CA2098283A1 - Oxidation resistant variants of parathyroid hormone - Google Patents

Abstract

Described herein are methionine-substituted variants of parathyroid hormone which, relative to their natural counterparts, exhibit reduced sensitivity to oxidation and substantial PTH activity.
Their production using recombinant DNA-based techniques is also described, as is their therapeutic use, e.g. in the treatment of osteoporosis.

Description

2 a ~ 3 ~ 8 3 PCT/CA91/00451 oxIDaTIo~ R~I5TAN~ v~lLLaNrs O~ PARAT~YROID W ~NON~

F~ELD OF T~E INVENTION

This invention relatas to ~asia~ts o~ parathyroid hormone, to the productioA o~ ~ch variant particularly ~ia recombinant DNA
technology, and to pharmaceutical compo~itions containing ~uch ~ariant~.

BACgGRO~ND TO T~E INVE~T~ON

Parathyroid hormone, or P~, is a protein product of mamma}ian parathyroid gland~ that elicit3 ~ariOuQ biological ef~ects. Of co~sid~rable current interest is the role o~ YT~ as a mediator o~
th~ phy3iologically ~ormal, bone rQmodelling proce3~. In thi~
regard, PT~ acts on o~seous ti~ue to ~odulate deposition of ~koletal calcium, and thus ca~ cau~e a~ iacrea~e in ~one mas~. It has be~n suggested that the administration of PT~, or agoni~tic analogues thereo~, would be u~e~ul therapeutically to treat and/or prevent bone-related disorders, such as osteoporoRi~.

It has also been revealed that PT~ exerts a vasorelaxant ~ffect on the cardiovascular syQtem, and may be useful in controlling systemic blood pre~sure (~ee for example the article by Tenner et al in Vas ular Neuro~ffector Mechanisms, 4th I~ternational Symposium, Ra~n Pre~s, 1983, pp289-293). It has more recently been revealed that ~T~ i~ capa~le also o~ modulating the growth of keratinocyte~, and may be useful therapeutically in the treatment of skin-r~lated disorder~ such as psoriasis ~see W089/03873).

VariouY ~orms of PT~, includ~ng bo~ine and human PT~ and thair analogues, thus hold great promi~e as therapeutics in the treatment and/or pre~ention of a umber of human disorders. And, current indications are that the ~upply of P~ in amount~ ~ufficient for ~ ',., W092~11286 PCT/CA91/00451 ~ 2 its clinical and commercial applications can be met by ~axploiting recombinant DNA technology for it~ p~oduction. It ha~ been reported that the bact~rial ho3t E. coli, for example, ia capable of expres3ing DNA coding for huma3 PT~, to produce a bioactive PT~
product (see Rabbani et al, J. Biol. Chem., 1988, 263(3):1307).
Production of bioac~ive P~ in the yea~t Saccharomyc3s cerevi~iae ha~ also been.reported (~ee Gautvik et al, W088/03165).

A drawbac~ to itQ value as a pharmaceutical product, however, is that P~ sensitive to oxidation, to the extont that it~
biological activity can bs el~manated following axposure to cQrtain ctrong oxidants, especially over ti~e. ~a oxidativa inactivation of PT~ can thus be problematical during variou~ ~tages in ~ts production and purification, can raduce it~ ~helf~ a and may reduce ~alf-life and/or bioavailabil~ty of the protein in v~vo. It would t~u~ be de irabl~ to provida PT~ Yaria~ta havi~g a reduced n~itivity to oxidation.

The sensitivity of PT~ to oxidation wa~ fir-~t appreciated during att~mpt~ to label the prot~in u~ing an oxidative iodination procdQs. As reported in J. Biol. Ch~m., 1976, 251(l):159, Ro enblatt et al ~ound that a fragment of boYine PT~ i.s. bovine PT~ 34), wa3 inactivated ~hen treated under iodinating conditions. ~owever, when the two methionine residues located at positions 8 and 18 in the pQptide were replaced with an i~osterically s~milar but synthetic amino acid, norleucine, they found that activity of the reQulting bovine PT~ analogue was 3ub3tantially una~fected by the iotination prooess. Although the substituted methionines and their norleucine replacement~ were close ~tructural homologues, however, the norleucine-containing analogue exhibited a ~ignificantly reduced bioactivity, of lQsq than about 50% of its'methionine-containing counterpart.

The use of a synthetic amino acid such a~ norleucine a~ a methionine replacement pre~ents ~everal disadvantages. Norl~ucine-~`~j" WO92t11286 PCT/CA91/00451 3 2 ~
containi~g analogues of PT~ can be produc~d only by the laboriousroute of solutio~- or solid-pha~e peptide synthe~iq. That norleucine is not naturally occurring also raises the possibilitiy that PT~ analogues containing it may stimulate a~ immu~e response ~ollowing administration. Moreover, the reduct~on in bioactivity cau3ed ~y replacing methionin~ with norleucine can be unde~irable in a pharmac~utical context, particularly ~ince further reductions in ~ioactivity are likely to occur during storage, and in ~o. It would accordingly be desirable to provide variants of parathyroid hormone that exhibit both substantial PT~ activity and reduced s~n~itivity to oxidation. It would be particularly dosirable to pro~ide an alternati~e method for preparing PT~ ~aria~ts having ~uch charactQristic~.

It is a general object o~ the pr~sont inventio~ to provide novel ~ariant~ of parathyroid hormone t~at exhibit. ~ubstantial PT~
acti~ity and reducad ~ensitivity to oxidation.
: ., It is another objoct of the present invention to provide variant3 of parathyroid hormone having substantial PTH activity and reduced sensitivity to oxidation, which are amenable to production by recombinant DNA technology.
' It is also an object of the present invention to provide a pharmaceu~ically useful composition containing a novQl parathyroid hormone variant that exhibits substantial PT~ activity and reduced sensiti~ity to oxidation.

.
S~MM~RY OF T~E INVENTION
::: , In the present invention, VariantQ of parathyroid hormone Qxhibiting sub~tantial PTH activity and reduced ~ensitivity to oxidation are obtained by replacing at least one ~ethionins re~ident in PTH with a genetically encoded amino acid.

.. , - . , , ... ~ ,, . . ;, , ~, . . . .

WO92/11286 PCT/CA91/00451 ~ :
~98~ 4 .
More particularly, a~d according to ~eneral aRpect of the pr~i3ent invention, there ii~ provided a parathyroid hormone variant haviAg subi3tantial PTH activity and xeduced sensiti~ity to oxidation, of the formula:

[X8Y18]PT~

wherein at least one of X and Y ii3 a genetically ~ncoded amino acid other than methionine and cyistQinQ.

AGCOrding to one ~mbod~ment, the pa~athysoid hormone varia~ts ~-are tho~e in which Y in the above fo~mula i~ methionine, and X i~ : :
elected ~rom alani~e, ~aline, lauci~e, i~oleucine, serine a~d tryptopha~.

~ocording to a~other embodiment, the parathyroid hormone ~:
~aria~t~ are those in which X i~ the abOVQ ~osmula i8 methionine, and Y is a ge~etically encoded amino acid other than methionine and cysteine.

According to another embodiment o~ the prosent i~vention, Y in ;.
the abov6 formula is other than methionine and cy~teine, and X i3 selected from alanine, ~aline, leucine, isoleuci~e, serine and tryptophan. ~ :
~ .
In using genetically encoded amino a~ids rather than synthetic amino acids as methionine raplac~ments, the pre~ent invention pro~ides PT~ variants that in addition to having substantial PT~
acti~ity and reduced sensiti~ity to oxidation, are also amenable to production by recombinant DNA techniques. According to another aspect o~ the present invention, therefore, there is prorided a callular host h~ving incorporated expressibly therein a DNA
molecul3 which codes for a PT~ variant o~ the present inv~ntion.
In a related aspect of the present in~ention, there is pro~ided a method for produclng a PTEI variant having substantial PT~ activity . .: ,.
. - ;' ~ ~
R~

~.: WO92/11~86 PCT/CA91/00451 ~ ..
2 ~ 83 and a reduced Qensitivity to oxidation, compri~ing the ~tep of culturing a cellular host in which DN~ coding ~or the PTR ~axiant is expras~ibly incorporated.

The PT~ ~aria~ts of the present i~e~tion are ~uitably ~mployed as therapeutics. According to another a3pect of the pre~ent invent~on, therefore, there i8 provided a pharmaceutical aomposition comprising a pharma~eutically acceptable carrier and a PT~ ~ariant of the pre~ent invention.

The~e and othar a~pect~ of the invention are now dQ~cribed .
with in greater de~ail and with rsf~rence to the accompanying drawings, in whi~h~
', ':
BR~EF REFERENCE TO TRE DRAWINGS .~ ~ .
. . .
Figure 1 i~ a map o~ plasmid pX in which DNA coding fo~ hu~an PT~ is li~ked operably with DNA enabling expres~ion thereo~ in ~
coli; . .
.. :' Figure 2 provides the ~ucleotide sequence of the human PTR- `.. ~ .
encoding region of the plasmid shown in Figure l, and al~o provides ~or re~erence the amino acid sequence of human PTR. .Methionine :~
residues at positio~s 8 and 18 are highlighted using boxes;
.,:
Figure 3 illustrates graphically the relative activities of human PTR and human PTH variants, be~ore oxidation; and :~
., -~
Figure 4 illustrates graphically the relative activities of human ~T~ and human PTH variants, after oxidation.

DETAILED DESCRIPTION OF TRE INVENTION AND ITS PREFERRED EMBODIMENTS ..
: .~
The preQent invention relates to PTH variants that exhibit :~
substantial PT~ activity.and a reduced ~ensitivity to oxidation.

~0~8283 6 In the present ~peci~ication, PT~ acti~ity is defined in the context of the o~etosarcoma-based adenylate cyclase assay employed conventionally in the art. Briefly, thi~ a~say provides an in vitro determination of the extent to ~hich PTH stimulates adenylate cycla-~e acti~ity in rat osteo~arcoma cells o~ the `~MR' lineage, and thu~ provide~ an indication of PT~ effects on bone i~sue i~

~i~o. Protocols for cond~cting the assay have been de3cribed by Rodan et al, 19~3, J. Clin. Invest., 72:1511 (in which the osteosaracoma cells of the ROS lineage a~e employed) a~d by Rabbani et al, 1988, Endocrinol., 123:2709 (which employ~ the lin9 ~MR-106~. PT~ ~ariantQ that sxhibit, in the nMR-ba~ed a~say, an EC50 of at least 2,000 nM i.Q. 2, 000 nM or lower, are herein characterized as having "substantial" PT~ activity.

In addition to retaining substantial PT~ acti~ity, the PT~
~aria~ts of the present in~ention are also characterized by a san-~itiYity to oxidation that is reduced, relative to a methionine-contai~ing P~ counterpart. A PT~ ~ariant having a "reduced sensitivity to oxidation" will exhibit, following exposure to an oxidant, an activity as measured in the osteosarcoma-based assay which exceeds the activity exhibited by a similarly treated PT~
control. An assay suitable for determining sensitivity to oxidation entails a two step procedure, in which the PT~ variant is first exposed to oxidizing conditions, for exampls u~ing hydrogen peroxide as oxidant, and is then assayed for actiYity in the osteosarcoma-based assay just described. Protocols suitable for assaying oxidation sensitivity are described by O'Riordan et al, 1974, J. Endocrinol., 63:117, and are outlined in ~he examples herain. ~uman PTH variants having a reduced sensitivity to oxidation will exhibit in the osteosarcoma-based assay an activity that is at least greater than a similarly treated human PTH
control.

The PTH ~ariants of the present invention conform to the general formula:

5 ~ ~5 ~ ~ J I

~ W092/11286 PCT/CA91tO0451 7 2~9~233 tX~Yl0~PTH

whQrQin at l~ast one of X and Y i~ a genetically encoded amino acid other than methionine and cyeteine. Tn the abo~e formula, the numeral~ identify the location of the amino acids X and Y withia the PT~ molecule, relati~e to the N-te~inal amino acid tha~eo~
~or con~istency and a~ is conventional in the art, X and Y are as~igned the ~ame positional n~m~er when pre3ent in the context o~
N-tarmi~ally truncated or extendad form~ of PT~, such a~ analogue~
or fragment~ of P~. In the ~ormula, the term P~ re~r~ to any gena~ically encodable form o PT~ in which a methionine i~ re~ident at one or both of positionQ 8 and 18. Such form~ include, but are not limited to, porcine PT~ which has a si~gle methionine re~ident at position 8, a~ well as human PT~ a~d bovine PT~, both of which have methioni~e~ resident at po.~ition 8 and po~ition 18. The term PT~ al~o ambrace_ rat PT~, which ha~ a methionine re~idue at poQition~ 8, 21 and 41, and chicken PT~ wh~ch has 3 methionina residue at position~ 5, 8, 26 and 80.

The term "human P~" re~er~ to the mature form of the hormone, which consi~ts of 84 ~mino acids arranged in the sequence reported by Kimura et al, 1983, Biochem. Biophys. Res. Comm., 114(2):493.
The terms "human PT~", "hPT~" and "hPT~ 84)" are used i~terchangeably herQin.

The terms "bovine PTR", "rat PT~" and "porcine PT~" refer also to the mature form o~ the hormone, each of which consists of 84 amino acids arranged in the 3equences reported by Xeutmann et al in Cusrent Re3earch on Calcium Regulating ~ormones, Cooper, C.W.(Ed.), ~987, ~niversity of Texas Press, Austin, pp.57-63.

While the term PTH refers unless otherwise stated to the mature ~orm of a given mammalian PTH species, it will be appreciated that the stratagy herein described can be applied also to genetically encodable, methionine-containing analogues and , ":
. ' t : - - , : ... , .. .. ,., . , , ,, WO92/11286 PCT/CA91/00451 ~ ~ .
2~98~83 8 ~ragments of PTH which exhibit ~T~ activity, in order to ganerate ~ariants t~ereof axhibiti~g reduced sen~itivity to oxidation. The term "PT~ analogue" is u~ed herein with r~erence to methionine-containing forms of PT~ ha~i~g an altered amino acid ~equencQ, ~uch as an amino acid sub~titution at a no~-m~thionine ~ite. The tenm "PT~ fragmant" is used herein with r~ere~ce to methio~ine-containing peptide~ having PT~ acti~ity a~d comprising at lea~t the first 27 amino acids of PT~, a~d ~ore desirably the first 34 amino acids o~ PTa.

A~ will be appreciatad ~rom the examples provided herein, t~e oxidation sen~iti~ity exhibited by PT~ can be reduced by replacing at least one methioni~e re~ide~t in PT~ with ~irtually any genetically encoded ami~o acid. Of course, cy~teine i-q a~
oxidizable a~ino acid, and should ~ot be u~ed a~ a methionine raplacQment. Fox PT~ ~pecie~ in whic~ methionines are reside~t at two po~itions, ~uch as human ~ aad bovine PT~, it has b~en 4Ound that the amino acid used a3 a methionine replacQment mu~t be care~ully selected in order to pr~erve ~ub~tantial PT~ acti~ity.
~urther~ore, the site at which replac~ment is e~fected al~o affects both oxidation sen~iti~ity and PT~ activity of the resulting variant.

More particularly, it has baen fou~d that ~ensitivity to oxidation is reduced a~d tbe PT~ acti~ity substa~tially preserved, when the methionine at po~ition 18 is replaced with virtually any genetically encoded amino acid. Ac ordingly, there i3 provided according to one ~mbodiment o~ the present in~ention a parathyroid hormone variant of the formula:

~yl~] PT~

wherein Y is a ge~etically encoded amino acid other than methionine and cysteine. Desirably, Y is selectsd ~rom among the group consisting of alanine, ~aline, leucine, i301eucina, serine and .

S ~ J~ T

.. . . . .. . . ..

. . . . . ~... .

. , ~ WO92/11286 PCT/CA91/00451 ~
9 209~283 tryptophan. Mo~t suitably, Y i9 3elected ~rom auong the group con~isting of alanine, valine, leucine and i~oleucine. ~referably, Y is leucine.
: :.. ' Specific compounds conforming to the formula [Y~PT~ include human PT~ variants ~uch aR rLeul8]hP~, t~lea]hP~, tAla~hPT~, and -~
[Vall~]hPT~, a well as bovine PT~ equivalent~ thereof.

~ eplacement of the methionine at position 8 o~ PT~ has a more Qigni~icant e~ect on both oxidation sens~ti~ity ~nd PT~ activ ty than does replacement o~ the methionine at position 18. Relative to r~placement o~ Metl8, a great~r reduction in 8en8iti~ity to oxidation is realized when Met8 is ~eplaced. ~owever, replaoamant o~ Mat~ can alQo cauQe a sigaificant decline in PT~ activity, and the amino acid chosan to replace Met~ mu~t be selQcted car~fully.
Accordin~ to one ~mbodiment o~ t~e pre~ent invention, there are pro~ided PT~ varia~ts which oonfosm to tha formula:
. .
~Xa]PT~
' `
wherein X is an amino acid s~lected ~rom among the sroup consi~ting of alaAine, valine, leuci~e, isoleucine, sarine and tryptophan.
Desirably, X is selected from alanine, valine, leucine and isoleucine. Most suitably, X i~ selected from valine, 10ncine and isoleucine. Pre~erably, X ~s leucine.

Specific compounds con~orming to the abo~e fonmula include human ~T~ variante, such as ~Leu~hP~ e8~hPT~ and [Val~]hPT~, as well as bovine PT~ and porcine PT~ equivalent~ thereo~.

~ n addition to PT~ variants characterized by ~ingle site methionine replaca~ent i.e. confonming to one o~ the formulae [X~T~ and ~Y1~PT~, the present invention provides PT~ variant~ in which methionines rasident at both positions 8 and lB are replacad, o~ the formula:
";;,'.:

- ' ' ' ' ' ' ' . ' ' ' -'.' :.: ".~ . . " ' " ' ` ; " ` ', ' ` . ~ . , . ' ' '. ' =' " ' ' . ' , ' ', . . ' : ,'`' ' ' . .: .' ', '' ': : . ,` .~. ' ' ''' ' .' ' ' . : . ' .

2 0 9 ~ 2 8 ~ tX8y~ ] PT}~

wherein X and Y are independently selacted, Y i~ a genetically encoded amino acid other t~an methiosine and cysteine, and X i5 an amino acid ~electQd f rom among th~ group con~i~ting of alanine, valine, leucine, isoleucine, aerine and tryptophan. Relative to VariantQ characterized by single site methionine replac~ment, PT~
variantQ conforming to the above fo~mula are Yirtually reQi-Qtant to oxidation. With selection o~ X from ths amino acid group recited above, ~ub~tantial ~T~ acti~ity i~ al~o ~etai~ed.

Speci~ic PT~ ~a~iants conforming to the above ~ormula, i . 8 ., ha~ing two-site me~hionine raplac~m~nt, include human PT~ varia~t~
s~ch a~ ~eu~Leu~]hPT~, rIl~8Leu~lhPT~, r~al~Leu~9~hpT~
~SeraT-eUla] hPTE~ aa~eul~] h~TE~, tTrp8Leu~ T~, tLeu8Ilela] hPT~, [Leu~Val~]hPT~ asd tIle~Ile~a]hPT~ and bo~ine PT~ equiYalents thereof.

The PT~ variant~ of the p.e~ent invention are genetically encodable proteins, and may there~ore be produced e~ther by ch~mical synthesis or, more deQirably, u3ing recombi~ant DNA-based production thchni~ues. ~he sol~d phase peptide-Qynthesi~ technique has been successfully applied in the production of human PT~ and can be used ~or the production of the P~ variant3 of the present invention (~or guidance, 3ee Xim~ra et al, supra, and see Fairwell et al, Biochem., 1983, 22:2691). Success with producing human PT~
o~ a relatively large ~cale has been reported by Goud et al in J.
Bone Min. ~es., 1991, 6(81:781, incorporated herain by re~ere~ce.
This production approach generally entails the use of automated ~ynthesizers and appropriate resin as solid phase, to which is attached the C-termi~al amino acid of the desired PT~ variant.
Extension of the peptide in the N-terminal direction is then achieved by successively coupling a suitably protectad ~orm of the next desired amino acid, using either FM0~- or BOC-baaed chemical protocols typically, until ~ynthe~is is complete. Protecting S~ 5 ~ S3~

... .

~.,` W092/11286 PCT/CA91/00451 11 ~09~33 ~
group~ are then cleav~d from the peptide, u~ually ~imultaneously with cleavaga o~ peptide from the re~in, a~d the peptide is then isolated and purified u_ing conventional techniqueQ. Such procedures are generally de~cribed in numerou~ publication~ and reference may be made, for example~ ~o Stewart and Youn~, Solid PhaQe Peptide SvnthesiQ, 2~d Edition, 1984, Pie~oe Chem~cal Company, ~ockford, Illinois.

More desirably, and in accordance ~th one aapect of ths present invantion, the PT~ varia~t~ are produced by cu~turiag a cellular ~o~t in which D~ cod~ng ~or the de~ired P~ ~a~iaat i8 expraesibly i~corporated. Inco~posation o~ the dssired D~A, in expre~sible form, can ~e achie~ed u~ing the no~ con~n~ional r~ombinant DNA-~a~ad approacht ~h~rai~ D~A codl~g ~or the PT~
varia~t i_ link~d operably with DN~ ~nabling ~xpre~-q~on of ~e P~
~ariant-encoding DNa, to fo~m a re ~a~t DNA expre3~ion construct which is th~ introdu~ad ~nto the ~lected c~llula~ ho~t by ~NA-mediated tran~formatlon~ electroporation or the l~ke.
cellular ho~t ha~ing D~A coding for a ~T~ variant incorpo~ated "expre~sibly" theroin is ~haracterized by t~e ability to yield the desired expre~sion product, whefi c~ltured appropriately.
cellular host havi~g DNA codin~ ~or a PT~ ~aria~t incorporated "stably" i8 able to ratain ~uch DNA during culturing, and to tran~mit such DNA to it~ progeny through at l~a~t several generations. For eucaryotic cellular hosts, suc~ ~tability is typically conferred by ge~omic integration of the PT~ ~ariant-encoding DNA. In bacteria, which typically harbour tran forming DNA in the form of autonomou~ly replicating plasmids, such stability i~ usually ensured by culturing a strain carrying plasmid-conferred antibotic resistance in the presence of the antibiotic.

, . . .
For expres-~ion in the cellular host, DNA coding for a salected PT~ variant may be obtained using technique~ that are well estab}is~ed in the art. For example, a DNA sequence coding ~or a 2~9~2~3 12 gi~en ~TH variant may be synthesized de novo i~ accorda~ce ~ith method~ standard i~ the gene sy~the~is art. Bris~ly, this entails the successivs 3' to 5' coupling o~ su~tably protected nucleotide reagents in an automated synthe~izer ~uch a~ the ~pplied~Biosy~te~s Inc. model 380B DNA synthesizer, and then th~ recov~ry by gel purification of the deprotected polynucleotide. The blo~k ligation approach may be amployed, w~erQby "bloc~ " of oligonucleotide pair~, up to a~out 80 nucleotsde~ in length, ara prepared a~d ligated in correct ~ucce~sio~ by overha~g cGmplamentarity, a~
de~cribed ~or example by Wosnick et al in Gene, 1989, 76:1~3. ~n an alter~ative approach, the desired DNA may be ~y~the~ized in ~oto, and then ampllfiad by polymera~s chain reaction (~CR), using the approach de~cribed by Ba~nett et al i~ Nucl. Acid~ ~es., l990, 18~10):3094.

It will be appreciatad that alternative strategies may al~o be appliad to genorate DNA coding ~or the de~ired PTH variant. ~or in~tance, DNA coding for human PT~ may b4 obtained and then used ~-~a te~plate e.g. mutaqenized ~ite-speci~ically, to intsoduce the de~ired am~no acid change at the genetic level. D~A coding ror human PT~ may be obtained from an appropriate human cDNa library, from a commerc~al source or by de novo synthe~is accord~ng to the procedures outlined abo~e, and in accordance with the PT~-encoding nucleotide sequence reported ~or example by ~endy et al, Proc.
Natl. ~cat. Sci. ~A, 1981, 78:7365, incorporated herein by raference, or a PT~-encoding equivalent thereof. The PT~-encoding DNA ~emplate may be convorted to DNA codi~s for a PT~ ~ariant using the well e~tabli~hed o~igonucleotid~-directed mutagene~is tecb~iqu~, a-~ generally describad for example by Xun~el et al, 1985, Proc. Natl. Acad. Sci. ~5A, 82:488. This technique is con~eniently accomplished with high e~ficiency using the E. coli-based system for synthesis and propogation of the altered gene in an appropriate vector, ~uch as ~13mpl8. Kits uRe~ul for perfor~ing su~h procedura in ~itro are a~ailable commercially. Al~o ~uitable ~or obtaining P~ variant-e~coding DNA from a PT~-encoding tsmplate S U ~ 5 i i ~ 1 ~ s ~ ~ ~ ~i D r T

. . . .
. . .

~ .
- . ~ ~ .: .

I~` W092/112B6 PCT/CA9l/00451 2 ~ 3 8 I~J) 3 3 i~ the relatad, technique in which ~ite-directed mutagenesis i~
achieved u_ing a PCR-based approach. One variant o~ thi~ mathod, te~med "recombinant PCR" i~ de3cribed by ~iguchi et al, Nucl.
Acids. Res., 1988, 16:7351, and a modified "meyapr~mer" PCR
approach is described in Biotechniques, 1990, 8~1):404.

Once obtained, DNA coding ~or the desired PT~ ~ariant is incorporated stably and expre3sibly into a cellular host selectad to serve in produc'ion of the PT~ variant. A vari~ty of organismq are suitable as hosts for production of the PT~ ~ariants. The~e include eukaryotic hosts including yaast~ such a~ Saccharomyce~, Pichia a~d KluvQro~yces, filamsntous ~ungu~ hosts including A~pergilluq ~pecie~ such as ~idulans, niger ~or awamori) a~d ory~ae, in~ect cell hosts, and mammalian cell ho~ 8 including the C~O and CO~ cell li~es. ~he PT~ ~ariant~ are ~ot depende~t on glycosylation for acti~ity, and thu~ can ~uitably ~e produced in bacterial host including Streptomyce~, Bacillu~ and, pre~erably, in E. coli. Racombinant D~A expra sion ~y~tems and culturing media/protocolq enabling production in the~e host~ of a de~ired protein have already bean e3tab1i~hed, and the~e ~y~tem-~ may be amployed in the conventional manner for the specifia purpo~e of producing PT~ variants. E. coli production of PT~ ~arianits may be achieved, for example, using expression sy-~temis based on the lac promoter ~see Rabbani et al, Biochem., 1990, 29:10080) and expression/secretion sysitems based on the tac promoter (see Wong et al, EP 357,391). Yeast expre~ion may be achieved using expre~sion ~ystems ba~ed fo~ example on ~he expreYsion controlliag regions of the alpha-l mating factor gene as describsd by Gautvik et al in WO88/03165. Production in Aspergillus may be achieved using secretion systems based on expression controlling regions of the A.
nidulans alcA gene or the A. niger glucoamylase gene, as described for example by Gwynne et al in W086/06097.

The PT~ variant produced upon culturing of the production host is extracted and purifi~d using techniques that are also ~ iJ ~' S~ S ~

WO92/11286 PCT/CA91/Q04~1 ~

~098283 14 establiqhed in the ast. In general, the human PT~ variants hava characteristics that are similar generically to those exhibited by human PT~, and may therefore be extracted and purified in Qubstantially th~ same manner. Like PT~, the variante have a net poQitive charge at neutral p~ (pI of about 9.3) and can be purified therefore by ion exchange chromatography, e.g. using cation exchange columns. The PT~ variants are also, like PT~, hydrophobic in nature, and may therefore be purified by hydrophobic interaction chromatography e.g. on columns having a phenyl-Sepharo~e matrix.
Also, of course, molecular ~ieves may be u~ed to s~parate PT~
~ariants from other proteins un2elatad by ~ize, and af~inity columns may be employed which comprise P~ affinity ag~nt~ such a~
hydroxyapatite or PT~ antibody. P~eferably, purification of the ~T~ variant is achieved by applying the prot~in mixture to a cation exchange column e.g. S-Sepharose, a~d then applying the eluted setentate to a column having a hydrophobic matrix e.g. a column having a phenyl, octyl or butyl ~ide chain ~uch as phenyl-Sepharose, phenyl-Superose, octyl-Sepharose or butyl 650M. The retentate eluted from the hydrophobic matrix is then subjected to final purification using reversed p~a~e high psrformance liquid chromatography (~PLC).

While the oxidation sen~itivity of ~uman PT~ typically d~mands that great care be taken during purification to guard against oxidative inactivation, such as the use of anti-oxidants e.g.
cysteine or B-mercaptoethanol, and the use of cold temperatures to slow the oxidative process, purification of the PT~ variants of the invention requires less stringent control d~ring purification and handling. For example, anti-oxidants are not required during purification of human PTH variants in which both Met8 and Metl8 are replaced, but may be ~mployed if desired.

For therapeutic USQ, a PTH variant is desirably purified to the extent that it migrates as a single peak on reversed phase ~P~C, and exhibits a single band on polyacrylamide gel S U ~STI~ IHE~T

.... . . .. .

~, - . . .
. ~ . ; . . .
. . . ~ ..... .
.... . .. .
- . ~ .. : .... ` ;............... -~ WO92/11~86 PCT/CA91/00451 2 ~ 3 electrophoresis in the pres~nce of SDS. Once purified, the PT~
variant may be formulated to provide pharmaceutical compo~ition~
suitable for treating the variou~ c~inicai conditions for which PT~
replacement therapy is indicated. Composition3 containing ~T~
variant may, for examplQ~ be delivered ~y~tQmically to treat bone disorders such a~ osteoporoRis and cardiova~cular condition , and for these purpo~es are ~uitably ~ormulated sither as injectable~ or ingestible~ or ~or nasal insufflation. Sterile injectable compositions ars preferred, and will genarally comprise an e~fective dose o~ the PT~ variant, in admixutrs with normal Qalins and suitabla solubilizing age~t e.g. dilute acetic acid. Tha PT~
~ariant may alternatively be applied topically, as a croam, lotion, ointment or as an aerosol, to treat psoriasi~ and related skin di~orders. A ~uitabl~ craam will comprise an e~ective dose of the PTg ~ariant, in combination with carrier~ o~ standard composition e.g. in a triglyceride ba~e.
:
~ he dose of P~ variant e~fective to treat a given clinical condition will depend of course on the ~ature and qeverity of the condition, and on such othar factors as are norma~ly con~idered and evaluated in clinical trials and by the attending physician. For treating osteoporosiQ, the PT~ variant is admini-~tred in amounts large enough to stimulate bone remodelling, but not so large as to cause net bone resorption or sustained increase in 3erum calcium levels. RefQrence may be made to ~S patent 4,698,328 ~or guidance on the administration o ~ to treat osteoporo~is. ~sing the e4fective P~ do~es in a given clinical situation ~or gui~ance, the dose o~ PT~ variant required to elicit a similar e~ect can be calculated based on the relative activity of the PT~ variant. For example, rLeu~8~hPTHtl-84), ~eu~hPT~ 84) and hP~1-84) are substantially equipotent, and e~fective doses of these P~ variants are thus similar to those of hPTX. It is expected that the greater oxidative stability of the P~ v3riants will provide for extended in ~i~o half-life, and thus somewhat sma}ler doses may be used or simular doses may be administerad less fr~quently.

S~ J~ T ;:

... . .. i . . . . .. . . .. . . ~ . . . .. . . .

WO92/11286 PCT/CA91/OM~
2~98233 16 Like PT~, the PT~ variants may be administerad in combination with other agents useful in treating a gi~en clinical condition.
When treating osteoporosi R and other bone-related disorders for example, the PT~ variants may be a~ministQred in conjunction with a dietary calcium supplement or with a vitamin D analogue ~sea ~S

4, 698, 328) . ~lterAati~rely, the PT~ variant may be administerQd, preferab1y using a cyclic therapeutic reg~men, in ccmbination with bisphosphonates,a3 de~cribed for example in ~S 4,761,406, or in co~bination with one or more bone therapeutic agentR such as calcitonin and estrogen.

~Exam~l~s :
The example-~ which ~ollow dascribe produc ion o~ 2T~ and PT~
Yariants. Pxoduction o~ these proteins was achieved usi~g, as a mattQr of con~enience o~ly, an E. coli-based syst~m substa~tially a~ descr~bed by Wong and Sutherla~d in ~uropean pate~t application 89308753.6 ~pub~ished as ~P357,391 on 7 March l990), the contentQ
of which are incorporated herein by reference. This syst~m makes use of the commonly available E. coli ~MlOl strain as ~ost and employs as vector a p~Cl8 derivative, designated pX. As is shown in Figure 1, pX incorporates t~e par eloment o~ pSClOl to enhance frequency of plasmid transmi~sion, t~e lacI~ ge~e o~ pMMB22 to enable overproduction of the lac repressor, and a PT~-excretion cassette. Incorporated in the excretion cassette is human PT~-encoding ~NA that was 3ynthesized u ing the block ligation tech~ique reported by Wosnick et al, supra, and in accordance with the PTH-encoding nucleotide sequence reported by ~endy et al, supra. Fused 5' of, and precisely to, the PT~-encoding DNA is the signal sequence of the E. coli ompA gene, which is capable of directing the PT~ portion o~ the expression product across the host inner membrane, a~d ultimately to the culturing medium. For regulated expression of the coding region, the plasmid operably incorporates the tac promoter, the lac operator and a consensus ribosomal binding s~te. TranRcriptional termination is controlled by the E. coli trpA gene terminator, and translational qtop codons S~J~ ~T

.

~ W092/11286 PCT/CA91tO0451 17 ~9~283 -are provided in all three ~eading framas, i~mediately 3' of the PT~encodiAg DNA. ~
':
Thus, the pX exp~essioA vector, used ~or the production of human PT~ and PT~ vasia2ts, is substa~tially the sYme as that described by Wong and Sutherla~d, supra, except that the multiple cloning site down~tream of the PT~ gsne conta~n cleavage ~ites ~or the re~triction enzymes ClaI, Bam~I, XbaI, StuI and PstI, in the order indicated on Figure l. Th~ precisa nucleotide ~equence o~
the ~T~-encoding re~ion of the excretion cassette i~ illustrat~d in Figure 2. The plasmid pX may thus be co~tructed by i~corporati~g into p~Cl8 at any suitable site therein ( 1 ) an excretion cassette ha~ing the functio~al components described by Wo~g et al, su~ra;
$2) the lacI~ gene ~ro~ pMMB22, and ~3) the par ela~eAt excised from pSClOl.
. . .
Example 1 - Production of human 2T~ 84) Plasmid pX was tran~formed into competent E. coli JMlOl using ~tandard procadures. Positive transforma~t~ were indentified following growth o~ernight at 30C on plates containing 2YT/agar and 70~g/ml ampicillin. PT~-producing trans~ormants were then examined for PTH activity, following growth in shake flasks, by IRM~ analyQis of conditioned medium, and ~rozen ~tocks of the selected trans~ormant were su~sequently prepared by ~ixing an equal volume of the shake flask culture with ~teril~ glycerol to yield 50%(~/~) glycerol stocks. These ~tocks were subsequently stored at -80C. When neaded, transformants were reco~ered from the frozen stock by scraping, and were then streaked on ampicillin-co~taining plates of 2YT/agar.

To produce human PTH, freshly plated transformants were picked as single colonies and then inoculated into 50ml Erlcnmeyer flasks containing 15ml of a liquid medium which contained 2YT, glucose and WO 92/1~286 PCI'/CA91/00451 2 ~ 3 18 ampicillin in the standard ~ixtur~. Following ovarnight growth with shaking at 30C, the cultureq w~re dlluted 20-fold with fresh medium, and then grown for three hour~ at 30C with shaking. ~ i Expression of the PT~-ancoding DNA wa~ then de-repressed by addit~on of l.OmM IPTG. ~fter growth for four hours in the pre~ence of IPTG, the culture was cooled to 4C a~d c~ntri~uged.
The supernat nt wa~ then har~sted and human PT~ contained therain was reco~ered and as~ayed for PT~ acti~ity.

To obtain sufficient quantitieY of human PT~tl-84) and the PT~
variants for purification and bioa~say, larg~r volume~ of conditioned media ware collected. In partacular, freshly plated tra~sformants w~re picked a~ le colon~e~ a~d then inoculated i~to 500ml flaskQ contai~ing 200ml of the ~edium de~cribed above.
Following o~ernight growth with shaking at 30C, the culture3 ~e~e i~oculated into 2L bioreactor3 containing 1.5L of the liquid medium, and then gro~n for 5 hours at 30C w~th st~rring.
~xpre~ion of the PT~- or PTH variant-encoding DNA wa~ then induced by addition of l.OmM IPTG. ~fter growth for 3-4 heurs in the pre~ence of IPTG, the culture wa~q cooled to 4C a~d centrifuged.
The supernatant was then harve~ted, and the PT~ or PT~ ~aria~t contained therein wac puri f iad in the manner described in Examp}e 7.

The examples which follow describe production o~ PT~ variants.
To obtain DNA coding for the~e variants, the in vitso ~ite-directed mutagenesis technique described by Xunkel et al, supra waQ applied.
To perform this procedure there wae first obtained pla~mid RX which iQ an M13mplB-based plasmid lacking a functional tac promoter.
Plasmid RX thus served as the template for conducting mutagene~is on the PTH-encoding DNA, in order to generate DNA coding for a desired PT~ variant. ~he particular mutage~esis strategy is de~cribed in the examples below.

,,,, ,, ., . . , - .... .` ,. . ..

'~`;;~ WO92tl1286 PCT/CA91/~0451 : ., :, . . .
13 ~9~8~
Example 2 - Production o~ a [Leul~] variant of PT~

To pro~ide D~A coding for a PT~ variant in which Metl8 is replaced by leucine, pla3~d RX wa~ ~irst recovered in ~ingle :~
strandad form and about l~g thereo~ was incubated, at 85C in ~in buffer, with about lOOns of a mutagenic oli~onucleot~de capable o~
hybridizing Qpecifically to that region of the PT~ gene ccntai~i~g the Metl8 codon. The ~pecific sequa~ce of the oligonucleotids, designated M2, i~ ~hown below where u~derli~i~g indicate~ the codo~
change relati~e to the PT~-encoding tQmplate:

N2 oligo: 5' CTCTCTCCAGCGAG~TC 3' .. ,~
template: 3'....... GAQAGAGGTAGC~C~AG..... ~. 5' ~ fter slow cooling, the annealed fragm~nt wa~ treated with D~A
polymerase I ~Xlenow) in the pre~ance o~ all ~our dNTP~, for about 2 hour~ at 37C and then ~or 4 hour~ at room tQmperature, in order ~; .
to form the full length double-stranded pla~mid, designated pRXM2.
Competent ho~t JM101 ~a3 then transformed by p~XM2, and plaqueq .:`
~ere ~creened by re~triction digest analysis and by DNA seque~cing to solect tho~e carrying the de~ired mutation.
. .:
pRXM~ is then dige~ted with ~ruI and XbaI and t~e resulting small fragment i~ isolated by low mQlting point agarose. Plasmid pX is ~imilarly digestQd, and the large NruI~XbaI ~ragment i~
, .
i~olated. The relevant isolated ~ragments are the~ ligated, to ~orm plasmid pXM2, which carrie~ DNA coding for [Leu~a]hPT~. ~hi~ ;
wa~ confirmed by restriction digest analy~i~ and D~A ~equencing.

Competent E, coli JM101 wa~ transformed with pXM2 and the tran-~formant~ were then ~elected in accordance with tha procedures outlined in Example 1. Supernatant containing the ~eu~a]PT~ for ~ub~equent purification wa~ then obtained by culturing the pXM2 `.
transformant, in the manner deRcribed by example 1. ~.

,. , ~ ; , , . : . . ` . , :.. , , ~ ,:

WO92/11286 PCT/CA91/00451 ~' 2~98'~.83 ~
~xample 3 - Production of a tLeu~] variant of PT~

In a manner similar to that deQcribad in ~xample 2, there ~aQ
obtained DNA coding ~or a human PT~ ~ariant in which Meta 8 replaced by leucine. In particular, ~ingle ~tranded pRX was incubated with an oligon-~cleotide having the ~eque~ce pro~ided below, where underlining indicates the codon change relative to the ~T~-QnCOding template:

M1 01igO: 5 ' C:C~GGTTA~GC~GAP.GCTG2ATT~CAC 3 ' tamP1ate: 3 ' .. GGTCCAATACGTATTCGP.C~T~AAGTG .. 5 ' A double stranded pla~mid carrying the eu8 codon, de~ig~ated pRXMl, i~ then cut with NruI/XbaI and the i~olated ~mall fragment i8 l~gatad with the laxge ~ragment of NruI/XbaI - dige_ted pX. ~.
coli was then tran~formed by the ~esulting pla~m$d pX~l, and the tsanqformant was cultured in the mann~r outlined in Example 1 to yi~ld ~upernatant containing l'eualhPT~.

ExamPle 4 - Production of a ~u~Leul~ ~ariant of PT~

In a manner similar to that de~cribed in Example 3, th~re ~as obtained DNA coding for a human PT~ variant in which both MetB and Metl8 are replaced by leucine. Thi~ wa achieved by incubating pRXM~, which already bears the ~eulB codon, with the Ml oligo ~example 3) which i~troduces the ~uB codon, to yield plasmid p2XCl. Following seque~cing which confirmed incorporation of the ~eu8 and ~eulB codons, the NruI~Xba~ fragment was cloned as described in example 2, and the resulting plasmid was trans*ormed into E. coli JMlOl. Transformants were selected, the selected tran~formants were grown in shake flasks, and the shake flas~ .
suparnatants containing [Leu~LeulB]hPT~ were recovered and ~tored frozen for subsequent analysls, all in accordance with the methods described i~ Example l.

r~ T~ T~ 5}1~T

~ WO92~11286 PCT/CA91/00451 21 ~9~2~3 ~
Exam~le 5 - Production of an [Ala8] variant o ~TH

In a manner similar to that described in Exa~ple 3, thara was obtained DNA coding for a human PT~ variant in whic~ t~e ~et~ codon ~a_ rep~aced by an alanin~ codon, In particular, the ~eta codon in ~RX wa~ replaced ~ite-~pecifically using an oligonucleotid~ having ' the sequence shown below, where underlini~g ide~ti~ies the introduced codon change:

M3 oligo: 5' CCCAGGTTATGAGCAAGCTGT~TTTCAC 3' ~;
tQmplate: 3' ...... GGGTccAATAcGTATTcGacaTAAAGTG... ~. 5' :.,.
T~iQ generated plasmid pRXM3, the ~mall ~ruI~XbaI fragment o~
which is lsgated to thé large NruI/XbaI fragment of pX to yield pXN3. E. coli JMlOl was then trans ormed with pXM3, and the tranQ~ormant~ w~re cultured to provido ~uper~ata~t~ containing tAla~lhPT~, in tha manner des~ribed in ~xamp~e l.
ExEmple 6 - Production of additional ~T~ variant~

In the maAner sub~tantially a-~ described above in example 4, supernatants containing additional PT~ ~ariant_ wera obtained by culturing E. coli tra~sformants habouring PT~ variant-s~codi~g DNA, as listed below. In each case, the D~A coding rOr ~Leul8]hPT~
(Example 2) wa~ used as template and was altered at the ~et8 codon using the noted oligonucleotide ~underlining is used to indicate the replac~ment codon~:

i) [IleaLeu1~]hPT~; using an oligonucleotide having the sequence 5'-CAGGTTATGGATA~GCTGTATTTC~

ii) tAsp8Leul8}hPTH; using an oligonucleotide having the sequence 5'-CAGGTTATGGTCAAGCTGTATTTC-3';
iii) ~Asn8Leu18JhPT~; using an oligonucleotide having the ~aquence ~J~ 5~ ~
. . .

. , . ,.. ..... . ~ . ... . ... ... . . .. .

WO92tll286 PCTiCA91/00451 2 ~

5~-c~GGTT~TGGTTAaGcTG~TTTc~3~

i~) [TyraLeu~8] hPTH; using an oligonuclaotide ha~ing the -Requence 5'-CAGGTTATGGTAAAGCTGT~TTTC-3'; a~d v) [Ar~0Leul8~ hPT~; u3ing an oligonucleotide ha~ing the sequQ~ce 5'-CAGGTTATGACGAAGCTGTATTTC-3';

Also obtained by mutagenizing the ~I,eu~8]PI!EI-er~coding templa'ca (example 2~, was DNA coding ~or the following additional PT~
~ar~ ants:

v ) tVal8~eu'8~hPT~; w~e~e Val i~ encoded by GT~
~ii) tSer3~u~ PTH; w~are Ser is e~coded by TCG
~iii) ~la8Leu~8~hPT~; where Ala i3 enaoded by GCG
xi) ~Trp8~eu~8~hPT~; where ~rp is encodad by TGG
x) tGln8Leul8lhPT~; where Gln i~ encoded by CaG
xi) tGlu8Leu~hPT~; where Glu i~ encoded by GAA
xii) tGly8Leul8]hPTH; where Gly is encoded by GGG
xiii) ~Lys8Leu~8]hPT~; w~ere Lys i~ oncoded by AAG

E. coli transform2nts u~re obtained a~d cultured, and supernatants conta~ning the ~ariant were collected indi~idually as dascribed in example 1, for analysis aR now describad in example 7.

~gE~ Purification a~d Evaluation of PT~ and PT~ ~ariants The conditioned medium collected f~om the transformants of Example 1-6 was, in each case, adjusted to about p~ 4 with glacial acetic acid. I n some but not all cases, mercaptoethanol was then added to a final concentration o~ lOmM and the solution was centrifuged. It was found that mercaptoethanol was unnecessary in the PT~ ~ariant purification process. $he supernatant was har~ested and then pa~sed through a column containing the cation axc~aage resin S-Sepharose Fa~tFlow ~Pharmacia, bed ~olume 50ml) pre-: .
:: ~ ' ~ W092/112~6 PCT/CA91/004~1 23 ~982~3 equilibrated with 0.04M ammonium acetate/lOmM B-mercaptoethanol ~p~4.0). PTH or the P~H variant, bound to the re~in, wa~ eluted by applying a concentration gradient of ammonium acetate a~ eluant of from 0.04M - l.OM ammonium acetate~lOmM B-me~cap~oethanol (p~4.0).
PT~ or the PT~ variant elutad ~rom the ro~in at about 0.6M a~monium acetate. Eluant fraction~, containing PT~ or the PT~ ~ariant (a~
measured by the Allegro two-site IRM~ purchaRed form Joldan Diagnostic3, California, catalogue ~40-2170, or by ab~ox~a~c~ at 280nm), were combined to provid~ PT~ or the PT~ Yariant at about 60-70g6 purity.
.
Samplas of greater purity ware obtained by ~ubjecting the ~ombined fractions to a chromatographic separation using the re~in pheny~-Sepha~o~e ~a~tFlow ~Phaxmacia). ~ore particularly, the p~ : :
of the combined S-Sepharo~e fractions was adju~t~d to p~ 8 with 5N
NaO~. Thi~ ~olution wa~ then applied to a column containing ph~nyl-Sepharo3e ~6ml ~ed ~olume), pre-oquilibrated with the bu~far ~6 ~olumes of l.OM ammonium acetate ~p~4.0) and 4 Yolume~ of 40mM
ammonium acetate ~p~4.0), then adjusted to p~ 8.0 with 5N NaO~
P~ or the PT~ variant, adYorbed to the colG, wa~ then eluted u~ing as eluant a concentration gradient of buffer to 0.6M ammonium acetate (p~8.0). ~ -., Fractions containing PT~ activity (as measured by Allegro two-site IRMa or monitorsd by A~o) were combined and then desalted by pas~age through a cartridge containing reversed phase C-18 resin 2 . g. Sep-Pak (Waters Inc.) or Amberchrom CG71 resin ~Toso ~aas) pre-equilibrated with 0.1% TFA. PT~ or the PT~ variant bound to the resin wa~ eluted with 0.1% TF~/80% acetronitrile. The desalted ~`
preparations were then frozen in liquid nitrogen, lyophilized and stored at -20C.

Thawed or fresh samples of human PT~ 84) and of PT~ varia~ts obtai~ed as described above ~ere then evaluated for biological :

5~ T ;~-` . ` .. ,, 1.. . ;, . .. . . . . . ..... .

WO9~/11286 PCT/CA91/00451 2~38~3 24 activity in a ~MR-106 based adenylate cyclase assay and the protocol as described by Rabbini et al, 1988, Endocrinology, l23:2709, which is incorporated herein by refsrence. As noted, rat osteosarcoma cell3 of the ~MR li~e are ~timulated by PT~ to produc~
adenylate cyclaso, an enzyme which catalyzo~ intracQllular conversion of ~P to it8 cy~ic mo~op~o~phate a~alogue, ~AMP. In thi~ asYay therafore, PT~ activity i~ detesmi~ed by as~ayi~g radiomet~ically the ~ormation o~ cAMP in PT~-stimulated ~R cell~.
Also assayed for compariso~ wa~ a sample o~ ~ynthetic huma~ PT~, purcha~ed from Bach~m Inc. ~Torrence, California - catalogue #PC~L
175). ~he re~ults of the as~ays, expr~3~d in term~ o~ EC~o (co~centration o~ PT~ or variant ~ffective for half-max~mal ~t~mulation of adenylata cyclase acti~ity), are presented in Table l.

''. .:' , ~';' S~S~ E ~EET

~, ~ W O 92tl1286 PC~rtCA91/00451 . :~
~ 2~3 TABLE 1 - Relative acti~ities of PT~ variant3 .:
_. _ -- . .
PT~ variault BC50 (r~) . _ _ _ .
~mDaul ~T~ 1.0 _ _ _ l ,, tLeul~] 1.5 ~ :
._ . _ '.~
[Teu3] 5.5 _ _ . .
[Leu~Laul81 5.7 _ _ _ _ :
~eUB~eUl~TyrJ~I 22 _ . _ _ .
tIle8Leu~] 32 :
_ _ __ . _ _ . . . .
Val8Leu~ gO
. ~ - . . __ tlLla~eu~] 850 :~
, . _ . :.
~ila~ 1200 . _ _ . _ . _ .
~Ser8Leu~] 1400 _ _ tTrp8LeU1~] 1900 .
~Lsn8LeU~B] >5000 ~;
. ~
~Gl~8Leu~a~ >5000 _ . _ . [Asp8Leul8] >5000 _ _ . . _ ~ Glu8Leu~8 ~ >5 0 0 0 :::
_ . :-.
tLys8Leu~8~ >5000 _ : _ .
[Arg8Leu~8~ >5000 .:
_ - . ., .
~Tyr8Leu~a~ ~5000 _ ....
[Gly8Leu~] ~5000 : .
. .',,', In reference to Table 1, it will be noted that ~ubstantial PT~
acti~ity is exhibited by only certain methionine-substit~ted PT~

:., ,~

WO 92/112X6 PCr/CA91/00451 ~
2 Q ~ 3 variant~. Acti~rity sub~tas~tially comparable to PT~ itqelf is retained by PT~ variant~ in which the methionine at poaltion 18 is replaced with virtually any ~enetically encoded amlno acid.
~eplacement o~ methionine by cy~teine, though an oxidizable amino acid and un~uitable for achieving reduced oxidation sen~itivity, gava a PT~ variant having an ECso of about 5.0nM. Va~iants in which methionine at position 8 wa~ replaced either alone or in the context of Leu~8 gave variable EC50 result~ deperld.ing on the identity of the replac~ment amino acid. A~ is indicated, little PT~
activity was ~aen when Met8 wa3 replaced with amino acids ha~ing either ~i~ an amide ~ide chain, ~uch as asparagine and glutami~e;
(ii) an acidic ~ide chain, such as a-4partic acid aud glutamic acid;
~iii) a basic ide ~hain, such a~ ly~ine and arginine; (iv) a ~all bulky ar~ma~ic ~ide chain such as tyro~ine, or ~Y) a~ amino acid ha~ing ~o side chai~ at a~l i.e. glycino.

S~b~tantial PTB acti~ity, a~ indicated by a~ ~C,0 of leRs than 2,000nM, wa~ ~een ~owever ~hen he Met' re3idue Ma~ ~eplaced by a~
amino acid having a hy~rophobic side chain, ~uc~ a i301eucine, valine, alanine and leucine, and wa~ also seen w~en Met8 i~
replaced by ~erine and tryptophan. . :

Example 8 - Analy~i~ of sen~i~ivity to oxidation The ~en~itivity to oxidation of ~ynthetic and recombinant ~.
human PTH(1-84) and of the PT~ ~ariants was also asses3Qd by measuring PT~ acti~ity following exposure thereo~ to an oxidant.
Oxidation was e~ected by exposing samplQs of the Yariou~ PT~
compounds, obtained as described above, to the oxidant hydrogen peroxide according to the protocol reported by O'~iordan et al, 1974, J. Endocrinol., 63:117 which i~ incorporated herein by reference. In general, this oxidation procedure entails admixing the PT~ sample with hydrogen peroxide for a selected period of time, and then halting the oxidative reaction by quick freezing in :~
liquid nitrogen and lyophilization. For -~ub~equent bioassay, the .
.:

S~ P 5~T

. . ..... ~

~::?.~`~

27 2~9 82 ~ 3 i~ample iiB di3~0l~ed in a~ay medium and appropriate dilution3 e~tablished, for u~e in the bioasQay. Bioacti~ity o~ the oxidant-expo~ed qample~ wa~ then aaae~ed in the ~MR-ba~ed adenylate cyclaqe assay. ~he resultiQ are pre_ente~ gsaphically in Figure~ 3 and 4, which show the relatiYe acti~itie~ o~ human PT~ and ~umas ~T~ ~ariant~ in the ab3ence of oxidant (but UiQi~g a ~oc~ oxidation treatment i.e. incubation in the absan~e of hydrogen peroxide for 8 minutei~ at room temparature in O.l~ acetic acid) (Figure 3) and a~ter oxidation i.e. incubation in the pre~ence of 1. 5~ (v/v) hydrogen peroxide for 8 minuta~ at room temperature in O.lM ace~ic acid ~Figure 4).

In reference to Figures 3 a~d 4, it will be noted that the ~eplacsment of methionine wit~ a genetically encoded amino acid haq the e~ct of reducing the 8Hn~itiV' ty to oxldation aixhibited by PT~, regardle~ of whethar the replace~ent i~ effected at poiqition 8 alone, at positioA 18 alone or at both positions. Tt will be ~oted as w~ll aQ that replacement o~ met~ionine at po~ition B alone res~lt-Q in a Qigniicantly greater reduction i~ oxidation ~ensitivity than does replac~ment at position 18 alone. The ~ariant tLeu~hPT~ 84) i~ about sixty-~old more bioactive than hPTH~l-84) under theQe condit~o~s, whereas the ~ariant [Leu~8]hPT~l-84) i~ about two-fold more active tha~ hPT~l-84).
The greatest reduction in ~ensitivity to oxidation i3 seen when methionines at both positions 8 and 18 i~ PT~(1-84) are replaced.
~he Ya~ia~ts [Leu8Leul~]hPTX and ~LeuaLeu~T~r3']hPT~ exhibit a bioactivity u~der th~se condition3 that i~ about 400-fold greater than hPTH~l-84).

Taken together, these result~ demonstrate that t~e Qen~itiv~ty to oxidation exhibited by PT~ is markedly reduced when one or both of its resident methionines i~ replaced by a genetically encoded amino acid other than methionine. It i~ contQmplated that this enha3ced oxidative stability will ba exhibited al~o by analogues of the methionine-substitutad P~H variants, in which one or ~ore amino ~ qg~ ~y 3 ~ T ~:

- ~ ,. - ; . . .

WO 9?/~1286 pcr/cA91/oo4sl ~
2098~ 2~ ~
ar~id ~ titutio~3, additions or deletions ~ave b~sn introduced.
Analogues o~ the PTEl variants o~ the invantion t:hus repre~nt additioD,al e~bodiments of ths presant invention.

A~alogue~ o~ the PT~I ~rarias~8 spec~fically coD.~emplated ~e~ein islclude those ha~ring ami~o acid~ ~eplaced at po~i~ios~s othar t~a~
8 and 18. Analogu~s o~ thiR class i~clude t~ose in which the phe~ylalas~ e at posi~ion 34 is raplaced a ty~o~ina re-~idue o:r other amino acid residue which i5 receptive to radiolabsl conjugatio~. Speci4ic ~uch analogues includ~a tLeu1~Tyr34]~
t~euaTyr3'~hPT~, ~Ila31eu~Tyr3']h~?T}~ and tI.euaLeul~Tyr3'~hPT~. To produce such analogu~, DNA coding ~or a YT~ ~ariant i8 ~e-speci~ically mutage~i2ed to ef~ct ths d~sisat amino acid ~aplac~ment at the ge~tic l~v~l, and ths~ expressed i~ a m~crobial ~o~t i~ tha manner ex~mpli ied i~ example 9 h~reinbelo~.

~ l~o w~thin tha ~cope o~ the present invo~tion are C~
tas~ina~ly truncated a~alogue~ o~ the mothionine-sub~tituted PT~
varia~t~ herein de~cribed. A~alogue~ o~ thi~ cla~s include ~-t~rminal fragme~ts of ~he P~ variants, which consist o~ at loast the first 27 N-terminal r~idues. Specific such analo~ues includa those comprising the ~irst 34 N-ter~inal residues, such a~
[~eu'~]hPT~(1-34), ~Leu~hPT~ 34), t~e~Leu~]hPT~ 34), a~d Tyr3' analogue~ thereof. It is reaso~ably expected that iA addition to reduced oxidation sansitivity, these fragments will axhibit a biological activity comparable to their full length countQrparts, as mea~ured in the osteosarc a assay. Accordi~gly, theQe fragment~ may be used in a manner similar to hu~an PT~ 84). The N-terminal fsagments may also be produced by recombinant DNA
approach, using PT~ variant-encoding DNA that has been mutagenized site speci~ically to introduce a translational stop codon immediately downstream of the residue 34 codon.

SU~ D ~ S~$~T

~ WO92/11286 PCT/CA91/00451 29 2~9~2~3 Example 9 - Production of a Tyr3~ analogus o~ ~Leu~heul~]hPT~ B4 ~ i~g pRXCl which containq DNA coding ~or [~euaLau~a]hPT~(1-84) as a tamplate ~sQe ~xample 4), the oligonucleotide-directed mutagene~is technique wa~ perfor~ed aQ de~cribed in ~xa~ple 2 replace the Phe3~ codo~ w~th a tyrosine codo~ e chango ~a~ : .
~ffec~d using an oligo~ucl~otide ha~ing the seque~ce;
5'-CTCCAAGGGCAACG~AT~GTGCACA~CC-3' ~ he resu1ting plasmid pRXC2 i then cut ~it~ ~rul and ~ I .
and the 8mall fragment i~ ligated to the large fragme~t o~
similarly cut pX, thereby gQnerating pXC2. ~ra~orma~ts harbouring pXC2 were then ~ultured, aAd tLau~Leu~yr3~hPT~ 84) ~o~tained in the conditioned medium was purified a~d as~ayed a~ ;.
d~cribed ~n Example 7. ~he result~ are i~cluded iA Table 1 and ~igurQ~ 3 and 4, aAd s~ow that the ~ra~iant axhibit~ r0d~ced 80n5itit~ity to oxidation aald retaisls sub3tantial PT~ activity. By introducing the tyro~ine residue, there i~ provided a sub~trate ::
amenable to radiolabelli~g, 8uch as with Tl23 in the manner reported : .
i~ ~S 4,409,141, a~d which i3 U8efUl ~0 imaging studieq and for in ..
~i~ro binding analyse~. ;
.
:' S~fiB~ JTE SH~ET

Claims (29)

WE CLAIM:

1. A parathyroid hormone variant having substantial PTH
activity and a reduced sensitivity to oxidation, of the formula:

[X8Y18]PTH

wherein PTH refers to a parathyroid hormone species selected from human PTH and bovine PTH, and X and Y repre-sent independently selected, genetically encoded amino acids at least one of which is other than methionine and cysteine.

2. A parathyroid hormone variant according to claim 1, wherein Y is methionine.

3. A parathyroid hormone variant according to claim 2, wherein X is selected from among the group consisting of alanine, valine, leucine, isoleucine, serine and tryptophan.

4. A parathyroid hormone variant according to claim 2, wherein X is selected from valine, leucine and isoleucine.

5. A parathyroid hormone variant according to claim 2, which is [Leu?]PTH.

6. A parathyroid hormone variant according to claim 1, wherein X is methionine.

7. A parathyroid hormone variant according to claim 6, wherein Y is selected from among the group consisting of alanine, valine, leucine, isoleucine, serine and tryptophan.

8. A parathyroid hormone variant according to claim 7, wherein Y is selected from alanine, valine, leucine and isoleucine.

9. A parathyroid hormone variant according to claim 8, which is [Leu18]PTH.

10. A parathyroid hormone variant according to claim 1, wherein X
and Y are both genetically encoded amino acids other than methionine and cysteine.

11. A parathyroid hormone variant according to claim 10, wherein X
is selected from among the group consisting of alanine, valine, leucine, isoleucine, serine and tryptophan.

12. A parathryoid hormone variant according to claim 11, wherein X
and Y are the same.

13. A parathryoid hormone variant according to claim 12, which is [Leu8Leu18]PTH.

14. A parathyroid hormone variant according to claim 11, wherein X
and Y are different.

15. A parathyroid hormone variant according to claim 14, wherein Y
is leucine.

16. A parathyroid hormone variant according to claim 14, which is selected from [Ile8Leu18]PTH, [Val8Leu18]PTH, [Ser8Leu18]PTH, [Ala8Leu18]PTH and [Trp8Leu18]PTH.

17. A parathyroid hormone variant according to any preceding claim, which is a variant of human parathyroid hormone.

18. A fragment of a parathyroid hormone variant according to claim 17, said fragment having substantial PTH activity and reduced sensitivity to oxidation.

19. An analogue of a parathyroid hormone variant according to claim 17 or claim 18, said analogue having substantial PTH activity and a reduced sensitivity to oxidation.

20. An analogue of a parathyroid hormone fragment according to claim 18, wherein Phe34 is replaced by tyrosine.

21. An analogue of a parathyroid hormone fragment according to claim 20, which is [Leu8Leu18Tyr34]PTH.

22. A cellular host having incorporated expressibly therein a DNA
molecule which codes for a parathyroid hormone variant as defined in any preceding claim.

23. A cellular host having incorporated expressibly therein a DNA
molecule which codas for a parathyroid hormone variant as defined in claim 17.

24. A cellular host according to claim 23, wherein said host is E.

coli.

25. A method for producing a parathyroid hormone variant having substantial PTH activity and a reduced sensitivity to oxidation, which comprises the step of culturing a cellular host as defined in claim 22, claim 23 or claim 24.

26. A pharmaceutical composition comprising a pharmaceutically acceptable carrier and a parathyroid hormone variant as defined in any one of claims 1-17.

27. A pharmaceutical composition according to claim 26, wherein the variant is [Leu8]hPTH.

28. A pharmaceutical composition according to claim 26, wherein the variant is [Leu8Leu18]hPTH.

29. A pharmaceutical composition according to claim 26, wherein the variant is [Leu8Leu18]hPTH.