuspended in 50 mls of PBS, 0.1% v/v Triton X-100. Following a freeze/thaw the cells were Iysed and the insoluble material collected by 30 centrifugation (10,OOOg for ten minutes). The insoluble material was then resuspended in 10 mls of 8 M urea in 1x binding buffer and heated to 65 C for ten minutes. The insoluble material was removed by centrifugation and the supernatant ~-:)'l)'.~:\oper'e;r.u~ c.pc~l 2~26~
was kept. Recombinant protein was purified from the supernatant by chromatography using His. Bind. Resin as described by the manufacturer (Novagen,USA) using denaturing conditions containing 8M urea. The eluted material (approximately 10 mls) was dialysed against 2 changes of one litre of PBS at 4OC.
5 During dialysis the recombinant proteins precipitate out of solution. The dialysed solutions were then sonicated to form a fine suspension and the protein concentration was determined.

3. Results 10 Fecal egg count data were obtained in sheep at week 14 and 15 post infection. The egg counts are listed by group (10 sheep per group) with the mean + SD and percentage reduction and p value. The Groups in the trial were as follows:

GROUP VACCINE
A Native denatured adult cathepsin protease (ACP) B Native active ACP
C Fhcat 2 D Fhcat 1 E Fhcat 1 + 2 F Infected controls G Uninfected controls The data show that vaccination of sheep with the native active cathepsin proeeases induces a 67-75~a reduction in fecal egg counts ~FEC) at weeks 14-15 post infection.
25 This result is significant (p ~ .01). Vaccination with denatured cathepsin protease or Fhcat 2 also induces a significant reduction in FEC at week 14 (59%) (P~0.013).
Fhcat 2 also induces ~ significant 51% reduction in FEC at week 15 (p~ .036). Thus, vaccination with the recombinant Fhcat 2 protein mimics the efficacy of the native cathepsin protease from F.hepatica.

,p:\oper~h.li~uv3c,pc~
~ 21264~5 ~ , Week 14 VACCINE GROUP' , . , ~ -A ¦ B C D E ¦ F G
_ . ~ . _ Average 73.7 59.9 74.9 127.5 164.6 183.6 0 StDev 68.6 85.7 61.8 112.9 82.5 107.5 0 % reduction 59.8584 67.374759.20479 30.5556 10.3486 0 0 P = value0.0130.01 0.012 0.27 ND2 : -~ . ~ . .
I Fecal egg count data (eggs per gram of feces) ~ :
2 ND, not determined; P>0.05 TABLE 5 :
.., ....... , = . . ,, . .. ~ . .
Week 15 VACCINE GROUP' , , . - ~ : :~
A B C D E F G N
Average 114 52.2 103.9 200 213.7 216 ~ : - :;
StDev 124 59 66 150 98 146 0 . I ' ~:
20 % reduction 47.22 2 75.8333 51.898148 7.40741 1.0648 0 0 P = value 0 107 0.003 0.036 ND2 ND~ _. _ ' Fecal egg count data (eggs per gram of feces) 25 2 ND, not determined; P>0.05 Summary of fecal egg counts from the recombinant vaccine trial at weeks 14 and 15 post infection from animals vaccinated as shown on page 39.
:

k~

J ? '~?er~Jn...~ a;.pct~3 ~` 212645~

EX~IPLE 4 ~ -SE{2UE:NCE .~NALYSIS OF F. HEPATICA I~L CAT~PS~N PROIE~

5 Larval proteases were isolated and the N-terrninal sequence deterrnined and compared to cathepsin B of bovine, rat, mouse and human origin; cathepsin L
sequences of mouse and hurnan origin; Fhcatl and cathepsin L sequences in a peptide GC20.2 from F. hepatica; schistosome cathepsin B sequences; and the plant proteases bromelain and papain. The results are set forth below:
lLarval pro~ease #l L P E S F D A R Q
2Larval protease #2 V P A S F D A R Q
Bovine Cat BL P E S F D A R E 8 Rat Cat BL P E S F D A R E 8 15 Mouse Cat BL P E T F D A R E 7 Human Cat BL P A S F D A R E 7 Mouse Cat LI P K S V D W R E 4 Human Cat LA P R S V D W R E 4 Adult Fluke: :
20 N-Term 1V P E D I D W R G 4 Peptide GC20.2A V P D K I D W R E 3 FhcatlA V P D X I D W R E 3 Schistosoma mansoni CAT BE I P S N F D S R K 4 25 Schistosoma japonicum CAT BE I P S Q F D S R K 4 BromelainA V P Q S I D W R D 4 PapainI P E Y V D W R Q 5 1 SEQ ID N0. 21; 2 SEQ ID N0. 22 The nurnbers on the right indicate the nurnber of residues in each sequence that are identical with the sequence of larval protease # 1.

~ 9J0~0J.p \oper\ejh ~ wac.pct JJ 2 1 2 6 ~ ~ 5 EX~lPLE 5 CLONING OF CATHEPS~N B PROTEASE FROM LARVAL F.HEPATICA

S Larva of F.hepa~ica were excysted (Carmona et al.,1993) in vitro and total RNAextracted using Ultraspec as recommended by the manufacturer (Biotecx Laboratories, Houston, Texas). cDNA first strand synthesis was performed using M~
MLV reverse transcriptase primed with oligo dT (Sarnbrook et al.,1989).
Amplification of the cathepsin B cDNA was perforrned using an oligonucleotide 10 predicted from the N-terminal amino acid sequen~e shown in Example 4 (SEQ rD
NO. 21) and oligo dT. The amplified Cathepsin B cDNA was cloned using the pCR- ;
Script SK(+) Cloning Kit (Stratagene, La Jolla, USA). One clone (FhcatB1) was obtained. Plasmid DNA was isolated and DNA sequence determined as described on page 30 above. DNA translation and alignrnents of the predicted amino acid 15 sequence were carried out using Staden software and sequences from Genbank.

As shown in Figure 12, the FhcatB1 sequence predicts a polypeptide showing high similarity to the cathepsin B family of proteases. In particular, cathepsin B
sequences from human and S. rnansoni are similar to Fhcat B1. FhcatB1 sho vs a 20 lower degree of similarity to cathepsin L sequences from human and F. hepatica.

Those skilled in the art will appreciate that the invention described herein is susceptible to variations and modifications other than those specifically described.
It is to be understood that the invention includes all such variations and 25 modifications. The invention also includes all of the steps, features, compositions and compounds referred to or indicated in this specification, individually or collectively, and any and all combinations of any two or more of said steps or fea~ures.

:

1, , .

~JO ~ p:\operiejhZ~ pc~4s 2 1 2 6 ~ ~ ~
, R EFERENCES

BARRETT, A.J. 1980. Fluorimetric assays for cathepsin B and cathepsin H with methylcouryl~mide substrates. Biochemical Jo~rnal 187:909-912.

BIRNBOIM, H.C. A~ DOLY, J. 1979 Nucleic Acids Research, 7, 1513-1518.

BURNETTE, W.N. 1981. 'Western Blotting': electrophoretic transfer of proteins from sodium dodecyl sulphate-polyacrylarnide gels to unmodified nitrocellulose and radiographic detection with antibody and radioiodinated protein A. Analy~ical Biochemist~y 112:195-203 CARMONA, C., DOWD, A.J., SMITH, A.M. AND DALTON, J.P. 1993. Cathepsin L
proteinase secreted by Fasciola hepa~ica in vi~ro prevents antibody-mediated eosinophil attachment to newly excysted juveniles. Mol. Biochem. Parasi~ol. 62:9-18.

CHAN, S.-J., SEGUNDO, B.S., MCCORMICK, M.B. & STEINER, D.F. 1986. Nucleotide and predicted arnino acid sequences of cloned human and house preprocathepsin B
CDNAS. Proceedings of the National Academy of Science 83:7721-7725.

COLES, G.C. & RUBANO, D. 1988. Antigenicity of a proteolytic enzyme of Fasciola hepaticQ Journal of Helminthology 62:257-260.

DALTON, J.P. & HEFFERNAN, M. 1989. Thiol proteases released in vitro by Fasciolahepatica Molecular and Biochemical Parasitology 35:161-166.

DRENTH, J., JANSONIUS, J.N., KOEKSEK, R. & WOLTHERS, B.G. 1971. The structure of papain. Advances in Proetin Chemistry25:74-115 EAKIN, A.E., MILLS, A.A., HARTH, G., MCKERROW, J.H. & CRAIK, C.S. 1991. The sequence, organisation, and expression of the major protease (Cruzipain) from T~ypanosvma cru2i. JolArnal of Biological Chemist~y267:7411-7240.

CI~:.opc`r ~ i.u~c.;~ct~6 21 2 6 4 55 HAROUN, E.M. Ar~l~ HILLYER, G.V. 1986. Vet. Parasi~ol 20:63.

JOSEPH, L.J., CHA1~1G~ L.C., STA~ENKOVICH, D AND SUKHATME, V.P. 1988.
Complete nucleotide and deduced amino acid sequences of human and murine preprocathepsin L. J. Clin. Inves~. 81:1621-1629.

LAEMMLI7 U.K. 1970. Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature 227:680-685.

MASON, R.W., WALKER, J.E. & NORTHROP, F.D.1986. The N-terrninal arnino acid sequences of the heavy and light chains of human cathepsin. L. Relationship to acDNA clone for a major cathepsin proteinase from a mouse macrophage cell line.
Biochemical Journal 240:373-377.

MC MANUS, D., WAINE, G., WEN, Y., BECKER, M., KALDNNA, B., LIU, X., AND TIU, W. 1993. Towards a vaccine against Asian schistosomiasis. Today's Life ~cience.

MORRISSEY, J. H. 1981. Silver stain for proteins in polyacrylarnide gels: A modified procedure with enhanced uniform sensitivity. Analytical Biochemistry 117:307-310.

MOrrRAM, C.M., NORTH, M.J., BARRY, J.D. & COOMBS, G.H. 1989. A cathepsin proteinase CDNA from Trypanosoma brucei predicts an enzyme with an unusual C-terrninal extension. FEBS Letters 258:211-215.

MUSIL, D., ZUCIC, D., TURK, D., ENGH, R.A., MAYR, 1., HUBER, R., POPOVIC, T., TURES V., TOWATARI~ T., KATUNUMA, N. & BODE, W. 1991. The refined 2.15A X-ray crystal structure of human liver cathepsin G: the structural basis for its specificity. European Molecular Biology Organisation Journal 10:2321-2330.

O~FARRELL, P. H. 1975. High resolution two dimensional electrophoresis of proteins.
Journal Biological Chemis~ry250, 4007-4021. -~

~J~ .p:\oper\eJ~ p~
212~5 RITONJA, A., ROWAN, A.D., BUrTLE, D.J., RAWLINGS, N.D., TURK, V. & BARRETT, A.J. 1989. Stem bromelain: Arnino acid sequence and implications of weak bindingof cystatin. Federa~ion of European Biochemical Socie~ies Letters 247:419-424.

SAMBROOK, J., et al (1989) Molecular Cloning: A Laboratory Manui31, Cold Spring Harbor Laboratory, Cold Sprin Harbor, NY, USA.

SANGER, F., NICKLEN, S. AND COULSON, A.R. (1977) Proceedings of the Natior~al Academy of Science USA, 74, 5463-5469.

SEXTON, J.L., MILNER, A.R., PANACCIO, M., WLIFFELS, G., CHANDLER, D., THOMPSON, C., WILSON, L., SPITHILL, T.W., MITCHELL, G.F. & CAMPBELE, N.J.
1990. Glutathione S-transferase:Novel vaccine against Fasciola hepaticainfection in sheep. Jourr~l of Immunology 14S:3905-3910.

SONODA, S. & SCHALAMOWITZ, M. 1970. Studies of Il25 trace labelling of immunoglobulin G by Chlorarnine T. Immunochemistry Vol. 7: 885-898.

SPITHILL, T.W. 1992. Control of tissue parasites. 3. Trematodes in Animal parasite control utilizing biotechnology, ed. W.K. Yong, CRC press, Boca Raton.

; VAN KAMPE~, E.J. & ZIJLSTRA, W.G. 1961. Standardization of hemoglobinometry.
II The hemiglobincyanide method. Clinica Chimica Aaa 6:538 WIEDERANDERS, B., BROEMME, D., KIRSCHKE, H., KALKK~EN, N., RINNE, A., PAQUETTE, T. & TOOTHMAN, P. 1991. Primary structure of bovine cathepsin S.
Comparison to cathepsins L, H, B and papain. Federation of European Biochemical Societies Le~ters286:189-192.

WLIFFELS, G.L., SEXTON, J.L., SALVATORE, L., PE~TITT, J.M., HUMPHRIES, D.C., PANACCIO, M. & SPITHILL, T.W. 1992. Experirnental Parasitology74:87-99.

~:

.

~ r SEQUENCE LISTING

(1) GENERAL INFORMATION:
(i) APPLICANT: DARATECH PROPRIETARY LIMITED
INVENTORS: MILNER, PANACCIO, SPITHILL and WIJFFEL,S
(ii) TITLE OF INVENTION: A VACCINE AND POLYPEPTrDES USEFUL
FOR SAME
(iii) NUMBER OF SEQUENCES: 24 (iv) CORRESPONDENCE ADDRESS:
(A) ADDRESSEE: DAVIEC COLLISON CA~E
(B) STREET: 1 LITTLE COLLINS STREET
(C) CITY: MELBOURNE
(D) STATE: VICTORIA
(E) COUNTRY: AUSTRALL~
(F) ZIP: 3000 (v) COMPUTER READABLE FORM:
(A) MEDIUM TYPE: Floppy disk (B) COMPUTER: IBM PC compatible (C) OPERATING SYSTEM: PC-DOS/MS-DOS
(D) SOFTWARE: Pa~entIn Release #1.0, Version #1.25 (vi) CURRENT APPLICATION DATA:
(A) APPLICATION NUMBER: PCT - INTERNATIONAL
(B) FILING DATE: 04-FEB-. j94 (vii) PREVIOUS APPLICATION DATA:
(A) APPLICATION NUMBER: AU PL7109 (B) FILING DATE: 05-FEB-1993 (viii) ATTORNEY/AGENT INFORMATION:
(A) NAME: HUGHES, E JOHN L
(C) REFERENCE/DOCKET NUMBER: EJH/EK
(ix) TELECOMMUNICATION INFORMATION:
(A) TELEPHONE: (613) 254 2777 (B) TELEFAX: (613) 254 2770 ~ :

: ~.

()3 p:~openeih 1i ~h~c ~c~ ~ 2 1 2 6 ~ 5 ~
,~

(2) INFORMATION FOR SEQ ID NO:l:
( i ) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 1075 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear ( i i ) MOLECULE TYPE: DNA
( ix) FEATURE:
(A) NAME/KEY: CDS
(8) LOCATION: 25. .1002 (xi ) SEQUENCE DESCRIPTION: SEQ ID NO: 1:
AGMCGTCCG ATMTMTCC MM AT~ CGA TTG TTC ATA TTA GCC GTC CTC 51 Met Arg Leu Phe Ile Leu Ala Val Leu Thr Val Gly Val Leu G15y Ser Asn Asp Asp L2e0u Trp His Gln Trp L2ys5 Arg Met Tyr Asn L3y0 Glu Tyr Asn Gly A35a Asp Asp Gln His A4r0 Arg Asn Ile Trp Glu Lys Asn Val Lys His Ile Gln Glu His Asn Leu Arg His Asp Leu Gly Leu Val Thr Tyr Thr Leu Gly Leu Asn Gln Phe Thr Asp Met Thr Phe Glu Glu Phe Lys Ala Lys Tyr Leu Thr Glu Met Ser Arg Ala Ser Asp Ile Leu Ser His Gly Val Pro Tyr Glu Ala Asn Asn Arg Ala Val Pro Asp Lys Ile Asp Trp Arg Glu Ser Gly Tyr Val Thr Glu Val Lys Asp Gln Gly Asn Cys Gly Ser Cys Trp Ala Phe Ser Thr Thr Gly Thr Met Glu Gly Gln Tyr Met Lys Asn Glu Arg Thr Ser Ile Ser Phe Ser Glu Gln Gln Leu Val Asp Cys Ser Gly Pro Trp Gly Asn Asn Gly Cys Ser Gly Gly Leu Met Glu Asn Ala Tyr Gln Tyr Leu Lys ?er ~ ~ ;~U~ ac ;~ l 2 1 2 6 4 5 ~
,~
- so Cln Phe Gly Leu Glu Thr Glu Ser Ser Tyr Pro Tyr Thr Ala Val Glu Gly Gln Cys 2A0r5g Tyr Asn Lys Gln Leu Gly Val Ala l,ys Val Thr Gly Tyr Tyr Thr Val His Ser Gly Ser Glu Val Glu Leu Lys Asn Leu Val Gly Ala Arg Arg Pro Ala Ala Val Ala Val Asp Val Glu Ser Asp Phe Met Met Tyr Arg Ser Gly Ile Tyr Gln Ser Gln Thr Cys Ser Pro Leu Arg Val Asn His Ala Val Leu Ala Val Gly Tyr Gly Thr Gln Gly Gly Thr Asp Tyr Trp Ile Val Lys Asn Ser Trp Gly Thr Tyr Trp Gly Glu Arg Gly Tyr Ile Arg Met Ala Arg Asn Arg Gly Asn Met Cys Gly Ile Ala Ser Leu Ala Ser Leu Pro Met Val Ala Arg Phe Pro CTGTTATTAT GAAAACGCAC CAAACAATTA ATTTCATTCA GCTTTGCTTC AiAAAAAAAA 1072 (2) INFORMATION FOR SEQ ID NO:2:
(i) SEQUENCE CHARACTEhISTICS:
(A) LENGTH: 326 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID NO:2:
Met Arg Leu Phe Ile Leu Ala Val Leu Thr Val Gly Val Leu Gly Ser 1 5 10 15 .:
Asn Asp Asp L2e0u Trp His Gln Trp L2y5 Arg Met Tyr Asn L3y0 Glu Tyr Asn Gly Ala Asp Asp Gln His Arg Arg Asn Ile Trp G15u Lys Asn Val Lys His Ile Gln Glu His Asn Leu Arg His Asp Leu Gly Leu Val Thr Tyr Thr Leu Gly Leu Asn Gln Phe Thr Asp Met Thr Phe Glu Glu Phe ::

3 ? 0~.~ h~ c ?c~5, 2 1 2 6 4 5 ~

~ 5;-ys Ala Lys Tyr Leu Thr Glu Mec Ser Arg Ala Ser Asp Ile Leu Ser85 ~0 95 His Gly Val lP0r0 Tyr Glu Ala Asn Asn Arg Ala Val Pro Asp Lys Ile Asp Trp llrg5 Glu Ser Gly Tyr lV2a0 Thr Glu Val Lys lA25p Gln Gly Asn Cys Gly Ser Cys Trp Ala Phe Ser Thr Thr Gly lT4hr0 Met Glu Gly Gln Tyr Met Lys Asn Glu Arg Thr Ser Ile Ser Phe Ser Glu Gln Gln Leu Val Asp Cys Ser lG65y Pro Trp Gly Asn lA7sn Gly Cys Ser Gly lG15y Leu Met Glu Asn lA8a0 Tyr Gln Tyr Leu Lys Gln Phe Gly Leu Glu Thr Glu Ser Ser Tyr Pro Tyr Thr Ala Val Glu Gly Gln Cys Arg Tyr Asn Lys Gln 2Lle0u Gly Val Ala Lys 2Vla5 Thr Gly Tyr Tyr 2T2h0r Val His Ser Gly Ser Glu Val Glu Leu Lys Asn Leu Val Gly Ala Arg Arg Pro Ala Ala Val Ala Val Asp Val Glu Ser Asp Phe Met Met Tyr Arg Ser Gly Ile Tyr Gln Ser Gln Thr Cys Ser Pro Leu Arg Val Asn His Ala Val Leu Ala Val 2G15y Tyr Gly Thr Gln 2Gloy Gly Thr Asp Tyr 2Tr35p Ile Val Lys Asn Ser Trp Gly Thr Tyr Trp Gly Glu Arg Gly Tyr Ile Arg Met Ala Arg Asn Arg Gly Asn Met Cys Gly Ile Ala S31e5r Leu Ala Ser Leu P
Met Val Ala Arg Phe Pro 325 :-(2) INFORMATION FOR SEQ ID NO:3:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 13 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID NO:3:

Val Pro Glu Asp Ile Asp Trp Arg Gly Tyr Tyr Tyr Val ? ~ ~ ?e r ~ ~. J ~
2126~55 ,~

(2) INFORMATION FO~ SEQ ID NO:4:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 10 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear .:
(ii) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID NO:4:
Ala Val Pro Asp Lys Ile Asp Trp Arg Glu ,, .
(2) INFORMATION FOR SEQ ID NO:5:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 6 amino acids ; (B) TYPE: amino acid , (C) STRANDEDNESS: single ,j (D) TOPOLOGY: linear (ii) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID NO:5: ;
' Ser Gly Tyr Val Thr Glu :, (2) INFORMATION FOR SEQ ID NO:6: - :~
(i) SEQUENCE CHARACTERISTICS:
. (A) LENGTH: 8 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear ~! (ii) MOLECULE TYPE: protein ' (xi) SEQUENCE DESCRIPTION: SEQ ID NO:6:
i~ Gly Leu Glu Thr Glu Ser Ser Tyr , ~, ~'` ~

~- ' J_ p: ~;er ~ n l ~ ~c; 3 2 1 2 6 4~ 5 5 ~ .
~ 53 -(2) INFORMATION FO~ SEQ ID NO:7:
(i) S~QUENCE CHARACTERISTICS:
(A) LENGTH: 9 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID NO:7:
Ser Ser Tyr Pro Tyr Thr Ala Val Glu (2) INFORMATION FOR SEQ ID NO:8:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 9 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID NO:8:
Thr Ala Val Glu Gly Gln Cys Arg Tyr (2) INFORMATION FOR SEQ ID NO:9:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 9 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID NO:9.
Cly Thr Gln Gly Gly Thr Asp Tyr Trp ? ~-?~ .J
2126~

(2) INEORMATION FOR SEQ ID NO:l0:
( i ) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 6 arnino acids (B) TYPE: amino acld ( C ) S TRANDEDNES S: s i ng I e (3) TOPOLOGY: linear (ii) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID NO:10:
Ile Val Lys Asn Ser Trp (2) INFORMATION FOR SEQ ID NO:ll:
ti) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 1041 base pairs (B) TYPE: nucleic acid ( C ) S TRANDEDNES S: s i ng 1 e ~:
( D) TOPOLOGY: l inear ( i i ) MOLECULE TYPE: DNA
( ix) FEATURE: ~ .
( A ) NAME/KEY: CDS
(B) LOCATION: 8..985 (xi) SEQUENCE DESCRIPTION: SEQ ID NO:ll: :

Met Arg Leu Val Ile Leu Thr Leu Leu Ile Val Gly Val Phe Ala Ser Asn Asp Asp Leu Trp His Gln Trp Lys Arg Ile Tyr Asn Lys Glu Tyr Lys Gly Ala Asp Asp Asp His Arg Arg Asn Ile Trp Glu Gln Asn Val Lys His Ile Gln elu His Asn Leu Arg His Asp Leu Gly Leu Val Thr Tyr Ly, Leu Gly Leu Asn Gln Phe Thr Asp Met Thr Phe Glu Glu P8ho Lys Ala Lys Tyr Leu Thr Glu Met Pro Arg Ala Ser Glu Leu Leu Ser His Gly Ile Pro Tyr Lys Ala Asn Lys Arg Ala Val Pro Asp Arg Ile Asp Trp Arg Glu Ser Gly Tyr la20 Thr Glu Val Lys lAs2p5 Gln ~;

? ~r e,~ c~ ~ 21 2 6 4 ~ ~
,~
- ss -CGA GGC TGT GGT TCT rGT TGG GCT TTC TCA ACA ACA GGT GCT ATG GAA 433 Gly Gly Cys Gly Ser Cys Trp Ala Phe Ser Thr Thr Gly Ala Met Glu GLy Gln Tyr Met Lys Asn Glu Lys Thr Ser Ile Ser Phe Ser Glu Gln Gln lL6eOu Val Asp Cys Ser lG65y Pro Phe Gly Asn lT7yOr Gly Cys Asn Gly Gly Leu Met Glu Asn Ala Tyr Glu Tyr Leu Lys Arg Phe Gly Leu Glu Thr Glu Ser Ser Tyr Pro Tyr Arg Ala Val Glu Gly Gln Cys Arg Tyr Asn Glu Cln Leu Gly Val Ala Lys Val Thr Gly Tyr Tyr Thr Val His Ser Gly Asp Glu Val Glu Leu Gln Asn Leu Val Gly Cys Arg Arg Pro Ala Ala Val Ala Leu Asp Val Glu Ser Asp Phe Met Me~ Tyr Arg Ser Gly I le Tyr Gln Ser Gln Thr Cys Ser Pro Asp Arg Leu Asn His Gly Z Val Leu Ala Val Gly Tyr Gly Ile Gln Asp Gly Thr Asp Tyr Trp Ile ' GTG AAA AAC AGT TGG GGA ACG TGG TGG GGT GAG GAC GGT TAC ATT CGA 913 Val Lys Asn Ser Trp Gly Thr Trp Trp Gly Glu Asp Gly 3ToyO I le Arg Met Val Arg Lys Arg Gly Asn Met Cys Gly Ile Ala Ser Leu Ala Ser 305 310 3~5 Val Pro Met Val Ala Gln Phe Pro .~ :.

'~ :

. ~r.

'O~ ,o;~er\e `~ ..pc;56 212 6 4 ~ ~

r~

(2) INFORMATION FOR SEQ ID NO:12:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 326 amlno acids (B) TYPE: amino acid (D) TOPOLOGY: linear (il) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID NO:12:
Met Arg Leu Val Ile Leu Thr Leu Leu Ile Val Gly Val Phe Ala Ser Asn Asp Asp Leu Trp His Cln Trp Lys Arg Ile Tyr Asn Lys Glu Tyr Lys Gly A15a Asp Asp Asp His Arg Arg Asn Ile Trp Glu Gln Asn Val Lys His Ile Gln Glu His Asn Leu Arg His Asp L6e0u Gly Leu Val Thr Tyr Lys Leu Gly Leu Asn Gln Phe Thr Asp Met Thr Phe Glu Clu Phe Lys Ala Lys Tyr Leu Thr Glu Met Pro Arg Ala Ser Glu Leu Leu Ser His Gly Ile Pro Tyr Lys Ala Asn Lys Arg Ala Val Pro Asp Arg Ile Asp Trp lAlrg5 Glu Ser Gly Tyr lVa20 Thr Glu Val Lys lA2p5 Gln Gly Gly Cys Gly Ser Cys Trp Ala Phe Ser Thr Thr Gly Ala Met Glu Gly Gln Tyr Met Lys Asn Glu Lys Thr Ser Ile Ser Phe Ser Glu Gln Gln Leu Met Glu Asn Ala Tyr Glu Tyr Leu Lys Arg Phe Gly Leu Glu Thr Glu Ser Ser Tyr Pro Tyr Arg Ala Val Glu Gly Gln Cys Arg Tyr Asn Glu . 195 200 205 Gln Leu Gly Val Ala Lys Val Thr Gly Tyr Tyr Thr Val His Ser Gly Asp Glu Val Glu Leu Gln Asn Leu Val Gly Cys Arg Arg Pro Ala Ala Val Ala Leu Asp Val Glu Ser Asp Phe 2M5e0 Met Tyr Arg Ser 2G55y Ile Tyr Gln Ser Gln Thr Cys Ser Pro Asp Arg Leu Asn His Gly Val Leu Ala Val G275y Tyr Gly Ile Gln Asp Gly Thr Asp Tyr Trp Ile Val Lys Asn Ser Trp Gly Thr Trp Trp Gly Glu Asp Gly Tyr Ile Arg Met Val ? ~ C ;~Ct~5 2 1 2 6 ~ ~ ~
,~ .

Arg Lys Arg Gly Asn Met Cys Gly Ile Ala Ser Leu Ala Ser Val Pro Met Val Ala Gln Phe Pro (2) INFORMATION FOR S~Q ID NO:13:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 326 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: protein (xi) SEQVENCE DESCRIPTION: SEQ ID NO:13:
Met Arg Leu Phe Ile Leu Ala Val Leu Thr Val Gly Val Leu Gly Ser Asn Asp Asp Leu Trp His Gln Trp Lys Arg Met Tyr Asn L3y0s Glu Tyr Asn Gly 3A5a Asp Asp Gln His Arg Arg Asn Ile Trp Glu Lys Asn Val Lys His Ile Gln Glu His Asn Leu Pro His Asp Leu Gly Leu Val Thr Tyr Thr Leu Gly Leu Asn Gln Phe Thr Asp Met Thr Phe Glu Glu Phe ~ ~
65 70 75 80 : ~::
Lys Ala Lys Tyr Leu Thr Glu Met Ser Arg Ala Ser Asp Ile Leu Ser His Gly Val Pro Tyr Glu Ala Asn Asn Arg Ala Val Pro Asp Lys Ile : :

Asp Trp lAlrg Clu Ser Gly Tyr lVa20 Thr Glu Val Lys 1525P Gln Gly Asn Cys Gly Ser Cys Trp Ala Phe Ser Thr Thr Gly Thr Met Glu Gly Gln 1 130 ~ 135 140 ! Tyr Met Lys Asn Clu Arg Thr Ser Ile Ser Phe Ser Glu Gln Gln Leu Val Asp Cys Ser Gly Pro Trp Gly Asn Asn Gly Cys Ser Gly Gly Leu :
, 165 170 175 :~
I Met Glu Asn Ala Tyr Gln Tyr Leu Lys Gln Phe Gly Leu Glu Thr Glu ~: ::

~ Ser Ser Tyr Pro Tyr Thr Ala Val Glu Gly Gln Cys AOrg Tyr Asn Lys ¦ Gln Lleu0 Gly Val Ala Lys V21a5 Thr Gly Tyr Tyr T2ho Val His Ser Gly '~ ~

' ; ~ ~ a ~ ` v~ ' c rJe ! ~ e~ 3c ~c~ `R 2 1 2 6 ~
,~
- s~3 -22e5r Glu Val Clu Leu Lys Asn Leu Val Gly Ala Arg Arg Pro Ala Ala Val Ala Val Asp Val Glu Ser Asp Phe Met Met Tyr Arg Ser Gly Ile Tyr G!n Ser Cln Thr Cys Ser Pro Leu Arg Val Asn His Ala Val Leu Ala Val Gly Tyr Gly Thr Gln Gly Gly Thr Asp Tyr T28rp5 Ile Val Lys Asn SeO Trp Gly Thr Tyr 2Tgrp5 Gly Glu Arg Gly 3Toy0 Ile Arg Met Ala Arg Asn Arg Gly Asn Met Cys Gly Ile Ala Ser Leu Ala Ser Leu Pro Met Val Ala Arg Phe Pro (2) INFORMATION FOR SEQ ID NO:14:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 333 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID NO:14:
Met Asn Pro Thr Leu Ile Leu Ala Ala Phe Cys Leu Gly Ile Ala Ser Ala Thr Leu Thr Phe Asp His Ser Leu Glu Ala Gln Trp Thr Lys Trp Lys Ala Met His Asn Arg Leu Tyr Gly Met Asn Glu Glu Gly Trp Arg Arg Ala Val Trp Glu Lys Asn Met Lys Mee Ile Glu Leu His Asn Gln Glu Tyr Arg Glu Gly Lys His Ser Phe Thr Met Ala Met ~sn Ala Phe Gly Asp Met Thr Ser Glu Glu Phe Arg Gln Val Met Asn Cly Phe Gln Asn Arg Lys Pro Arg Lys Gly Lys Val Phe Gln Glu Pro Leu Phe Tyr Glu Ala lPlr5o Arg Ser Val Asp Trp Arg Glu Lys Gly Tyr Val Thr Pro Val Lys Asn Gln Gly Gln Cys Gly Ser Cys Trp Ala Phe Ser Ala Thr Gly Ala Leu Glu Gly Gln Met Phe Arg Lys Thr Gly Arg Leu Ile Ser , 212645~
~ru'''~ per~.e,h.li~ c.pC~5~

~9 Leu Ser Glu Gln lA6n5 Leu Val Asp Cys SeOr Cly Pro Gln Gly Asn Glu Cly Cys Asn G8y Gly Leu Met Asp lT8y5r Ala Phe Gln Tyr 190 Gln Asp Asn Giy Gly Leu Asp Ser Glu Glu Ser Tyr Pro Tyr 2G15u Ala Thr Glu Glu S10 Cys Lys Tyr Asn 2Plr5o Lys Tyr Ser Val Alo Asn Asp Thr Cly Phe Val Asp Ile Pro Lys Gln Glu Lys Ala Leu Me~ Lys Ala Val Ala Thr Val Gly Pro Ile Ser Val Ala Ile Asp Ala Gly His Glu Ser Phe : :

Leu Phe Tyr Lys Glu Gly Ile Tyr Phe Glu Pro Asp Cys Ser Ser Glu Asp Met 2s75P His Gly Val Leu 2V80 Val Gly Tyr Gly 2Ph8e Glu Ser Thr Glu 29r0 Asp Asn Asn Lys 2Tgy5r Trp Leu Val Lys Asn Ser Trp Gly Glu G305u Trp Gly Met Gly 3Gloy Tyr Val Lys Met Ala Lys Asp Arg Arg Asn His Cys Gly Ile Ala Ser Ala Ala Ser Tyr Pro Thr Val 325 330 ::: :

(2) INFORMATION FOR SEQ ID NO:15:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 212 amino acids ~ . -(B~ TYPE: amino acid (C) STRANDEDNESS: single ~ :
(D) TOPOLOGY: linear (ii) MOLECULE TYPE: protein ~ :-(xi) SEQUENCE DESCRIPTION: SEQ ID NO:15:
Ala Val Pro Gln Ser Ile Asp Trp Arg Asp Tyr Gly Ala Val Thr Ser Val Lys Asn Gln Asn Pro Cys Gly Ala Cys Trp Ala Phe Ala Ala Ile :

Ala Thr Val Glu Ser Ile Tyr Lys Ile Lys Lys Gly Ile Leu Glu Pro :

Leu Ser Glu Gln Gln Val Leu Asp Cys Ala Lys Gly Tyr Gly Cys Lys Gly Gly Trp Glu Phe Arg Ala Phe Glu Phe Ile Ile Ser Asn Lys Gly Val Ala Ser Gly Ala Ile Tyr Pro Tyr Lys Ala Ala Lys Gly Thr Cys ~ ~
85 90 9S :~ :
Lys Thr Asp Gly Val Pro Asn Ser Ala Tyr Ile Thr Gly Tyr Ala Arg Ge ~ c ~c;~ ~ 2 1 2 6 4 5 5 , Val Pro Arg Asn Asn CLu Ser Ser Mec Mec Tyr Ala Vai Ser Lys Cln Pro Ile Thr Val Ala Val Asp Ala Asn Ala Asn Phe Gln Tyr Tyr Lys S145r Gly Val Phe Asn lGloy Pro Cys Cly Thr lS5e5r Leu Asn His Ala Val Thr Ala Ile Cly lT6y5r Gly Gln Asp Ser Ile Ile Tyr Pro Lys Lys Trp Gly Ala Lys lT3po Cly Glu Ala Cly Tyr Ile Arg Mec Ala Arg Asp Val Ser Ser Ser Ser Gly Ile Cys Gly Ile Ala Ile Asp Pro Leu Tyr Pro Thr Leu Glu Glu . 210 (2) INFORMATION FOR SEQ ID NO:16: .
(i) SEQUENCE CHARACTERISTICS:
.~ (A) LENGTH: 335 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID NO:16:
Met Trp Ala Thr Leu Pro Leu Leu Cys Ala Gly Ala Trp Leu Leu Gly .1 Val Pro Val Cys Gly Ala Ala Glu Leu Ser Val Asn Ser Leu Glu Lys i Phe His Phe Lys Ser Trp Met Ser Lys His Arg Lys Thr Tyr Ser Thr ,l 35 40 45 Glu Glu Tyr His His Arg Leu Gln Thr Phe Ala Ser Asn Trp Arg Lys ~ 50 ~ 55 . 60 ;~ Ile Asn Ala His Asn Asn Gly Asn His Thr Phe Lys Met Ala Leu Asn Gln Phe Ser Asp Met Ser Phe Ala Glu Ile Lys His Lys Tyr L5eu Trp Ser Glu Pro Gln Asn Cys Ser Ala Thr Lys Ser Asn Tyr Leu Arg Gly Thr Gly lPlro5 Tyr Pro Pro Ser lVa20 Asp Trp Arg Lys lL2ys5 Gly Asn Phe Val Ser Pro Val Lys Asn Gln Gly Ala Cys Gly Ser Cys Trp Thr Phe ~, 130 135 140 i, .
.
~.~

~-: ?.,~ : 2 1 2 6 ~ 5 5 -Ser Thr Thr Gly Ala Leu Glu Ser Ala Ile Ala Ile Ala Thr Gly Lys Met Leu Ser Leu Ala Glu Gln Gln Leu Val Asp Cys Ala Gln Asp Phe ~
165 170 175 :~ ::
Asn Asn Tyr Gly Cys Gln Gly Gly Leu Pro Ser Gln Ala Phe Glu Tyr Ile Leu lTyr Asn Lys Gly Ile Met Gly Glu Asp Thr Tyr Pro Tyr Gln :
Gly Lys Asp Gly Tyr Cys Lys Phe Gln Pro Gly Lys Ala Ile Gly Phe 210 21S 220 ::
Val Lys Asp Val Ala Asn Ile Thr Ile Tyr Asp Glu Glu Ala Met Val Glu Ala Val Ala Leu Tyr Asn Pro Val Ser Phe Ala Phe Glu Val Thr Gln Asp Phe Met Met Tyr Arg Thr Gly Ile Tyr Ser Ser Thr Ser Cys 260 265 270 : :
His Lys Thr Pro Asp Lys Val Asn His Ala Val Leu Ala Val Gly Tyr Gly Glu Lys Asn Gly Ile Pro Tyr Trp Ile Val Lys Asn Ser Trp Gly 290 295 300 :.
Pro Gln Trp Gly Met Asn Gly Tyr Phe Leu Ile Glu Arg Gly Lys Asn Met Cys Gly Leu Ala Ala Cys Ala Ser Tyr Pro Ile Pro Leu Val ~:
325 330 335 :

(2) INFORMATION FOR SEQ ID NO:17:
(i) SEQUENCE CHARACTERISTICS: ~
(A) LENGTH: 339 amino acids ~ ~-(B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID NO:17:
Met Trp Gln Leu Trp Ala Ser Leu Cys Cys Leu Leu Val Leu Ala Asn Ala Arg Ser Arg Pro Ser Phe His Pro Val Ser Asp Glu Leu Val Asn Tyr Val 3A5n Lys Arg Asn Thr 4T0hr Trp Gln Ala Gly 4H5s Asn Phe Tyr Asn Val Asp Met Ser Tyr Leu Lys Arg Leu Cys Gly Thr Phe Leu Gly Gly Pro Lys Pro Pro Gln Arg Val Met Phe Thr Glu Asp Leu Lys Leu Pro Ala Ser Phe Asp Ala Arg Glu Gln Trp Pro Gln Cys Pro Thr Ile per ~ ?~' ~ ' 2 1 2 6 4 5 5 .

Lys Glu I le lAoo Asp Gln Gly Ser Cys Gly Ser Cys Trp Ala Phe Cly 1~5 120 125 Val ier Val Glu Val Ser Ala Glu Asp Leu Leu Thr Cys Cys Gly Ser 14e5 Cys Gly Asp Gly lC5ysO Asn Gly Cly Tyr lP5r5o Ala GlU Ala Trp Asn Phe Trp Thr Arg lL6y5 Gly Leu Val Ser Gly Gly Leu Tyr Glu Ser His Val Gly Cys lAargO Pra Tyr Ser Ile Pro Pro Cys Glu His His Val Asn Gly Ser Arg Pro Pro Cys Thr Gly Glu Gly Asp Thr 2Po5o Lys Cys Ser Lys I le Cys Glu Pro Gly Tyr Ser Pro Thr Tyr Lys Gln Asp Lys His Tyr Gly Tyr Asn Ser Tyr Ser Val Ser Asn Ser Glu Lys Asp Ile Met Ala Glu I le Tyr Lys Asn Gly Pro Val Glu Gly Ala Phe Ser Val Tyr Ser Asp Phe Leu Leu Tyr Lys Ser Gly Val Tyr Gln His Val Thr Gly Asn Gly Thr Pro Tyr Trp Leu Val Ala Asn Ser Trp Asn Thr Asp Trp G305y Asp Asn Gly Phe Phe Lys Ile Leu Arg Gly Gln Asp His Cys Gly I le Glu Ser Glu Val Val Ala Gly I le Pro Arg Thr Asp Gln Tyr Trp Glu Lys I le 2 1 2 ~ 4 ~ 5 (2) I'~IFORMATION FOR SEQ ID NO:18:
( i ) SEQUE~iCE CHARACTERISTICS:
(A) LENGTH: 340 amino acids (B) TYPE: amino acid ( C ) STRANDEDNES S: s i ng 1 e (D) TOPOLOGY: linear (ii) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID NO:18:
Met Leu Thr Ser Ile Leu Cys Ile Ala Ser Leu Ile Thr Phe Leu Glu Ala His Ile Ser Val Lys Asn Glu Lys Phe Glu Pro Leu Ser Asp Asp Ile Ile Ser Tyr Ile Asn Glu His Pro Asn Ala Gly Trp Arg Ala Glu Lys S5e0r Asn Arg Phe His Ser Leu Asp Asp Ala Arg Ile Gln Met Gly Ala Arg Arg Glu Glu Pro Asp Leu Arg Arg Lys Arg Arg Pro Thr Val Asp His Asn Asp Trp Asn Val Glu Ile Pro Ser Asn Phe Asp Ser Arg Lys Lys Trp Pro Gly Cys Lys Ser I le Ala Thr I le Arg Asp Gln Ser Arg Cys Gly Ser Cys Trp Ser Phe Gly Ala Val Glu Ala Met Ser Asp Arg Ser Cys Ile Gln Ser Gly Gly Lys Gln Asn Val Glu Leu Ser Ala Val Asp Leu Leu Thr Cys Cys Glu Ser Cys Gly Leu Gly Cys Glu Gly Gly Ile Leu Gly lPr65o Ala Trp Asp Tyr lT7rO Val Lys Glu Gly 117e Val Thr Ala Ser Ser Lys Glu Asn His Thr Gly Cys Glu Pro Tyr Pro Phe 180 185 l9G
Pro Lys Cys Glu His His Thr Lys Gly Lys Tyr Pro 2P0r5o Cys Gly Ser Lys I le Tyr Asn Thr Pro Arg Cys Lys Gln Thr Cys Gln Arg Lys Tyr Lys Thr Pro Tyr Thr Gln Asp Lys His Arg Gly Lys Ser Ser Tyr Asn j 225 230 235 240 Val Lys Asn Asp Glu Lys Ala Ile Gln Lys Glu Ile Met Lys Tyr Gly Pro Val Glu Ala Ser Phe Thr Val Tyr Glu Asp Phe Leu Asn Tyr Lys Ser Gly Ile Tyr Lys His Ile Thr Gly Glu Ala Leu 2G35y Gly His Ala ~:' 't~lp:\oper\ejht~ c.D;:n!
~ 212~
~ .~
~ 6~ -Ile Arg Ile Ile Cly Trp Gly Val Glu Asn Lys Thr Pro Tyr Trp Leu 305e Ala Asn Ser Trp 3Als0n Clu Asp Trp Cly Glu Asn Gly Tyr Phe Arg Ile Val Arg Gly Arg Asp Glu Cys Ser Ile Glu Ser Glu Val Ile Ala Gly Arg I le Asn (2) INFORMATION FOR SEQ ID NO:19:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 29 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:l9:

(2) INFORMATION FOR SEQ ID NO:20:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 28 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:20:

- `~ ?e e ~c?c~ 2~ 264~5 ,~

(') INFOR.~ATION FOR SEQ ID NO:21:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 9 amino acids (B) TYPE: amino acid (C) STR.~NDEDNESS: slngle (D) TOPOLOGY: linear (ii) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID NO:21:
Leu Pro Glu Ser Phe Asp Ala Arg Gln (2) INFORMATION FOR SEQ ID NO:22:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 9 amino acids j (B) TYPE: amino acid ,j (C) STRANDEDNESS: single (D) TOPOLOCY: linear (ii) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID NO:22:
'l Val Pro Ala Ser Phe Asp Ala Arg Gln ¦ (2) INFORMATION FOR SEQ ID NO:23:
;¦ (i) SEQUENCE CHARACTERISTICS:
:~ (A) LENGTH: 11 amino acids , (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: pepeide (xi) SEQUENCE DESCRIPTION: SEQ ID NO:23:
Gln Xaa Xaa Xaa Xaa Xaa Cys Trp Xaa Xaa Xaa s~
~- J I 1 ~ 03er e h ~ ~3c ?c~66 2 1 2 6 4 5 ~5 (2) INFORMATION FOR SEQ ID NO:24:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 235 amino acids (B) TYPE: amino acio (C) STRANDEDNESS: single (D) TOPOLOCY: linear (ii) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID NO:24:
Arg Ser Gln Trp Pro Cln Cys Trp 1or Ile Ser Glu Ile Arg Asp Gln ALa Ser Cys Gly Ser Cys Trp Ala Ala Gly Gly Thr Ser Ala Met Ser Asp Arg 3Val Cys Ile His Ser Asn Gly Gln Met Arg Pro Arg Leu Pro ..a Ala Asp Pro Leu Ser Cys Cys Xaa Xaa Xaa Cys Gly Gln Gly Cys 6Ar6 Val Gly Tyr His Arg Ala Xaa Trp Asp Tyr Trp Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Pro Thr lPlrO Pro Cys Xaa Xaa Xaa Xaa Xaa Xaa Xaa Glu Glu Ala Cys Gln lT2h5r Gly Tyr As Lys lT3hOr Tyr Glu Glu Asp lL3ys Phe Tyr Gly Asn lS4r0 Ser Tyr Asn Val Gly Asn Thr Glu Ser Xaa Xaa Xaa Xaa Ile Met Gln Glu Ile Lys lA60n Gly Pro Val Glu Val Thr Phe Ala Xaa Ile Phe Gln Asp Phe Gly Val Tyr Arg Ser lG30y Ile Tyr His His Val Ala Xaa Gly Lys Phe Ile Gly Arg His lA95a Val Arg Me~ Ile Gly Trp Gly Val Glu Asn Gly Val Asn Tyr 2Tlr0 Leu Met Ala Asn Sler Trp Asn Glu Glu 2Tr2pO Gly Glu Asn Gly 2T2y5r Phe Arg Met Val 2A3rOg Gly Arg Asn Glu 2T3hr

Claims (52)

CLAIMS:

1. An isolated polypeptide comprising a sequence of amino acid residues wherein said sequence includes, in a contiguous sequence, amino acid residues:

wherein Xaa is any amino acid residue; Xaa1 is Gly or Glu; and Xaa2 is Ser, Thr, Ala or Gly; said polypeptide further characterised by its ability to inducean immune response in a host against a helminth.

2. An isolated polypeptide according to claim 1 wherein said polypeptide is a cathepsin protease.

3. An isolated polypeptide according to claim 1 or 2 wherein said helminth is a trematode.

4. An isolated polypeptide according to claim 3 wherein said trematode is a species of Fasciola.

5. An isolated polypeptide according to claim 4 wherein the trematode is Fasciola hepatica.

6. An isolated polypeptide according to claim 4 or 5 wherein said polypeptide is derived from said species of Fasciola.

7. An isolated polypeptide according to claim 6 wherein said polypeptide is derived from a Fasciola species in the mature state.

8. An isolated polypeptide according to claim 6 wherein said polypeptide is derived from a Fasciola in the newly excysted larval stage.

9. An isolated polypeptide according to claim 1 wherein said host is a mammal.

10. An isolated polypeptide according to claim 9 wherein said mammal is a livestock animal.

11. An isolated polypeptide according to claim 10 wherein said livestock animal is an ovine or bovine species.

12. An isolated polypeptide according to claim 1 or 11 wherein the immune response is a protective immune response.

13. An isolated polypeptide according to claim 12 wherein said immune response is a humoral immune response.

14. An isolated polypeptide according to claim 2 wherein said polypeptide comprises an amino acid sequence substantially as set forth in SEQ ID NO.
2.

15. An isolated polypeptide according to claim 2 wherein said polypeptide comprises an amino acid sequence substantially as set forth in SEQ ID NO.
12.

16. An isolated polypeptide according to claim 2 wherein said polypeptide comprises an N-terminal sequence substantially as set forth in SEQ ID NO.
21 and 22.

17. An isolated polypeptide according to claim 1 or 14 or 15 or 16 in recombinant form.

18. An antigenic fragment, part, derivative or analogue of a polypeptide according to claim 1 or 14 or 15 or 16.

19. A polypeptide which:
(i) is a cathepsin protease or like molecule;
(ii) comprises a sequence of amino acids which includes the contiguous amino acid sequence (iii) is isolatable from a helminth; and (iv) comprises an amino acid sequence having at least 50% amino acid sequence identity to all or part of the amino acid sequence substantially as set forth in SEQ ID NO. 2 or SEQ ID NO. 12 or SEQ
ID NO. 24.

20. An isolated polypeptide according to claim 19 wherein the helminth is a trematode.

21. An isolated polypeptide according to claim 20 wherein the trematode is a species of Fasciola.

22. An isolated polypeptide according to claim 20 wherein the trematode is Fasciola hepatica.

23. An isolated polypeptide according to claim 20 wherein the trematode is Fasciola gigantica.

24. An isolated polypeptide according to claim 22 wherein the Fasciola species is in the mature state.

25. An isolated polypeptide according to claim 22 wherein said polypeptide is derived from a Fasciola in the newly excysted larval stage.

26. An isolated polypeptide according to claim 19 further characterised by being capable of inducing an immune response in a host.

27. An isolated polypeptide according to claim 26 wherein the host is a mammal.

28. An isolated polypeptide according to claim 27 wherein the mammal is a livestock animal.

29. An isolated polypeptide according to claim 28 wherein the livestock animal is an ovine or bovine species.

30. An isolated polypeptide according to claim 29 wherein the immune response is a protective immune response against helminth infection.

31. An isolated or recombinant polypeptide having an amino acid sequence substantially as set forth in SEQ ID NO. 2.

32. An isolated or recombinant polypeptide having an amino acid sequence substantially as set forth in SEQ ID NO. 12 or SEQ ID NO. 24.

33. An isolated or recombinant polypeptide having an N-terminal amino acid sequence substantially as set forth in SEQ ID NO. 21 or SEQ ID NO. 22.

34. A nucleic acid molecule comprising a sequence of nucleotides which:
(i) encodes a cathepsin protease;
(ii) is isolatable from a helminth species; and (iii) hybridises under low stringency conditions to all or part of the nucleic acid sequence set forth in SEQ ID NO. 1 or 11 or to a complementary form thereof.

35. A nucleic acid molecule according to claim 34 wherein the helminth is a trematode.

36. A nucleic acid molecule according to claim 35 wherein the trematode is a Fasciola species.

37. A nucleic acid molecule according to claim 36 wherein the Fasciola species is Fasciola hepatica.

38. A nucleic acid molecule according to claim 36 wherein the Fasciola species is in a mature state.

39. A nucleic acid molecule according to claim 36 wherein the Fasciola species is in a newly excysted larval stage.

40. A nucleic acid molecule having a sequence of nucleotides substantially as set forth in SEQ ID NO. 1.

41. A nucleic acid molecule having a sequence of nucleotides substantially as set forth in SEQ ID NO. 11.

42. A method for reducing spread of a helminth parasite, said method comprising administering to an animal susceptible to infection with said parasite an effective amount of a polypeptide derived from or a comprising cathepsin protease according to claim 1 or 19 for a time and under conditions sufficient for an immune response to develop to said cathepsin protease.

43. A method according to claim 43 wherein the helminth is a trematode.

44. A method according to claim 42 wherein the immune response is a protective immune response.

45. A method according to claim 43 wherein the species of Fasciola is in mature form.

46. A method according to claim 43 wherein the species of Fasciola is a newly excysted larval stage.

47. A method according to claim 43 wherein the helminth is a species of Fasciola

48. A method according to claim 47 wherein the Fasciola species is Fasciola hepatica.

49. A method according to claim 42 wherein the host is a mammal.

50. A method according to claim 42 wherein the mammal is a livestock animal.

51. A method according to claim 50 wherein the livestock animal is an ovine or bovine species.

52. A vaccine composition comprising a polypeptide according to claim 1 or 19 and one or more carriers and/or diluents acceptable for veterinary use.