CA2109819A1 - Insecticidal proteins and method for plant protection - Google Patents

Abstract

2109819 9221753 PCTABScor01 The present invention provides a composition and method of using certain cysteine protease inhibitors to protect plants otherwise susceptible to insect infestation by one or more of Mexican bean beetle, red flour beetle, confused flour beetle, cowpea beetle, boll weevil, Colorado potato beetle, three-lined potato beetle, rice weevil, maize weevil, granary weevil, lesser grain borer, flea beetles, Egyptian alfalfa weevil, bean weevil, yellow mealworm, asparagus beetle and squash bug.

Description

W092!'1-~3 PCT/US92/~78~ :
~?i,~

INSECTICIDAL PROTEINS AND M~THOD ~3~ ?LAN~ O~rCT 3~1 :
~-~ ?~ e~ a ~ 3 ~
.g .~ r.~ ~-.c .~ 5c-~ C~_ pec~fic~lly,: the invention prov:ides methads and eompounds ~or controlling or combating in~cts in ~agriculture or hort1cul~ure.
~ 5 : Many vegetabl~e and field crops are a~tacked by sect pests.~ Most plant~ ~how some resis~an~e to cer~ain insects; ~he resis~tance can be phy~ical or ; ohemLcal. ~For example, khe hairs on the leaYes of many 10~ pla~nts~oan stop small~insects ~rom getting near enough ~ ;
~o the:surface to chew~it.: In other cases plant~ US8 a rang~ of complex secondary chemicals to make their ti es unattractive or toxic. Con~rol : :
ofsuchphytophagous insects has traditionalIy been 5~ partially addressed by~cultural and bre~ding me~h~ods.:
- An e:~fectiY~ way ko reduce: theYe lo~seB is to use crop cultivars:having gene~ ~or pest reslstance:~ee:Pain~er (1951), '~ ~ ~, M~cmillan: New :~
York).~; Plant brejedqr~ ~av,e attemp~ed to ~educe Iosses , cau~ed by insect attack by incorporatLng insect re9i~tanc~ g~ne~ into~thelr var:ieties Yia eonYentional breeding programs. ~;
.
~: 25 : ~ :

,:

WO 92~ 3 PCI/l~S9~/W78a _, _ i s 1.3 _'_s~ c~ roae:_a ~. ~.cs ~ r_s s---.e-.
a ~ i c _ _ 5 5 . _: ~ . . S 3 ~ _ . . S ~ a ., c _ s . ~ . --r~tha e~?iV~ica~. Once "'raits" for ~s s~anca ar~
disco ~_ r ~ - y - r ~ i i rlt3 a~,~ on o. cai` y -~ e -? a~ le S ~ ~ c ~ _ ~ ,, ' C r~
c_ - ss ~ c~ 3~;_^ C ~ ~ S .,;~ . ''.3 FC'ic. ~ O~ e s Or resist2n~ frorn ona plant to anoth5r a r sstr ^ ~5Aj ~e s?ecies ~,na~ c~n b~ int~r~re~. Addi~lona' ly, t;lesa types OI rea-istance are likely to b~ under tha con~rol ~,~ o~ ny ~n-s, and so are ~if`ic~l' fe~ ths plan' ~ r~ ~ 5 ~ ; 3 ~ 5 x p l ~ i ~ . 0 f _ r~ r~ 5 ~ ~; r~ ~ .; ~ ~ _ ~ ~ 1 _ have show~. a yield de~ress on and S3 ha Ja not baer~.
economically viable~ Moreover, if no resistance can be identified within a ~pecies or within related species, :~
15 then no improvement in insect pest resistance is ~possible ~y classical breeding.
Chemical~ insect~icides have been hea:v:ily relied :~: : upon to control insects. The e agents typically are : 20 applied~ on or banded into the soil~ or to plant foliage : or ~ in bait stations:. In spite of the availability of a wide range of chemical~pe ticide~, ~hytophagou insect~
remain a ~erious problem. Many chemical pesticides have the disad~vantag~ o~requi~ing repeated applications. A
5 ~major problem in the u3e of many pesticides is the ability of in~ect~ to become r~sistant to the applled ~: agents. Thi~ phe~omenon occurs through seleetion of the mo~t resi~tant memberq o~ the in~ect population during repeated appli~ation of the a~entO A need there~ore ;; exists for néw ing~c~tlcontriol agents', particularly gent~ tha~ have a mode o~ actioh dif~erent ~from conv~ntional inseeticid~e~. -: Ag alternatives to synthetic compounds, certain naturally-oocurring agent9 have been isolateù and ,, .,. ,.,.. ,.. . . . ~ -WO 9~!"1?~3 PCI/US92/0478 ? ~
~ ~ 'J, ` ~

~ re:o?e-' ~3 ?estin d_â. ~.~Lâ_ r.cl_c~ n' _r.~
m'-~r~ i 5_CC'`.e:~~J L-e -_o: ' es --,~ ?~G~e n9, a~.~
~.at~ra' pre~a~ors or p-~ho~er.s of insects ~ irlcludin~
o ~ er~ ins _c ~, f ~n5 , 3_ ~,_~ a - nd ~ -~ .ses ) .
~ th~ ~o r -, ,^ s r C~ n o~. ~ ~ 2-. ~ 5 n ~ . . 3 ' ~ J ~ s _ ~
g -~,e s ` - ~ , o r ~r~ . s-. ~- -J ~ - -.s ~ _ J -recipi~a!lt organis,~ resu~ t r~z ln a ns~ ?henoty~a r, t:r~e r~cipi~nt . In the ca3~ OL tr~ sgenic ?iants . tnis pnenotyDe may be resis,,ance to insect dama~ if tr.e ,~ i r.troduced gerne encode3 a po~ y?e~tide . ~:r.e ~c~ ion of w;~ r s~ . a d~ c~_s -~ c.. .~ s .
Co:nsequ~ntly. ther~ is a g~ea~ inte~s and ut ' l~j in I inding polypeptide~ that have such an effect~ Gene~
for these polypeptides can be used to modify organisms, :~ t5 especial;ly plants and microbess, ~o that they adversely affect the growth and development o~: insect pests. A
very limited number of such polypeptides have been desaribed, e.gO, polypeptides from Bac~llus ~h~ringlensis9 various prot~inaceous protease and amylase inhibitors, 20~ Yarious~ plant l~ctin9, etc.

On~physiological system:of Ln~eck~ known to be susceptible to di3ruption by ~peci~ic:inhibitors i~ the action of dige~tîv~ pr:oteas`e~. The disestive protea~es : ^ 25 hydrolyze ingested proteins and:polypep~de~ by cleaving peptide bonds. The ~erm l'protea~e" i~ spec1fieally : intended t~ include endopeptidases and exopeptida~eq oP
-~ the four major catalytic clas~es: ~erine~protea~es, ; 30 cystein~ pro~ea~e~, carboxyl protea~es and metallo pr~tea.es`(see La-~kdwski' et al. ~ 1 sa 3 )~ Ann. ~ev.
, 49:593-626). The cLa-Q~ to which a speci~ic protea~e belongs can be determined by the pH range:over ~4~ which it is activs. by its ability to hydrolyze ~peci~ic ~:

~: :
~:

:,~ ~ , :

W092/117~3 P~CT/US92/~78~

~ .
. t ~ ~. s . , ~ t . ~ ~ ~ , , ~, ^ ~ ~, ^ _ ~ , ~ ~ ~ .
~rot,~^-s~ a-.~ s s ~-.s ~ f~ fi~_S ~ Jr~.

~ ' '; ^ ~ ~ _ '.',';J _ 3 ~ s--5 3 ~ r a~ zJ--,^
r ~` ~ t^_S ~ P CP ~ t a'^ C _ - J ~ 't ~ ~5 ~
O t . ~ t _ " 3 ~ _ j _ _ z J__ ` _ 3 ;, ~ _ " 3 _ ~ _ . 5 ~:
arot_inas~s. The te~. "e~Jste~ne p~ote~lase" is i~-.dfd to desc~ibe ~à ~ot_~s~ a~ ?ossess_s ~l-h_t re~f~ ~tr ~.:
thlol ~ou? of a cys~e,ine res due 2~ th5 C~ tâ~ S . ~_ o~ t.~e enzy~eO ~ner^ is:f;id~l.ce t;~l~t ~l.J p;~jto~:~a~o l-.s:-~ s ~ e~ - ?~ c~ s-~

2 ~ O ~ 3 ~ r~ _ ~; L V . ? - ~ _ . . ~. ~ ~5 5 " J _ r' ^ S ^ _ ~
Hemiptera9 especially squash bugs (Anas~tristis~; Coleoptera, especially, cor~ rootworm (Diabrotica spp.); Mexican bea~ :
lS~ beetle (Epilachna varivestis); r~d ~lour beetle ( Tribolium castaneum); confu~ed flo:ur beetle tTriboliumconfusum);
cowpea weevil (Callosobruch~s maculatus); boll weevil (Anthonomusgrandis) ;~Colorado potato beetle :(Leptinotarsa decemlineate); three ~lined potato beel;le (Lema tr~linea~
: 2~0:;~rioe:~wèe~il (Sl~op~hilusoryzae); maize weevil (Sitophilus æamais)~; granar:y weevll~(Sitophil~sgranarius?; lesse~ grain borer~ ~hyzopertha~ominica); the f1ea beetles~ (:Chaetocn~ma spp., H~lticaspp., and ~pi:trixspp.3; Egyptian alfalfa w~evll :
iperapo~tica); bean weevil ~Acanthoscelidesobtectus); yellow ~-: .`25~:mealworm (Tenebrio molitor); and a~paragus~bee~tle (rzoceris asparagl ) O
~ Compounds ~hat form c~mplexes~with proteases :~ an~ inhibit their proteolytic activity are widespread in

3 nat~re. A variet~y,o~ wlmolecularjj~weight"~prote~inase inhi~i~ors are knawn, 1argely of~non-natural:synthetie origin~ A numb~r of naturally oc urring low molecular ~;
weight inhibitors havs ~Pen isolated from bacterial and ungal source~ and characterized; thi3 group inc1ud~s uch i~hibitors a~ E;64 (N-(L-3-tran~-carboxyoxiran-22- :
, , , , WO 9''f~17S3 PCI/US9~/~478 ~, 1 n ~J~ ~ t~ ~!

c~ y' ) -r ~ Cy_ ~ '' t~
'_';.lp~...t_^~3~ a-. i-_ ~.a --d ?3?'~ S-` _ J ~ . _ _ , . ~ ~, i . .-- ~, _ 2 L 5 ~ . .-- S ~ _ . 1 . . _ ., _ ., _ . 3 h~ f ~ ~ e ~ ^. Q o l ~ e ~ . t Q ? ~ ^ i _ 3 ~ r 9 a.~o 5 ~ C_~l S ~ r~ ?' ~ ~ ss~es deve 1 opmentally reulated anc induc_d in r e3~ns~ to insee~ a-.d pa~.og~n ~-~ac~a . nn~ ~ i .,ars c ` _er l-.e- .
cy~teine-, aspartic ac!d-, and ~e a' 10-3rGt-in~s~s ha~_ bee~ found in p n! s an~ es?eci-_'y ^. s cra~e o~ r.s 1 0 ~ e~s _~.~ s~ _ =c_ ~ "5~~~
:;: s~ud _ ~r3li? 5~ ~O~ S '^.^_~ r_ _''''S~
that inhibit the animal 3erine proteases, whicn include trypsin and chymotrypsin tsee Ryan ( 1990), Annu. Rev~
Ph~to~atnol, 2B:4250449?.

Prtoteinaceous Gy3teine protea~e inhibitors decrease ~ or elîminate ~:the catalytic activity of a ; cys:~eine~;: pro~ease~. The~ pH optima o~ cysteine 20~ -prote:inases~ :is~ u~ually in the:range~ of: 5~7, ~hich is the pH range:in the lumen~ ~o~ midgut~ of insects~that use : cystei~ne~proteinases (see Ryan, (1g:90), supra). :~
:: :Cy~ta~tin~ are~naturally oceurring,~prot~inaceous :~
cy~teine ~proteina~e inhibitors (~ee Barrett ~(1987~. :
T~rends. Bi~l Sci~, t2:193-196). Cystatin-q have be~en clas~ifl~êd~in~o thre~amilies with respect to molecu1ar : weight,: the:number~of~di`-~ulfide bonds9 ubcellular ~ ~
: localiza~io~n, and primary structure characteristics (~ee Bar~e~t (t987)~ supra) . The cla sification sy~ttem iS
3 mainly;ba3 d on:,infoF~mat,ion,regard~ing verte~rate , cystatins. ~ - : :
~ - ~
Gne: ~amily corr.prises the Type 1 cystatins (some'clme~ called stefln4) whose moletcu' es consist cf a singL~ domain of about 100 t3,minQ acid residues (Mr ~

~: , ' . . ', :
, ::

WO 9~/~17~3 PCI/US92J04785 O O ) ~ n o ~ i; ~ i f c a ~ ~,, . .. s o-- c _ r ~ G .r. i ~ ~--c~ s .
~ a ~J r, ~ ~ L x _ r4 ~ a - ~ ~~-- 2 c ~ _--. s .
are mol~ulcs h~ving a s..~.31e do;na n of ^~out 1 i~ ~..ino OO ~ S ~ C r _~ _ 0 X~ _ a ~ . c ~ s --- ~ S
C _ _ . _ 3 _ t ~ 1 ~. C ~ _ . . 5 '~ --. .-- ` ! ^ ' 7 J S _ fro:n beef co 1 03tr~m~ ar.~1 a c~s~,~tir. ~rom snake ve!~o;n.
T ~. mo s t c o~.? ~ a V c ~J ~ t a ~ 4,c i ~ a ~ c c ~ _ Typ~ 3 C'JSt2ti~19 ~ 'r,a ki.~i~og~s . _~c:~ o:' 'hace contains .our ~o~lalr.s: co.~al.rl 4 ~s a~ kini.!~ hlch is ,r~o~

c~Js.~a~ _ike do-.al-s tha r._~r- _,.,~r~c-. 'l y ~sLlre~ ~ro~
~: ~ two: duplications of genetic material; ~owe~ter, domain l not inhibitory to cysteine proteases~ whereas domains 15: 2 and 3 are inhibitory~

The reglons o~cy-~tatins respon~ible for :inhibitory~aotivity~can: be: summarized as follow~
sequence ~omology among members oP the cystatin : 20~ ~uperfamily reveal~ two well conserved features; one, the~a~îno-terminal Gly residue and the other, the sequence~Gln-Yal-Val-Ala-Gly or it-~ analogue Gln-Xxx- ;
:Val-Xxx-&ly. Thi~ hiFhly conserved region i~ considered o con~truct the "binding~edge" with other con~erved ~egmentQ :and to interact with:cy~teine proteinase at the active site cle~t~

Ik ha been taught that animal-eystatin~ (such as hen egg white cystatin and ki~inogens) and low 3 ~molecular weight? nonpeptide cysteine~protea3e l '! ' ;' ~:~ Lnhibitor~ (such as E-64~ antipain and leupeptin) ma~ be e~fecti~e in the oontrol of a variety of Coleoptera which ~: : util~ze~cy~teine proteinases (qee Australian Patent Application No. 36568/89)~
~ ~ .

~:

~ .

W~ 92/21753 P~/IJS92/7~478 ~7~ 21 jJ9~1U~

~e12 1 ;e ~J 11'~t' - 15 knOWr. ~OU V ~1~r. CJS~
S _ ~ . C jr 7 _ ~ ,,_ _ _ r7 ~ ~ S _ ~ 7 !~ C
ha /e bee~. r_?or',~ f rom a va~le y o~' p!a~lt tissu~ . :
' -.C '~C ~--6 ? l ~ e~ ?~ e~ ot ¢~ G
C~.~ . . 2~ 0: 1 7 ~ ), ? ~J ~c ~ û . - _ ~ o ~. ~J r g _ _ _~ _ _ " 3 __ ~3~?- -. r,~ ;a~ (-?-? (3-- ?.~- s --.- i3'' (1984), ?la~t Phvsiol.. 74:907-311); cor!l (s~ AbQ etal.
( I g 8 ~ ), A ~, 2 ~ a 3 - l 5 ~ !L 3 ) .~ ( s c ADC~ etal. ~1987), .,~. 31 0~ . CnQ~ 252: 167g3-10797);
1O cowpc~s (se~ ~elQ etal. ( lsao~. A~c:~. 3iOC;~l~-.. ' O~ S..
20~ 2 3 ) ; ~ 3 ~ t C, . ( ,' 7 6, .
t 3~isioi., sa i o); 'o.,.a o (s_~ ALtC3~5 e~a~ sa -~: -:Can . J . Bot . , 58 : 1 000- 1 003 ) , wheat , barley and rye ( see Fos~om ( 1970) ~ Acta Pathol. Microbial. Scand. Sec B
Microbial!, 78:741 754); millet (see Tashiro and Maki ( 1 9 a 6 ~, ~ ~, I C ~s ~ ., 50: 2 9 5 ~ - 2 9 5 7 ); pump k i n ~ s e e Valveski ~etal. ( 1991):f~ P~lant Science, 74:179-184); Scots ~ :
pine ~ ( ~e~ almia ~ :( :1980 ) 9 P7nysiol . Plant ~ .: 48: 266-270 );
and~ Enterolobium con~ortisiliquum beans ( ~ee Oliva et cl.
( 1988 ) . D~91~~H-SeVI'l, 369: 229-232 3 .
Oryzacystat:ins I and II from~ rice seeds have been: i~dentified as cystatins. Alignment of the amino aci:d ~sequBnce with those: of other cystatins re~eals that 25 ~ oryzacysta~in is homologou~ to memberY of the cystatin superfamilie~ OI animal origin and suggests ~ha~ this plant oys'ca'cin and th animal c~tatins: have evolved : from a oognate ancestral g~ne (~:ee Abe et~ ( 1988)~
30 supr~
Parkial amino acid se~uence da:ta from cys~,eine pro~einase inhibitors puriI ied fram seed~ o~ Wisteria ribunda (Hira~hiki etal. (1990~ J_Bio em., 108:604- :
608) and ~oybeans (Brzin etal. ~1990), Biol. Che.n.
~: ~Ef 371:167-170) also indicate that these are ~:

WO 92/217~;3 PCI'/US92/047B:~

3 ~ 1 ~

.~ê.. br"'S 0-' th~a ~ r~ -. ;Lpra^~^--' J h2~ 3_.'t~L- a C'JS~ ' q d5-~ ~ r~s.

?r~ rs'~ s h a ~i ~ G ~ e~ " 5 naturally ir. ?~ t"~ers~ Ihr C~'~JSta' S OCC'l J ~ J ' !. t ;~ ?; ~ f ' ~ J g ~t ~, ~, ~J~ srJ~a~ s -~
found t;qroughQ~ e t ber.~ S'~_c;~r_l y i.qtact c~bical cr~ys~als LSo~ .~ ~h~ out=. ^~.~x o ~a _ G ~ 3 _ ~ ~.
: a~e protei~.s wi~h ~.a signif ca~.t a~o~.t3 of ~rlcl~ic ip~A . 0~ c~ r~ c~ ~a (s~ :io-- etal.! (~972), - ' ? '~ f-~ S ~ C ~ r ~ 9: 1, 2 ~ ~ 1 5 ~ ? .` . ~ ~
J s t _ 1 s v ~ ~ 2 ~ ~ O ~ ; r _ ; _ _ cuboidai snape, although so~.eti~es can occur as twin crystals and crystals of prismoidal shape (~ee Rodis and Ho~f (1984), supru) .

The potato~crystalline~protein po~sesr~es pro~teinase inhibitor activity against the sul~hydryl prote~inaq~es~papain~,~Qhymopapain, and ~icin (see Rodis : nd Hoff~ (198:4)~ :s1Lpra)~.~ The polypeptide is~also~uniq~e ~
: in that it readi~ly~crystallizes at alkaline:p~ and in :the~presence~o~phosphate (see Rodis and;HoEf (1984) supra) ,~and is ;produced by potato plants in::larg~
quantitie in ~the tuber~periderm and }eaves.
25~
For example, erystals found in young tomato lear1et~7:in which chymopapain inhibitor activlty ~a detected~ are similar in:size and~appearance to those~
obs~erve~d in potato tuber. (see Akers~and Hoff (1980 :~ :
Can. J. Bot~, 58:100~-1aO3). Cytoplasmic crystals also ~: were ~hown in elec~ron mi'~rographs o'f tamato,leaf ti sùe after 20 hour3 of induction.
:: ~
:: :
~; - ^ The Punction of plan~t cysteine protease inhibitors ar~ not weil understood in ~erms o~

: : : :

WO9~1,53 P~T/US~21~7~5 1 J u~ . ` 1 3 3 1c ~ h ,r-;ps -.
s. ~ 2~_,a~ 'J _ _ 3 ~ 0 `~ C
~yste~ne p~tel.Aase in:~ ,or~ sug~5st ~ p~ticlpation i...~.,a~c; _/_.., 3 _ .. , .. _ S _ _ _ . . . _ ~ - _, . . _ ~ ~ _ r 5 ~
a~ ,a~ rs~ y --.- -G'^'` '''.~ r's e ~ r- ~ 5 (S__ ia: lsl~ ~
(1991), _1 r.t Scien.ce. 74: 179-184). A protective role a~ains' insect and/or ?a'~ho~-.s hcs ..o-, be~n substantiated.

~;~ 5.. ~ p ---, ?~ .s ~ C~ r.^ ~-,-s~
~:; class of enzymes, he also states that the vast majo~i~y of the inhibitor genes ~vailable in nature still remain 1~ to be studied:and tested for their possible defensive roles in plant3 (~ee Ryan (1990), Annu. Rev. ::
Ph~to:~athol., 28:425-49).: Thus, there i9 little direct evidence that~the:cysteine~protease inhibitors, : part1Qularly~animal cys~tatins, have a del~teriouq effect 20~ on insect growth and development. I:n other words, while ~: cyst:eine ~prctease inhibi~tors~would be expected to~
inhibit oy~eine proteases~in an invitro~ a ay of ey~teine~pro~tea~es,:there simply is iffsufficient publi~hed data to predict whether a cysteine~protease~
25 ~lnhibitor would ~unction in a qelected in~ect gu~
env1ronment to ~ontrol the growth and~devel:opment ~f an insect pe~:t. For example, there i~ ~o~corr:el:ation be~tween the l~v81~ of papain inhibitors $n selected :
cowpea ~eeds and the resistance to Callosobruchus, maculatus n lnsect wi~h predominantly cystei:ne protea~se~ in the , ~.
midgut (sea Xavier-Filho e~al. (~1989),;~ Food Gh~m~ 37:1139-1143).
, In fact, Ryan spe ifically cites a re~erence (Murdock etai. ( 1987) . comD~ Biochem. Phv~iol. B, ô7:783-, , W~ 92/~7~7~3 PCr/US92/~47~5 ,' 9 8 1 9 - C- - ~

37 ) w:~le~ c:~.es ~ l~r~;z~ G~gUt ~3--~ 5~ 3C~Ier~_ -.se^r.~ . Ior.c CoZeople~ ~ ~c~^~. T. c~7s~e7~rn. ' Sr'OW-. _3 have cysteine gu.. pr3.,~ases ;~ ly i.-;;nibite~ by the - ~J ~ ; ?C~ C~ taZ, (~.g~
278~2) t^'5-~ .r~t~Z ( 153~; (?~ _X~r~C7S_n z -. ~ ? ~ ~ o r., 3 ~ _ s ~ ., ~ -. , ~ a ~ -; s ~
.
i~q a poce lt inhibitor o T. castaneum ml~ut proteases ln an ~vitro a~say. r;ow-v~r, C'.~e~ et~ ?92, (stlpr~
de2r~0nst-~te thct oryz5c~Js~a' n .ro~c~s ~nly mar~lna' t3 lnhibltion o~ in~ect g-o~h (35~,7 a~r ~ days) wr.cn levels ( lO~c we~ gnt~w_ 3.~ `__ . C ` 1O,~ ' : oryzacystatin in the diet is considerably less than the e~ect o~ non~proteinaceou~ eysteine protease inhibitor 15 E-64.

~; An object OI the present inven~ion i~ to provide a method :~or pro~ecting a plant or a part thereof from inse~t: in~e~tation by insects having 20 digestive cy~teine prot~asss.
.
A further ob ject: of the ~ p:resent invention i~ to pr~vide novel compositions which are capa~le of protecti:ng from: attack a plant or a part thereof 25 otherwi~e susoeptible: to inse :t in~estation by insect~
having dlgestive cysteine proteaseCf.
-:: A ~further ob ject of the present inven'cion is to provlde ~ proce~i3 ~or prep~ring geneticall~ l;ransformed 30 ho~t cell~ which proce~s comprises the transformation of hf3st cëlls wi'ch a~gehe~ enc'od;ing a prio`tein capable of causing ~ a deleteriou3 effect, upon ingestion, to insects having digestive cy~teine proteaff~es.

~ , .

WO g2~ 1, C3 PC~/US9~/047~
I ~ 1 3 3 I 3 ~5;~- o~a5_-a --.c a 5_ -i 2 ~ ~ a 3 ~ ~
ir.ve-. ,G,. w_:: s~ ,e -~~a~ e 5a~- --ion :~ t'~'lr.ve?.ticr. ~r3viced here~ind~.

: A^^or- r.~ o.-_ _s--~ _ r.~-n. on insec~s havir.~5 di~stive c~js-~31.~3 prot3a3~s. I5, is As~s^~a'~ c~nce~ p~ . r.~ d~ e plant ^ys~a' n i~" on c~ r.e~r ~ zr.t tiss~e o~her~ise susc=~lble to inf~3~5tion ~y s~ch ~r.sec~ 3, wnere~y th_ ,~
~ _ :' . . _ : _ S S ~ S _ . _ . _ `i--_ . --S _ S ~ , S _ _,, _,, C _ :
n a secor.d aspect, the ?reScnt inven~:on relates to a~ insecticidal composition having a midgut-effecti~ue plant cystatin, wherein the composition is capable of improving the resistance of plant tissue otherwise susceptible ~o insect infestation by one or :m~re inseet~ having~digestive cysteine proteases.

: In a third aspect, the invention relates to :~ectors encoding and oapable Or expressing a midgut-effecti~e~ plant cysta:tin in a plant cell. ~
In a ~ourth aYpect ~ the invention relate~ to : ~ tran~formed aell3 and cell culture~ of cell~ which ~25 p~s~é3s: genes encoding: a~midgut e~ec`tive:plant cystatin capable o~ protecting~plant t:is3ue otherwise -Qusce~tible to in~ec~ infestation by one or more iilS ct~ having igestive cy~teine protease~.

3 In ~lrth ~s~e,t~ the pre~en~ invention relates to a process of preparing an insecticidal c~mposition o~
: ~ midgut-e~eetive, plant cystatin. wherein the :~ . : compo~ition i5 capable of improYing the resistance of plan~ ~i33ue otherwise usceptible to ins~ct infestation , W092/~17~3 P~T/~lS92/~7~
2 1 q ~

~J J -' ^ ~ r ~ s ~ _s~ c~;s~
?r0~e_s^s.

W ~: - s ? _ ~ "; ~
^~_~ - , - ^~^-2--Y~ .-~ ..Ss. l..

~ ~ gurC 1 S~.OWS th,~ ~r-~-r ~ .0 _^ d s~
~ ?o'-t~ ~?~Lr. ~.~.ihito~, ;
tC Figure ~ snows th~ ~.ucl~ctir~ s~sue.qc~ o~ t;^e L .q ~ s- 3 . Figure 3 shows the N-terminal amino acid sequences of polypeptides obtained by digestion o~ PPI
with trypsin.

Figure 4 shows a compari30n of amino acid sequences of PPI-5, oryzacystatin-1, and hen egg ~: cystatin.

~;~: ~ : Figure 5 shows e~fect of PPI on Growth o~
Second Instar Western and Southern Corn Rootworm.

~:Figure 6 shows effeck~of PPI on Growth oP ~:
Neonate Southern Corn Rootworm.
: :
Figure 7 ~hows the ~lasmid map of pDAB219~.

~igure 8 shows the plasmid map of pH707-Not.

The entire teachings o~ all references ~ited :herein ar~ here~y in~orp~ratédiby refierence., ~: A~ discu~sed previously. th~ mere fact a protease inhibitor is inhibitsry in an in uitro as ay of dige~tiYe as~ays dae-~ not necessariIy mean it will be e~ectiYe in viuo. This is especially shown in the work .

, WO92/ 17~3 PC~/US92tW785 - - 71q9~

';'' o~ _r'c~ i et al. ~ sa~ C'` _............. ,Uc~ r' ., c~ 22~ s r.o i....... ~ or~ cw~ o` ~io-: W'3','__ C-too^cco budworm 1~rV~ was ~âsocl_Led with f3eAing high 'I e~21s OL -,rypsin innl~ crs, des~' ~2 t;rl- fac t~
t 'n 3 s - ? r v ~ r. s ~ ( i û
il ~ of mic~ ro,,eoiy~ic ac ~L~ t'; Znt,~tro. ~r.2r_ ia _~
e~.piric~i 3vldenc3 zs to whether ~?~cifi~ c~Jstatir~aT ha~J~
a delet3rlous effect on s~lected insec~ growth and ~: devel~pm~n~. WhaT, evid3nce is ava lable SUggQStS
re~fiously c~. r ^ ~rlzeA~ cystati~s ar3 r~lati~JelT~
r. ~ ~ t C 3 ~.: . 3 i _ r. _ s-_3~ -_ ..s_^~ ~.owt.. -.~_ development Ise3 Ch3n etaZ. (19~2), suDra) ~

The present invention is directed to an insect controlling amount o~ midgut-e~fective plant cystatins with an abiIity to control infestation by insects having dige~tive cysteine proteases. Specifically ~u~ceptible inse~ts include one or more inqects (including larvae) 'I' ~ :
.$~ 0~ c~rn rootworm, Mexican been beetle, red flour beetle, canfused f:lour beetle, cowpea beetle, boll weevil, Colorado p~tato beetle,`three-lined potato beetle, rice ; weevil, maize weevil9~ granary; wee\~il, le~ser grain ~ : borer~ flea beetles~ Egyptian al~alfa weevil, bean -g~ weevil, yellow mealworm, asparagus beetle and squa~h bug.

An "in~ect controlling amounti' is an amount ~f a midgut-e~ective plant cystatin su~icient to deleteriou~ly di~rupt the normal life processe~ of an 3 iin~ect;[i.e., am~un~$ which are le~hal (t~xi,c) or~
sublethal (injuring, growth or development inhibiting or repe11ing)]~ ~

A~ discussed prev~ously. the abilicy to ~nhibit proteoly~ic enzymes ~n ultro does not necessariiy mean the ~ - ,-,, .
': - ' ' , / , .

.~

~ W092J'~ 3 P~T/~S9~/~785 ~ .
~ld~l3 --., sw~ 5 - n ~ s.s-r s ~ ir.~ -Js,ei-- -~5 ~---ses ~
possess ot~ dig~stlve prote~ses wr.ic:~ ma~J Lr,Gct ivac5 ing~ste~ C'~J3t3' r.e prot_aa_ sr.~ 3rs. ~r.

sin~-ie do~ia~ CYS G~ ..S -~ i-.act ~;5 _~ n-environme~ lor to bein~ abls to ~ind to anc i inhiblting t;ne tar~ cyste~ ?~ot-~_ses of a ~ive.
'1~ targ3~ pest.
~3 .~
. i. i _ . _ s _ . ., `'5 ~id~lt~ ve ~ 7s ~
plant cysSatin" is meznt a cystatin which is resistant to inactivation in the midgut of a target pest ~or a time sufficient to permit inactivation of digestive cy~teine proteases. For purposes oL this invention, 2 "target insect" i9 one which possesses a cysteine protease as a digestive enzyme. By "resistant" is meant a midgut-eff~ective plant Qystatin which i3 not sus~eptible to substantial inactivation in the target in~ect midgut prior to controlling the insect pest.
In a preferred embodiment, the present invention i direc~ed to crystalline cystatins from potato, also referred to a potato papain inhibitor.
For purposes of thi's inYentlon, "potato papai~ ;
inhibitorl' is meant to include a: protein encoded by a genP haYing khe sequence set forth in Figure 1, or a functional derivative thereof. A~ can be seen ~rom 3 Figure.1, the~ prot,ein co~po~ent of~crystals derived from ~m potato tubers a~ well as potato }eaves is compos~d n~
eight domains that. whilP in~ending to be bound by theory9 appear to have resulted ~rom the dup}ica~ion of geneti~ ma~erial. The eight domains comprise an 87 kD
polypeptide. Each domain comprises a~out 95 amino J
~"~
,~, ,~ .

,~ ~
,,' , WO92/217~3 PCT/US92/~85 i ., S 1 3 ac'~s. ~i'h ~o cisul~ or.rs. ~_s_- o~ 4h- s_~]--.ca-: o~ t:~- cG~_ n~, ~s ~?c~ .4 t;~ ro ~ e~ c~ ~r.e cys'a. n ~?-~r~a...ily. compr sin~- ~e.c~
cystatir~ ur. i,s. S?ee ~i~al'~J, the do.T.2 ~ sa~u3.qc~s sno~
h~ . c3..s3~ia~ cn c~ a ~X~ s_ ~--.e- ~r._ ~h^ -.- r.o ra re~ion o~ n dom2 n c~n4am~s a cons_~e~ _y.
.

T:~ c~n~igl~o~s ~o~.-^i~s of t h3 ~7 ~3 pctat~
pap~in ir.h ~ ~or pOl'Jpei ~'53 can 53 c~ v3~ ~n_3 i~di~idual un~ts co~is_d of 1, 2, o~ 3 c~Jstati.
Sc ' '~ ~ ~ ~ ., " _ 2C _ ' ~ ~';~ S _ . . O ~ 5 ~ ~ 3 ~
as cny~otr-~p~ r. ~ 3UG~ s n C-rl3~e~3, -h3~...oly3 ~ n anc ~ : protease K will also cleave PPI into individual active ; cystatin ulits. The domains have a Mr of approximately ~i 15 10 kD. Each of the domains tested possesses cysteine protease inAibitor actIYity. rrom direct amino acid ; sequencing af several domains and ~rom the predicted amino acid sequ~enees:~rom the DNA:sequence, there is olose:,~but not~ldeltlc~l, similarity among domains.
Those skilled in the art re~ognize that such.
other mult.idomain~cystat:ins are includ~ed within the cope~o~f present:~invention.

Prote~iDs comprlsing multidomain cys~tatin units may~ be isolated from~:~ouroes other.;th~n ~potato tubers.
:For example, naturally occurring multi-domain c~statins . m~y be isolated from~:various plant sources ~uch a3 ~::; tomato leaflets. Polypeptides of the same size as ~PI
30 ~from potaito tubers~(~87 kD) which reaet strongly~ with 3 6 polyclonal antiserum against tuber PPI are also found in .q~ : : potato leaves. Increased levels of the leaf~ PPI are inducible by injury to the leaves and levels of up to 2 f the total leaf soluble protein can be achieved.
~3 ~ Similar eefects are also noted in tomato leaves as ~he -~ ~
~.~s~

/3~ ~

....... .
.. W~92/~17~3 PCTJ~IS92/~785 ~1~.,31~ - o ,.. .
..~;, -o~y~e~ s ~ 7-r ~',J ~Ci~C'--~
:aised asa_n_ ~ c~ re-,.
., I

-~v~ c~. . . - s .-,--~ ~ c c~.c ~ . c~ `. ~. 3~... ;_ ~ _ â
C~ 3 ~ `_ t /_ ?i^^-. ~ . s:^- ~. ^t ,~.,~ ` s s ., .-or more of the v2rious cy~tatin domains. Multl~domaln cystatins may b~ syn~heslze~ ~_3ing re?-~ .g combina~ions G~ a s ng'_ co~ai~ c~Js~a~lns c~ ~ usin~
~, ~ cif~ ent si.~*1~ coma n cys~;ins. cor exam?i~, tn-.~- r~ 3 ~ .. _ .. v .. ~ -- 1 s 5 _ .. c ~ _ s _ 3 _ .. ., _ ~
c~ the ?o~ato pap~ln lnh ~i.o~. Lh_s_ ~~a~m,-n s -.e_u5-any a~d all combinations of the eight indivldual domains of the potato papain inhibitor.

Multi-~omain cystatins having more tha~ one t~pe o~ cystatin:subunit are likely to have the ability to control insects resistant to:inactivation by any one : cystatin subunit. :The~inhibitors may be rearranged to 20 ~provide novel pro:tein forms, comprising multi-domain cystatins. :It ~hould also be apparent that maintaining : : : a~multiplicity~:o~ domains will provide,~at a molar equi~alence level, a cystatin with more e~ficacious cysteine protea~e:inhibiting properties. Also, the : 25 likelihood of pest resistance rapldly ~eveloping may be duced by the i~nh~ibi$or having a multiplicity of : domains with~diPferent~active slte sequences~
Any embodiment which reduces or inhibits the deg~adation of cystatin in~the midgut ~f the target ect su~h that the midgut-effective plant cys~atin is ~:: capabl~ o~ (or has an increased ability t4) be effe~tive : in lnhibiting the growth OL the insect peqt is within th~ ~cope oÇ thi~ Jention. Exemplary embodiments o~
the pre~ent invention include using multi domain s ~
~, , W092/~1753 PfCT/US92/fM7~v;
3 ~.`if 1 3 " W

~ys.a ~~.s -f ~. ~; 5 'f f'~ O ~ ' 1 r. 3 - C ~ i' rf ~t r ~ f 1 v _f r- .
~ c.~ h~b ; 'f _ ~ n,c-~ ~ /2~ '' f_n Q~ e ~f~f~s~
evsv2~ n.

M.t~ C-_ ' " C'jS v2t ' '.3 -2y be, ~r _-2',; -f 5 2 ~ -- -- S ~ 2 ~ Sf _ S ~ _ _ _ . 5 ~: ?roteln retzins its activit~ for a fe~iod suff~cien~v to 3ubsvar.~izlly cor~f~rol the ~ar5~ pest --~r~.h~ df~f ;~ e~5~ a~g i~.~ or~

its acti~ity ~or a. period sufficient to substantially , control the target pest~ ~
:: :
~ As seen in the Example.~ ~ection, the : multidomain potato papa~in i~nhibitor is more résLstant tCf inaf~tivation in the~ gu:t~than single~domains~of the B7 kD
pefflypeptide, :when lngested:by Diabrotica larvae~
Therefor,~given the teachings of the present ir,fventlon, ; a skilled~:ar~;isan may~now determine the mode o~ gut~ :
inacti~Yatinn o~ ~he cysteine proteina~e inhibitors and ~
: include~a3 a~syn~er~gist an effective amount of~ a compo~und which inactivates;the~oystatin inactivating en2yme(s).
25 :~ For: example, when fed~to Diabrvtica larva:e, ^ oarboxypeptidase~inhibit~or from potato (Ryan ~1974),~;~J. :
24~:5:495) did not ha~e~:any deleteriou~ :
e~ec:~s~on: the~digestiY~ phy~iology or growth of the :
nsects - Hofwever ~ iche 4s-administratlon of~potato ~iar-boxypeptid~a~e,inh:ibitor,and ~a -~fingle cystatln~domain derived frfofm th:e multid~main potat3f papain inhibitor proYided a ~ynergi :tic ef~ect result~ing in growth supprf~s~ion o~ Dlabrotifra larvae. Carboxypepfrida~es from : nther ~lant ~pecies (e.g. ~ Lf8ary e~al. ( 1979), Bio~hemistry, 1a~ 2252-2256) would al50 be expected , ~ :, , ~ ~

~:;: :

W~9~t217i3 PCT/US92/~7~

;'~ 03313 ta W5~ ~5 S'~Jn_~- 5~S '~ ~r ~? ~o con~rei Diaorocic~
ï2r v ae .

i s . ~ ~ ~ c . . ~ ; ^ " , ~
_ . . . _ ~ _ _ _ . ~J -- C . _ lr _ _ ,J O _ ~ _ J _ ~

for protelns with the a~lllt~ to inhibit cysteine ?rot_-ses n æ-. ln vitro aqsa-~.~A see~nd 3~_~e¢n. m,~ be employed n w;nic;. he cys ~ n.~ pr~ ~se ir.:~i5ito~ ls : ~p31ied to the diet of the t~rg nsact diet. A~te~
ln~es~ on ~y ,~- -s-e~ 2 ~ s. :se ~ ~_ s re~.ove- an~ :~ 2~0~ 0~ CySt-' !._ ~r~_3i~ cti~
~`~ in the gut is~ssayed using a spectrophotometric, or preferably a sensitive fluorometric or radiometric assay. Those mid~gut-è~fective plant cystatins that ause a significant de:crease in the amount of digestive cys~keine proteas:e actiYity in the midgut are likely to a ha~e~a:deleterious effe:ct on the growth of the insect.
Thls~Qan be~con~firmed by a ~hird screen in which the 20 `inhibitor is ineorporated in or applied onto the in.~e:c diet~and ~the growth~and~deve~lopment:of~the insect monitored~by meas~uring:welght gain and:~mortality.

Once~appropriat:e activity is determined,:the~ :
25~ amino a~id ~quenoe of~the~midgut~effective~plant ;: cystatln, or~at lea3t~a portion thereof,~may be deter~ined by N-termi~al~s~uencing and~sequen~ing~o~ :
oligopep~tide~ der~lved~by~proteoly~is. In addltion~ ~
ntisera can be prepared that specifically recognizes -~ 3~ ~he midgut-effec~ive'plant~'cystatin.

~: It ~hould be understood tha;t:9 given the pre~ent ~ : teaching one may ~ynthe~ize or;isolat:e;sub~an~ially :~ ~ : pure Yunctional derivatives o~ naturally-occurring midgu~-e~fective plant cy9tatins. A "functional ~::
, WO 97/'717:13 PCr/l~S92/04 _l9~ ~ 1 9 ~

,- ~ r~ ;n e ~ C 3 ~ ~ ~ J S ~ S
c~mpound which pass_sses ~ 3iolog~cal activi~y t;~a, is S U ~ S ~ t 1 '; S ' ~ r- ~, O ^ ,~ _ ~ C c ~ a q r ~ .f t.~e ~ t lta ~1 r'.t C~J_~ n. l'.~_ ,er~ c~ona' ~ r :~ _ S _ ~. _ ~ C ' ~ ~ r~ ^ n;: ~
' "e~.ectiie~y ho~.o;o~ous var~l~n's", or "a~a:oguetl'.

A !'fragmen~" of a ~T~ol~cllle iS mean~ to refer to : ar.~ nh~ito~y polype~ Ldo su~set o~ a mid~u~-c~ec~i~
? ~ C~S'~tn ~ol~u~
Arl "e~I^ec i `la '; ~-0,-.5-~_0U5 iZr'' ~t!;- " 3. c mol:ecule such as the midgut-effective plant cystatin is `: meant to rePer to a molecule substantially similar in : sequence; and function~to either the entire molecule or :15~:to a:fragment thereof. For purpos_s of this invention, the structure of:one amino:acid sequen~e is e~;ectlvely : homolog~ous to::a second~amin:o acid sequence i:f at lea t : 70 percen:t~,~preferably ~a~t least 80 percent~, and most 20::~preferably at~lea~s:t 90 percent of the active portions of : the amino acid~ sequence~ar~e identical or ~qu-ivale~t.
General~ly, the ~e~ective~ly homologo~us equenc~s should retai~n h~igh conqerva~tio~n at the naturally-occurring positions~of the amino-terminal Gly resid~e :and the conserve~d sequ~nce Gln~-Xxx-Val-Xxx-Gly.; General ~ ~
categories oP~potentially-e~uivale~t amino acids aFe ~et forth below,:where~i~n,~amino acids within a group may~:be~ :
: substi~uted for other:amino acids in that group~
glutamic acid and aspar~ic acid; (2) ly~ine, arginine ~ ~ 3 and hi~tidine; ~3)~i'al!ani~e.' valine, leucine~and j ! ,j isoleucine; (4)~asparagine and glutamine; ~5) threonine and rine~ (6~ phenylalanine. tyro~ine and ~ryptophan;
`:~ and (7~ glycine and alanine. Mbre importantly and cri~i~al t4 the de~inition. th fun~tion o~ a s:econd ~ amino acid s~quence is effe^tively homologous to another :

WO92/~17~3 P~T/~5~21 ~ ~ f~ 2~-~ ~ J ~

a.- -.~ _c - s ~ .c ~ .o _^-d ~ ~ ?. ~ J~-.S
te~Siar-J structu~3 ha~in~ he c~?aci~y to dsc~2s~
~ a ~ .al; ~~ a~ J of ~ d~ g3S_1'13 p~o:e~se.

A~ n~ " v-~ o ~ : 3 ~
c~iva ?l~st c~s~ati~ e~nt to re~e~ to a moi~eule ~ubstantiailv simiiar in function to ~it;~er th- -.-. Y
molecule or a fragment the~eof. Tnus, prov de~ ~r.a~ '~o ~ol~cllles possess ~ si~ r activity, they are -.Cide~_ a~ o3, - ~.a~ e~- i3 ~ _rs ~
the structure o~ o-.e o~ t;~.e ~lol-cul~s is no ~o~3nd _n, the other, or if the ~equence of amino acid residues is not identical.

: 15 As u3ed herein, the ter~ "substantially pure"
meant to describe the midgut- ~fective plant cystatin which is homogeneous by one or more purity or homogen~jity characteri~tics. For example, a ubstantially pure midgut-effecti~e plant cystatin will ~how constant:and reproducible characteristics within : tandard experlmen;tal deviation~ ~or parameter~ such as molecular weight, chromatographio behavior and the like.
The term, however, i3 not meant to exclude artificial or ~ynthetic mixture~ of the midgut-effective plant cy~tatin wlth o~her compounds. The t~rm is al~o ~ot mean~ to exclude the pr~ence of minor impuritie~ which ~: ` do not inkerfere with the biolsgical activity of the midgut-effectiYe plant cys~atin and which may be 3 pr~se~t~for example,`due to incomplete pu~ification..
A substantlally pure midgut effective plant cystatin may be isolated from the:~ource in which it : ~ naturally exi~ by ~ny ap?ropriate protein purification ~ technlque. ~xemplary techniques include chromatographic WOg2J~17~3 PCTtUS921~78 -21~ 2~ 9Ql3 , , s c~ a -e' ~
c;~roma,ogra~ny, ion exc~n~e c;~r~mato3rapn~, high ~e~fo~.a-.c~ 1 qui chr~ gr~?:ny. rQve~so phase c:~cm~og~~?h~J e~ by use o~ i2~ r,olog c~ r~ag~ts e~2 '~ O-J '' ~ C'JS ~,a ., ~ rs. ,, - .,C ~
It is pos5iblo ~o s-~nthesize in vitro a midgut-e~fec ive plant cys~atin ~rom ~h2 con~titue.~t amino acids (see Merrifiold (t963)~ J. Ame~. C~ Soc..
85:21~ 154: and Solid Phas~ Pe~tide Svnthesis (1969).
ds,) St~wa~ 2~.d Your.~ ?~ldes ~ s 2r_-~2~_;
~; may De isol~ted an~ puri-i2d b~ ?rocedur s well known Ln the art (see Cu-rrent Protocols in Molecular Biolo~
(1989), (eds.) Ausebel, et al. ) and Sambrook etal. (1989), Molecular Cloning- A La~boratorv Manual)~ ~

Although~ is ~possible to determine and :` synthesize the~èntire amino acid equence of the midgut-effectlve pl~ant oystatin,~:it i5 pref~able to iso:late 20~ the en~ire se~uenoe of~the midgut-e~feetive plant cy~tat~n gene. DNA~encoding a midgut-e~feet~ive plant cystatin may be prepa:red from chromo~omal DN~, cDNA or DNA~ of:syn~hetiQ~:~origln~by u~ing:well-k~nown ~teohniques.

~ Genomi~o~ DNA encoding a midgut-e~eotiv~ plant cystatin may~be i~olate~d by sta~ard te~hniques ~
(Sambrook étal. ~ 989) . supra) . ~ Speoifioally comprehended : as part~o~ this invention are genomic DNA~se~quenc~s encoding allelic variant formY of the midgut-e~fective plant eys~a~in;gene,las well-as itslj5'~and 3'~ ~lanking;
regions. It is alsa QoSSible ~O use pri.~ers and exponantially amplify DNA i n uitro uqing sequence peoi~ied oligonucleot:ides ~y the polymera~e ch~in reaation (P~R) (se~ Mullis etal. ( 1987) . ~ ~, 155:335-350 9 Horton et al ( 1989), Gene, 77:61; and PCR
~, , ,: ~ :
, ~

:
; , ' WOg2~'17~3 P~T/US92JW/8~
Z 1 0 ~

.a C2'~ ^ 'C~ .S ~ DNA
Am~'lflc--- on~ (ed.) Eriicn ~13a9)).

A ~o ^~- e~.c~ Z~; r~ ?
~ ? ~ -cj :~7~ s_ ~_-J _:s~ ~ r~ 3 c~l2 _~.c^.~ '?~ ., _ ^r_~j. c~
lig~t~ ir.to recombinant ~ectors to for~ a gen~ r~r~.
Alt_~nati~ely, 'ne cDNAs ~aj D~ ex?res3-d in z vector sucn a~ Agt11 and tne library scre~n~d usin~ an-ibodi_s a~ainst the mid3ute~fective plant c~statin.

S ~ _ 3 'J . . -~ v . _ _ ~ V _ olig~nucleotide3 may be used, by techniques well known in the art, to screen the genomic DNA or cDNA libraries.
To facilitate the de~ection of the de~ired sequence, th~e oli:3Onucleotide prob~ may be labeled with any mate~ial having~a detectable physical or chemical property.
GeneraI pr~cedures~for i501ating, purifying and sequèncing thè: desired sequences are well known in the art:(see: Current_Proto ol~ in Molecu_ar_BioIo~v (1989), supra;: and~ Sambrook etal.:(~1989), supra).:
An~alternative way o~ obtaining a genetic se4uence whioh i~ capable of encodi~ng the mid~ut-e~fectlve plant:~cystatin i~ to:;prepar:e it by :ol:igonucleotide~synthe~is, after th~e gene sequence o~
interest i,~ determlne~d (see Caruthers (1983), In:Metho~ol~L~ ~ L~ (ed.3 Wei~man3; Beaucage etal.(1981), Tetrahe~rc~ rs~ 22:1859-1962). A ~
~e~ie~ of oligonuRleotid!e~imay be syjn:the~i~zed in order to provide a ~eriei of overlapping fragments ~hieh when :annealsd and ligated will produce both 3trands of ~he gene.: These~fragments~are then annealed and ligated together using well known techniques ~ee Sambrook et al.
(1982), supr~). Alternatively, the genei may be produced ::

, W(:l~ 9~/217~3 P~/US92/04,8 -23- ., 1.0 9 ~ ~ ,3 i~y syn~es zir.~ r ~er '.~a l~ r.~, ~ so-czl e~ "wz~
tz 1", .n~, doe3 nod ;~ly~ridize Wi;;~l tr.e l,ar~Set ~Jh'A;
t~ere~'ter. t~e ~,e~omiC seq~ .nces ane a~r.?ll~ied 2nd ~llce~ t3g5Lher by ove~l~? exten.slon (3ee ~orLon etal. :"
( l9Q^, ) . G~ . 77:o ~ . ~he r~e3ui~ing ~ ffr^~=cnt with the pred~cte~' size ls ~sol~ Dy e~ o?hore~is 2r.d liga ~A lr~.to _ 3~it~ble clonl~ v~c'c~ 'or amplif~c~tlQn ~nd ~ ther mar,i?ulaL~ion (se~ Mu'lis etal.
(;~87)~ 3upra: an.d pr?~ Teeh.no~ z,: ~r nC~lcs a?.
? ~ " SL ' ~,3 ~ NA ,~ i r '' ~ L ~ su~ra~ .

:~ . Of cours-, one ;n~y r.cor?ora-~ modi~c~ ons into~the:isolated sequence including the addition, deletion, or noncon~ervative substitution of a limited number of:various nucleotide or the conservative ' substltutlon of m~a~ny nucleo.tidec, provided that the prope;r reading frame ls maint~alned., Translational stop and~star~ s,ignals;are added at the appropriate points and sequenoes~ to;~create oonvenient cloning sites are :~ 20 a~d~ed:to the ~nd's. Exemplary techniqu~s Çor modifying oligonucleotide~sequences include u3ing polynucleotide-medi:ated~, site-dlrected~mutageneqis (see Zoller etal.
19~84), ~ DNA, 3:4,7~9-:488); Higuchi etal.~ ( 1988), NucI .
Acids P~:es., 16:7351 7367; Ho etal. (1989), ~Gene, supra;
-~ 25 ~lort,on ::etal. ( 1'989), supra~; and~
and:A~Dlic~tion~:~or:DNA Am li ication~,:(ed.) Erli~h : ( 1 9 8 9 ) ) . , :~: In order to further characterize s:ueh genetic 3 sequences, it is!~esirable'to.introduce l;he,~equence : : int~ a suita~le host to express the~proteins which ~chese e~usnce~ encode, and ~con~irm that they pos3e s ' :
cha~acteristics of mid~gut-effective plant cystatir~.
:: ~

~:

WOg'/~17~ PCT~US9~/~7~i 1~,,-,'1 chn~ s,c. -.^~ io~.s a~o we:1 ~r.ow.. i~
~t ar.~ discios3d ~l ~a.,.~roo~ et al. ( 1989 ), supra .
i~ 3-s ~ c^~. b~ y 2 - ~ C ~ _ - ^ -. S h~ 3 n 3 ' 'J ' r"-5 S - ? r' ~ J'- - ~

shoul~ contain all 'he ~N~ co~trol sequences necessan~r ~or ~oth maint3nance and ex?r~as1On of a het-r~1O$3us DNA seq~ence in a gl~en host. Such contro! seque~.ces g~nerally inelude a promoter sequence, a transc~iption~l s~ or eac_~ s_;~anc-. a ~A se~onc- ~nr~,r.~ _~
~: ~ . translation s~a~t-31gn~1 codo.~., a trans'a-~ion te-~.ina~r - codon? and a DNA sequence codin~ for a 3' non-translated region cont~ining containing a signals controlling t~rmination of RNA synthesis and/or messenger RNA
modiPication. Fina~~ly, the vectors:should desirably have a marker gene tha~ i capable o~ providing a phen~typical property~which allows ~or identification of : host cells containing the vector, and an intron in the 20 ~5' untranslated~region, e.g., intron 1 from the maize al:cohol dçhydrogenase~gene~that enhances the teady state level~:of mRNA. ~ ~

Exemplary host cells include prokaryotic and 25~ eukaryotic~train;s. The appropriate procedure to :
Sran~form a selected host cell m y be;chosen in ~, accordance with the host cell used. B~ ed on th~ :
experience to:date, there appears to be little differenr~e in-the~expression of genes,: once inserted : 3~int~o dblls,~attriibutable~toithe met!hod~o~ t~an formation, 1tsel~
Conventional technologie3 for~introducing ~: : :
biolo3ical ma~erial into hoit cell inc}uds e}ec~roporati~n ~ee Shigekawa and Dower (1988), ~, ~ ,., . .,:
. . .

~ ::

WO 92f21 ,~3 P~/U~92104/8~ ;

-25- ~ 1 J 9 ~-c~ , cl s. ~:-.2~ e~, e~al. !tsa3)~ rJ~~
-- .
Ac d. Sc .USA, 8~:3~o~860; and Powell, etal (1983), ~:
. r.-.v ~en~ lc~e~lol.. ~4:5~ ^60!: dlr~c DNA
up'ake -ech~n ms [s^~ Mandel and Higa (1972). . ~.oi.
3io:.. 53:15~162: 3it-J tk n, e~al. (1972). 3 ~ c~ e 3iopr.~ 3~ , 28t:319-323; Wi~ , etal. (1979), Cel', 16:~7; and 'Ich~ , et~l. (19v2), In: .~c. ~ t _ In~ l ~
Cor.~. Pl~ m~ ~' S~ Ce~ 1 Cultun~- A. ~ iw~n~ (e .), J2~. ASSOC~ f3n P ~r.L~ TLSS~e CU1 tu~^, Tok~,ro~ ?P 507-o ~ Q,; f ~ S ~ . --C ^ ~ S ~ S _ ~ U C :~ A ~ 7 ~ ot c l . ( 1 r~ 2 0 ) . ~.:
~ ~ ~ .L Op ~ l _ Q ~ J, ~
Cel s, C. Baserga, G. Crose, and G. Rovera (eds.) WistarSymposium Series, Vol. 1, A. R.~Liss Inc., NY, pp. 169-185]; infectious agents [see Fraley, etal. ( 19~6) ~
1~ CRC Crit. ~ev. P12nt Sci., 4: 1-Lt6); and Ander~on ~ 4), _ _ _ _ Science,:226:401~4:09]; microinjec~ion mechanisms [~
: Crossway,~etal.~ 86),~Mol. Gen.:Genet., 202:179-185];
and~h:igh veloc1ty~projectl;Le~ mechani:sms [~ee EP0 0 405 Transformant~ are isolated in acoordanoe~with :~ oonventional methods9 u~ually employing:a~selection techni~u~, which~allow3 ~r qelection oY ~he desired : organi~m a3 against~unmod~ified~organism~: Generally~ .
~; 25:: after being:transformed, the::host cells are g~r~wn for ~
abaut~48 hour3~to allow~for~expre sion 0f marker:genes.
The~:ce:lls are :then:p;~aced in~selective and/or~scre~enable ::
~: media,~where untrans~ormed cell re distingui~hed ~rom~
: tra~formed cell~ either-by death or a biochemical : ~property. The ~elected cells can be screened for : expr ssion oE the midgut-effec~ive plant cy~tatin by assay techniquès sueh as :immunoblot analysis,~enzyme~
linked~immunosarb~nt assay. radioimmunoassay, or Pluore~cenoe~activated cell 30rter analy3is, ~:

' ~ `

:~: ' .

W092/217~3 PCT/~Sg~/~7~
~ "
2 ~ - ;

~ s~ 5- ~ r ~ t~5 :lk~ s~
tissue3 arQ then tes~ed for insect con~rollin~ ^c~lvi.-A :r.os~ ce~ J be trans~r~ o ?ro~J '- 5 s~urc_ ~r~ r. ^;~ ~-s~ r.~ '__3 C~
~ con~a7ni.q~- ~re 55~ o~- r.~_~^a~ ~a~ 53' ~ ~
subsequen~ introduc'~ion into ~h~ desired hos~ c~lls or for whic:q signiflcant qu2ntities o tne pro~ein may DQ
expre3sed and i~olated. Exemplary recam~inan~ nost eell~ lnclude unicellull5r proka~yotic and eukaryotic r~ins. ?~ck~r~c- ^ r.~crooes ts~ J be US5- -s r,o~a include Escherichia coli, and other Enterobacteriaceae, Bac~lli, ;
and various Pseudomonas. Common eukaryotic microbes include Sacchromycescereuisiae and Pichia pastoris. Common higher eukaryotic host cells include Sp2tO or CHO cel1s~
: Another pre~erred host is in~ect cells, for example Drosophlla larvae~, in which: ~h~ vector contain~ the s Drosophila alcohol dehydrogena~e :promoter.
Alternatively, baculovirus vectors, e.g. t Autographa 20:~californlca ~uclear polyhedrosi~ virus (see M:iller etal.
:: (1983),~ 5~ 219:715-721) may be engineered to expr~ess Iarge~amounts 0f the midgut~e~ective plant :cyst~ti~ in cultured inseces celIs ~see Andrew~ etaa. -:
:~ : (1988~, ~ , 252:~1g9-206.
The pr~ent:inv~ntion proYide~ an agricuLtural ompo~ition ~or appli~cat;ion to plants or part~ thereo~
which ~are ~u3cep~ibl~ to infestation by in~ects having digestive cysteine:protea~es, ~aid agricultural 3 composition comprisi!ng:~midgut-e~fective plant cy~tatin. Often the agricultural composition will contain a~ agriculturally acceptable~arrier. :By the erm 1'agriculturally acceptable carrier" is meant a ' :~
sub~ano~ which may be u~ed to di~solYe, di~perse or : diffuse an active compound in the composition without WO92/2175~ PCT/~S92/~,8 _~7~ 9 ~l~

i_~-i.~r.g t:- a _ _ ~ C ~ ~. ~ ~ 3 0 _ _ . . _ C n ~, ~ ~ " ~. ~ ~ ~. ~ W ;~ _ ~ ~. ~ ';
i~sel~ hac no detri~ental effect on t;~e 30i_ t e~'~i?m3~t .
^ro?s cr -g~nc.~ c ~r.v~re~

h ~ c ~ .~ ~ s ~ ~ ~, . . s .c ~
a '~.&- vcrie~; û~ ~ or.s _~ r.~ ?cw~ ~5~ c-~js~a:s, sucpen.sions, .usts, pell rs, gr~nules, s~.ca~sulations, mic~oer.capqulations, ae~osols, soiut~.on~, gals or otn~r dis?ersions. In add tion to appropr~at~ liquid or solid c~ rs. compositians may include ~d~uvants, su~:~ a3 ~ e~ Lfy~r.~ ar.d wett~n~- Q~ ~3 . S?r~ - a~_n~3 ~
~: dis?. sing agents~ adhesives or agents wnicn stimula-~e insect feeding ac rding to conventional agricultural practices. Adjuvants ~or the formulation of insecticides ar~ well known to those ~killed in the art.

; :The concentration of midgut-effective pIan~
:cystatin will vary widely;depending upon the:nature of the~particul~ar f~ormulation, particularly whether it is a 20~ conc~ntrate or:it is to~be used directly. The midgu~-éf~è~t:i:ve~plant cystatin generally will be preqent in at l:east 1 percent~by weight and may~ be:up to 100 percent by:wei~ght.

25~ ~ The pre~enta~ion~of:the agricul~ural ;compo~ltion may be~achi~e~ed by external~appl.ioation ~
:e:ith~:r~d~irectly or in:the~vicinity of the plants or ~:
p:lant parts. The:~gricultural compositions may be applied to th~ environment of the inse~t pest(~s), e.g., !plan~3~ ~oil or w~e~ ~by~spraying.~dusting9,~ p~lnkling,,, or ~he like.

rhe pre~en~:~invention further contemplates u3ing rec~mbinant hosts~ .g.. microbial ho~s and :ins~ct viruses);trans~ormed w~th a gene encoding the ~: -: ~ .
: .

W~92~17~3 P~/US92/~7~
2 i d 9 ,~ 13 -~8- .

.
_- 'Je . izn C'JSt- ~' ?. a~.d ~??~-d on ~r r.c~
selected pian~ cr plan~ pa~t 3usce,~ti3i~ to at~ack ~J a '~a~gQ~ inscc~. Th ho3ts are s~lected czpa~ls of coloni21r~ ~ ?lar.t ti~iu~ susce?tible to in~ec~
i nfQSta~iCn or cf ~e r.~ -??iied as d~- o~ ,?n~
c~lls contal-.ing t-ne ~ld5~t-eff~L~ve ?la..t cys~a'.r..
Mic-obial hos~3 of pa~.io~l2~ inL~ss~ b3 t~
p~ok-r~Jotcs --r.d 'he lowe~ euka~yotes, such as f~

: ~ Characteristic3 of microbizl hosts for e~c psulavin~ ~ mid~ ctlve ?ia~.- c~s~_:in _n~ 5 protective qu2iities for tne protein, sucn as:~hic~ celi walls, pigmentation, and intracellular packaging or ~ormation of inclusion bodies; leaf affinity; lack of :mammalian toxi~ity; attract:ivene~s to pest~ ~or ingestio~ni eas~ of kiliing and fixing without da~ag~ to the midgut-effectiv~e plant cystatin; and the ability to ~;
be treated to pr~olong the activity sf the midgut~
efP~ctivè plan~:oy~tatin. Characteristics of microbial 20 hosts ~or colonizing a~plant include non-phytotoxicity; `~
ea~e:of introducing a genetic sequen~e encoding a :m~Ldgut-er~ective plant cystatin, availabilit~ of expres~ion ~ystemsl effi:o~iency of expression and ~ t:abili~y~of the insecticide in the;host.
:~ - 25 : Illu~tra~ive prokaryotes, both Gram-negat,iYe ~ :
and -poqitive, includ& Enterobacteriaceae, ~uch a -Escherichia; Bacillaceae; Rhizoboceae, such as R:hizobium and :~
:: Rhizobacter; Spirillaceae (~uch a~ photobaeterium~, 3 Zymomonas, Serra~la~ Aeromonas, Vibrio,~ DesulfouibrioA
Spirillum; Lactobacillaceae; Pseudomonadaceae (such a3 Pseudomonas and Acetobacter); Azotobacterace~e and~ ~
Ni~robacteraceae. Among eukaryote~ are ~ungi (sueh as Phycomycetes and Ascomycetes), which includes yeast (such as ~accharomy~e~ and Sch~zosaccharomyces ); and Basidiomycetes , WO92~ 3 PCT/US~2/~785 -29- 2109~13 s ~ ( s ~ c Rhoc~otor7~cla, .~uroosasidillm . ,~pors~olomyces an~ the like.

h3 pr~ on - i SG ~ 0~ ~ S ^
'o~_r~s ~r.~~ d~ -. 3 ~ 3, ct v~ pia~ Ja ~2_' ~1. 3a_u;~ ~ s ~ 5 ~, ~5_ t~at i~.~e^t Heliothis virescens (cotton bollwor~), Orgyla pseudotsugata (Douglzs ~ir tusâocK moth), Lymantriad~3par (gypsy moth),AutQgraphic~callfornica (al~ah a loope~
Neod~prionsertifer (Eur~pe n pine fly) and Laspeyresia pomanella (coddl~n~ ~oJk) nav~ r^~ 3d ~ us-~
as pescicides (se~US ~',745,0~i and r? 17~ a~2) .

The recombinant host may be formulated in a variety of ways. It may be employed in wettable powders~ granules or dust , or by mixing with various inert ma~erials, such as inorganic mlnerals : : ~ (phyllosilicates, carbonateQ9 sulfates, phosphates, and :,~ the like) Qr botanical~matsrials (powdered corncobq, 20: rice hulls9~walnut ~hellq, and the like). The : formulations may ine:lude spreader-sticker adjuv nts~
abilizing agen~s, other insecticidal additives ~: ~ur~actants, and bacterial nutrients or other agen~s to enhance~growth or ~tabilize bacterial cells. Liquid ~:: 25 formulations may be aqueou-~-ba~ed or norl-aqueous and employe~d as ~oamq, gels, u~pensions, emul~ifiabl~
concentrates, or: the~like. The ingred-lents may include rh~ologi~al agents,: ~urfactants, emulsif iers, ~: disper ants, or polymers.

Alternatively, the midgu~-effectivs plant cy~tatin ~an be incorporated into thé~ti sues of a .. . .. , . . . " , . ..
-~ susceptible plant so that in the course o~ infesting the ~lant the ln~ec~ eonsume in~ect-controlling amounts of the ~ele~t~d midgut-effective plant cystatin. One W092JZ~7~3 PCT/~IS92/W7 ~3~

~ h~d o~ 3 i3 ~~ ' r.~~c~ r.~ "_A~
e~fec'iv ?lar.-~ cy~,at n in ~ non-?~ x c veni~ie ch ~ r ~ 5 ~ 3.~ nistr~1 5 ~. ~
sUcc~?ti~le ?l_r.ts. :-owe~e~, s ~.ce L ~.a ~en~ which coce f3. ~_~_ ~ ~ v~ __-..~ cys~ ~o_- ~. ~:._ inven',ion conte~plat33, ln a prefe~3d 3.~odim3n,.
t~ns~nic pl~n~s wr. c~. 2~ c_pâ~!3 ~ bi~lc5ic~'1J
~nth2s~zi~.5 mi~ ef~ee' i~9 plant c~Jslztin to pro~lde ~h3 31â~3 ~ th ^ ~.~w, o~ an â~d 'i~na!. ~e~hc.~ sl. of t__~ -_.s ~ ~X ~ t ~, C ~ _ ~ 3, 1 ' .
The inventlon provides methods of imparJ~n~ :
resi~tance to insect infestation by insectq having digestive cyqteine protea~es to plants of a susceptible taxon, compri~ing: (~) culturing cells or tissues from : at least one plant from the taxon; (b) lntroducing into the~oells of the cell or ti.~sue culture a structural gene encoding~a midgut-e:ffective plant:cystatins :operably linked ta plant~regulatory~sequences which :20 ~cau~:e expression of th~ midgut-effectiv~ plant ~ystatin gene in the cells~ and (c) regenerating inaect-resistant whole plants ~rom the cell or ti3sues:culture. :

: Ob~iou~ly~ the~expres-~ion of;:uniquely hi`gh : 25 ~:quanti:tie3 of midgut-effectiYe plant cy~tatins may be deleterious to the plant itself~ The u~e o~ a ignal :~ sequenoe to ~ecrete or ~equester in a ~elected organelle allow3 the protein to be in a metabolically iner~ ~
location until releaQed in the gut enYironment o~ an ; 3 in ect pa~hogen:.! ~oreov~r, ~ome proteins are ~accumulated tQ higher l~vels in tran3genic plants when ~ : : they are ~ecreted from the cells. rather than tored in : the cyt~sol (Hiatt. etal. ( 1989), Nature, 34~:76-78).

~: .

~'092/21753 PC~/US92/~/'8~

-3l- 21f~ 13 T~ A ~e~encs r~ hs 3r.~
origir. tes from, or nas substantial se~uence ;~o~.o og~ ~,o ~_tiv_ ~__.~., c,3~ ,r ~ ~.~., .~ r ~
?l~nt of ~ ~pecieq d f~s~sst from thct of th5 :_r~5-, or~.ie-. ~.cwsve-. ~h~ ^ 3NA ~ e.~c~ is os- ~:~ c;~
originates fro..., cr ha~ subs~ant7al seq~lencs ho~o c~; ~3 a ~id~ut-s~ee' 1 V2 plan'~ C'~ s'a'~ln O- g' r.a i..g pla-.t o~ the s ~e spe^ es ~s 'haL c~ ~he ~arg5~ pl~
SUCS Se~U5nCe ~2y be ex~resse~ l~ s 3ni ficantl-J ~r5-~"r ~ ;
-7 /~ 5--G'`''` .,S ~ ~
~; `
;: In ord2r to optimize tAe transcriptional and translatio~al efficiency of such systems, it is possible to examine the ~requenoy of codon usage and determine -;
which codons are, in essence, pre~erred within the transoriptional~and translational systems ~orma}ly pre~ent in that plant O ~ Using quch oreferred u-~age codons~ it i~ passible: to construc.: a protein coding se~ue~Ge which may result in a significantly enhanced ~levél o~ tran~cri~ptional;and tran~lational~efSiciency of : ; the:midgut-2ffe~tive plan:t cystatin gene~compared to ~ -:
: what would be achieYed b~ taklng the coding~sequence dlreo~ly~in an ummodir:ed Form of the donor plant.
:: 25 &enerally, the in~ertion of het~erologous genes -: appears to be random u~ing any t:ransformation technique;
:~ ` however, techno1ogy ourrently exists: f~r~producing:
pl~nk~with site ~pecific r~ombination of DNA into plant oells (~ee W0/910g957). The activity o~ the 3 ~orei~n gene` in~ërted in~o'iplant cell~ is deipendent upo'n ~h~ expre~ion characteristic of the individual :in~rted ~enes7 reqult1ng from control regions ~ (promo~er~, polyadenylation r~gions, enhancer~. etc.) : ~ , WO92/~17~3 PCT/~S~2/~78~
21~319 -32-o~ t~ .c~ o~ .cl~ ?l_-. D~A
t~e chimeric i~ser~ and by tne copy numDe~.

The pro.~ote~ selec~i sr.ouic :e ca~3l o~
c^^~s r.~ s~ -x~ess~
? r o d u c t i o n O _ ~! .'1 _ . . S ~: "; C O . ~ O ~ b ' ~ O L " r. 3 " -,, Suitabl~ promot~s mzy include both thos~ whic~. a~
derived from a gene wnlcn is na~urally expr~sse~ n nts and syntnetic promoce~ sequences wnich may l~clude re~ur.d~nt or heterol~gous ~nan _~ ss~uence3.
In oases wn~ 'h 3~quenc~ is G-~- V~ a.~ - ?i~.n~
source, one can use the 5' and 3' no~-~ranslated region naturally associated with the particular gene. A number of promoter~ which are active in plant cells include the nopaline synthase, octopine synthase and mannopine syntha~se pramo~ers from:the tumor-inducing plasmids of Agrobacterium tume~ac~ens.

In speci:e~s whloh produce a midgut-effe~ctive plan~ cystat~i~n but in`~lower than insecticidal:amounts,~
t~may:be:prePerable~to~overexpress the~midgut-effective plant cystatins in: the~same plant, and even tissue, from .
whieh it;~as derived9 whereln th; midgut-e~fective plant cys:tatin:s:is expr~es~ed-at ~ignificantly greater levels ~ ;
: 25 ~han normally ~ound. By ~ignificantly greater levels is meant~th~ produ~tion~of the: midgut-e~.ect:ive plant cy~tatini at level~s at :least 50% great@r than `normally ound :in untrans~ormed planti of the ~ame speci~s.
Accordinigly, the pre~ent invention contemplates con~titutiiiye pro!m~t~er~ s;~ch that the trans~rmed plant.
ha~ incre~d tolerance to insect pest~. Examples o~
¢:on t~itutive promoter5 include the;CaMV l9S and:35S:
promo~rs (JP 63287485~), ubiqjuitin promoter7 the rice actin promot~r (W0 9l09948~).
, :~ ::: :
, : ' , , :

WO92/217~3 PCT/~S~2/~78~ l~
-33- ~ ~'J~ 3 1 ~

,~"
_-. 3?~ s ~ h ~ c~ 2 ~.c~ ~l ~ld_,~
2fL ective ?.a~t cystatin ~hicn is no-~ produce~ ,~ or ?.Ot d~sr~ibuted ~o ~'SQU3S w~.ich ~ .ormal'~ nfe~'~A wlth 'he i~Qe^'s. a tlssuc speeif~c ~romote~ c~n be us~ o ?rovide lec_ lze~ ex?res3ion of or ot/o~ d~_,ior. c~ h_ ' midgut~e~c~ive ?lant cys~a~i?~s. Ex2mples ol~ tissue ~:
3pecific prc~.oter~ i~clu~_ th3 t~oo~ spe~-1 f~'c ~omote~.s 3ueh 2~ ~ai 7C m~'allothionei~ (_? ~5~g), the root spe^_fic pro~ot3~ (W0/9113997) the ?l~r.' aeed s~o~-_-~oty p"3~ Y' (W0/91 13353~ . ~''.'' t~ ^0~
dehycro3^~-se-~. oro~o er. ?~~~c;e~s 'x-.cw-. 'o ~- : 3 inducible include the promoter of the gene eneoding the ~mall 3ubunit (ss) of ~he ribulo9e-1,5,-bisphosphate carboxylase ~rom soybean~and the promoter of~the gene 15 encoding the chlorophyll a/b bin~ing protein in greening ~
leave~ (Coruzzi etal.,~ (1983), J. Biol. _hem~, 258:t399; .:
~ and ~unsmuir 9 et al. (19~3~), J. Molecular and Ap~. Gen., : 2:28~3.
:
20: ~ ; Finally,: a wound or pathogen inducible promoter Oan be U~d t~ PrOVide eXPreS~iOn O~ the midgUt-e~eCt~iV:e P1ant CY tatinq When a tiqgUe iS attaCked bY a P1ant Pe~t. :EXamP1e ~Of WOUnd Or PathOgen indUCib1e PrOmOter9 inC1Ude the PrOte~ina9e inhibitQr II PrOmOter.

: : : SUitabLe VeCtOr~ ~Or tranS~Orming P1ant ti~SUe and PrOtOP1a~tS haVe beZn~deSCribed in~the 1iteratUre and are ~et fOrth here1n ~See deFrammOnd etal. ~1983~ ~ ;
~ 262; An e~al. ( 1985), ~@Q~ 4:277;
3 POtrYkU~ etat. ~1g~5),l MQ1~ G~en~. Genet.~19~:183; !' , ~ "
ROthStein e~aZ. ( 1987), Gene, 53:1~3; WO 90/08829 and W0 84~02913; and, in a Pre~erred e~bOdiment, PD:AB7.19~-NOt (aS de~Cribed 1n the EXamD1eS~. It~iS nOt neCeSSarY in PraCtiCe that the VeCtOr harbOrin~ the Se1eCtab1e marker gene a1JO OOntain the gene Of intere9t. Rather, CO-:

WO92/217~3 PCT/US92/~785 _34_ .
3`~

t~a-.c~r~ . o~ s_c:r v~ s ~ J 3e ~ce~ .S~-3 ;~
plant c511s.

V' ? r C i.~ ' 3 ~' 5 '~ '~ "" a ~ r 5 ~ ~

?_a~ s?-c -s ~s_~ ^._-a; ~ _ a _ _ speeies of plar~t~. Ef~icIe~t regen.er~ion wi'l d3?e~d upon tné mediu-T~, on the g3.~.0t-~?e ar.d o~ histor~ o~ `"
the cultur~. Oncs whole olancs nave De_r. obtair.ed, tney can be sexl~ally or clona':ly r~?roduced in such a manne~
t;~a^ ~ e~ 3r.3 CODy ~ s~r~e~.c_ â ?~_s_~.~
cells o~ tne pro~eny of tne re?~oduc~ion. aucn ~.
procadures may be chosen in accordance with the plant :~
species u~ed.

Mature plants~ grown from the transformed plant cells,~may be sel~ed to produce an inbred plant. In diploid pla~ts,:typically one parent may be:transformed and th~ other parent:may~be the wild type:. The parent :20~w~ill be orossed:to ~orm~irst generation hybrids (F1)9 which are ~elfed~to produced second generation hybrids :
(F2). ~F2 hybrids wi~h~the genetic makeup~of midgut- ~ -e~fective~plant cys~tat;in/midgut-effective plant cystatin are chosen and selfed to produce an inbred;plant.

Conventional plant b~reeding~methods~ean be used to transfer the~midg~ut-effective plant cy~tatin :
, structural gene via cro~sing~ and backcrossing. Such method~ comprise the further steps of ~a) ~exually crossing t;he insec,t e~ tant plantjwith a:plant from I . -the in~ect-susceptible variety; (b) recovering reproductive material from the progeny of the cross; and ~c~ gro~ing insect-re~iqtant plants from the rep~oductive material. Where desirable or necessary, the agronomic ~haracteristic3 of the susceptible variety :
. :
: :

.', W092/~1753 PCT/US92/~785 -35~ 1 J

?. be ~ 5 3 ~ ' y p r 5 3 ~ r ~ J ,r - ~ S 2 ~
tO include the ~ her s~e?3 c~ rep- i;lve~J (dj back ros9ing 'h~ insec'-rss s~ prsg -rr ~ith ~ns c~-su~captible plants fro~. t~.e s~cceD~ v2riet~, _r.d (e) ~3 e '~ a c ' _ r~ ~- ' 3 r ~ x ? r e s s ' o .'~ 0 ~ t ~ '' t ~ ~:; 5 ~ o ~
J a-~sociated ~ark~ gene) amon~ t;~ ~rCg~?.'; 5~ the h2~kc~o~ c~ n t ~ ''3 Q ~t l n ~ e n~l e~l t~ o ~ L ~5 charac4e~isL~cs o~ the S1lSC3~L ibl3 Vcr~ et'i a,re ?r5S~
in the prog~r,~J ~lor.~- w~th th= 3~r.e i~?~ r.g insen' s~_nce. S~bse~u~ J. '~- i-.~r~s produce the hybrid.

The present inventisn further contemplates 1~ using, with the midgut-ePfectLve plant cystatin, ; : adi~vant~ che~ical or biologic~l additives:in an e~for~
: :;to ex~and the: ~pectrum of target pe~ts, to extend the :duration o~ effecti~eness ~f the mldgut-ef~eckive plant ¢ystatin or to help stabilize the agricultur~al 20:~:composition o~;the:mi:dgut~ef~ective plant c:ystatin.

Exemplary::poten:tiators would include lectins, -;: amphipathia proteins or complementary prot~einase inhibitors. For example? the presence of~:mor:e than one 25 ~dePen~ive protein,~:in the presence of other defensive : proteins, may have~ n important role in the plant~
:de~e:n~e against in ect attacks. Ik:i~ known that , Hemiptera and Coleoptera in~ect3 devéloped alterna~i~e pathway~ of protein digestion o~ foods containi~g high : 3 levels:of 0ertaLn protel;nase`inhibitors. It, may be adYant~gous to include inhibitors from families ~ucn as KunLtz-type inhibitors, Bowman-Birk inhibitors5 Barley Trypsin inhlbitors, ~potatD inhibi~ors:I and II, Squas~.
inhibitors 5 Raei 1 -2/Maize bifunctional inhibitors, carboxypeptidase A and 3 inhibi~ors and aspartyl :
: :

W092/217~3 PCT/~'S921~785 ~ ' ~ n~ 36-?ro~-r.~ c~s ~3~ Ry_. (14g~ . ?.
?~.t~oo 2~ hol., 28:425-~9.

rasen.t in~ on csn~-~. c~ s pro~
l~.- 5~ a tax~ c:~ _ a S " S C ~
a..r. da~.c~- ~J ~ 3 ~ C ~ a r.c;lr.~ e ~;s~_ ,._ ?rotaases, ~s?ecialL~ one or ~O~Q 0~ cor~ ~ootwor.s, Mexican be3n ~eetle, re~ flour be3tle, con.uscd ~lour be3tle, cowpe2 be3tIe, Doll wee~fil, Coiorado ~o~to beetle, t:~r~e-lined Dotato be~tleq ~ wee~rll. ma~ze . ~ .
we_vl~, gr~n~ w~Jl . i~CC~ r. :~o~ c Deetles, Egyptian al~alfa weevil~ bean weevil, yellow mealworm, asparagus beetle and squash bug. By the term "taxon" herein i~ meant a unit a botanical ; 15 classi~ica~ion of genlls or lower. I t thu~ includes :~ genus, specie3, cultivars, varieties, variants and oth~r :~: minor taxonomia groups~which lack a consi t~nt :~
~:~ nomenclatur~

20; Exemplary:pla~t 9 i nclude maize, sorghum, tomato, potato, cotton, soybean, dry beans, rape, alfal~a, a~paragus and sweet potato. However, it is not : ~to be con~trued as limiting, 1nasmuch as these in~ects m~y in~est certain other crbps G Thus 7 the m~thods of the invention are readily applicable to~numerous plant speci~ if they are ~ound to be susceptibl:e~to the plant specie~ li3ted~hereinaboYe, including;without limitation9 ~p8cie~ from the genera Medicago~ Tri~olium, Vigna t Citrus, Daucus, ~Arabidopsis, Brassica 9 Raph~nus, ~
~: 3 Sinapis,` Capsic~m. Lycopers~ni~ Nicotinia,~ Solanum ? ~
Helianthus, Bromus, Aspar~gus, Panicum ~ Pennisetum, Cucumis, : Glycine, Lolium, Tritic~m and Zea.
:: :

: , .
.. :

W092/217~3 PCT/US92/~78~
_37_ ~ 1jJ~ 31~

-'~2- ?'~ "
The pres~ nve~t~o.~ is L~ st~a~e~ i n. fur~ r ds~a_l by the fo;iowir.~ -xa.~?i-is. Tr._i ~ix_...?ies a~e ~or ~ pOQ~3 o~ :_,s~r--' c-. v..~ -.t ~ -.3; _3 ~_ cons~rueia as ii,Z'-~ih~ tr.i-i sco?~ o~ 2rs~s~
invention~ All pa~ts an~ p~c~r.ta~s ~r~ by w~
l~nless otherwise saecifically noteA. Ail DNA s~ue~ces a e giver. ir. the conven~ional ~' t~ 3' dl rec-io~. Al~
a~ir.o acid se~lenc~s a~ giv~ n c~J~ lor.al. a~ o-~ ~inus to carsoxyl~ C ac~ C t~ ., al-~c ~r; .

Example l: P~rification and characterization of potato papain inhibitor A. Purification Potato papain inhibitor (PPI) wa~ purified from the skin of~mar~et-purahased potato tubers essentially : : as descri~ed in~the literature (Rodis and Hoff, (}984~, 2Q ~supru~ . Typical yields were lO-SO mg pure PPI from the : peel fr~m lO lb of tubers. After purificationi the ~: protein was homogeneou3 as det~rmined by sodium dodecyl :: :sulfate-polyacracylamide gel electrophoresis and by ion exchange a~d reverse-phase high performance:liquid chromatography-:
B. Fragmentation of PPX by limited~p~o~eolysis 'PPI was fragmented into smaller polypeptides 30 ~hat re~aiined thel,abilit~ to inhibi~ cysteine protease$
- by incubating PPI w~th trypsin (treated with L-l-chloro-3-(4-t~sylamido)-7 amino-2-hep~anone chloride) at a PPI:~ryp~in ratio of 20:l ~weight basis) for 2 hours at ;: 37~C in 50 mM Tris buf~r, pH 7.5. This resulted in ~
s~able ~amily o~ polypeptides of -lO kD and polypeptides .

WO~2/217~3 P~T~VSg2/~78~
~ , .
21 ~ 9~ ~3~~

C~ ac:~le..~ t~s _ s_ 3C ._-'~7'~_ _S_~'.~
othe prot~ases sucn as c;-.y~ctry~sir., SUOt' lisi~.
Ca::s~e~ '~5e '~. a~ r~..cl~7s ~ s -.c t-.e sær~
c~r~ r.~. T~, th~s-~ ~ ns-a~.c~s, ~ 22 k~ (r~ er ~,a5 32 ~3~ s?~'~'-'â ~S ~31 ~se~ c~ ?. :0 ~ 0 s~ecies.

Trypsintreate~ ??~ was frac-ionated by s_ze exc'uslon chromatogra~hy using a SuDerose 12 column (Pha ~.~cia rx3, Pis~t2way, NJ). ~his resulted in two ~e~s, ~r.e _ir-~ c~ e~. c^r..~.s rhe -32 k3 s?~ie~ ~-.c the second, the -10 kD s~ecies. These were furtne~
purified by ion exchange chromatography using a Mono Q
HR~ S/5 column equilibrated in 20 mM Tris pH 7.5 and developed with a 0-150 mM NaCl gradient over 30 minutes at a flow rate of 1 ml/minutes. The resulting fragment~
(two -32~kD speci~es and-~six -lO kD species~are all potent inhibitor~ of papain and of Diabrotica gut proteases tsee Example 2~. :
,.
: ~ ~ : ? O
. Trypsin-digested PPI was~also~separated by ~reverse phase chromatography using:a:Vydac~C4 column : : e~uilibrated in O.l~ trifluoroacetic acid and developed with a 0-60~ acetonitrile gradient. This resulted in 25~ five peaks containing~the -10 kD polypeptides tnamed~PPI-~; : lOK-l through 5) and two~peaks:containing the -3~kD
pvlyp~ptides (named PPI-32K nd PPI-33K~

C. Stoich1ometry and inhibition constants for PPI and 30 'che ~rypti'.c f ragments ! 1 ~
The inhibito~y~activity of the polypeptide was assayed by m~nitoring the inhibition o~ papai~ in the presenc~ ~f ~arying amoun~s of PPI. Papain activity was measured by methods as~ d~scribed and referenced in ' - . , , ; - ~ ' ' ' ' ' , "'' ~092/~17~ PCT/US92/~,~S

_ ~ g _ ~ J S ' 3 ~ _0~~ V ' r _~,~ Jr,~3~ C~' ap?-~a-~ e5. ) ~
B~nyon and 'J ~ S. 30nd tl989), _~ pr~5~ ~Y. SuD~tra~s ~e~e ~3c~se~., b~ g'~.i.-.~ va~ a~
~ A) (s?e~-~o?ho'~m.e- ~ as3ay) sr Z~ arg-N,~e~
(whe a ~ yl~x;c~ nv , ~r.c ~ = 7-a~ ~5-4-methvlcoum.2ri~ luor~m~~lc a,~ay).
.~, Tl~-a~ions o^ pa?aln with r~I usiny 3APMA as subs.rate and spec~ropho~ometFl C21l y ~onltorlng t:~e rele~s~ of ~ara-nitr~pr.enol at 440 ..m showed tha' 28 'û ?moles 3?_ s~ cnio.~ ic~ily .ni~ 2:, ?-..ol~s papain. Typically 5 ~g papain was titrated witn PPI in `~
0.1 ml 0.1 M sodium acetate, pH 6; 4 mM dithiothreitol 2 mM sodium EDT~. Reac~tions were initiated with 0.1 ml BAPNA and the absorbance at 410 recorded after 1 hour using a ~icroplate:read~r. The stoichiometries obtained ~`; indicate tha~t the~re are~8 binding sites for papain per PPI molecule. ~This stoichiometry is unchanged after ;~
trypsin~treatment to ragment the protein into the 10 kD
::: 20 and 32:kD pol~peptides:démonstrating that the ability to '-- i~nhibit cysteine proteasP~is maintained even;a~ter limited proteolysis. : :~

The inhibition constants ~Ki values~) for PPI~- :
25 ~8~K~ PPI-lOK and~PPI-~2K against papain were determined ~:
by::the sensitive fluorome~ric assay using Z-Phe-Ar.g-NMec adapted from Barrett and Kirschke (198;1), ~
y~ , 80, 540-541j.: Initially, titrations of papain (50 ng) were performed with various concentrations of ~ 3~ PPI (10-100 ng) at 20 ~M final; subst~at con~centration :~ to obtain inhibition::profiles of each polypeptide.
Re~ctions were ~tarted by addition o~ Z-Phe Arg-NMec (0.2 ml) using a Cos~ar multipipettor to give a final Yolume o~ 0~3 ml. Hydrophobic interactions of PPI with :the mi~rotiter plate required the addi~ion of 0.01%
, ' ;

.

W092/~1753 PCT/US92/~785 . X-'~0 ('i~J) -~ 03~ . d~-2 c~ a ~Di~ a-seerl at highe papa~r.ji~Aibltor conco~ Grs ~s ..5 ~
'e~a sens' _i.JD 3~ a,~Sy. mh~ ?ros ~.c~ or a3s~nce o-~i~cn ~.a~ ro a?~a~. e--ect on calc~l2,ed '~ va ues.
~a-~ we ~ c_l:e~-o~ ~si S a ~ ros~a.. ;_~ :u~
microei.e~ ~3la-e ~e?der a~.acned to a ~lomera;iics~U
d~a coliec i 0?. ,o--~ar~ sys~~.~. h2~ir.g '.~inetic ca~abil~.ies~ ~xc t~t~o~ ar,d e~ission wavelenglh were 380 ar.~ 460 r.~, res~e~ti~Je1y. ~ir.e~c assaYs from wh~ch ,z ~- s ~ ~ = C~ 7 = r ~ '? ' C s 1 ~ 3~ r _ ~ rm e~ a ~. _~_~ ' J~.~ ~eCS~s ~~ V~ J~'' 5 '` 30, ~: 50, and 70~ inhibition of papain, and substrate c~ncentrations ranged from l to 20 ~M. The Ki values for PPI-87K, PPI-32~ and PPI-lOK were O.l (~O.Ol), ~.7 (+0.06) and 0.5 (~0.02~) nM, respectively, indicating that the inhlbitory poteney of the fragments~is 5imilar to~ that of ~he~parent~molecu~le.

D.~Amin~ acid~s~quences~ of PPI an~ tryptic fragments.

The PPI fragments purified by~reverse-phase :
chomatogr~aphy were subjected to N-terminal:amino acid sequencing~u~sing an:ABI 477 1iquid phase s:equencer with an online 120A PTH amino acid analyze~. Extended seque`~ce informa~ion was:obtained for PPI-lûX-4 and PPI~
lOK-5. The pa~ent 87 k~ polypeptide;:(PPI-87K) was~also segue:nced, but was~:resistant to Edman de~radation. PPI-10~2 was also resistan~ to N-terminal sequence analysis : and 50 is presumably:the N-terminal fragment derived 3 from PPI ~7K. PP~-lO~-2'was denatured in ur,ea and , , further dige~ted by trypsin and the resultir.g peptides s2para~ed by~reverse-phase chromatography. :Three of the : puri~ied oligopeptido fragments wer~ sequenced: PPI-lOK-: 2-T77, PP~-lOR-2-~Sl a~d PPI lOr~-2-T32~
~ .

WO92/21l~3 PCT/US92/~7~5 -4l- '~ lu~ 3 1 3 m a~ sc ac ae~-e~c=s a~ s~a~. ~. ~ g ~.
There i5 e~tensive ,~omolog~ De ~ee~ tne sec~le?.cea ~n~ca! ~g that t:-e _-a~e~s are a'l re'a~e~. m~.e ^~
extend~d secuenc~ da~a oDta~ned '~om ??I-;~ , W25 ;-CO.-~a-ad t3 -;~a~ of ~e? e~s cys~a: n a~.d ric~ c~Js-~a i~.
(~is. 4~. ~hes2 da~a ,nc~ca-e ;~a- P2I cons~s~; o. 8 dG.. ~2 n~ t~: 2-e a'~ c~se'y rela-~d a?.d wniçh are al' ,~
me~bers c~ the cvs.a~n ra.~ily o- cystelne ?rot~ase ~nhibi-sr;.
G ~xar..pl- 2:. ~niDl~_3~ o D3aoroticc :-r-;a_ gr_~-h o;i P--.
: PPI is functional as a protease inhibitor either as an in~act 87 kD polypeptide or after proteolytic cleavage~into smaller one, two or three -~.
: 15 ~domain fragments. : :

The effect~of:PPI on the larvaI growth o~
Diabrot~ca~spp. was moni~ored as follows: 0.03 ml of pur:i~ied PPI solutions;(in water) was applied to the ; 2Q ~:surface~ of O~Z5~ml art:ificial diet ~adapted from Rose and:McCaber J. Eco~. En~omol., 66:398-400, 19733 in 24 well p1ates;and allowed to air dry in a sterile flow : :
hosd. The ~ell~ qere~hen infested with sLng1e, neonate ~southern corn:rootworm~(SCR, :Diabroticaunde~impunctata :~-howardi) hatched from:s:~erilized eggs or with ~ingle, pre~eighed second~ins~ar western:corn rootworm (WC~
Diabrotica uirgifera virgifera) . The pla~es were then pla~ed in ~erî~lized, ~ealed plastic containers and:put in a humidi~ie,~ growth,chamber m~intaine~,iat 2~5C~for 6 days (SCR~ or 3~5 days (WCR) prior to final we~ghing~

: A.:Effect on SC~ neon~te lar~ae :
Increasing concentrations of purified PPI were ~: used In ~eeding studies with neona~e SCR as described :~
:

WO 92/7~,7~;3 PCT/IJS92/04785 "10~31~ -42-~OV'. ??~ C~"Se~ a C~s~ o?~ o-. ~?.~. 3~ va:
5"3'~t-.!'1 '~Ji_~ 5i~ '?.AiD~:iOrl OC'~ _ 7;15 a- aPPrOXima~e1Y
O . 2 mg/g die~ Ure 5 ) . .~aXima' inh' bitiOn ODSe-~7ed was 73~ a~ 2.0 mgjg die . ~he32 da~a indica~a ~na~ ~?- ~.
; an e far- ve n~ tor of ,~ ~es-,a;e lc~'i2_ 5~
,':
3. ECfect on seconc-inslar WC~ and SCR ...
': .
WC~ larvae cannot be bi32s,aye~ as neo-~tes d~o ~: : ~3 ;he~r ina~iil-y ~ arow on a~ i- clal aiet. '~swe~e , ~C s:e~-.d i~.s~a~ i~ e ~ 5:~'~ 2-- C_ J~ ~? ^-- 2~ i2 :di ~ a ~r - - ~ d . ~ a ~ ' C ' e- ~7~ c-e~ ~.~ Ca ~
~ ab~ve. PPI caused a dose-dependent inhibition Of WCR
: larval growth with 50% inhibition occurring at apD~oximately 0.25 mg~PPI/g diet (~igure 6). At the 5~ ~hi~hest~dose tested (l.~0 mg/g diet), PPI essentLally halt~d~growth.~: Similar:exper~iments with second instar .
SCR~showed~ ~ reduced~ef:fect~o~f PPI on la~val growth (5:0%
inhibition a~ O`mg~PPI/g diet) in comparison to neonate~larva~ These dàta show that PPI is an : .:
:eff~ective~inhibitor~of~WC~ iarval growth. In addition, l~-the~stag~:specif~ic~ef~fects of~:PPI in S~R~suggest:that neonate WC~ larvae:~may be more~sensit~iv~e to ~the effects~
of~PPI:~han neona~e~:S~R.

Example~3:~9ynergistlc acti~on~of PPI-lOR in co~bi:na~ion wi:th a ca:rboxypeptidase inhibitor As demonstra~ted in Example l, tryptic~digest;ion :~ O of th~ i~tact PPI molecule produces -lO and ~32 kD
3~ fragments which are~e~fect~vé in vitro inhibitors of~
papaLn.: Intact~PPI and the; isolated PPI -IO:kD ~fragments al~o inhibit proteoly is~by Diabrotica r:ootworm gut ~ ;
:: : :extracts using:the same ~ssay system. However, these ragments ~ave little or no ~rowth inhibitory effect in : :.

,: ,::

:

:

W092/217~3 PCT~VSg2/~785 -43- 2l0~

-_^ri~.5 ;'s~c ;_ u-~ ?.g ~ ~ r.a~'~c~~ SC~l a-,r aer~?.C
_ns~a- WC?~ ~a-~ie 13. ~G ~ iV2 nis d__~a~~nc~ 2 s~n5' ~ive aSSay was d~v~lopea ~ directly monito~ ~he cy,t~ine ~rote~iy ic ac-lvlty in tne gUt juice o 1 rva~ :
â_-=r ?.5~_G-. O_ i.. _~C~ ?~ ? ' L:rg."e. _~, ' `' :

0.03 .~1 or ei:he~-P?I-87K or ~?--lOK ~ob~ained -~m trypsin diges~lo?. Oc 8~ k3) in w~ e~ w~s a~li a~
a 'inal concen-ratio.. o 0.5 ~s/ml of Gi et ~3 the sur.ace of 0.23 ml a -i~icial die as described above.
? a ~:-e c:e- -~ 5 ~e: ; ~as -~ .ove~ a~.~ ? ac~ ~ a s~erile pe~ri dish~ ~wer,~ o i~s.ar SC~ (rea-ec o~.
corn rootsj were then placed on the die~ and allowed to feed for 3 hours. After feeding the alimentary canal from each larva was removed~and placed in individual ` `chilled:Ep~endorf:tube~ :containing 50 ~1 SO ~M soaium acetate bu~fe:r, p~.O~+ 4 mM EDTA ~ 8 mM dithiothreitol .:
and~vortexed vigorously.~ Five microliters of the ` -.
:ext:ract ~rom~each tube was then added to 0.095 ml o the : ~O ~same bufer in a~96-well~plate and allowed to it for lO
minutes~ O. ml o Z-Phe-Arg-NMec were added to the diluted~ extrac~ using a~ Costar 96-well pipettor to give 20:~M final concentration. Data were collect~ed via a Fluroskan IIT~ fluorescent microtiter plate reader a~tached to~ a Bi~metallicsTY data collecti~on software - system~h~ving kinetic capabilities.:~ Excitation and ~-~
emission wavelength were 380 and 460, re~pectively. : :
Initial rates of substrate cIea~age were expressed as O fluorescence units/minute. ~ :

These data show that ingestion of PPI-lOK
result~d in relatively little inhibition of cysteine : pro~ease activity:in the roo~worm larval m~idgut~ In -.

. ' ' .

, W~92/217~3 P~/US92/O~i785 2 1 0 5 ~ 1 3 ~a :~: c~. z- s-- c ;5-3 ~ ac~
r^^ ~ i2' ~1, r; ~ ?-~
ae va~ ves ___ _ Sa.~Die I .~C~iV~ Y ; ( 1~10re,CQ~.C3 Cor.trol j 29 ~ 36 ,~1)T_-~37~ ! 70 . 8-L 14 .'1 1 24 ! _ _ __ _ __ :-lO'~ ~ 242.5 1 32.9 1 8~ ,:
'.J '-O~ a~r '~.j35-'0-1. C - ~ e'- 35' ~3-'~ r.:~i b i C; S ~ . 3 ~ 3 3 2 _ _ _; 1 . ~ ~ _ _ . _ . . _ . 3 ~
:
': ~
.~:
:
:
1 5 : : :

: : ~ : ~, : . ~
, ~:: : : , . : : ~

~ ~ . 25 ~

:
~ 30 ~ . . '! ! 1 ` ,. ~

:: ~ ' ;:
~:

,~ :

: ' .

WO 92/~ 3 P~rJUS92/04785 ~4 5 - 2 i 3 ~1 ' 1 ., ..~

c-2 3 ~ C:~J?2--~ ~a~
i n the pres2~c~ a- ~? I -;0:~ was de ~r~ ~.''5 ' r. i~.s~s~
.g . sa ts . '"hese dzta are snown ~ ~1. Table 2 .
''2-_e 2 ~ o ~ yp' c ..
--3C~ 3 C~. g~rW-'l O_ .e~na-3 ,~ r.e:~.
co r ~ ~ .. ' 2 -;a-:
;.
. ~ , ~ .~NT L~AL W~ Ç~7~
( mg/g aiet ) ( mg ) :.
C-~r.~ 3.
'0 ('.0~ 1 3.~.0 ~ 0-2 !
, . .~
~: PPI-lO ( O . 25; 3 . 09 :~ 0 .19 '':
~, _ __ _ _ _ PP~-32 l~.25) 3,70 ~ 0.28 .
CPI (O.25): 3.6~ ~ 0.l~l ~ PPI-10 :(0.25~ + ~ : 2.15 + 0.15 : :
:~ CPI (:0.~5:3 ~ - Values --e th- ean + SEM from 5~ separate experiments ~::

~: : : :
, ~ :

.
, ~ .

WO92/21753 PCT/US92/~78~
. . . .
~ ` Q v ~ 1 3 - l 6-~;e_-q- ~c ~ cx~-?e~ 5 -~
~?--lO~ a'one (e~c:~ a 0.2i mg/g diet) r.ad ar.y e-fec 3~.
~^^~~3~~ a~~2' 5--~ s~e~ 5 ~
we-s cs-.~l-.e- _n --~ d ~-, = s 5 - ca~.- :sd~c sn -5~ a, ,~ Z-=~ 5 ~ a- s~
cor.ce~r~-ion OL in~ac PPi. Peps~a~n, a car~oxyl P~3-3~ n~1Dit5. ;.ad z s~ b~- s~ e--ac .

~o signi~ ca-t e-fect ~o- ??--10'.~ ~a see~ 'n C5a~- -, 2;-~ S C- 2-.~ ~nst~ 'AC~ !Ta~l~ 3).
l Ac~ n~l y~ no ai5nl~ c2nt e__~- o ??_-10 carboxypeptidase in~ibitor:was seen in feeding assays of 2nd instar WCR (data not shown).

Table 3: Effec~ of PPI tryptic : fragments:on~g~owth of se:cond instar western cvrn rootworm larvae ; 20~ T~IA~EN~ WEIG~T GAIN
:(mg/g~ d~iet~ ; (mg) : :
: ~ Control ~ 7.65 + 0.35~

:(0.25) : 5.99 ~ 0~41 :
25~ ~ 25) 2 ~l ~ 0:~ ~ :
: `: ., ;;

* Values are the m~an + SEM~from 2 separate 3 experiments :~ , .
:"

~:

WO92/~1753 PCT/~92/~785 ;
_~7_ 2~` U5`'1., `

--Xc~ 3~ T ~ .a~ 2 C'~~CXJ~
pro.ease innibl~

P~ ibi-~d 60-90~ of r30t~0r~ gu- ~ :
p-~t3~-' vsls de~e~c~g or. t:~e ~I?e of ?-~ u,e~ z, 2 substrate in th~ as~ay. ~he remalni-.g ?ro;eoly; c ac~ ty wa, e -~ ve'y inh~ by ?e?s at -.r a ca~oxyl prot~,e ~ hibit~r~ ~his was s;ncwn as follows:
: cllute~ SCR gut ex-~ac- and t:~e Zp?r^~r ~e ir.hib~ s : (??~ ~2s ~s~ ~- 4~ ~g~ al c c~ r~ ?~
__ 8 ~g~ _3~1 c~ce~ o~ ) W2_5 C~ -3 : volume of 0.05 mL }OO mM sodi:um aceta~e buffe~ pH 6 + 5 mM EDTA + S mM dithiothreitol. The assays were initiated wlth 20 ~l 0~5% fluorescein isothiocyanate (FIT~)-linkèd hemoglobin or casein prepared as desc~ibed ~:
in Twining (Ana_. B~eh5~ 143:30) and quenched af~er 3 hours at 37C with 75~l 12.5% trichloracetic acid.
: Af~er 30 minutes at 4C, samples were centrifuged and the f1uorescence of t~he supernatant determined after 20: mixin~ with llO ~l M T~i~s pH. Results are;given as~
percent (%) inhibiti:on relative to a control~containing no inhibitors.

: ~ :

~.

: 30 ~ i 1~ ~ 1 1. . .
: ~ . : : :

- - ', ::
` , ., WO g2/21~53 P~/US~210478~
2 1 q 9 ~ 8- ~

~aL,l~ ?- ~-.c pe~s~ . G'' ~n vztr~
p~~ s ~ ~a_~5 S~.?. :=~~a~ e-, ~ _ SU5~ ) _ _ ' C ~. I .
~?I FITC c~sein 91. 4 1 :
P~ FITC he~ogl~bin ~9 . O
Pe~s~ati?.FI~C casein 39 .
Pepstati~r ` ~c hemogl~bi n ~8. 6 ~?- :- ~e~s a~'' cas~ ~. 97.5 P5I ~ pepsta.~i~FITC hemogiooin 99. 2 .

;~ Similar results were obtained with WCR gut extracts, using~azo~lbumin and a20casein as substrates.
The~:~extent:of inhibitio~ of lar:val gut pro~eolysi~ by PpI~varies~accordin9 to~the pr~otein~substrate :in the or:der case~in>al~umin~hemoglobin. Inhibition by pepstatin~
:20~:;has :thé reverse~o~der:w~ith most inhibition~observed with hemog~lo~in a~ substrate~ Although PPI alone cons~iste~ntly inhibi~ts~a larger proportion o rootworm gut prot~eolysis~than~peps~tatin alone, neith r~inhibitor g:ives complete~inhibi~ti;on. ~However,:the combination of bo~th~inhibi~tors gives~ almost complete inhibition o~
: proteolysis for all pr:otein~su~strates.~ The combi~a~ion of an a~sartate protease i~nhibitor w:ith PPI in the die~
~ give3 enhanced inhlbition of Dlabrotica laEual growth, :~ 30 when.ass~yed as descr~libed in Example 2. :

Exampl~ 5: Construction of~ plant expression plasmids : The pla~mid~:pDAB219h-Not repre3ents a dual :: purpose veokor;oontainlng two gene~, each under the ontrol ~P a promotor expr~ssed in callus ti sue. The - ~ , .. :
.:
, t ~' WO9~/21753 P~T/US92/~7 -49- '2 1~?3 '1J
.:.....
~ r_~ ~-r~_~ a ~ a~ 2~ . s a ~c~ ^ ûe~c-glucuronid2se (gusj gene L rom Escnerichia coli unde~ the ~-~
.~r.~l_ l~r.-_ con~.~_ o. th~ C~ M J _, ~ _ r ~ L- 0 _ L~z~sc~i?ti~r~ 2nd ~o~ de~.yl~L~on ad~ o~. sl_r.2's ~
s ?pll~i ~y ss~uenc~ derive~ ;'ro~ - ~.03al ~.e synthz3^
gene. The second ~ne, b~r, is a s~l~ct2ble marker :~
wr.ich ccce. fo~ phospnir.~t~.ricine ac~'yl tr2n.sfera3ê an~
ls de~lved ~rom Streptomyces hygroscopicus. ~his ger.e is also uncer ~he reg~l tion of the CaMV ~5i promoter and r noa~ 3~n~h2s2 ,r^-r.s^~i~ti~n ~~~ir._t ~
, ~
_~^n;i^t~ s_~l e~r~s. Ihe g'l3 ge^.- ~: ~ws for t:q_ rapid analy~is o~ expression using commercially available ~lu~rometric or histochemical assays. The expr~sqion of the ~ar gene confers re~istance to the herbicide 8astar~ ~Hoechst), which contains as an active in~redient bialaphos9 thus, imparting a ~elective advantage to trans~ormed eells under selection pressure.
The sequences derived from Cauliflower Mosaic Virus (CaMV) represent the Cabb S strain. They are available as the:~M~ASTRAS~sequence of GenBank, and published by Franck eta~ 9Bo)~ Cell7 21:~285-294.:

A. Plasmids utilizLng the 355 promoter and~th~
Agrobacterlum Nos Poly A sequences : : -~; i 25 --~
The starting material for is plasmid~pBI22l, purchased rom ~ONTEC~ (Palo Alto~ C~). This plasmid :
contains a modified copy of the C MV 35S proD ter' as : ~;
described in Bevan etal. (1985), ~@ Q ~, 4:1921-1926;
3 Baulcomb~ e~al.` (i986), ~, 321:446 449; Jefferson ~t : al. l1987~, EMB0 J. 7 6:3901-3907; and Je~ferson ~1987), 5:387-40. Beginning at the ~:
: 3' end o~ the PstI site of pUC l9 ~Yani~ch-Perron et al.
~l98~, Gene, 33:103-ll9), a~d reading on the same strand as that which~encodes the Lac Z gene of pWC 19, ,: ,'.

,... . . .. ... .. . . . .

W~92/217~3 PCT/US92/04785 _ ,}9Xli ~ .C~ ' ~ c~m~ o -~~ 'l?.k~- r.t~c~~
GTCCCC, ~ollowed by Ca.~V nucleot~des 6~05 to 7439, ~llcwe b ~ t-.~ ker ;e~ue-.c~ .
G~-G&~C~C~r-~.G~-.TCrCCC-G~T5ÇTC C-~CC~, wh~ r ein -:~.e ~ ;
~de~ l-.e~ ~as~s repr~ e Bam-~ --~^gn - c~
sequence. These bases are then followed by 1809 base pairs (bp) c m?rising ~he ccc ..g se~ue~c~ c~ t~e Escherichia coli uidA ger.e, which e~code; 'he b-g}ucuron1dasa (GUS~ protein, and~4 b-~ o- 3' 'anking bases tha- a:~ derived f~~"~ E. c~li ge.c.e ~e_-a~
etal. ~1~a6 ) t ?~oc. N~l: Ac^~ .. 83~
follo~ed by the SstI linker se~uence GAGCTCI which is ::then followed by the linker sequence GAATTTCCCC. These : .
bases are followed by~the;RNA transcription :~15 termination/polyadenylation signal se~uenc~s derived from:~he Agro~ac~eri~mtumefaciens nopaline synthase (Nos) ~ -~ene,: and comprise~the 256 :bp Sau3AI fragment corr~sponding to nu~leotides l298:to 1554 of D~Picker:e~
al. (l982:)~ . Mo~LeL_~ee~ 561-573), followed :20 ~by two C residues, the:EcoRI recognition ~equence~ -GAA~TC,~and the rest of pUC l9. : ~ .
pBI~21 DNA was~digested with EcoRI: and BamHI, and -:
~; ~he 3506 bp fragment was separated from the 2l63 bp ~:
: 25 small fragment by agarose gel electrophoresis~, and ~then purified by st ndard methods. pRA~275 (CLONT CH, efferson (1987~, supr~) DNA was digested with EcoRI and ~
salI~ and the 1862 bp ~ragment was purified from an : ~ ; ~3~ agarose qel.~ ~hes~e:two f,ra~ments were mixed~together, and complementary 5ynthetic oligonucleotides having the ~ : 3e~ue~ce GA~CCGGATCCG and TCGACGÇATCCG:were added. The ragm~nt wer~ ligated~together ~nd the ligation ~ac~ion was transformed into competsn~ E. coli ce}ls. A
trans~o~mant harboring a plasmid ha~ing the appropriate `.:
; ~

.

WO92/21753 PC~/VS92/~785 ~ ~3~1i ~NA s-r~ ~Z5 _~ 5C 3~ :as:-_c io~ ~z ~ 5- -a mapping. Th,s plasmid W2S named pKA881.

2. pX~.881 DNA was diges~sc ~i'h Bal_ and ~coR , and -he 4148 ~ large f~a$~e~ was pu- -ied ~m an asa-os~ se-. -3NA OL ~3I221 was simllarly dig a e~ ~ a~.a t;n~ 1~17 ~
Eco~r~lI f~z~men~ was g~l puriCied and lig2t~d t~ ~e above p~88l f r2amen~ ~ to generat~ ~las~id ~K~882.

pKA882 DNA was digested with SstI, the prot;udlns 13 ends we~ made blun- ~y ~ e-.- wi ~ y.,-~-a~e, --:
and the Lragm~n~ was lîga~ed to syn~netic Bam.-.l llnkera having the se~uence~CGGATCCG~. An E. coli transformant that harbored a plasmid havins BamHI fragments ~f 3784 :and 1885 bp was identified and na~ed pKA882~. ;

4.~pXA882 DN~:was digested~with PstI, and the linear fragments were l~igated~to synthetic a~aptors having the sequence~`CAGATCTGTGCA.~ An~ E.:coli transformant was ~ ~;
;~ ~identified~that~ har~bor~ed:~a:plasmid that~wa not cleaved -~
:~by~PstIt and t~at had:a~new, unique BglII:s~ite~ This plasmid~was named~pKA8~82 ~g. : :~

S. ~pRA882-Bg DNA was~digested with~EcoRI,~and the~
ea~ fragments were ligate to synthetic:adaptors ~ :-

5 ~having~ the~ sequence AATTGAGATCTC. An E.coli trans~ormant was identified t~hat harbored a plasmiditha~ was not ~-cleaved by EcoRI, and~that generated BglII fragments;of 3027 and 2658 bp. :This plasmid was :named pKh~82 2xBy.

3 6. pKA88~ DNA was dig~sted with BamHI and'the mixture of fragm~nts was ligated~ An E.coli transformant har~~ng a plasmid that generated a single 3783 bp ragm~nt upon digestio:n~with Bam~I:was identified and : named p35S/Nos. This plas~.id has the essen~ial DNA
s~ructure of pBI221, except that the coding sequences of :~ ' '.

WOg2/217~3 PCT/US92/~7~5 ;

~ J ~ 1 r,~ :

_-e C-~'S ~e~ ve De~-. da'~ a-e .-^, C2 nucleotides 6605 t0 7439 a:e ollowed by the li?.ke ~

--~i'owe~ ~y ~-~ ~OS ~ aGa-.'~'' a~ ' ^~. ~e~"e .CQS a~.- h- h '`";, _ a, _ cf ~__2 7 . p3.S~'Nos DNA W25 d-ges-ed wi--. Eco~l a-.d Pst-, a~.d .
th~ 3037 bp fragme~t was purlf~ed and ligated to th~ ~3 b~ -racme~t oDt~nec f:o~ diges~ Gn o~ p35S/Er~2 DN.~ (,e~
_xæ-.,?le ~, S~- on C.;~ w~ h Eco~ -.d Pst~ . A~. E. coli .. :
ars~ .a-~ ice~ .2: h2-~o: ~ a ?las-. ~ -ha~
., generated fragments of 3~31 and 534 bp upon digestion with ECORV and PstI, and the plasmid was named p35S " `~
En2/Nos. This plasmid contains the duplicated 35S
promoter enhancer r~gion described for p355 En2 in ~:
Example~5, Section C o 5 ~ TAe promoter se~uences was :: ~separated from the Nos~polyadenylation sequences by linker sequences that~lnclude a unique Bam~I site.
B. Plasmid utilizing the 355 promoter and the Agrobacterium ORF 25/26 Poly~A sequences. :~

~: The starting material is plasmid pIC 35. This ~ -plasmid contains the~ 845 bp SmaI/HindIII fragment from :- ~25~: pUC 13 35S ~343) [see~Example 1~, Seetion C], liga:t d ,~.
into the NruI and HindIII sites of pIC l9R (Marsh, et ~
(1984~ e~, 32-481 485), in ~he ~rientation such that ;;.
the HindIII recognition~site is maintained. The source ~ of the A, tumefaciens O~F25/26 se~uences is plasmid 3~ pICi925~ This plasmid con~ains the 713:~bp HincII
fr~gment comprising nucleotides 21728:to 22440 of A.
tumefaciens pTi 159~5 T-DNA ~Barker et al., ~ lL~
, 2:335-3~0), ligated into the SmaI site of pIC
l9~ (Marsh~ e~al. (1934). suyra), in the orientation such , , , .
, W~ 9~217~3 PC~r/U~92/û47~5 -53- ~ 1 U J 3 1 J

t;~.2~ .e B~ - ?-~ - a aZ, ,- c~-.t ~ -t ' ~.
25 end or ';~e ~-DNA f rag;rLent .

;. 3NA of pias;;l1d ~ ~_ 3~ ~a-, d~ ge,~ . Ba,7l-_, a-.
i~ ga;ed tO a 738 b? ~ a ~r y d~ 5~ 5--p~C1925 D~ am~-~ a........ c B~ E. col,~ t- ~ .a ~-.. a was iden~if ied that harbored a plasmid in which a Bam~
site wa~ pos~tioned be~ee!l tne 3;~ promcter ~;agmen.~
and the OR~ 25/26 Poly A fragment. This plasmld waa ; ;:
named pIC l9R35/A.
1 0 '' ~
~ pIC 1~3;/A D~A waa c_s~s~ed ~- ~ Sma~ 2_ _~a unique site, and the DNA was liga:ted to BglII linkers having the sequ~3nce CAGATCTG. The tandomization of ~
these BglII linkers generates, ~esides BglII recognition - :
sLtes ~ also PstI recognition sites, CTGCAG. An E. coli ' ,'~
trans~ormant was identiied that had at least two copies o~ ~he linkers ~(and new BglII a~d PstI sites ) at the ~posit~ion~ o~ the former SmaI siteO This plasmid was :: 20 ~ named pI~35/A-~ :
:
3. DN~ of plasmid pIC 20R (Marsh, etal. ~1984) t ~t ~
32:481 48514) was digested with NruI and SmaI, and the ::
lunt ends of the larg~e; f ragment were ligated together .
An E.coli transformant was identified that harbored a ;.
: plasmid that lacked Nru~I, SmaI, HindIII, SphI, PstI, `-S~II, XbaI, and ~Bam~II sites. ~hi5 plasmid was called ~ -pIC: 20RD.

30 4. . pIC 20RD/DNA:was digested with Bg~ and was ligated to the 162~ bp BglII f ragment of pIC3S/A. An E. `' coli transformant was iderltified that harbored a plasmid that c~ ain0d 'che 35S promoter/ORF 25 poly A sequences.
Restriction enzyme site mapping revealed these sequences ~o ~ in ~he orientatlon- such that the unique KpnI and -W092/~1753 PCT/U~9X/~785 2 1 q9 ~ 1;3 ~54~ ;~

xnoL s_t~s o- F-~ 2~ 2-~ ?s~ a~ 2_ ~e 3' e~c e ~he ORF 25 Poly .~ sesue~.~as. T~is pias~id was na~ed pSG
~c' 3525 (Pst3.

;. D~A o- ?SC- 3a5l~~ 3~, (?s:) w~, c ~s ~ w~-~ B~
r~c~- c~r.ci~_cr~a ~ 3 ~ 3 B~
sites of the moîecuie were cl aved. The 4301 bp lln~ar fragments were 'i sa;ed .o sy~et~c caa~ter : oiigonucleotides naving the ~equence GATCGTGATC~C, wnere the underlined bases represent the BCII recognition 1C secuence. A~ ~ CO~ ana cr~an waa lâe~.~ ^led -~2- :nad ~-: a BCII site at the posi~ion of tne ror~er BglII site posi ioned 5' to the 35S promoter. This plasmid was named pSG 3525 a ( Pst ) .

C. Construc~ion of a doubly-enhanced CaMV 35S Promoter : The:starting material î~ plasmid pUCl3/355 (-343~:as described~by Odell etal. (`(l985~, Natur~, 313:810-812)~ This plasmid comprises, starting at the 3'~:end of the SmaI a~ite~Of pUC 13:(Messing,:J. (1983) in "Methods in Enz:ymo}ogy"~(Wu, R. etal.9 Ed-~) 101:20-: 78~), and reading on the strand contiguous~eo the ~:non oding strand of the Lac Z gene of pUC 13, nucleotides 64~5:~o ~97~ of CaMV, follow~d by the linker : se~uenGe CATCG~TG~(which~encode5 a ClaI recogn:ition sit~, ollowed: by CaMV nu leotides 70R9 to 7443, ollos7ed by the linker ~equence :CAAGCTTG, the la~ter s~uence including the recognition se~uence for HindIII~ :
3û which is then followed b~ t he remain!der of the pUC 13 plasmd DNA.
1. pUC 13/35S (-343) DNA was digested with ~I~I, and :~he prcstruding ends were made flush ~by tre~ur.ent with T4 polymerase. The blunt-ended D~P, was then li~ated to :

, W092/21753 P~T~USg2/~785 J .' -a ~~ t n ~ ~ _ C 3 i ~ g ~ r - ~ ~ 5 ; a r~ C ~~e - ~ ~ 1 3--C -' ' ', CCC.~GGG, ~nic.~ ~nc udes an .NcoI re~gnl ion site. A~
E. coli trans~or~nt was ident fied c~ntai~i~g a ~las~lc (named pOO#l) having a~ Nco_ slte positioned a- the ~ :;
-orme Cla~ si~
. ~:~
2. pOO~l DNA was dige~ted wi;h NCOI and the com~at/Die ;;
ends or the large ~;ag~en; were re'is2~ec, resul ing _~
t;ne aele~ion o ~0 bp from pOO~', to ge~e-~;2 pl~s~id 1 Nco~.
~ CX_ ~co~ w2, c_s~ , c..~
blunt ends were llgated to ClaI linkers having the sequence CATCGATG. An E. coli transformant harboring a ~.
plasmid having a new ClaI site at the position of the :~ 15 previous ECORV site was identified, and tne plasmid was ~ named pOO#l NCO~R~/CIa.
:
: ::4. pOO~l Nco~ R~/Cla DNA was~digested wlth ClaI and : NcoI,;and the small (268:~bp) fragment was purified from ~.
20 an agarose gel. This ~agment was then ligated to the : ~:~ 3429 bp ClaI/NcQI fragment of pUC 13/3SS (-343) prepared by isolation from:an agarose gel, and~an E.coli ~:
: ~ transformant was:identi~ied that harbo~ed~ a plasmid ~ 25 having ~laI/NcoI fragments 3429 and 2Ç8 bp. This ;~
; ~ plasmid was named pUC:13/35S En. :

~;; ; 5. pUC 13j355 En~DNA was digested wlth NCOI, and the prokruding ends were~ made blunt by treatment~with T~ ~
polymerase. The treated DNA was then cut with Sm~
30 : . ~
and was ligated to BglII linkers having the sequence : C~ TTG. An E. coli transfo~ant was identîfied that harbor~d a plasm~d in which the 416 bp SmaI/NcoI
fragmen~ had been replaced with ~t least two copies o the B~II X linker and named p35S En~.
`~

.

' W09~/2~7~3 PCT/U~92/~785 :;

3 ~ 1 3 -56-3~.~ s -~c-;r~ 5~ _n 7 a a-~ ws e 1n~ins with ne nuc_eot de :.~zt ~si_sws :he third C
~sld~e O.c the SmaI site on the st~a~d co.. ticuous t~ :
the no~c~d~ng s; and o the Lac Z ger.e o ~UC 13, th.e _ Sa~5'1:' C~ C.~G.~-Cr'GC'~G.:~-C-G~ 5tGC''~-'G, oi'owed ~'J
a CaMV nuc1eo~ides 7090 ~o 734~, ~ollowed 3y a Cla l nk~- se~u~nca C~CG ~G, ~~ wed b~v C~MY ~s1~'e~t ~es 7089 t3 7443, followed by the HindIIT 17 nk~- 5e uer.co C~GCTT, ~o~low~Z by the res' o' p~C 13 sa~ nce . ~.i a s~ ur~ has ~o -~ re tha~ e~.h.~.c~ aecue~.s_s o-:~.e C~M'J ~;S 2:_~.o~e~i wh c~ r ~ ~-. U~S-~of tne ECORV site in the viral genome (nucleotides 7090 to 7344)l have been duplicated. This promoter construct incorporates the native 35S transcription start site, which lies 11 nuc~eotides upstream of the first A resdue .
of tne HindIII site.

Do Construction:of a synthetic untranslat:ed leadPr A DNA fragment was:constructed that includes sequ2nces which comprise the 5' untranslated leader portion of the:maj:or rightward transcript o th~ Maize ~Streak Virus (MSV) genome~. The MSV yenomic sequence was :published by Mullineaux etal., (1984~, EMB0 J., 3:3Q~3-3068, and ~owell (1984), Nucl. Acid~_~es 7 12:7359-7375, and the transcript~ was described by Fenoll etal. (1~988), EMB0 J., 7:15~9-159~. The entire sequence, comprising ~:
154 bp, was constructed in three sta~es by assembling blocks ~A, B, and C) of syntheti~ oligonucleotides.
~ r`
1. The A Block: Complementary oligonu~leotides having the seque~ce GATCCAG~TGAAGGCTCGA~AAGGCAGATCCACGGAGGAGCTGA :
TATTTGGTG~ACA and AGCTTGTCCACC~AATATCAGCTCCTCCGT~GATC
TGCCTTGTCGAGCCTTCAGCTG were synthesi2ed and puri.fied by .

-~ ~roc~-~a. -.~.o~ .e~^ -,_ r ~ o ~ i ~ e ~ .
into doubie-s ~anded ,tr~c_lres le Ye 4-ozse s~icKy e~.cs t~al a~e c~m~a-ible with those gerlerated ~v B~m~I :
on one er.d or -he molecule (GATC), ana wit~ HindIII- ~ :
Ger.er2-ed sincle s - r,a~ e~ds or. -;~e o-her en~ o- t.~e molec~le (A~CT) S~cn annealed ~oiecules were ligated int~ ~las..id p_'~esc-l?t S:~(-) ES ~t~e~ Cloni~g Syste~hs, La Jolla, CA], tha had be~n digested with ;:
BamEI and HindIl-. An E.coli tr~ns 2r~a~.t harboring a :~
.~ ?1~ c~n:~ning t:~ ol gonuc'e~t ~e se~ue~r.cs ~a~ ;
lce~ ed DV ~ a-r Hind~_ res~ c: 5-. er.Z'J~
analysis,~and the plasmLd was named p~SV A.
2. The B Block~ Camplementary oligonucleotides having the sequences AGCTGTGGATAG~AGCAACCCTATCCCTAA~ATACCAGCACCA
CCAAGTCAGGGCAATCCCGGG and TCGACCCGGGATTGCCCTGACTTGGTGG
::~ TGCTGGTRTATTAG~GATAGGGTTSCTCCTATCCAC were synthesized and purified by standard procedures. The underlined bases represent the recognition sequence for r@striction enz ~es SmaI and XmaI. Annealing of these nucleotides ; into double-stranded structures leaves 4-base sticky ends that are compatible wi~h those;~enerated by HindIII
~n one end af the molecule ~AGCT), and wi~h Sal generated sticky ends on the other end of the molecule (TCGA). :

DNA of pMSV A was digested with Hi~dIII and SalI~ and was ligated to the above a~nealed .
30 oligonucleotides.!'~An E.~ol~ tr nsformant harboring a plasmid containing the new oligonucl@otides was identified by re~triction ~nzyme site mapping, and was named pMS~ ~B.

W092/21753 PCT~US92/~78~

210~13 : ~

3 . m e C 3'oc~: C--~ n-a~y ~: ~or.uc:es~ avi-.s ::
the sequ~nces CC(:~G~CCAl~Gl~ICCAGGCACGC~GAT~GCA
Tr(: AGCC ~TGGG ATATC ~4GCl~GG4TCCC and TCGAGGGATCCAAGCITGATATCCCATGGC
. .
TG'~ATGCII ~TCCCGT~CCTGG~ A C~ TGGC ~7ere, n ~esi~e~-and pur'fied by s~ar.aa d procedures. ~hese olisonuc'e~des inc~?~2~e bases th2' c~...prise recognition sites (~l~der~ ined) r~r NCOI tCC~,TGG), ECORV
(GATA~C) ~ HindTT (.?~AGCmm) r and Bam~ (GG.~mCC).
î3 ~ O~ t:-~c~ -id~ 1--3 doubl~-s~:~.d~
~ ~ uc~ ~ ~ _â le~ves L~ 2,a ,~ c~y ~.~, t;~ c^. - L~2~
with those generated by ~maI on one end of the molecule .
(CCGG), and with xhoI~generated sticky ends on the other end of the molecule (TCG~). Such annealed molecules were ligated into pMS~ AB DNA that had been digested with Xm~I and XhoI~ An E. coli transformant harboring a .
pla~mid containing::the oligonucleotide sequ2nce was identified by restric~ion enzyme site analysis, and DNA
structure was verified by sequence analysis. The ~:
20 ~plasmid was named pMSV CPL; it contains the A~ B and C ~.
blocks of nucleoides in equential order ABC. To~ether, the~e co~prise t~e 5' ~ntranslated leader sequence ~"L"~
of the ~SV coat protein ("CP") gene. These correspond to nucleotide~ 167 to 186, and nucleotides 188 to 317 of the MSV sequence of Mullineaux etal., (1984~, supr~, and are flanked on the 5' end by the Bam~I linker sequence GG:ATCCAG, and on the 3' end by the linké~ se~uence ~ATATCM GCTTGGATCCC. An A residue corresponding to base l87 ~f the~wild tyRe ~SV ,s~quence was inadvertently deleted during cloning.
4. -BglII Site Insertion: `~
p~SV CPL DNA was digested at the SmaI site corres~ondlng to base 277 of the MSV genomic sequence .

: .

WO~2/~1753 PCr/US92/0~785 _~9_ ~~a 3^'~

tM.ull~e_~_x. era~ 193" ) ~ suzr~, 2-r~ ~ '.e~ 3~ir. '~'25 'I iga ~" ;
tO 3gl ~ t inKe-s havl.. s ~e seq~ence C.~_C-G. A-. E coli ~:
~rans~orrua?.' ha~bo-in~ a ~l~s~id hav n~ a un_c~e B~
slte a' the ~osl;lon of the for;ne SmaI si~ 7a~
lde~.t lec a~.d ve- - ~d o~; 3N.A se ~ .C3 a~ Js~ S r a~d -the plasruid was named pC~-3gl.

~. Cons.ru~,tiorl o, a deiet~d ~7~ a~0n o~ _-e .,~alz~
alcohoi de:~ycr3ge~ase : (Adhl ) ~n;ro;

~ '?.- ~-.e ~ .c~ __ -_ -__-e .~ .S 5~
intron l from nucleotides ll9 to 672, ~nd was described in Callis e~al. (1987~, Genes and Devel., 1:1183-1200.
The sequence following base 672 of Dennis etal. ((1984), 15~ Nuc:l. Acid~ Re~., 12:3983-4000) is GACGGATCC, where the : :underlin:ed:bases represent:a BamHI re ognition site9 The entire intson ~l sequence, including 14 bp of exon l, ~:: : and 9 bp;of exon 2, was~:obtained from this plasmid on a 20 ~556 bp fragment:following digestion with BclI and Bam~
Plasmid~pSG 3525 a (Pst) DNA (see Example, section B.::5~) was di:yested with B~mHI and Bc~ and the 3430 bp ragment was purif:ied ~rom an agarose gel. ::p~ ll9 DNA
~was diges~ed with Bam~I and BclI~ and:the g~l~purified r: gmen~ of 556 bp~was~}igated to the a~ove 3430 bp fragment. An E. coli transfor:mant was identified that . ~.
harbored a plasmid that genera~ed~fragments of 34~30 and ~6 bp upon digestion with Bam~I and BclI. This plasmid ~ 30 was-~amed pSG Adh~

:~ 2. pSG Adh Al ~NA was digested with EindIII~ [which cuts between bases ~O9 a~nd 2lO of the Dennis et a l984~ J supra) sequ~nce, bottom strand]:, and with StuI~
whLch cuts between bases 554 and 555. The ends were ::

~092/~1753 PC~/VSg2/047XS
2 1 ~ 9 lQ ~ 60-X12d~ 5.. D ~ ~t r o i ~ as ~ ~ = ~...~ . , 2--. - ~ i~ ~ g~ - _r An E. coli ~.z~.s ^3r~an na Dor ..g a ~ i as;n- c :ac.~ ~.g E~nd-II a~d StuI sites was ide~.tified, and tne 3NA
st-uc ura '~25 ve ifi~d Dy seaue~cé analys s.
ola--mia W23 na.~er ?5~ Ad:~ A:3. In t;~is cor.~ r_ ~ 3 ~p of DNA have ~e~?. deie~ea ~rom tne in;e or of ~he in-ron 1. The unc ~onal intrcn seauence g obt~lne~ on ~ 213 b~ ~ragment following diqestion witn BCII and BamE .

3. pC?_-3~: 3~ x=~..?:_ ,, S-~ ~o~
diges.ed wi~ BglI_, and the iinearizes DNA was _~a~
:to the 213 bp BCII/BamH fragment cont~ining the deleted ~ .
version of the Adh l.S intron 1 sequences from pSG Adh ; ~:
AlD. An E. coli transformant was identified by :~ restri tion en~yme site mapping that 'narbored a pl~s~id ; .
; ¢ont~ining the intron sequences ligated into the : ~ ~ite~, in the orientation such that the BglII/Bc~
~ j~uncture wa:s nearest the~5' end of the:MSV CPL leader 20 ~s~uence, and~the :BglII/ ~Bam~I juncture was nearest the ~.
: 3' end~of the CPL.~ This orientation was confirmed by DNA:Beguence analysis.~ The plasmid was named pCPL
AlI~lD.: The MS~ leader/intron sequences is obtained from `:.
this plasmid by digestion with ~amEI and NcoI, and ~ ~i puri~icati~n of ~he ~373 :bp fragment.

. Canstruction of:plant expression vetors ba~ed on : the enhanced 35S promoter, the MSV CPL,:and the deleted `~
versi~n of the Adh 1 in~ron 1 1~ DNA o~ plasmid p355 En2/~os ~see Example 5, Section ~:: A.7~ was digested with B~mHI, and the 356~ bp linear frag~ent wa~ ligated to~a l71 bp fragment prepared from pMSV CPL UNA digested with BamHI . This fragment contain~ ~he e~ire MSV CPL se~uence described in :~
`:

... ..
~ .

WO92/217~3 PCT/USg2/~785 -6l- ~ 1S,~3 Se~ . 3.3~ ~r. ~.czl~ t ans-~ .an- was ic~ Q~ b~
-~s~- c~sn en~yme s_~e mappin~ that h?r~o~ed a ?iasmi~
tha~ c~nt~l~ed these seauenc~s i~ an orien~a-isn sucn.
tha~ tk.~ lNcoI site wa, positior.ed near tne Nos ~oly A
sesllences. ~his ~ias.,. d was n~2d ?3~ ~n2 C~L/~o,.
con~ai~.s the er.nanced version of tne 3~S ~ra~e~
direc''y c~ntlguo~s t~ the MSV le~der s~uencss, such that the aerivec transc-ipt will include the ~SV
se~enc3s ~ n its ~' u~.~ranslate~ por'ion.

2. DN~ o plasm a ~ 882 (a2~ _~2.~ 'a ~ aeC__cn .~.2) :
was aiges~ed witA HindI ~ I and NCOI j ar.d the iarge 47l3 bp fragment was ligated to an 802 bp HindIII/NcoI
fragment containing ~he enhanced 35S promoter sequences ~:
and MSV leader sPquences from p3SS En2 CPL/Nos. An E.
coli transfcrmant harboring:a plasmid that contained .:~
; fragments of 4778 and~802 bp ollowing digestion with HindIII:and NCOI was:identified, nd named pDAB 310. In this plasmid, the~enhanced ~ersion of the 35S promoter ;:
20~ is used~:to control expression:of the GUS gene~ The 5' untrans~l~ted leader portion of the transcript contains ;~.
the leader sequence of: the MSV:coat protein gene.
:
3. ~DNA o~ plasmid pDAB 31~ was digested~with ~coI and:
. ~ 25 SStI. ~ The large 3il7 bp ~ragment was purif~ied~rom an ~:~
~ gar:o e gel and liga~ed to complementary:cynthetic :~ ~ olig~nucleotides having: the sequences CGGTACCTCGAGT~AAC
and CATGGTTA~CTCGAGGTACCGAGCT. These~o1igonuc1eotides, ~-when annealed into double stranded st;ructur~s, generate 30 imoiecules having sticky ~ends com~atible with~-those lef :by ~:stI ~AGCT), on one ~end of the: molecule, and with NCOI (CAT~) ~n the~o her end of the~molecu1e~ An E.coti :~
tra~s~orm nt was iden~ified that har~ored a plasmid - con~aining sites for enzymes S3fI ~AGCT), NcoI (C~TG), ~pnI (GGTA~C), XhoI (CTC~AG~, and HpaI (~TTAAC), and ::
" ~

.

WO~2/21753 PCT/US92/~785 ~ ~ ~ 9 Q l :~ -62~

h- ~N.~ s-~lc~ as ~J~ er by se~ze.-.c3 2-.alvs s.
Tnis pias~ld was ~.e~ p~A~ 1148.

~ - ~~ ~~ ~ p~r~ '~ ~8 ~as ~_5~
2...d ~ c~ g 3 3 -, 7 b~ ~ , ?~ r - 3--.
_, _5_ ~s~ 2~ _ 3,3 ~ s...e~. J~
from pCPh AlIl~ (see Example ;, Section E.3) ~ollo~ing dig~s., on Wit;l Bam~- a..d Nco; . An E. coli -ra;lâ or-.,ar.
was identi~ied tna. har~ored a p;2s~d t~a- se?.~ d f~agments of 3;77 and 373 bp rollowing dlges'ion wi h ~ am- d Nco, anc -.-e ~ as..... la wa, ~.a.ee ?3~-3 303~
; : This p_as~ld Aas ~ne ~oliow~ns DNA s.rlic~ure: beginn_r.s ~: with the base after final G residue of the PstI site of pUC 19 (base 435)t and reading on the ~trand contiguous to the coding stra~d of the Lac Z gene, the linker sequence ATCTGCATGGGTG:, nu~leotides 7093 ~o:7344 of CaMV
DNA,:the linker;s~qeunce ~TCGATG, nucleotides 7093 to 7439 of CaMV, the linke~ sequence 5GGGACTCTAGAGGATCC~G, nucleotides 167 to 186 of~MSV, nucleotides lsa to 277 of ; 20 MSV, a C~residue followed by nucleotides 269 to 359 of ~Adh lS intron l,~nucleotides 704 to 82~1 o maize Adh 5 intron l r the linker sequence GACGG~TCTG, nucleotides :27~ to:317 o MSV, the linker sequence GTTAACTCG
AGGTACCGAGCT~G~ATTTCCCC, nucleotide~ 1298 to 15S4~of 25; Nos~, and a G residue followed by the rest of~the pUC 19 s~quence~ (~including the ECORI site~ he uni~ue :E~ORI
and~B~III sites of pDAB303~were converted to~ NO~I 5i~es, ~:: respectively~ by oligonucleotide3 con~aining the ; Eecogni~ion sequence GCGGCCGC to form pDAB303-Not~

G7 Construction of plant transformation vectors . containing the bar~gene o Streptomyces hygroscoplcus The ~ta~ting:material is plasmid pIJ4104 ~White~ etal. ( 1990), Nucl. Acids Res., 18:1062~, whi~h ' .

WO 92/21753 PCr/U~2/04785 -63- ~109,~5 C3~.t-~.5 t .e c~cl-s r3~ n 0-- t, e bar gOr~ O S.
hygroscopicu3, Wh.iC;r1 e~.C~deS :-,e -~Z1...e ~;-OS2h~ C ., aCetY1 tra~Sf~aSe (~-~T) ~ . D~A - ~1C S-.~ C .~L_ ~' O4 Wa, ~i~5~ SmaI, 2nr~ ' -, - ^ e 5 5 3 ~ ? 1 r - ~ ............... a -. - g = - 3 5 ~ g C
DNA Of P1aSmid PSG 3;25 a (PSt) ~See ~XamP1e 5, S2CtiOr1 3.5) Wa5 1inear1ZeC bY d 5eS-iO?. a- ~:~e Un~CIU~ HinCII
tnaC lie3 be;Ween the ~;S PrOSnOCer and OR~ 2~ PO1Y A
:: SeqUenC~S, and the 1in~a~ rra~ment WaS ' ? g~ad ;~ the ~3 bP Oar ge~,~ fra~.e~ . coli ~ S_Or-~2~ W^_ -: identifiea Dy reStriC~iOn e~ZY~;~e Si-g r.ZPPi~g tna-~: harbOred a P1aSmid COntaining the bar 9ene in the OrientatiOn SUCh that BglII di9eStiOr1 generated 5 fragments of 4118 and 764 bP. ThiS P1aSmid WaS named PDA~ :218.
:: 2. DNA Of~ P1aSmid PDAB 218 WaS digeSted With BC~ and the linear fragment:of~4882 bp was ligated to a 3133 bp : Bg~ fragment prepared~from DNA of pK~882 2xBg (see E~ample~ 5, Sec~ion A.5):.: The latter fragment contains .
the G~S~coding~r~egion, under the transcriptional control ; of~the 355~promote~ with:the Nos Po}y A transcription ter~mination signals. An E.coli transformant was 25 identifi:ed~that con~ained the:GU5 and PAT codi:ng ~ :
r~egions,~:~and restriction enzyme re~ogni~tion~:~lte ~appin~
revealed that both coding segi~ns were encoded ~y the same DNA strand. Thi~s~plasmid was named pDAB tl9.

3. DN~ plasmid ~DAB,219 was us~d as thelte~plate :for the polymerase chain:reaction tsaiki etal., (1988)~
: Q~L~3~ 239 4~7-49i) usin~ as~primers the ~ynthetic~
01igO~UC1eOtideq: i~ CT¢GAGAT~TAGAT~TCGA~G M TTCCC, and ) TAT~____~GTGATAACC ~ . Primer ) rePre5ent~nUC1eOtideS 41g tO 446 Of PDAB 219, and : :`: ~ : :

:: ~

WC~ 92/217~3 PCI/US~2/04785 ~` 13

6 4--~ -.c ~ld=~ _asas c~ s?5r.c~ t3 ~ ~12 r~r~ a- ;~s _~~
XhoI (C~C~.~G)/ B~!-- (AG~C~) ~- Xba_ (~CT.~ rCoRJ
(G~TAT~), claI (A~CGAT), and EcoRI (G~'TC). The si~gle unde-lined bases in primer ii) re?res~ Q recocr.l- ' on seque~c- o ~am__, and 'h~ aoub'~ ,d~ : ' ne~ 32S~a ' re?rese~ nucleo~iaes 1138 ~o iL~ G- pvA_ 2-3, ar.c cor espond to nuc'eotides 21728 to 21749 of tne 0~ 25 Poly A ';ragment (Sea Example ~, Section 3). P Q
a~,pl~'ica~ior, cenera~ed 2 ~roduc- o' 760 b~.
~. D~ o- pla,~.,id p3A_ 2:3 ~as ~ ~a _~C ~- ^. B~
7252 ~p fragment was puri~ied .rom an agaro, g~:, and ligated to the 747 bp fragment generated by digestion of the above PCR product by BglII and Bam~I. An E. coli ::~ ` 15 transformant w~s identified that harbored a plasmid containing a unique BgllI site positioned at the 3' end of the OR~ 25 Poly A fragment. The DNA structure of khe 3'~end ~f the PAT coding sequence was confirmed by DNA~sequence analy~sis.~ This pl~smid was named pDA~
:~ 20 21g~.
The DNA sequence ~f pDAB 219~ is a~ follows:
B~ginning with~the base $ollowing the last A residue of the:XbaI si~e on the Lac~Z coding strand of pIC 20R
25 ~ (Mar h,~etal. (1984), Gene,~32:481-485)9 the~linker TCCT~A~CTGTGC~GGTCCCC, followed by CaMV;nucleotides 6605 to 7439,:followed by the linker sequence ~ :
. GGGGACTCTAGAG~ATCCGGATCCGTCGACATGGTC,~followed by the re.t of the coding region of ZUS with 44 bp of 3' 3~ ~lanking E.~c~li gen~mi¢ DNA (nucleoti~es 306 tp 215~ of , ;.
Jef~erson etal. (1986), (Proc. Natl.: Acad. Sci., 83:8447-845i~. The underlined b~ses represent the codons~:for th~ ~irst two amino acids of the GUS prot~in, the second i ~: o~ which was changed from leucine in the or~ginal ~. coli idA ~e~e ~J~erson etal (1986) ,; supra) to valine in ~ , ~: `
., .
.,:

WO'~2/217~3 P~T/U~2/~785 -6~- 2 1 a~J~ 13 : p-~J27 (Ja~ so-.~ (1937), suDra). T~.es~ ~2S~5 followed by '.~e l nker se~le~ce GCG~A.TGG~E.~GC~CGA
A~TmCGCC, then b~ ba es l2g8 t~ l~;4 o. t:ne N~s ~oly ~
se~uence ~DePicker, etal. ( 1982), J. ~.oiec. Ao~l. Gane~., 1:~61-~736). The linker secue~ce GGG~A~TC-AGATC~GGA~CTCGAGCTCGG~ is ~ollowed ~y Da;~s 49 t~ 6972 o- Ca.U.V, ~h~ linke CA~CGATG, and CaM~ bas~s 7090 to 7443. These bases are follswed by the linker C~GCm~G&CTGC.~CG~C, 'he~ by bases c~rres~ondl~.g to ~c'~ des 20 to 579 o~ ~he bar cl3r.e in ~IJ4l0~
e, etal. (199)), Nuc~. Acias ~aS., 18:1062), tn3 ~-~ linker CTGTGATAACC, ORF 25/26 poly A nucleotides 21728 to 2~440 (Barker, etal. (1983~, Plant M _ec. Biol. 9 ~:335-3S0l), the linker ~:~ 15~ GGGAA~TGATCGATA~rCTAGATCTCGAGCTCGGGGTACCGAGCTCG~TTC, and the rest of pIC~20R. ~ The BglII recognition site underl~ined~:represents a~unique site into:which ~other :genes`may~be~introduced.~ A partial restr:iction map of pDAB: 21s~a i~5~ appended.~ An oligon~cleotide containing 20 ~the;~recogn~ition ~equence for the restriction enzyme Not (GCGGCCGC)~was~in~troduced into~the BglI}~ site to give the~p1asmid ~DA~2l9~-Not (shown in~Figure 7);.

Example:6:~ Canst~rùction of a cDNA library from potato tuber skin~tigsue A. ;~RNA Pu~i~fication ~ :

The~ ski~n :and outer cortex tissue was harvested : 3O from ~4 cm1potato tubelrs ~Solan~mtu~oe,rosum cv. Superior) and immediately f rozen in liquid nitro~en . Frozen tissue :wa~ ~round in a mortar ~o a ~ine powder under uid ni~rogen; Five~ grams of tissue were ~extracted ~ ~1 : with a:volume of 50 II~M Tris-~ICl pEI 8~0, 4~ para-amino salicylic a~id r 1% Tri-isopropylnaphthalenesulfoni:c ,`
, ~ , ,;~
, , ~ ~

W~92/217~3 P~/US92/~785 ~ln9~ ' 9 acic, 10 mM ci~ h-~ -ol, a-r lO r..~ sodillm me~aDisu~ ite. ~ og~.~.a ~ w - ~:ne~ e:~.rac~e~ wi~n ar.
e~ual voiume of pr.e~ol con~2ining 0.1% 8-hydroxyauinoline. A^-e: cent-ifuga~ion, tne acl~eous lat~er ~s ex~,ac~_d w~-n as e~ual voï.lme ~^ ?~.e~.o;
' con~aining chloror^or~;i;oamy aiconoi (24:1), foilowe~ ~y extrac ion with chloro~rm:octanol (24:1).
Subs~quently, 7.5 ~ ~mmonium acetace was added to a ~inal conc~t~a~ion of 2~5 M. The RNA was precipitated over~i~ht at -20~C, c~llected by centrifugation, :~ ~?-=r ~i~a~d w~h 2~3 ,M a.. _~.cnium acetate and wasned with 70~ ethanol. The dried ~NA was resuspended in water and stored at -80C. Poly A~ RNA was isolated using ~ybond mAPt~ messenger affinity paper (Amersham).
B. Library Construction and Screening cDNA was synthesized using S ~9 of Poly A+ RNA
:: and the:ZAP-cDNA'X~s~ynt:hesis kit (Stratagene). Size ~- , 2~ sele¢ted cDNA:~was ligaked to 2 ~9 of UniZap XR~ vector arms (Stratagene~j, and packaged into phage particles with Gigapack~Goldr~ packaging ext~act (Stratagenej.:
About ~2 x 106 putative clones were obtained after :
packaging~ The~pla'e-amplif~ied library:~contained approxim2tely 5.0 x L01 pÇ:u/ml when titered using E.col~
PLK~F"U cell~ (Stratagene) as the host strain.: About 1.5 x 105 plaques were~screened (1.5 x 104 pe~ lO cm ilter) using the picoBLuet~ immunoscreening~kit (Stratagene) and:polyclonal rabbit antisera against ~he 3~ ~7 k~ PPI pro~ei~ ~5Be!rke}ieyi~ntibod~y Company). Plaquec with the strongest reaction were rescreened an additional three times to ensure pla~ue purity. DNA ~as : : subcl~ned from these plaques as a plasmid, by the - , ' W092/2~753 P~T/US9~/04785 ~ 1 ~ 9~19 excl,~on ~.er.zz~.~,, enslr~ r~ _~e '-J-.- za? _-.3c~
vec~or.

C . .. _ a ~--.L ' i _ a O i 5 O ~ a-.~ r ,~ . r ~ .L2 _ ~ " n. ~3 ~ 5 _ U ~ .. ~L ~ . .
A,-.c ' vs s Plas~ic ~NA was ~s~lated by the alkal~r.e lysis me hod (Sar..~roo~ etal. ( 1989), 3upr~). T~.se S'' 7CL wa3 de~er~,ined by c~mpler_ diges-io.~ wi~ coRT/Xhor (Ne~
ns_and Bic'abs) a..c agaros~ ge~ e~ec~:~?horesl,. ~ir.e c _~ s-5~ 3~_ .c~ .e ~ e ~ w~-~
_5~_~3~ a~ ~3C'v~ ?"-~- 3-~ 5a-~
and blotted to~nitrocellulose ~Schleicher ~ 5chuell~.
Two oligonucleotide probes based on C-terminal a~d N-termi~al regions respectively, of the amino acid sequence o PPI were synthesized on the DNA synthesizer pplied Biosystems Inc. Model 28A) and were labeled at their 5'~ends with ~32P~ ATP using T4 polynucleotide kinase. Filter~were p~ehybridlzed individually at 37C
~or;2 hour in~50~mls of 6x SSC (O.9;M 50dium Chloride, 0.~09 M Sodium Ci~trate),~Sx Denhardts so;lution, 20 mM
aPO4 p~ 7 4~ 0~5%~SDS and 250 ~gjml salmon~sperm DNA~
ybridi~ation wa~s~performed i~n the same solutiQn at 37C
o~erni~e with~the~addition;o~12 x 106 cpm of each~probe to the~individual~boxes.;;~ The filters~were~then washed 3x~at r`oom temperature~in :2x:SSC ~0.45~ Sodium : Chloride,:0.045 M:Sodium citrate)~o.l%~sDs~th~en Ix at : 37C~ r 30 minu~es in 2x SsC ~ 0O~ SDS.:~ ~hey were:
: exposed to Kod~k X OMAT film Eor 24 hours.
3~ ; " , ; j Two of the cDNAs showed strong homology to both the C-terminal an~:~N-terminal probes. The lon~est of theae clones, was~determined to be l kb in length, and ~ :, , , ~
. ;; ....
::~ ~ ~
I ~ :

W092/217~3 PCT/US9~/~7~.5 2109 ~ 6~-'~2a r.a-e~ pota-~ c~s~a ~. _ (?C:) .r.ls c'cr~ was ~ e-charac~eri%ed Dy 3~. s~_e~cl~g.

_x~pl_ 7: A ~_-.^ csd -.~ f~r _ si~ s~a'lr.-: 'x_ un o~ rP_ The c~mple Je sequsnc~ of the inse~t in ~C1 was de's~ ned, USi~.s _r2se-.~-3ase~ 1~iL (?~~m~a, ~dlso.., WI) to g~e~a~e seste~ dele'ions, and Se~uen2~e~ k t (US 2iochemical, Cl vel~s~d, OH). Thl~ DNA was de~ivec ,3 o~ :._.~ _..~ ~f - ?. =_~s_--. I.s , ~... ~_~ -.c wl-;-ln ~ 0 _~. ocd ~ or - C'JS~ n~
:~ is followed by sequence coding for two complete units at the carboxy-terminus. It also includes th~ 3' non-translated region and a poly A tail. The penultimate unit was PCR amplified (Perkin-Elmer, Norwalk, CT), ~ using 25 cycle~ of 1 minute at 94C, 1 minute at 50C and :~ 3 minutes~at 72C~ The primers (GTCAT.4GAATTCAAC~CCATGGCTGGT~ATGTCCCAATACTC and 20~ GGAACAATGATAAGQGCTCATTACTTTGCACTATCATCACC) were a~sembled on a 380A DNA Synthesizer (Appll~d 3iosystem~, Foster City, CA). They add an in-frame initiator ATG
with:in a ~coI site a~ the 5' end, nd~:a TAA 5top codon and a Sst~I ~ite at the 3' end. The~amplified DNA was ; 2~ clone~ into pCR A~ O`OO (Invitrogen, San Diego~ CA). The region coding for a complete cystatin-like unit was ~ trans~erred on a NcoI-SstI ~ragment into the plant - expre~ion vector, pDA~303-Not~ The resultant pla~mid~
pDAB1189, wa~ used to demonstrate the ~unctianal 3 integrity of t~he cons~ructed gene~ When int~duced into pro~opla~t~ of cultured corn cells, it dire~ted syn~he~is of a polypeptide which cross-reacted specifically with anti PPI anti~erum~

~ :

::
: , ;:-~

WO92/~1753 P~T/US92/~478 -69- 2 l o~

_x~?l~ 3: A ~ codl~ cr - 35~ er C~;a ~a ~ n.-lik5 unit o: ??`-.

~'l_r.C- ~od s.~ ~or ~ 2~ _~.i-.o ~ r.o-in_' ~? d~ w23 ~ 0 ~h5 ?? -~o~
~ s_ ~_~.c_ _. ~~-.31,~. ~_ 3_~..~ 5~ _..~
:~ a prep tatin cDNA clone (p~AB1008), was assembled from sy.nt;~e~ aligonuc~3~tldes i-. ~A5 fo~low~ Lh~33 3~n3:

:1. A vector 'ac'~in~ A~I-- s't~s was pre~ar~ f~om 23~ a~ --. ?~ s~ah2~ J~ .5 ~5 D~
l~ -LI, ~' -.5 i~ o e.~s ~ e~cw - ~5-~- -~ of DNA~polymerase I, and recircularizing tAe plasmid :: with T4 DNA ligase. Enzymes were used according to the ~: manufacturer's protocols.
: 15 2. Two oligo~ucleotides (CATGGCAACTACTAAATC~TTTTTAATTTTATT~TTAT~ATATTAGCAACTA~T
AGTTCAAC~TGTT ~ CGGTACC~GGGCCATGGA and AGCTTCCATGGC~C5GG:TACCGTTAACATGTTGAACTAGTAGTTGCT~A~ATCAAA
~:~AAAT ~ TTAAAAAAGATTTAG)~;were cloned into the pKK233-2 derivat~lve, between:the;~NcoI and H~ndIII :sites. The resultant~plasmid, pDABl079, contains the fiEs~ 22 amino aCidS O~ ~the~ Signa1 ~betWeen a NCOI and AIqIII site :~ underlin~d~

:3~ The~signal sequence was completed bY c~oning the oligonucleotides~CA~GTGCCATGG and AGCTTCCATGGCA : between:
the A~II} and HindIII:site of pDABlO79. They add the ; :
30 last codon~ ~ollowed by an NCOI site containing ~n in-~: frame AT~ codon, The compléte signàl, on anl NCO~
fragment, was introduced from ~he PPI-coding s~quence in pDABll8~ ts genera~e pDAB1209. The precursor cystatin-: like unit encoded by this plasmid~has the following amino-~rminal sequence:

7~3 PCTlUS9Z/047B5 2 1 ~3 9 ~ ' -3 1 2 ~ 9: ~.A ~ ~ L ~ ~ S _ ^ r~ - J J ? _ . ~
C;~?~ 3~5: U''E;)J?~_''~-rCL~lpi~ 9 .~ ~ ~~ h' ~ "''~.S C~ , `0~
. _ .

The tuber c~NA Iibrar~J was r~-scr~ened with ~he 6~3 ~ Eco~I ~rSg-~~ ~ 5~ ?C 1 ~o o5tai-. lon~ cD~A
clones. The l~brary W2S 3IataA 0~ E. coli ~L~-~ ' CQl I, as describeA in str2ta~9ne ' S Un1~Zap ~la~uai. Only a low lJ d~.31'j, c~ 2~0'' ~nn~ .hag~ 3er ?1~t9 (80 ~. d~ er~.
u~-- b~ca~c~ ~ hig~. ?-o~o~ c~. ~ .J~ lz~r.~-plaque~ was anticipated. The plaques were transferrPd to NytranTM filter~ (Schleicher Schuell, Keene, NH) and fixed by UV irradiation in a Stratalinker7~ apparatu~
:~ 15 (Stratagene). The ge~-purified PCl fragment was labeled with digo~ygeni~ ~y Klenow polymerization from random primers (BQehringer~Mannheim~ Indianapoli~, IN).
~ Fil~ers were hybridized according to the manufacturer's :: 20 protocol~, with stringent washes in 2xSSC, 0.1% SDS at 65C.~ Binding;was detected wi~h anti digoxygenin ntibody coupled to alkaline phosphatase ~Boehringer-Manneheim) : 25~ Hybridizing cDNA~ were excised as phagemid, by co-infecting with the phage ~nd a helper phage:(R408), a~ de~cribed in the Stratagene Uni-Zap~ Manual. An extra ~tep o~ retran5formation at low density was neces3ary to eliminate helper from the phagemids. The ~iZ~Q of the aDN~ in~ert~ were determined by digestion ~: with NsoI ~nd XhoI, followed by agaraose gel electrophoresis. The longest insert (in pDA~1034) coded for almost 4 eystatin-like units~, the non-tran lated 3' : region^and a poly A tail.

, ' -`:

WO 92/21753 P~/US92/04785 -71- 2lo9~l9 A B3m ~ n. ,j ?3~-,'03!'. C~ , f~n CYSta~ir.-~ 1K- unit_, ~ac g_l-?ur ~ a~ it:~
digoxy~nln~ ~s -30Ve~ Thls pr~be was use~ to screen a library o~ pOtZ~0 genomic ~NA fra~en~ in pnage lam~d~
r iX~ tr~ag~ne). ~n_ sa~Q c~..~ ' ons -~ a~ov-~ wer~ used, excep~ tna~ pnzge ~re ?ia;Z~ ~t ~ car.s.~20.0CO p~ plate. One clone, B~2. was purified by 3 cycles o~ rep1atln~ at low density, and hybridization, A large s~ale preparation of this phage was made by infec'i~ exponenti~lly-growing E.col~ L~392 cells with ~0 ph~ge/^el'. o ~axi.~iz~ yield. t~.e culture was diluted 10-fold`afte~ 2.5 hours growth at 250 rpm and 3fC, and re-incubated overnight. Cell lysis was completed by the addition of chloroform (4 mL/L).
Debris was remo~ed by low-speed centrifugation after treatmen~t:with 6% NaCL for 1.5h at room temperature, The~phage were precipltated by 5 hour treatment on ic~
with~7%~PEG6~0:0 ;(Fluka:AG, Buch~, Switzerl~d), then:
col1èGted by 10 minutes centri~ugation at 12,000 x g.
20 ;~Phage~were resuspended in lOOmM NaCl, 8mM MgS04, 0.01%
geIatin;~, 50mM Tris.HCl pH 7.5,~ and:puri~ied by equllibrium den3i~ty centrifugation in:~CsCl (43% w/w~ at 155,000 x g o:vernight.: DNA was prepared from the phàge 25~ in ~buoyant density CsCl by ethanol~precipi;tation9 after overnight incubation at room temperature in 50%
ormamide, 10 mM EDTA,;0.1M Tris.HCl, pH 8.5.
~ BZ2 DNA was~:characterized by standard :~- 3O re~triction enzyme:analysis and Southern blot~ing (Ausubel etat., 19~ Sam~rook etat. ( 1989), suprd) . ~1 The ! i phage c~ntain~d a 13 kD insert, with the cystatin-like homology looalized in a 5 kb ~en~ral region. Fragments spanning thi3 hybridizing region were subcloned into pUC18 or pBlueiscriptY:II plasmids (Stratagene). and ~:

W~g2/21753 PCT/~S92/0$785 ~l'J9Si3 -72-se~ ?.ce~ as de3c~ ~e~ s~oi-. Tha ~?- ~ene ~n _~
. con~i3~ c~ 3 exons ana a l..l~ons. ~ c~d~3 ~r ~
poly~e?tide con3isting of 8 cystatin~lik~ units, with no other domains. The ~NA for each uni~ is in~errupted by an ir.~on. in t;~' 3^-mc ~OS' L_~n sS _- ' n'-o.-. ~5~r.
' the oryzacys~,a~in ~enes (~ondo (133~ S Le-~s 278:87-90: and ~ondo t1899). ~ne, 81:259-265).
~: Thc 5' end o~ the c~dln3 ~q~3nc~ W29 mo~' fie ~:: to ~orm a NcoI site around the initiator ATG, by PCR
1C a~p; ~.c_~ ~r. us ~ .a~s -~ &~ ..4.--- -.--TTTAAACTCCAAdClAGAA~C.: I:ne a.~piif _i ~râ~-n~ ~cs :~ cloned into pTA1, a pUC19 derivative, such that the 3' :~: end of th~ cloning sequence was adjacent to the BamHI
site in:the polylinker. The region between the unique HpaI:-~ite:in the~:insert and the BamHI site in the vect~r was replaced with~a 5 kb HpaI-BamHI fragment from~pDABi286~, which;contained the~6.2 kb XhoI fragment of B~Z2 in:pBlue~cri~pt II.: This reconstituted the entire PP1 gene:,~along with 1.5 kb of 3' non-translated equencé. The~ mutated coding region was then ~: transferred~on~ a NcoI fragment to the plant~:expre~ion vec~tor, pDAB30~3-Not. ~The expresYion cas~ette from this plasmid was tran~fèrred as a NotI fragment into ~the vector pDAB219 -Not. The resultant plasmid,:::pDAB~1400,~ ;
wa~u~ed ~or:t~ransformation o~ the maize:plants~

~ ; Example 1~ A gene without introns for~ full-length PPI.
,~
~ . The introns i,s remqved from,ajcloned PP~
gen~mic sequence by ~ite directed mutagenesis, using primer~ to loop:out the DNA between coding regions.
^ ;Such ~hanges a~e made with a Trans~ormer Mutagenesis Kit ..
(Clontech, Palo Al~o~ CA). A plasmid ~ontaining the PPI
gene wi~h intron~ is mutagenized by in uitro replieation -:"
::

~::

:

W~ 92/~1753 PCr/VS92/~785 73 ~ 1 3 ~ ~ 1 J

~nO~ ~WO Pn i 31~YS . One ~r .~en ( G~-ATCC~C~-C~4T~r-~AGCTC
eiiminates tne uniaue KpnI siJe in tne vector. The ~econd prim~n (GATTATAATAAGAAAGdGAA~GCTCATTTG~AC-~TL) is homolo~ous to the coding seauencQ3 flanking intron 6 of th~ ??I ~en~. Mllt2nt ~l~smi~3 _~Kin~ intron ~ ls selected by resistance to Kpn di~sstion. Succ~ssiv~
rounds of mut2~ .esi~ may b~ ur^~ to ~emova a~ he In~on from the P~' gQno.~iC cl one. The codin~ se U~CQ
m~y ther. be 'rSnsf~Q~ into pDA3303-~ot ~c~ Qx?rQssio~
lC i~ rl_n' c~lls. T~ x?ng93i5r c~ss~t3 fro~. ~his p'_s~i- w~ r~..s~ _ 3 ^ .Vot~ ~n__-en' i ~3 th~e : ~ vector pDAB219~-Not. The re~ultant piasmid was used for transformation o~ the maize plants.
Example 11: Development of a transgenic maize plant expressing a potato papain inhibitor : .
:A~. : Establishment of Friable, Embryogenie ~allus : C~ltures ~ Friable, embryogen1c maîze oallus are initiated rom imma:ture embryos of the genotype 87:3 x A188. Seed of ~he dent~eorn înbred,:B73, and the ~weet-corn inbred, A188, are obtained from~Ho1den's Foundation Seeds, Inc., 5 ~William~burg, XA and ~he ~niversity:o~ Minnesota, Crop Improvem~nt A~sociation, St. Paul, MN, re pectively.
Seed~are ~own indi~idually in pot~ containîng : appro~ima:tely 18 kg o~ dry oîl mix (Conrad:FaPard, Inc. 9 Spring~ield, MA~ moi~tened and adjusted to pH 6~0.
The plant~ ~re:maintainied in a greenhouse un,~er a 16/8 : photQperîsd. Ambient dayLight is ~upp1emented with a combina~ion of high pre~ure sodîum and metal halide . :lampe such that the minimum light intensity 2 m above pot level î~ 1:,$00 ft-candles. Greenhouse temp~rature -: is maintaîned within 3C:o~ 38C durin~ the day and 22C
:~ ~

:~
.
:
~,.,.. . , , ~ . . . . ... .. . . . . . . . . . . .

W~92/~1753 PCT/US92/~785 , 1 Q q ~
_, ~ J t,~ _ a~ r~L~ ?l~s ~ a 3~ ~ L.e~
solution containin~ 4C~ mg~ OL 20-20 2-~ .er~ l z-~(W.R. Grace & Co., Fogelsville, PA) plus 8 mg/L chelated iron (Ciba-G3igy, GreenlsDoro, NC).
-_ ~ -J ~ 3 ~ s a~ - L'~
inflorescQnces (tassels) a~e s;nedding pollen and silks have emerged ~rom f~ma_~ in~l3re3c~nc~s te~s). ~_le.~
is collec~ed by~plaoin~ a pape~ bag ove~ t;~e t~s- o~ a plan~ of the inbred line ~188. A female plant of the ~C i~br3~ ne L~13 iS ?r-Far_~ _0~ ?o'-~'-~C~ . 'J-. ~
bPfore pollell availa~iiity by c~t~ ng o~ tha ~ ~ o~ 3 husks and silks o~ an unfertilized ear shoot, The next .
day, after the silks have grown to for~ a thick "brush"
15 all the ~ame length, pollen is carefully applied to the sllks and the entire ear is covered with a paper bag.
When:the developing hybrid embryos reach a length of:approximateIy 1~-2.0 mm (10-t4 days after 20~ ~pollination3, the ear is exci~ed and surface:sterilized by emersion in 70% v/v:et~hanol for 10 minutes followed by soaking in 20% v/v commercial bleaoh (1% ~odium hypochlorite) for 30~minutes.: Following a ~teril:e, distil1sd water rin e, immature embryos:are aseptically i~olated and p:laced onto~a "callus"~medium with ~he embryo axis in~c~ntact with the medium ~cutsllar~slde ; : away ~rom the medium). The "~allus" medium consi3ts of the following oomponents: N6 ba~al salts and vitamins ~: ~Chu etal., ( 1978 ) Proc . Sym~
3 Science Pr~ss, Pek!ing, p~ 43-56): :20.;~/L sucro , ~91 ~: mg/L proline, 100 mg/L casein hydrolysate, 1 mgtL 2,4-dichloro-phenoxyacetic acid (2,4-D), and 2.5 g/L gelrite (K~lco, Inc., San Diego, CA)~ adjusted to pH 5.8.
~; :

~ .

W~92/21753 PCT/US9X/~785 ~1 Q,~1 n --75~J J - ' J
;.
,,; .
`~.,j n~ ryo~ a~e ~nc~
~l 28C in ~he dark ~or 10-30 days dur1n$ whic;~ 4i-~ ca' ' US
~ '~ssue. ~isplayin~ various types o, morphology, j ~rolife~ates from the scucellar region. The cailus t1ssue prod~c~d du~'n~ tnis tL~_ is class-~ied ~n~3 ~-three di tinct types: i~ sof4, granuiar, ~ransiucent call~1s lacking any zppare~t morpholo~ical organization (known as non-e~bryogenic); ii) compact, nodular, ¦ yellowish-to-whit c2llus consisti~g of groups of soma'~c e~bryos (often ~used) with distinct scutellar-d co:~o?tile-lik~ struc~ures (known as Lype I); and ~ oft ca1lus with numerous globular and elongated -i~ somatic embryos on suspensor like structures (known as Type II). Type II cal1us is the most suitable for establishing fr'able~ embryogenic cultures. Sometimes entire scut~ ill proliferate with this type of tis~sue or at t .;aes:~onl~small ectors~sxhibiting thi~
mo~phology will de`velop. At this point, selective sub-culture is necessary whereby only ti~sue with well-- 20~; def1ned globular~:and: elongated somatic embryos along with~some subtending undifferentiated, soft ti sue is rans~erred to Presh "callus" medium~

Every 10-~14 days,~the callus i~ ~ub-cultured to :25 :Yre~h "callus" medium being care:ful to seleet only tis~ue~of the oorrect morphology~.~ For the~first 8`10 week , selec~Lon is ~or Type II callu~ only, to increase ~y ~ the amount o~ tissue and to ~eleet agains~ non-q~: embryo~Q~ic and Ty~e I. At each sub culture/ lesq than ~ 3o 100 mg o~ ti sue is typically selected ~romrcallus that ha~ reached a ~ize o~ 1 g. Thus, the amount of Type II
- callus will no~ increase to more th~n 1 g ~or the ~irst 12 w~eks due to the striGt ~election for tis ue type.
During the fi~st 3 months, some lines (a line~i~ defined , ' W~92~21753 PCTJUS9~/~7~

210981~ 76-as or ~i~at~ng fro~ ~ s ..S e hyb~ld e~br-jo) wl ~-discardei i~ ~n~y io3- t;ne ~ pe ~ cr~noiog7. A~
about 8-16 weeks in well establi3hed Type II cultures.
selection o~ a aif~ere~t ~ype o~ ti 39ue can proceed.
Th~s tis3ue ~knowr as l~p~ ~ ~ is d ~r~n~ ~ro-. -~JF-I in that i~ i3 some~ha~ mor no.T.o3~neous 1.~ .~or~r.o;o~-J
and relatively undi~erentiated with no vi~ibl~ som~tic embry~s. The coIor will vary from ligh~-to-brlght ~: yellow. Normally~ it takes about 16-20 weeks to get this hcmo~eneous, Type IIT tissue in suf~icient amounts for routine experimentation (0.~-1.0 g).

During the 14-20 week period o~ Type III callus establiqhment, more lines are discarded if they revert to~Type II or Type I after repeated selection. At 14-20 waeks oP ge,-the cultures is checked for their ability to regenerate.plants ( ee Example: 11, Section ~). Lines that~do not regenerat~;are discarded. Culture~ capable o~ maintaining Type III morphology and regenerating plants are re~ferred to as:friable, embryogenic callus.

B. Trans~orma~ion via Microparticls:Propulsion Plasmid ~NA is adsorbed onto the 3urface of 25~gold particlP~ prior to use in transformatian experiments~ Th~e: gold particle re spheriaal with diameters ranging~rom about 1.5-3.0 micron~ in di meter (Aldrich:Chemical ~o.~ Milwaukee~, WI)~.~ Ad~orption is ~: ac~omplish~d by adding 74 uL of 2.5 M calcium chloride : 30 and;30 uL o~ 0.1 M ~permidine to 300 uL of DNA/gold u~pension (70 ug pDAB1400, 0.01 M Tri~ buffer, and 1mM
E~TA). The DNA-coated gold parSicles are vortexed immediately, th2n allowed to 3ettle to the bottom o~ an -Eppendorf tube and the resultant clear liquid is completely drawn of~. The DNA-coated gold particIes are :

WO92~217$3 PCT/US92/~785 ~77~ 2 l ~ 9~

t;ne~l ~es'~su~n.d~ ; c` 1O0/Q 5t;~a-.c~ 5 suspension is then d~luted to 15 mg DNA/boid per m~ 5~
ethanol for u~e in mic~oparticle propulsio.~ ex?e~ime~s.

-~.??~V~'~C~5 ~J ~,V ~5 0~ ~' a~ _, e~ ;
cai_is ~ ~s~ s ~J~ l~wlr.~ s~u-~ r_, s arran~ed in a thin layer on a 1 cm diamete~ piece of filtsr paper (Scnieicner and ~chuell, Inc., Ae-r.e, ~J
~ placed on the surfa~e of "callus" medium. The callus I tissu~ is allowed:to dry out slightly by allawlng the C Dlates to s~ana uncove~ed:in a laminar L;oW nooc fo~
several minutes before ~se~ In preparation ~or particie bombardment, the callus is covered with a 104 micron stainless ~t~el ~ereen. The DNA-coated gold particles ~ 15 are acoelerated at the friable, ~mbryogenic callu~
,~ ti~sue usin~ the particle bombardment apparatus :~: de~cribed in European Patent Application EP 0 405 696 ~ A1. Each callu~ tissue sample i~ bombarded 10-15 time~
:~ with eaeh bombardment delivering approximately 1 uL of .
20: DNA-coated gold ~uspen ion.

election:of Transformed Tissue and Plant Reg neration A~ter bombarding the 3ample, callus tis~ue is allowed to incubate for 1~2 day~ under ~he conditions described previou~ly (-~ee Example 11, ~ection I~. A~ter 2 days, each tis~ue:sample is divided into appr~ximately 60 equal piece~ 3 mm diameter~ and ~r~ns~erred to fresh!"callus'~' m~diu~jcontaining 30 mg/L
- Ba~ta~ Every three weeks, caLlu~ ti9SU2 iS non ; selectively tran~ferred to fresh Basta-containing - ~'callu '1 medium. At thiY concentration of herbicide, very little growth is observsd. After 8-16 weeks, sector proliferating from a background of growth WO92/21753 PCT/US92/~78S

- ~ û9~13 i/ e~ L~ SSU~ iS c~3~ T:~is ~ S3U- is so from the other callus and maintaine~ separately on ~as~-c~ntainin~ "callus" medium ar.d sel~ctively sub-~: culturQ~ ~ve~y 10-14 days. At this point, a h~stQche~ica~ assay for gus exDres~ion ~s pe~o~ D~
piacing small sample9 of callus tissue into 24~well mLc~oliter d~`shes (Co~lin~. N^w ~ork, N~? c~nLai.nl.~.
~pproxim2t~1y 500 uL of assay buf~er (0.2 M sodium ~: pr.osshate p~.~ 8.0, 0.1 ~M each of potassi~ fe-~ey~nid~
~ ~ ?' aSS''?~ ~rrocy~ d~. 1.0 M s~diu~ _~TA. ~.d t ~ .'L ~romo-'l-ehlo~o-3-indolyl-~_L~-D-~l~lc~o~
: Potato papain inhibitor gene expression is also assayed via immunoblot analy~is with potato papain lnhibitor antiserum.
~5 Basta-resistant, gus- and potato papaih ; inhibitor-positive callu ~i~ selectively sub-cultured to "induction" med`ium and incu~ated at:28QC in low light 12~ Pt-c~ndle~) ~or one~week followed by one week in 20~high~1ight:(325 ft-candles) provided by cool ~luQrescent : lamps~. The "in~:uction" medium ~is compo~ed of MS sal:ts and vitamin~ (Murashlg:e and Skoog~ 1962), 30 g/L
ucrose, 100 mg/L~myo-inositol, 5 mg~/L benzyl amino purine,:0.025~mg/L 294-D, 2:.5 g/L Gelrite adjusted to pH
5,7, Following~this two week induction period, the oallus i then non-9electively transferred to 7'r~generation" medium and incubated in high light at ~: 2~C. The "regeneration" medium is composed of MS salts and vitamins, 30 g/L ~ucrose, and 2.5 g/L gelrite 3 0 .~
adju~ted to pH 5.7. Every 14-21 days the ca~lus is , subcultur~d to ~resh~"regeneration" medium selecting ~or ti~9ue which appears to be differentiating leaves and ro~. Both "induction" and "regeneration" media ~ontain 30 mg/L Basta. Plantlets ~re transferrmd to 10 ~::
, ~

W092J21753 P~T/US92/~7~5 _79_ 2 1 0 9 c~ pot3 cr.r.~~ a~?rcxi.~.a'~'J 1 kg ef ~-~J sol~
moistened thoroughl~, and covered with cle~r pi~s~.c cupq for approximately 4 days. At the 3-5 l~af-sta~, plant~ are transplan~ed to l~rger pots and grown to m2turity as pr~viousi~J described (se~ _~æ~?ie 1,, ' Section A). Self- or sibling-pollination3 is per~orme~
on plant~ re~nerate~ ~rom the same culture. Crosses to non~transformed parental lines (i.e., ~73 or Al88) can : also be performed in order to obtain transge~ic proge.~y ar.alysis.

IV~ ~ ConPirmation o~: Potato Papain Innibitor Gene Integration ' : To confirm the pre3ence of the potato papain inhibitor gene in reg~nerated plants and progeny, 50uthern blot analy~is o~ genomic DNA is performed. DNA
;~ for each plan~ i~ prepared from lypholized leaf tis~ue ~; as ~ollows. Approximately 500 mg of tissue i R placed ; into;a 16 mL polypropylene tube:(Bec~on Dicken~on, Lincoln Park, NJ) into which is added 9 mL ~ CTAB
extraction bu~:fer (6.57 mL water, 0.9 mL of:1.0 M Tris pH7.5, 1.26 mL of~5 M ~odium chloride,~0.18 mL o~ 0.5 M
EDTA, 0~.09 g mixed alkyl tri-methyl ammonium bramide~
: 25: and 0.09 mL beta-mercaptoethanol) and immediately ~ incubated in a 60C water bath with ooca9ianal mixing.
:~ After about 60 minutes9 4~5 mL of 24:1 :
:chloro~orm/o tanol i~ added and gently mixed for approximately 5 minutes. Following a 10 mirute 3 centrifug~ at 900Xg at room'temperature, the top aqueous~ i.
layer i~ poured into a l6 mL polypropylene tube can~aIning 6 mL o~ i~sopropano1 where DNA precipitation oc~urs.

~: ' ,~

:~:

WO92/21753 PCT/IJS92/~7X5 ~109 ~ 80-lh.e ?r=~pi~cter DNA i~
with a gia-~ hook ar.a transLe~rea ta a ~ mL dis?osable tube containing l-2 mL of 76% ethanoi a~d 0.2 M sodium aeetate for 20 minutes. Tne DNA is the~ rinsed on th~
hook briefly in a microfu~ tube contai~ l m~ 76 J ethanol and 10 mM ammonium acetate ~efor~ oeing ~: trans~erred to a microfug~ tube containin~ ~00 uL of TE
buffer (lO mM Tris pH 8.0 and 1 mM EDTA) and placed on a rocke~ overnigh~ at 4C. The next day, undi~solved ~solids is re~oved by cer.t~i~ugation ~t high ~peed f~r 10 minutes. The DN.4-cont i.~in~ supe~na,ar.' is the~
pipetted into a new microfuge tube and stored at 4C.

The con~entration o~ DNA in the sample is determined by measuring absorbance at 260 nm with a : speotrophotom~ter. Approximately 8 ug of DNA is dige3tsd with ei~ther oP the restriction enzymes BamH1 or EcoR~1 as~suggested~by the m nu~acturer~(Bethe da Re-q`e:arch Laboratory, GaitherQburg, MD). :Thi~
20: combinat~ion ~f enzymes cut~ out the potato papain : : inhibitor gene intact. The DNA is then fractionated on :a~0.8%~agaros~e~gel~and tran~ferred onto nylon mem~ranes as:suggested by:the manufacturer (Schleicher and ; S~huell, Inc.9 Keene, NH). A potato papain inhibi~or gene Pragm~nt ~rom pDAB1400 i5 used~as a probe. Probe DNA~is prepar~d by random primer labeling with an ~ligo : Labeli~n~ Kit ~Pharmacia LKB ~iotechnology, Inc, Piscataway, NJ) as per th~ upplier's instructions with : 30 50 microCuries 32 P-dCTP. Blots are ~hen washed at 60C
in 0.25 x 5SC (30 mMIsodi'um chlsride, 3.0 mM'sod~ium citrate) and 0.2% sodium dodecyl sul~ate ~or 45 minutes, : blotted ~ry, and;exposed ta XXAR 5 film overnight with ~ : two inten~i~ying ~ereen~.

: ~ ~ s :

WO92/21753 PCT/US92J~478 ~, ~13331~

-o as~s raQ_3 an.~a to ir.se^' 2 t~cx, transgenie p~an s exprsssin~ th~ maxlma_ leYels o~
midgut~ef~ective plant ~ystatin are grown in 12" pots in ~oil. The ~oii is in~ested witn D~abrotica virgi~era egg~
and tne piants monitora~ ~or vi~i'ity, ~ , root mass ~nd s~andaoiiity over the cours~ of 4 wae~3.
Pl~nts ex?ressing midgut-effective plant cystatin ara significantly protected from the effects of Diabrotica l~rval damage. Alternatively, transgenic plants and 1~ popul2tions o~ transgenic plant3 ex~r~ssin~ P~I ar~
assessed ~or Dicbrotica ~esis4ance by th~ ~ethod3 d~cailed in '^Methods for the Study of Pest Diabrotica" ( 1986 ) eds., J.:L. Krysan and Tc A. Miller, Springer-Verlag, New York, pp 172-180.
1~
Example 12: CotransfoYmation of Maize wlth PPI gene and Potato C rboxypeptidase Inhibitor The procedures~of Example ll is substantially repeated, with the~exception that a second maiz2 ~issue is ~ransformed with a potato carboxypeptidase inhibitor jCPI). gene~ The potato CPI gene encodes a protein having a sequence o~ Glu-Gln His-Ala-A5p-Pro-Ile-Cys-Asn-Lys-Pro-Cys-Lys-Thr-His. rorrespo~ding coding and non-coding oligonucleotide sequences are 5ynthe~ized u ing ~Model 380A DNA synthesizer (Appli~d Bio~ys~tems, Focter City, CA), with pho~phoamidite chemistry. After ~ r~moval o~ excess:reagent by phenol/ehloroform :~ extra~tiGn7 chloroform extraction, and ethanol 3 precipitation, the~f~agments are diasolved ilh T4 ligasq 1 ~, buf~r. The mixture i5 heated ts 85C, then slowly cooled to 15C and maintained at 15C for at least 4 hour~ to allow the fragments to anneal.
, . .

WOg2~21753 P~T/US92/0~7~5 _ .
7 l ~ 9~ l g ~82-?3-~303 i~ t:~en cises~d w -h an excns, ~~ a restriccion endonucieas~c reco~nizing a unique restriction site on pDAB303 and the larger vector fragment purified by agarose g31 electrophoresis. Th resuitin~ frag~ent and the syntnesized car~ox~peptlda~c gene ar~ incubated witn T4 DNA ligase.

Th s plasmid is trar.s~or~3d nto ~.-iz~ s a~d stably tr~n3formed maizs cells are re~ ated following ~he procedures in Example 11.
,0 ~: Se~ h~ r cg a ?- e~ J ~ -. 4 ~ . -x ~
1:1 and Example:12, respectively, i9 germinated and the resulting planks ~elf-pollinated, i.e., pollen from one plant is uqed to fertîlize itself to produce an S0 population. S1 ~eed ~rom the resulting ears are grown , and 3elf-pollinations made to produce S~ germplasm.
rosses are mad~e between select:ed S2 plants derived from Examples ;11 and Example 12~ respectively.: The resulting 2~ F1:hybrids are evaluated f~r their co-expre~sion of PPI
nd CPI.

To a~se~ re3ist2nce to insect attack, tran~genic malze plants are~grown and infes~ted with 25 Diabroti~ ~uirgifera eggs:~ a~ discussed~in~Example 11.

: Example :13: Tran~ormakion o~ Rice Plants :~

A gen;e havin~ the sequence set forth in Figure introduced into rice plants (Oryzasutiua) u ing: 3a: substan~ially the~pro~eduPeQ qe,t ~orth in Christou, etal.
(1991)~ ~ 9~gh99L9l~ 9:957-962. The gene is in~erted into th~ rice tis~ue~culture using the transformation t-chnique~ ~et forth in ~xample 11.

.

WO~2/21753 PCT/US92/~785 210981~

To assQss re~ls~anc~ ncQ~t ~t'ack t tran~genic rice plantcf are grown and in.'ested with rice w~Qvil, using ~ubstantially the procedures of Example 1 1 .

I ~ ~xa,~pie 14: Trans~ormation o~ Co~tan ~ ant3 ¦ A ~Qne~ hav n~ th~ s~ a-.c~ ~v ~or'~;. in ~lg~r3 1 is introduced into cottor. (Gossypiumhirsutum L. ~ pl5nts ~:by either particle bomoardment or Agrobacterium mediated 13 L ~ns ~or~.a~.on.
f : :
~ kA. Par:ticle Bombardment ` , .
A gene having the sequence set forth in Figure :` 15 1 is introduced int:o cotton plants using substantially the~procedures;set forth:in Finer and McMullen (1990), ~ L~ 5~UJ Jb~ 9~ 8:586-589. The g:ene is in~erted f~ i nto the ~ot~on~tissue~-culture using the tran~ormation techniques~s~et :forth~in~Example 11.
: 20 To a~e :q::~resis~k:ance to inse~t attack, t:ran~geniC co~ton;:~plants are grown and infested with boll;~weevil, using~substant:ia~lly the~procedures o~
Éxampl~

B. ~Agrob~cterium-mediated~ Transforamtion ~

A~gene having the ~equence set forth in Figure:
1 is introduced into cotton plants:u~ing:sub~tantially 3f~ th~ prooedur~ qtl,for~hjin F,iroozablady,~etal.~ ( 19873, :~P ~ , 10::105-116~ The binary vectar u~ed ~or tra~ormation. pH707-Not (set f~rth in Figure

8), i ba~ed on th~ ~road hosk range plasmid RP4. It c~nt~ins khe A:and~B borders of an octopine-ty?e T
pLa~nid flanking~ a unique NotI clonlng site, the ,~, .

W~92/21753 PCT/US92104785 21~3 Q~ 84-selQ~a )i=~ ~c-i~er' l9 1-"~pJ~.-1 or~ 25 ~-~G t";' ~;
marker 35S-gus nos. The tetracycllne-~esistance ~ene o~
RP4 was rQplac~d by er~hromycin- and kanamycin~
resistancQ genes for selection in Dacteria.

To ZSa~S~ ~S1 3JanCQ to ins~ t~ck, transgenic cotton plants are grown and in~ested with boll weevil, using sub3tantlall~ th3 ?rCc~ Qs o~
Example 11, C ~x~?l- tJ ~ .S''~r~ ''On ~ ?^~. s , A gene havîng the sequence set forth in Figure 1 is introduced into alfalfa plants usng ~ubstantially ~: the procedures Yet~forth in D'Halluin etal. (1990), Crop ~;~ : 15 Sci., 30:86-871. The binary vector used ~or trans~ormation is pH707-Not.

: To as~ess resistance to in~ect attack, tran genic al~alPa plants are grown and infested with Z0~ Egypt:ian~alfalfa~eevil and alfalPa weevil,:uqing subYtantially the procedures o~ Example 11.
: :
Example 16: TransPormation o~ Dry Rean Plants A g~ne havlng the sequence 3et forth in Figure encoding potato:papain inhibitor, is introduced into dry bean plants (Phaseolus vulgaris) using sub tantially th~ same procedures qet fo~th in Unitsd State Patent 5,0159580.

To as~ss r~sistance to in~ect attack~
tran~eni~ plants are grown and infe~ted with Mexican ~: ~ bean beetle~ using~8ubstantially the procedures of ExampLe ~1.

::
~ .
: ' .

wo g2/2l7~3 2 1 0 g ~ 1 ~ P~/U5~2/0478s -8~-Exa,~pl~ 17: ~rans~or~a~-ion o:' ~ot~o .Jian~s A ger.~ having the sequ~r~ce se~ forth in Figure 1 is introduced into po~ato plants (Solanumtuberosum L~ ) is e~fecteA using suDstant~ally the same proeedures set ~, ~orth ln aha.~in and Simpson (1936j. .iortaci~nce, 21(~):1199-1202. The binary vector used for tr~nsformatl~n is pH707-Not.

` To assess resistance to insect attack, transgenic potato plants are grown a~d infested with potato be~clss, usin~ slostant ~ J ~ne procedure~ o~
Example 11.
:~
~: Example 18: Transformation of Rapeseed Plants : A:gene having the sequence set forth in Figure introduced into rapeseed (Brassica napus L . 3 i s e~Pected: u9ing ~ubstan~ially th same procedures ~set for:~h in Ch~are~t,; etal. :(1987),~Theor:.; A~e~ Genet, 20~ (1988~:, 7~:438-4:45. The:binary vector used for transforma~ion; is~pH707-Not.

: : To asse~ss~r~esistance to insec~ attack, transgen~ic rapeseed plants are grown and infested with 25~ :~flea~beé~tles~,~using~sub~stan~tially the procedure~ of Example~

:: . :

:
. ':
~': :`: , .

~ ~ .

W~92/21753 PCT/~S92/~785 2lassls -~xa~m.pi~ 19: I~ola~ion o~ tne Mui~iaomain Mid~ut-~fec~il/e Cy~tatln ~ro~ ~omat-~ Le~ves Leaves from ~eedling tomato plants are exc~s~d and the petioles placed in moist sand. The leaves ar~
maintained under continuous illumin~rion for ~our days.
a~ter which they are gentiy homog ~ized in a Warlng blendor with O . 1 M sodium phosphate pH 7.5 cont~ini~.~ 50 ~g/ml each of leupeptin, antipain, and pepstatin and 1 mM ethylenediaminetetraacetate (2 ml per g~am tisque .
A~ter straining through four l~e~s of che~ss^loth, th~
filtra~e is centri~uge~ ~t 12,000 ~/olu~ns p~ nu~
in a Sorvall GS3 rotor and the pellet taken up in 0.1 M
30dium acetate, pH 4. The solution is centrifuged to remove insoluble material and the supernatant dialyzed : agai:nQt 0.01 M Triq pH 7.5. The dialyzate i9 loaded onto a Pharmacia Mono Q HR 10/10 column and:eluted with a 0-3~0~mM s:odium chloride~gradient over 40 minutes, Fractlons containing peak papain-inhibitory activity are O: pooled, dialyzed~a;gainst w~ater and concentrated.: The purified polypeptide is digested and sequence :in~ormation as:de~cribed in Example 1. The polypeptide iS: ~hown to be an~ effective inhibitor oS D~abrotica larval midgut proteases and Dlabrotica growth by methads descri~ed in hxample~ 2 and 3. : :~
Although the invent:ion has been~described ln onsiderable d~tail, with reference to Gertain preferred embodiments thereo~, it will be understoQd that 3 ~variations and modi~ica~ions can be affected within the spirit and scope of the invention as describ~d above and ~ as:defined in the appended claims.

,~ ' .

~ ' '

Claims (49)

WHAT IS CLAIMED IS:

1. A method of protecting a plant or a part of said plant against insect infestation by one or more insects having digestive cysteine proteases, comprising presenting to a loci wherein said insects(s) is to be controlled with an inhibitory amount of an midgut-effective plant cystatin, whereby the inhibitory amount of midgut-effective plant cystatin is ingested by the insect.

2. The method of Claim 1, wherein the midgut-effective plant cystatin is a protein having more than one cystatin domain.

3. The method of Claim 2, wherein the midgut-effective plant cystatin is potato papain inhibitor or tomato papain inhibitor.

4. The method of Claim 1, wherein the midgut-effective plant cystatin is a midgut-effective plant cystatin and a synergist capable of inactivating insect digestive enzymes which inactivate the midgut-effective plant cystatin.

5. The method of Claim 4, wherein the midgut-effective plant cystatin is a peptide of a single cystatin domain and the synergist is carboxypeptidase inhibitor.

6. The method of Claim 3, wherein the midgut-effective plant cystatin is a protein is a protein having the amino acid sequence set forth in Figure 1, or a functional derivative thereof.

7. The method of Claims 1 through 6, wherein the midgut-effective plant cystatin is applied to a plant species other than the plant species from which the midgut-effective plant cystatin was derived.

8. The method of Claim 1, comprising inserting into the genome of the plant a sequence coding for a midgut-effective plant cystatin with a promoter sequence active in the plant to cause expression of the midgut-effective plant cystatin sequence at levels which provide an insect controlling amount of the midgut-effective plant cystatin.

9. A method according to Claim 8 further comprising the steps of:
(a) culturing cells or tissues from the plant;
(b) introducing into the cells of the cell or tissue at least one copy of a gene coding for the midgut-effective plant cystatin, (c) regenerating resistant whole plants from the cell or tissue culture.

10. The method according to Claim 9, which comprises the further step of sexually or clonally reproducing the whole plant in such a manner that at least one copy of the sequence coding for a midgut-effective plant cystatin with a promoter, sequence active in the plant is present in the cells of progeny of the reproduction.

11. The method according to Claim 10, further comprising the steps of:
(a) selecting a fertile, insect resistant plant prepared by the method of Claim 11;
(b) sexually crossing the insect resistant plant with a plant from the insect susceptible plants from the susceptible variety;
(c) recovering reproductive material form the progeny of the cross and (d) growing resistant plants form the reproductive material.

12. The method according to Claim 11, for imparting insect resistance to a substantially homozygous population of plants of a susceptible variety, which comprise the further steps of repetitively:
(a) backcrossing the insect resistant progeny with substantially homozygous, insect susceptible plants form the susceptible variety; and (b) selecting fro expression of both insect resistance and the other characteristics of the susceptible variety among the progeny of the backcross, until the desired percentage of the characteristics of the susceptible variety are present in the progeny along with the insect resistance.

13. The method of Claim 1, wherein the plant protected from insect infestation is maize, alfalfa, cotton, rape, dry beans, potato or rice.

14. An agricultural composition containing a carrier and an insect controlling or combating amount of at least one midgut-effective plant cystatin as an active ingredient.

15. The agricultural composition of Claim 14, wherein the midgut-effective plant cystatin is a protein having more than one cystatin domain.

16. The agricultural composition of Claim 15, wherein the midgut-effective plant cystatin is potato papain inhibitor or tomato papain inhibitor.

17. The agricultural composition of Claim 18, wherein the midgut-effective plant cystatin is a midgut-effective plant cystatin and a synergist capable of inactivating insect digestive enzymes which inactivate the midgut-effective plant cystatin.

18. The agricultural composition of Claim 17, wherein the midgut-effective plant cystatin is a peptide of a single cystatin domain and the synergist is carboxypeptidase inhibitor.

19. The agricultural composition of Claim 18, wherein the midgut-effective plant cystatin is a protein having the amino acid sequence set forth in Figure 1, or a functional derivative thereof.

20. A transgenic maize plant and its sexual progeny resistant to attack by one or more of corn root worms, maize weevils, lesser grain borer and flea beetles, said transgenic maize plant expressing an insect controlling amount of a midgut-effective plant cystatin.

21. The transgenic maize plant and its sexual progeny of Claim 20, wherein the plant comprises a DNA
sequence stably incorporated into its genome, said DNA
sequence having a coding region capable of encoding a midgut-effective plant cystatin downstream of a promoter sequence active in the plant to cause expression of the midgut-effective plant cystatin sequence at levels which provide an insect controlling amount of the midgut-effective plant cystatin.

22. The transgenic maize plant of Claim 21, wherein the midgut-effective plant cystatin is a protein having the amino acid sequence set forth in Figure 1, or a functional derivative thereof.

23. The transgenic maize plant of Claim 22, wherein the plant further comprises a second DNA
sequence stably incorporated into its genome, said DNA
sequence having a coding region capable of encoding carboxypeptidase inhibitor with a promoter sequence active in the plant to cause expression of carboxypeptidase inhibitor at levels which provide amount sufficient to inactivate insect digestive enzymes capable of inactivating the protein.

24. A transgenic rice plant and its sexual progeny resistant to attack by rice weevil, said transgenic rice plant expressing an insect controlling amount of a midgut-effective plant cystatin.

25. The transgenic rice plant and its sexual progeny of Claim 24, wherein the plant comprises a DNA

sequence stably incorporated into its genome, said DNA
sequence having a coding region capable of encoding a midgut-effective plant cystatin with a promoter sequence active in the plant to cause expression of the midgut-effective plant cystatin sequence at levels which provide an insect controlling amount of the midgut-effective plant cystatin.

26. The transgenic rice plant of Claim 25, wherein the midgut-effective plant cystatin is a protein having the amino acid sequence set forth in Figure 1, or a functional derivative thereof.

27. A transgenic potato plant and its sexual progeny resistant to attack by one or more of Colorado potato beetle and three-lined potato beetle, said transgenic potato plant expressing an insect controlling amount of a midgut-effective plant cystatin.

28. The transgenic potato plant and its sexual progeny of Claim 27, wherein the plant comprises a DNA
sequence stably incorporated into its genome, said DNA
sequence having a coding region capable of encoding a midgut-effective plant cystatin with a promoter sequence active in the plant to cause expression of the midgut-effective plant cystatin sequence at levels which provide an insect controlling amount of the midgut-effective plant cystatin.

29. The transgenic potato plant of Claim 28, wherein the midgut-effective plant cystatin is a protein having the amino acid sequence set forth in Figure 1, or a functional derivative thereof.

30. A transgenic cotton plant and its sexual progeny resistant to attack by boll weevil, said transgenic cotton plant expressing an insect controlling amount of a midgut-effective plant cystatin.

31. The transgenic cotton plant and its sexual progeny of Claim 30, wherein the plant comprises a DNA
sequence stably incorporated into its genome, said DNA
sequence having a coding region capable of encoding a midgut-effective plant cystatin with a promoter sequence active in the plant to cause expression of the midgut-effective plant cystatin sequence at levels which provide an insect controlling amount of the midgut-effective plant cystatin.

32. The transgenic potato plant of Claim 31, wherein the midgut-effective plant cystatin is a protein having the amino acid sequence set forth in Figure 1, or a functional derivative thereof.

33. The transgenic alfalfa plant and its sexual progeny resistant to attack by one or more of Egyptian alalfa weevil and alfalfa weevil, said transgenic alfalfa plant expressing an insect controlling amount of a midgut-effective plant cystatin.

34. The transgenic alfalfa plant and its sexual progeny of Claim 33, wherein the plant comprises a DNA sequence stably incorporated into its genome said DNA sequence having a coding region capable of encoding a midgut-effective plant cystatin with a promoter sequence active in the plant to cause expression of the midgut-effective plant cystatin sequence at levels which provide an insect controlling amount of the midgut-effective plant cystatin.

35. The transgenic alfalfa plant of Claim 34, wherein the midgut-effective plant cystatin is a protein having the amino acid sequence set forth in Figure 1, or a functional derivative thereof.

36. A transgenic rape plant and its sexual progeny resistant to attack by flea beetles, said transgenic rape plant expressing an insect controlling amount of a midgut-effective plant cystatin.

37. The transgenic rape plant and its sexual progeny of Claim 36, wherein the plant comprises a DNA
sequence stably incorporated into its genome, said DNA
sequence having a coding region capable of encoding a midgut-effective plant cystatin with a promoter sequence active in the plant to cause expression of the midgut-effective plant cystatin sequence at levels which provide an insect controlling amount of the midgut-effective plant cystatin.

38. The transgenic rape plant of Claim 37, wherein the midgut-effective plant cystatin is a protein having the amino acid sequence et forth in Figure 1, or a functional derivative thereof.

39. A substantially pure midgut-effective plant cystatin, wherein the protein is composed of more than one cystatin domain and is capable of controlling insect infestation by one or more of insects having digestive cysteine proteases.

40. The substantially pure midgut-effective plant cystatin of Claim 41, wherein the cystatin is a protein having the amino acid sequence set forth in Figure 1, or a functional derivative thereof.

41. A DNA isolate capable of encoding a protein composed of more than one cystatin domain.

42. The DNA isolate of Claim 41, wherein the DNA isolate has the nucleotide sequence coding an amino acid sequence set forth in Figure 1, or a functional derivatives thereof.

43. A biologically functional expression vehicle containing a promoter effective to promote expression of a downstream coding sequence in plant cells, a DNA coding region coding for the expression in plant cells of protein composed of more than one cystatin domain and a termination sequence effective to terminate transcription or translation of the genetic construction product in plant cells, the genetic construction effective to express in the cells of the plant insect controlling amount of the midgut-effective plant cystatin.

44. The biologically functional expression vehicle of Claim 43, wherein the DNA isolate encodes an amino acid sequence set forth in Figure 1, or a functional derivatives thereof.

45. The biologically functional expression vehicle of Claim 43, wherein the expression vehicle is pDAB219.DELTA.-Not.

46. The biologically functional expression vehicle of Claim 44, wherein the expression vehicle is pDAB219.DELTA.-Not.

47. A host cell transformed with a biologically functional expression vehicle of any one of Claims 43 through 47.

48. The host cell of Claim of 48, wherein the plant cell is maize, alfalfa, cotton, rape, dry beans, potato and rice.

49. The transgenic plant cell of Claim 49, wherein the DNA sequence is controlled by a promoter effective to promote expression of a downstream coding sequence in plant cell. the DNA sequence coding region coding for the expression in plant cells of a midgut-effective plant cystatin and a termination sequence effective to terminate transcription or translation of the genetic construction product in plant cells, the genetic construction effective to express in the cells of the plant insect controlling amount of the midgut-effective plant cystatin to control one or more insects having digestive cysteine proteases .