CA2094832A1 - Specific detection of antibodies to human t-cell leukemia viruses - Google Patents

Abstract

Disclosed is a method and test kit for detecting in a biological sample an antibody to a virion of a human T-cell leukemia virus (HTLV) or to a cell infected with such a virion generally involving contacting the biological sample with an HTLV-II-encoded antigen and detecting formation of the antigen-antibody complex by an immunoassay. Also disclosed is a related method and test kit for detecting an HTLV-I virion or an HTLV-I-infected cell generally involving contacting the biological sample with the HTLV-I specific antigen, RP-B1, and detecting formation of the antigen-antibody complex by an immunoassay. The HTLV-II-encoded RP-IIB and RP-B2 peptides and purified nucleic acid encoding these peptides are also disclosed.

Description

WO92/07961 PCr/US91/07802 - 1 209d832 SPECIFIC DETECTION OF ANTIBODIES
TO HUMAN T-CELL LEUKEMIA VIRUSES
Background of the Invention This invention generally relates to peptides, methods, and kits for detecting antibodie~ to Human T-Cell Leukemia Viruses (HTLV's) or to HTLV-infected cells in a biological sample. In this application, we use the term "HTLV" to include two viruses, HTLV-I and HTLV-II, 10 whose specific prototypes are disclosed in the articles cited below. We also include in that term variants, mutations, or other forms of HTLV-I and HTLV-II. We do not include the virus known as HIV (or HTLV-III).
Human T-cell leukemia virus type I (HTLV-I) has -15 been shown to be etiologically associated with human adult T-cell leukemia and lymphoma (ATLL) and with a neurological disorder termed HTLV-I-associated myelopathy/tropical spastic paraparesis (HAM/TSP) (see, e.g., B.J. Poiesz et al., Proc . Natl . Acad . Sci . USA
20 77:7415, 1980, S. Jacobson et al., Nature 331:540, 1988).
HTLV-I infection is endemic to Southwestern Japan and the Caribbean islands (P.H. Levine et al., Int. J. Cancer 42:7, 1988). Estimates place the number of infected individuals in Japan at over one million (Y. Hinuma et 25 al., AIDS Res . 2:517, 1986) Human T-cell leukemia virus type II (HTLV-II) has been isolated, in two cases, from patients with an unusual T-cell malignancy resembling hairy cell leukemia (HCL); however, the etiological role of HTLV-II in this 30 disease has not been established (see, e.g., I.S.Y. Chen et al., Nature 305:502, 1983, J.D. Rosenblatt et al., Leukemia 1:397, 1987). HTLV-II has also been isolated from individuals without evidence of malignancy, including a hemophiliac with an unexplained pancytopenia 35 and a patient with acquired immunodeficiency syndrome SUBSTITUTE SHEET

.

, . .

W O 92/07961 PC~r/US91/07802 ~(~9ds~

(see, e.g., v.s. Kalyanaraman et al., ~M~O J. 4:1458, 1985) The prevalence of both HTLV-I and HTLV-II
infection appears to be increasing in the United States 5 and Western Europe, particularly among intravenous drug abusers (H. Lee et al., Science 244:471, 1989).
Shimotohno et al. (Proc. Natl. Acad. Sci. USA
82:3101, 1985) report the complete HTLV-II proviral DNA
sequence and deduced amino acid sequence.
Lee et al. (Proc. Natl. Acad. sci. USA 81:7579, 1984) report that HTLV-II encodes an envelope glycoprotein, termed gp67.
Seiki et al. (Proc. Natl. Acad. Sci. USA 80:3618, 1983) report the HTLV-I proviral DNA sequence and deduced 15 amino acid sequence.
Lee et al. (Proc. Nati. Acad. Sci. USA 81:3856, 1984~ report that HTLV-I encodes a 61kD envelope glycoprotein (gp61).
Essex et al. (U. S. Pat. 4,743,678) discloses the 20 use of the 61 kD HTLV-I envelope glycoprotein as a serologic marker for HTLV-I infection.
-Schupbach et al. (Science 224:607, 1984) report that the HTLV-I envelope glycoprotein is cleaved into an amino-terminal 46kD glycoprotein (gp46) and a carboxy-25 terminal transmembrane 21kD glycoprotein (gp21E).
T. D. Copeland et al. (J. Immunol. 137: 2945)report that a peptide derived from the carboxy-terminus of gp46 is recognized by HTLV-I-positive patient sera.
Lee et al. (Proc. Natl. Acad. Sci. USA 81:3856, 1984) 30 report that the HTLV-I envelope protein, which "appears to be the most immunogenic species in exposed people", is immunoprecipitated by serum samples from ATLL patients as well as from healthy carriers living in endemic areas.
Lee et al. further report that human antisera known to -35 have antibody reactivity to the gp61 envelope protein of SU~3ST!T;JT_ SHEt ~

. . .. ; ~ .

, ~ ~ ....... ... :~ :
. .. . . . . .
. . :

W O 92~07961 PC~r/~S91/07802 _ 3 _ 2 ~ 2 HTLV-1 reacts equally well with the gp67 envelope protein of HTLV-II. Samuel et al. (Science 226:1094, 1984) report that a bacterially-expressed recombinant protein containing seven amino acids from the carboxy-terminal 5 region of gp46 and two-thirds of the HTLV-I transmembrane protein is recognized by sera from HTLV-I-positive and HTLV-II-positive subjects.
There are various tests to determine the presence of antibodies to HTLV-I or HTLV-II in a biological 10 specimen (Particle Agglutination Assay, Fujirebio Inc., Tokyo, Japan; EIA, Abbott Laboratories, North Chicago, IL; HTLV-I EIA, Dupont Company, Wilmington, DE). In one particular example, an ELISA test is used for blood bank screening. For such assays, disrupted HTLV-I virions or 15 recombinant HTLV-I virion proteins are used as the source of antigen for the ELISA test. This assay detects antibodies to HTLV-I and, at least, in some cases, also detects antibodies to HTLV-II. H. Lee et al. (Science 244:471, 1989) report that "serum was screened for 20 antibodies to HTLV-I by enzyme immunoassay (EIA) (Abbott laboratories). Although purified disrupted HTLV-I
virions were used in the EIA, sera from two previously identified individuals infected with HTLV-II isolates (HTLV-IIMo and HTLV-IINRA) were strongly cross-reactive in 25 the HTLV-I EIA assay. Therefore, this assay would be -expected to react with other HTLV-II antibody-positive sera". Anderson et al. (Blood 74:2585, 1989) report that "seroreactivity to both gp24 and gp46 and/or gp61 by WIB
tWestern Immunoblot] or RIPA [radioimmunoprecipitation 30 assays] or both are suitable criteria to confirm but not to distinguish HTLV-I and HTLV-II infections".

Summary of the Invention We have discovered that there may be a substantial population of HTLV-II-infected individuals, and we have SUE~STITUTE SHEET

, .,, ., . . .. . ~
..
,; . ~ ~ .
.. .. . . .
. . - ~ . . .:
.
. - '. ~ `~
. . ;

W092/0796t PCT/US91/07802 20~4832 identified immunological markers to detect such individuals reliably, either as part of a general HTLV
screen or as a specific assay to discriminate between HTLV-I and HTLV-II infection. By enabling reliable 5 quantification of HTLV-II infection, our discovery identifies the s~ope of the problem being addressed and highlights the importance of the invention. The importance of our discovery is further highlighted by our finding that HTLV-I-encoded markers may fail to detect a 10 non-trivial percentage of HTLV-II-positive samples.
In general, the invention features a method for detecting in a biological sample an antibody to a virion of a human T-cell leukemia virus (HTLV) or to a cell infected with the HTLV. The method involves providing an 15 antigen encoded by HTLV-type II (HTLV-II), contacting a biological sample with the antigen, and detecting formation of an antigen-antibody complex by immunoassay.
In a related aspect, the invention features a test kit for detecting in a biological sample an antibody to a 20 virion of a human T-cell leukemia virus (HTLV) or to a cell infected with the HTLV. The kit is compartmentalized to receive in close confinement therein one or more containers which include: a first container containing an antigen encoded by HTLV type II (HTLV-II), 25 and a second container containing a means for detecting the formation of an immunocomplex between the antibody and the antigen.
When the human T-cell leukemia virus detected is HTLV-II, the antigen is preferably all, or an antigenic 30 segment or analog, of the HTLV-II envelope protein;
preferably the carboxy-terminal half of the HTLV-II
envelope protein; more preferably, RP-IIB or a segment or analog thereof which is reactive with RP-IIB antibodies;
and, most preferably, RP-B2 or a segment or analog 35 thereof which is reactive with RP-B2 antibodies. If SUB3 ~ 'TU ;-E S~EET

,, . ~ . , . . : , -, . : , ;
, .~, . .

W O 92/Q7961 PC~r/US91/07802 2~9~32 desired, however, it is possible to select and use HTLV-II-encoded antigens that are reactive with antibodies to HTLV-I.
In other preferred embodiments, the method further involves screening for both HTLV-I and HTLV-II. In addition to the use of the HTLV~ encoded marker described above, such a screen involves contacting the biological sample with at least one antigen encoded by HTLV-type I (HTLV-I), preferably an envelope segment or 10 analog which is reactive with HTLV-I sera and not with HTLV-II sera, more preferably, RB-Bl or a segment or analog thereof which is reactive with RP-B1 antibodies.
The antigen encoded by HTLV-II and the antigen encoded by HTLV-I may be combined and contacted with the biological 15 sample simultaneously; or they may be maintained in separate containers and contacted with the sample sequentially or with different aliquots of the sample.
Detection of antigen-antibody complexes preferably is accomplished using a Western blot or an ELISA format.
In another aspect, the invention features a method for discriminating between HTLV-I and HTLV-II infection.
The method involves: providing HTLV-I recombinant protein RP-B1 or an antigenic segment or analog thereof, contacting the biological sample with RP-B1 or an 25 antigenic segment or analog, and detecting formation of an antigen-antibody complex by immunoassay.
In a related aspect, the invention features a test kit for detecting in a biological sample an antibody to human T-cell leukemia virus type I (HTLV-I). The kit is 30 compartmentalized to receive in close confinement therein one or more containers which include: a first container containing HTLV-I recombinant protein RP-Bl or an antigenic segment or analog thereof, and a second container containing a means for detecting the formation 35 of an immunocomplex between the antibody and the antigen.

Slll3ST17~ 1E SHEE~

.
.

.
- ..
. , ,. ~ , , `
.~ .
:.

2~)~483~

Detection of the immunocomplexes is preferably accomplished using a western blot or an ELISA format.
The invention also features the RP-IIB peptide or a segment or analog thereof, preferably RP-B2, which is 5 reactive with RP-IIB antibodies and, preferably, which is not reactive with antibodies specific for RP-B1; and purified nucleic acid encoding the RB-IIB peptide or a segment or analog thereof which is reactive with RP-II3 antibodies. Preferably, such nucleic acid is included in lO plasmid, pIIB, or, more preferably, pB2. -By "antigen" is meant a substance, in this case, a peptide which interacts in a demonstrable selective way with an antibody (e.g., an antibody which is included in a biological sample) which results from challenge by all 15 or part of the virus at issue. By "demonstrable selective way" is meant that the interaction of the antigen with the antibody is detectable (e.g., by an immunoassay) and the antigen is binds preferentially to the antibody directed against the virus at issue. A
20 "peptide" is any chain of amino acids, including polypeptides and proteins as well as smaller peptide chains~ By "antigenic segment" or "segment of an antigen" is meant any portion of an antigenic peptide which interacts in a demonstrable selective way with an 25 antibody directed against the organism bearing the antigen. By "analog" is meant a peptide differing from the antigen or antigenic segment by one or more conservative or non-conservative amino acid changes; a suitable analog, as used herein, is one which interacts 30 in a demonstrable selective way with an antibody directed against the organism bearing the antigen. Such analogs may be produced by any method of recombinant DNA
technology or by chemical, e.g., peptide, synthesis.
When we refer to "HTLV-I-encoded antigen" or "HTLY-II-35 encoded antigen", we include not only peptides whose SU~3S r1TUTE SHE~T `

: ~ :
':, .

W O 92/07961 PC~r/US91/07802 _ 7 _ 21~ g ~ 2 amino acid sequence is encoded by a naturally occurringHTLV, but also analogs of such peptides as described above. By "purified " is meant substantially isolated from other cellular components, e.g., proteins, lipids, 5 and other nucleic acids, with which the substance naturally occurs.
Other features and advantages of the invention will be apparent from the following detailed description, thereof, and from the claims.
Detailed Description The drawings are first briefly described.
Drawings FIG. 1 is the nucleic acid and corresponding amino acid sequence of the HTLV-II provirus (Shimotohno et al., 15 Proc. Natl . Acad. sci. USA 82:3101, 1985; SEQ ID NO.:1).
FIG. 2 is a hydrophobicity plot of the HTLV~
encoded envelope protein sequence and a comparison of the amino acid sequences of the ~TLV-II and HTLV-I envelope proteins.
FIG. 3 is the nucleic acid and corresponding amino acid sequence of HTLV-I including the sequence encoding RP-B1 (Seiki et al., Proc. Natl . Acad . sci . USA 80:3618, 1983; SEQ ID NO~ 3)o FIG. 4 is a diagram depicting construction of 25 expression plasmids, pB, pB1, and pD.
FIG. 5 is a diagram depicting construction of expression plasmids, pA and pC.
FIG. 6 is a diagram depicting construction of expression plasmid, pIIB.
30 Obtainina HTLV~ encoded antiaens for_use in the method of the invention Those skilled in the art will recognize that HTLV-II-encoded serologic markers other than those disclosed below may be used to detect HTLV-II infection according 35 to the invention. These serologic markers would SUBSTITU~ St~EE1 .... . .

. ~ . ..
.

. - . - . . . -,. : :

2 ~ 3 ~

preferably be envelope protein peptide segments or analogs, but may be any HTLV-II-enc~ded peptide which is reactive with antibodies to HTLV-II. To produce such peptide segments or analogs, HTLV-II-derived nucleic acid 5 encoding putative antigenic peptides may be cloned into an expression vector (e.g., an expression vector described below). Alternatively, such peptides may be synthesized by other techniques, including, without limitation, any technique of recombinant DNA technology 10 or chemical, e.g., peptide, synthesis. One source of HTLV-II is the mammalian cell line, termed MO, which is permanently and persistently infected with HTLV-II; this cell line is available from the American Type Culture Collection (Accession No. CRL-8066). Viral DNA may be 15 isolated from such a cell line by standard techniques (see, e.g., Tsujimoto et al., Mol. Biol. Med. 5:29, 1988;
Seiki et al., Proc. Natl . Acad . Sci . USA 79: 6899, 1982;
Hirt, B., J. Mol. Biol. 26:365, 1967). Alternatively, HTLV-II DNA may be obtained from available full-length or 20 partial HTLV-II proviral clones (e.g., ~H6.0; Chen et al., Nature 305: 502, 1983; Shimotohno et al., Proc. Natl .
Acad. Scl. USA 82:3101, 1985). The full-length HTLV-II
sequence is shown in Fig. 1 (SEQ ID NO.~
Information regarding hydrophobicity provides 25 guidance in choosing candidate antigenic peptides (including antigenic peptide segments or analogs);
hydrophilic regions are more likely to be antigenic, i.e., reactive with HTLV-II-positive sera, because these regions are exposed on the surface of the virion or 30 virion-infected cell. A hydrophobicity plot of the HTLV-II envelope protein sequences is shown in Fig. 2. To facilitate selection of candidate peptides (including peptide segments or analogs) which specifically or selectively react with HTLV-II-or HTLV-I-positive sera, 35 Fig. 2 also shows the the regions of conserved amino acid SU~3S~u~ SH~T

... . . . . . . .
. ~ . . . . - . -.... ~ . .
.
. . ~: . . .

W O 92/07961 PC~r/US91/07802 , .
- 9 - 2~3~832 residues along the HTLV-I and HTLV-II amino acid sequences. Conserved segments of amino acids (i.e., identical amino acids) are represented by black boxes.
Peptide segments derived from regions of divergent 5 sequence would be most likely to react specifically with serum directed to one particular type of HTLV (i.e., either HTLV-I or HTLV-II).
Candidate peptides may be tested, by methods described in greater detail below, using, e.g., PCR-10 confirmed HTLV-II-positive antiserum (as described below). Antigenic peptides are those which react with HTLV-II-positive serum (as determined using the methods described below). Peptides specific for HTLV-II are those which react exclusively or selectively (e.g., a "two plus antibody reactivity", as defined below) with HTLV-II-positive serum.
A particularly preferred HTLV-II-encoded antigen is the recombinant protein, RP-IIB (described below; S~Q.
ID NO.: 2) or segments or analogs thereof. Candidate 20 segments or analogs may be produced, e.g., by any technique of recombinant DNA technology or chemical synthesis and screened for antigenicity, i.e., reactivity with HTLV-II-positive serum, using methods well known to those skilled in the art, e.g., those methods described 25 below. One preferred antigenic segment of RP-IIB is included in the peptide RP-B2 (described below).
HTLV-I-encoded antiqens Those skilled in the art will recognize that many HTLV-I-encoded antigens (either purified or provided in 30 mixtures obtained from disrupted virions or virion-infected cells) can be used to detect HTLV infection.
Where the goal is to screen samples for infection by either HTLV-I or H~LV-II, the HTLV-I-encoded antigen can be used in addition to the above-described HTLV-II-35 encoded antigen to reduce the incidence of false negative SU~3STITUTE SHEE~T

. : .: .: -. ., .:: . . , . ~ , . .- -: . . . . .. . .

WO92/D7961 PCT/US9l/0~802 ~a~32 readings. In that case, it is possible to combine any of a number of known human HTLV-I serologic markers with an HTLV-II-encoded antigen, e.g., as discussed above.
Where the goal is to distinguish HTLV-I from HTLV-5 II, it is desirable to use RP-Bl, as described below, or a segment or analog thereof. Candidate segments or analogs of RP-B1 would be generated and screened for antigenicity as described above for RP-IIB, and for lack of reactivity with HTLV-II. Sources of HTLV-I include 10 the mammalian cell lines, termed MJ and C5-MJ, which are permanently and persistently infected with HTLV-I; these cell lines are available from the American Type Culture Collection (ATCC Accession Nos. CRL-8294 and CRL-8293, respectively). Viral DNA may be isolated from such cell lines by standard techniques (see, e.g., Tsujimoto et al., Mol. Biol. Med. 5:29, 1988; Seiki et al., Proc.
Natl. ~cad. Sci . USA 79:6899, 1982; Hirt, B., J. ~ol .
Biol. 26:365, 1967). Alternatively, HTLV-I DNA may be obtained from available full-length or partial HTLV-I
20 proviral clones (e.g., ~ATM-l or ~ATK-1; Seiki et al., Proc. Natl. Acad. sci. USA 80:3618, 1983). The HTLV-I
-sequence encoding RP-B1 is shown in Fig. 3 (SEQ ID NO.:3) Ex~erimental Information The following specific examples are provided to 25 illustrate, not to limit, the invention.
The preferred HTLV serologic markers according to the invention are identified from a panel of recombinant proteins containing different regions of the HTLV-I or HTLV-II env proteins whose immunological reactivity is 30 assayed as described below.
Seroloaic ReactivitY to HTLV-I Recombinant Proteins To produce a test panel of recombinant proteins, fragments of HTLV-I proviral DNA sequences were cloned into appropriate expression vectors, using as a 35 reference, the HTLV-I sequence reported by Seiki et al.

SU~3S~ITUTE S~tEET

. ` . ~ , .................................... . .
. . . . . . . . . . : . .
: ,. . . . . , : .. .. ~ . ..

WO92/07s61 PCT/US9l/07802 ~13~83~

(Proc. Natl . Aca~. sci. USA 80: 3618, 1983, hereby incorporated by reference). The intact env gene was carried on the plasmid, psphI-envl. This plasmid was constructed as follows. The plasmid pMT2 (Clark et al., 5 Nature 305:60, 1983, hereby incorporated by reference) was digested with SphI and a 4.2-kilobase (kb) fragment containing both the HTLV-1 env gene and the x region was isolated and subcloned into expression vector, p806 (a derivative of pUC18 containing the tac promoter and v-10 ras~ gene on an EcoRI-NcoI fragment which was originally derived from plasmid pXVR; Feig et al., Proc. Natl. Acad.
Sci USA 83: 4607, 1987, hereby incorporated by reference).
The inserted env gene was determined by sequence analysis (by the procedure of Toneguzzo et al., Biotechniques lS 6:460, 1988, hereby incorporated by reference) to be in the same reading frame as the preceding v-rasH gene.
The distal two-thirds of the HTLV-I env gene was expressed from plasmid, pS3. To generate pS3, psphI-envl was digested with Sal I, and a SalI-ended fragment 20 containing the first 5694 nucleotides of the env gene was deleted. The resultant plasmid (containing nucleotides 5694 to 6665 of the env gene) was treated with DNA
polymerase Klenow fragment and religated by blunt-end ligation (Fig. 4).
The transmembrane env protein (encoded by nucleotides 6140 to 666S), was expressed from plasmid pD
(Fig. 4). To generate pD, psphI-envl DNA was digested with ~pnI, and a KpnI-ended fragment containing the first 6140 nucleotides of the env gene was deleted. The plasmid 30 DNA (containing nucleotides 6140 to 6665 of the env gene) was treated with DNA polymerase Klenow fragment and religated by blunt end ligation.
Two internal regions of the HTLV-I env gene were expressed from plasmids, pB and pB1 (Fig. 4). These :
35 plasmids were generated from plasmid pS3, isolated from . :.

SUBSTITUTE SHEET

. .. . - .. , .. . , . .. . - . . . , . . .: - . ` . . . . . . . .

.. ... .. . , . , ~ ... . .. . .; , ~

W092/0796~ PCT/US91/07802 ~'3i~3~ 12 E. coli strain JM110 and dige~ted with either ClaI or XhoI. Ends were blunted with DNA polymerase Klenow fragment and re-ligated, by blunt-end ligation, in the presence of NheI nonsense codon linker DNA, 5 d(CTAGCTAGCTAG~ (New England Biolabs, Beverly, Mass.) The resultant plasmids, pB and pB1, contained HTLV-1 env gene nucleotide sequences (5694 to 5887) and (5694 to 5799; SEQ ID NO.: 3), respectively (Fig. 4).
Expression vector pJL6 (Lautenberger et al., Gene 10 Anal . ~echnol . 42:49, 1984, hereby incorporated by reference) was used to express the N-terminal half of the HTLV-I envelope glycoprotein, gp46. pJL6 contains a bacteriophage ~ PL promoter and the N-terminal fragment of the ~ cII gene, including the ribosome-binding site 15 and an ATG start codon. As shown in Fig. 5, a 42~-base-pair (bp) PvuII-SalI fragment (including nucleotides 5273 to 5694) was obtained from pMT2 (Clark et al., Nature 305:60, 1983). It was then treated with DNA polymerase Klenow fragment and fused in-frame to plasmid vector pJL6 (Lautenberger et al., Gene Anal . Technol. 42:49, 1984), which had been digested with ~indIII and blunt-ended using DNA polymerase Klenow fragment. The resultant plasmid was termed plasmid pA (Fig. 5). Plasmid pC (Fig.
5), encoding the C-terminal region of gp46, was 25 constructed by inserting a 234-bp ClaI-B~mHI fragment (including nucleotides 5887 to 6120) from plasmid pMT2 (Clark et al., Nature 305:60, 1983) into plasmid vector pJL6, which had been previously linearized by digestion with ClaI and BamHI (Fig. 5).
The recombinant protein, RP-IIB, was expressed from plasmid, pIIB. This plasmid was constructed by isolating, from plasmid pMOlA (Gelmann et al., Proc.
Natl. Acad. Sci. USA 81:993, 1984, hereby incorporated by reference), a 0.42 kb RsaI-RsaI fragment containing an 35 internal region (i.e., nucleotides 5462-5883; SEO ID NO.:

SUE~STI I UTE SHEET

- . . ~ . . - . .

.. , ~ : . . ............. : ., .
:

- 13 - 2J13~8~
1) of the HTLV-II env g~ne (nucleotides 5180-6130; SEQ ID
NO.: 1) and subcloning this fragment into plasmid pJL6 (Lautenberger et al., Gene Anal. Technol. 42:49, 1984), which had been digested with ClaI and blunt-ended using 5 DNA polymerase Klenow fragment (Fig. 6). The inserted env gene was shown to be in the same reading frame as the preceding lambda phage cII gene by DNA sequence analysis using the procedures of Toneguzzo et al. (Biotechniques 6:460, 1988). To clone the RP-IIB-encoding fragment into 10 another vector (e.g., other prokaryotic expression vectors or a eukaryotic expression vector), pMOlA may ~e digested, as described above, with RsaI and a 420 base pair fragment isolated for insertion into the desired vector.
Recombinant proteins (RPs) containing specific regions of HTLV-l gp61 were produced by either ve~tor p806 (pB, pB1, and pD) or by vector JL6 (pA and pC) in two different bacterial culture systems. E. coli X-90 (Pallas et al., J. Virol . 40:1075, 1986, hereby 20 incorporated by reference) was transformed with p806-derived plasmids and the RPs were produced following induction with isopropyl-~-D-thiogalactopyranoside (IPTG) as described in Matsuda et al. (Proc. Natl. Acad. Sci.
USA 85:6968, 1988, hereby incorporated by reference). E.
25 coli DC1148 (Lautenberger et al., Gene Anal. Technol.
42:49, 1984), a strain lysogenic for a lambda phage which encodes the mutant temperature-sensitive repressor, cI857, was transformed with pJL6-derived plasmids and the RPs were produced following induction upon temperature 30 shift from 32 to 42C as described in Samuel et al.
(Science 226:1094, 1984, hereby incorporated by reference).
Following induction of recombinant protein production, the RPs were partially purified as described 35 in Matsuda et al. ~Proc. Natl . Acad . Sci . USA 85: 6968, SUE3STITUTE SHE~T
: ::

~09~32 - 14 - : .
1988) and were identified by Coomassie blue staining (as described in Reisner et al., Anal . Biochem. 64:509, 1975, hereby incorporated by reference) of cellular proteins which had been separated by electrophoresis on a sodium 5 dodecyl sulfate-polyacrylamide (SDS-PA) gel (Laemmli, Nature 227:680, 1979). Their molecular weight (in kDa) was determined by comparison with protein standards (of known molecular weight); the apparent molecular weight of each RP is given in Table 1.

SUBSTITUTE SH~ET

..

. . . . . -;
.. . . ;. . .. .. . . . .. . . . . .

Wo 92/07961 PCI/US91/07802 203~32 .

m ~ ._ ~ c~ .
Q O ._ C
c Eo n L~ ~ ~ O
. I C ~

E¦ u ~ u, o . I ~ ~,B
c c o _ 8 ~ _ N V~ 0 U~
nvl Q L'-2 -- Q ~
C ~_ N N _ ~ ._ Ul .~ 8.' aO ~ ~
z :~ :r u en ~
.C U~ C ; ~ :
'u ~ ~ C' Cl - ' E ~¦ o N O 0 0 c Ul ~
C ~I N _ _ ~J 1~1 0 2 c L,~lvu~
o 3 vl c u cl ~OOO o~O . c ~ 8 ~ :

L C~ Q 0Q 0Q Q cO \ -- L O

lo _ Z E ~ >
~L ~ CQ~Q~ ~ Z`~ ~ n ~7 .' ~' SUBSTITUTE SH~

,, . ~ - .

W092/07961 PCTtUS9ltO7802 20~ 4832 16 Plasmids psphI-envl and pS3 failed to express their RPs. However, the truncated protein fragments were expre~sed at levels ~igh enough to allow direct detection by Coomassie blue staining. The RPs ranged from 15 to 32 5 kDa and together covered approximately 98~ of the total ~TL~-1 en~ precursor protein. The pJL6 bacterial system generally produced the RPs in greater quantity than did the p806 system, however, the reason for this difference is unclear.
Identification of the RPs was confirmed by Western blot (WB) analysis using high-titer HTLV-1-positive sera and goat anti-v-ras~ antiserum which recognized the fusion proteins expressed by pB, pB1, and pD. By this assay, the observed molecular masses of the RPs also 15 corresponded to their predicted molecular weight values.
RP-D consisted of two molecular weight species, one of molecular weight 32 kDa, the other of 30 kDa; both reacted on Western blots with most HTLV-l-positive sera ; and with a rabbit anti-gp21 antiserum.
RP-IIB was produced by transformation of pIIB into ~. col i strain DC1148. An 18 kD protein was expressed by pIIB and was shown to be reactive to an HTLV-II-positive serum by WB assay 20 minutes after the temperature shift.
Its production reached a plateau 40 minutes after 25 temperature shift. To purify the protein, the bacterial pellet was subjected to a series of partial purification steps which included successive high salt and detergent extractions combined with sonication as described in Matsuda et al. (Proc. Natl . Acad. Sci . USA 85: 6968, 30 1988). RP-IIB was subsequently detected in an 8M urea fraction by Coomassie blue staining of an SDS-polyacrylamide gel (Laemmli, Nature 227:680, 1979, hereby incorporated by reference).
Serum samples from two groups of Japanese HTLV-1-35 positive subjects, healthy carriers, and ~TL patients SUBSTI T UT~ SHE'r :.
.
. ~ ' ' . -. : .
. :

: , were used to study the prevalence of antibodies to each ~ of the specific RPs. Initial screening for HTLV-1 - seropositivity was standardized by using both the particle agglutination test (Ikeda et al., Gann. 75:845, 5 1984, hereby incorporated by reference) and the immunofluorescence test (Ishizaki et al., J. AIDS 1:340, 1988, hereby incorporated by reference). All samples were then confirmed as positive by both a Western blot assay (as described in Barin et al., Lance~ il:1387, 10 1985, hereby incorporated by reference) using MJ cell lysates (Popovic et al., Science 219:856, 1983, hereby incorporated by reference) and a radioimmunoprecipitation assay (RIP assay) using [35S~cysteine-labeled MT-2 - antigens (Miyoshi et al., Nature 294:770, 1981, hereby '' 15 incorporated by reference).
As shown in Table 2, antibody reactivity to the RPs can be summarized as follows: 22.2% (10 of 45) of samples from the carriers and 16.9% (13 of 77) of samples from the ATL patients were reactive to RP-A; 80% (36 of 20 45) of samples from the carriers and 68.8% (53 of 77) of the samples from the ATL patients were reactive to RP-. Bl; and 91.1% (41 of 45) of samples from the carriers and ` 93.8% (76 of 81) of samples from the ATL patients were reactive to RP-C. ~;

: , : :' J~EET

... .

:

W O 92/07961 PC~r/US91/07802 ~ ~^o ~ ~ ~.
~o , ,~
C'o ~ ~

U

~ ~ L~O ~ ,~ .

? '' i i - ' _ m o o o ~

~ ~
~n o SUB~;TITUTE SHEET

....~..
.. .;.. ~ .
. ~ ... .

W O 92/07961 P~r/US91/07802 - 19 ~ 2 The antibody reactivity rates for all the serum samples, as assayed by Western blot, were as follows:
18.9~ (23 of 122) rea_ted with RP-A; 89.6~ (112 of 125) reacted with RP-B; 70.2~ (85 of 121) reacted with RP-Bl, 5 and 92.9~ (117 of 126) reacted with RP-C . These results indicated that the C-terminal half of gp4 6 (RP-B plus RP-C) detected 97.6% (123 of 126) of the HTLV-II-positive sera, a percentage which is significantly higher (P<0.005) than that detected by the N terminal half of 10 gp46 ~i.et ~ ~P-A). RP-A, RP-B, and RP-C, which together span the entire length of gp46 except the first five amino acids at the N-terminus and the last four amino acids at the C-terminus, detected 99.2~ (125 of 126) of the HTLV-I-positi~e subjects. This same combination of 15 RPs detected every ATL patient in this study. In contrast, RP-D, which contains the transmembrane envelope protein gp21 minus the first amino acid at the N-terminus, had only a 73.7~ (84 of 114) reactivity rate.
The difference in the rates of antibody response between 20 gp46 (RP-A plus RP-B plus RP-C) and gp21 (RP-D) is statistically significant (P<0.005; Statistical Methods in the Biological and Nealth Sciences, ed. Milton and Tsokos, McGraw-Hill Book Co., 1983).
Recombinant Protein B2 contains an HTLV-II-specific 25 Antiaen To produce expression plasmid, pB2, a DNA fragment including nucleic acid residues 5675 to 5801 was ligated, by blunt end ligation, into SmaI-/ SphI-digested p806;
both the RP-B2-encoding fragment and the p806 vector were 30 treated with Klenow fragment to produce blunt ends prior to ligation. The 0.16 kb RP-B2-encoding fragment was produced by standard methods of PCR amplification, using plasmid pIIB as a template and the primers:
5' GCGGAATTCGTATGATCCTTTATGGTTC 3' 35(SEQ ID N0.: 4) AND
.
:
&UBSTITUTE SHEET

. . , ~.
... . . , ........... . ~ . - . .

. . .

2~9~832 20 -5' GCGGCATGCCTAGGTCAGCTGGATAAATTT 3' (SEQ ID N0.: 5) Plasmid pB2 encodes a fusion protein, termed RP-B2, containing 48 amino acids from the HTLV-II envelope 5 protein (i.e~, amino acid residues 166 to 213 of Fig. 1;
SEQ ID NO.: 1).
RP-B2 showed specificity for HTLV-II-positive sera in WB assays. None of the 12 HTLV-I-positive sera, shown above to cross-react with RP-IIB, had detectable antibody 10 reactivity to RP-B2; all 20 HTLV-II-positive sera exhibited antibody reactivity to RP-B2.
Recombinant Protein B1 contains an HTLV-I-s~ecific Anti~en Twenty PCR-confirmed HTLV~ positive serum 15 samples (from intravenous drug abusers from New Orleans;
Serologicals, Inc., Marietta, GA) were used to study antibody reactivity to five of the recombinant proteins (RPs-A, -B, -B1, -C and -D), described above. PCR
confirmation was carried out by analyzing isolated 20 lymphocyte DNA according to the 32[P]-oligonucleotide end-labelling PCR technique described previously (Lee et al., Science 244:471,1989, hereby incorporated by reference) Five oligonucleotide primer pairs corresponding to tax, protease and LTR sequences were utilized. The tax 25 oligonucleotide primers corresponded to conserved sequences in both HTLV-I and HTLV-II; the two protease primer pairs and the two LTR primer pairs distinguish absolutely between HTLV-I and HTLV-II (Duggan et al., Blood 71:1027, 1988). RPs were analyzed for antibody 30 reactivity by Western blotting (WB) as described above.
Partially purified RPs solubilized either in 3M or 8M
urea were subjected to electrophoresis on a 15% SDS-polyacrylamide gel (Laemmli, Nature 22?:680, 1970 and passively transferred to nitrocellulose membranes (Schleicher & Schuell, Keene, NH) for 36 hours using the SUBSTITUTE SHEET

:

; : .
.

WO~2/0796l PCT/US91/07802 - 21 - 2~94`832 methods of Barin et al. (Lancet 1i:1387, 1985). WB
strips were then lined up and the reactive bands were scanned using a video-densitometer scanner (Model 620, BioRad Laboratories, Richmond, CA). When appropriate, 5 the radioimmunoprecipitation (RIP) procedure of Chen et al., (J. Virol . 63:4952, 1989, hereby incorporated by reference) was used as a confirmatory test; this test utilizes MT-2, an HTLV-I cell line (Miyoshi et al., Nature 294:770, 1981. The HTLV-I specific viral antigens 10 expressed in MT-2 cells have been reported previously.
Lee et al., In Human T-cel l Leu~emia/Lymphoma Virus , ed.
Gallo et al., pp. 111-120, Cold Spring Harbor Laboratory, Cold Spring Harbor, NY, 1984).
Antibody reactivity with each of the RPs were 15 determined to be as follows: 10% (2/20) for RP-A; 5~
(1/20) for RP-B; 0% for RP-B1; 85~ (17/20) for RP-C; and 80% (16/20) for RP-D. RP-IIB, which contained amino acid residues 96-235 from the HTLV-II exterior envelope glycoprotein (i.e., amino acid residues 21-308) was 20 reactive to all 20 HTLV-II serum samples.
To more carefully compare antibody reactivity, RP-Bl and RP-IIB proteins were used in a Western blot assay to study the antibody reactivity of 115 additional plasma samples. Those samples included: 9 PCR-confirmed HTLV-25 I and 45 PCR-confirmed HTLV-II plasma samples from intravenous drug abusers in New Orleans, 13 HTLV-I-Enzyme immunoassay negative samples, 1 HTLV-I-WB indeterminate case, and 1 HTLV-I seropositive but PCR-negative case.
Another panel of 46 PCR-confirmed HTLV-I plasma samples 30 were selected from a nationwide survey of food service employees in 1987-1988 in Jamaica. The samples were randomly mixed, blind-coded by a collaborator from another laboratory, and tested by WB assay. The results of the WB test were classified into two major categories: -35 seropositive to RP-Bl (presumably, HTLV-I-positive cases) SUBSTITUTE SHEET

- . . ... .. . .
..
... . . . . . . . . . .

.. ..

~094832 or seronegative to RP-Bl (presumably, HTLV-I-negative cases). In each major category, samples were divided .: into four subcategories (negative, one plus, two pluses and three pluses), according to their antibody : 5 reactivities to RP-IIB. These relative levels of antibody reactivity were determined by densitometerscanning. Following such categorization, the serum -sample code was broken, and the results of the WB tests were shown to oe identioal to the PCR results.

," ' .

.~ .
. ' .~ ,~

:.
. ,j :. .
,:,.
.
. :

.
~ '. ' .

..... .
".
..... .

. . .
.~
'','-...
SlJBsrlTu~E S'~ r -. ~ -- 2~334832 J : .
C .~:

._ . ~
. . .

~ ~ , o o .
~
.. c, o ~ N

oooo ~L
., . C o .. ~ D 0 t~ooooo~ ~ ~c -oooOOV~

m m m m a~ m m + al ~ c) ~_ _ _ _ _ _ _ _ _ o ~

cc m m 1 L tl . '~ ' SUBSTITUTE SHEET
-~ .~. ,. .. . .,, . . .. , ., ,,, .. , ..... . , ", . . . . .. .

W O 92/07961 PC~r/US91/07802 ~9 4~2 As shown in Table 3, all 55 PCR-confirmed HTLV-I-positive samples and none of the 45 PCR-confirmed HTLV-II-positive samples were reactive to RP-Bl. All 45 HTLV-II samples were reactive with RP-IIB, and most of the 5 positively scoring antibody reactivity was scored as two to three pluses (39/45). Thirty-six of 55 (65%) HTLV-I-positive samples were cross-reactive to RP-IIB, however, the majority of these samples exhibited a one-plus antibody reactivity. Among the 13 HTLV-seronegative 10 samples, there were 3 cases (21%) which had antibody reactivities to RP-IIB; none had antibody reactivity to -RP-B1. These 3 cases were found to have indeterminate antibody profiles to HTLV-I antigens by radioimmunoprecipitation assay (using MT-2 cells and the 15 procedure described in Lee et al., Proc. Natl. Acad. Sci.
USA 81:7579, 1984). One case, which had two-plus antibody reactivity to RP-IIB, had antibodies to HTLV-I
gag pl9. The other two cases which had two-plus and one-plus antibody reactivities to RP-IIB, respectively, had 20 antibodies to HTLV-I gag p55. These three cases may represent HTLV-II infections which have been neglected by the current HTLV-I antigen-based serological-tests. In addition, a WB-indeterminate case and an HTLV-I-seropositive but HTLV I and HTLV-II PCR-negative case 25 also show antibody reactivity to RP-II8.
. Recombinant protein IIB contains HTLV-II-specific ,` epitoDes . Serum samples from the following groups were tested for their antibody reactivities to RP-IIB: 27 30 HTLV-II carriers from New Orleans; a patient MO from whom the first HTLV-II was isolated (Chen et al., Nature 305:502, 1983); 20 HTLV-I carriers from an endemic area in Japan; 17 ATL patients from an HTLV-I endemic area in Japan (Chen et al., J. Viroi . 63:4952, 1989); and 10 35 HTLV-I/II negative blood donors. All serum samples were . .

~ SU~STITUTE S~EEr ..

., .. . . .
-, . . .

:. - , . .

:
:

2~3~832 tested by two HTLV-I enzyme immuno assays (Abbott EIA, Abbott Laboratories, North Chicago, IL and Du Pont EIA
(Du Pont Company, Wilmington, DE), and confirmed by WB
and radioimmunoprecipitation (RIP) (using the procedures 5 cited above). HTLV-II carriers were confirmed by PCR
according to the technigue of Lee et al. (Proc. ~atl. :
Acad. Sci. USA 81:7579, 1984) described above. Among 27 HTLV-II carriers confirmed by PCR, two carriers were seronegati~e in Abbott and Du Pont HTL~-I EIAs and had 10 indeterminate antibody profile for HTLV-I infection (i.e., one case only had anti-Gag p24 antibody; another case only had anti-Env gp61 antibody).
.~ ~
...
' ' .

' : , ' . .
.
''';
.~ . ,, : ' ', :' .
.
:~ -. , ~
,, : .
. .
' SU~3STlTUTE SHEET

. . .

. . ...

WO 92/07961 PCI/l IS91/07802 ~,o9 ~S~32 .

.
m . o _ oo~ .~. .

~, b ~

. ~ ~80 .~
:.
~ . ~o~
.: ~ ~_ ., ~
' ~ 'L.~1 C
- ~ _uv~ ~o . ~ ~ ~ ~, _ o .. U~ ~S~ ~
: "' o - SUBSTITUTE S~1EFT
;

. - . . .

. .
.. ` ... . . . .
: . ~ ... . ` , `

.
., ; ., , ,, ` ~ ,.~

2~3~832 As shown in Table 4, in addition to patient ~0, all 27 PCR-confirmed HTLV-II carriers had antibody reactivity to RP-IIB. In contrast, only 10 of 20 HTLV-I
carriers and 4 of 17 ATL patients had antibody 5 reactivities to RP-IIB. None of the 10 normal human sera had antibody reactivity to RP-IIB. The differences in r the rates of seropositivity to RP-IIB between ~TLV-II
infected people (100%) and HTLV-I carriers (50~), or ATL
patients (24%), or all HTLV-I infected persons (14/37, 10 37.8%) were highly statistically significant (by Fisher's exact test, two-tail; p=3.57E-05, p=4.58E-08 and p=4.30E-08, respectively; Statistical Methods in the Biological - and Health Sciences, ed., Milton and TsoXos, McGraw-Hill Book Co., 1983).
In addition, the optic density (O.D.) of reactive bands in the WB results was recorded by densitometer ; scanning (Model 620, BioRad Laboratories, Richmond, CA) and scored one plus to three plus according to a panel of ~! standard reactivities which were tested side by side with 20 the test samples in WB assays. Anti-RP-IIB antibody :~ reactivities of a standard PCR-confirmed HTLV-II serum :. were tested at 1:200, 1:2,000 and 1:10,000 dilutions. . .
. For all that had a visible band, the scoring was as follows. A serum sample having reactivity equal to or - 25 lower than that of the standard serum at l:lO,000 : dilution, the score was one plus; for serum reactivity - equal to the standard serum at 1:2,000 or between those - of the standard serum at 1:10,000 and 1:2,000, the score ~ was two plus; and the score was three plus when a sample : 30 had antibody reactivity greater than that of the standard serum at l:2000 dilution. This data is also su~marized in Table 4.
Twenty-four of 27 (89%) HTLV-II serum samples had two or three plus seroreactivity to RP-IIB while, among 35 those HTLV-I positive samples cross-reacting to RP-IIB, . . .

~ SUBSTITUTE SHEEr ~ . . :. . . . ~ ..

' ' ~ ~ r. ~ , . . . ..
.. .' , ,' . , . ' ,, ~" `:
' ~" , only 1 of 14 (7%) had two plus reactivity. This was also reflected by the significant difference in the means of O.D. from densitometer scanning for the above two groups, i.e., 1.19 + 0.11 for HTLV-II samples and 1.04 + 0.05 for 5 HTLV-I samples (t-test, p<O. 05); Statistical Methods in the Biological and Health Sciences, ed., Milton and Tsokos, McGraw-Hill Book Co., lg83)~
Qther Embodiments Antibody reactivity may be recorded using any of a 10 number of immunoassays well known to those skilled in the art. The antigenic peptide can be radio-labelled by conventional methods for use in radioimmunoassay, with fluorescein for fluorescent immunoassay, with enzyme for enzyme immunoassay, or with biotin for biotin-avidin 15 linked assays. it can be employed, labelled or unlabelled as desired, in competitive immunoassays, as well as in double antibody assays or other assays. The antigenic peptide can also be immobilized on some solid phase, such as an insoluble resin (e.g., a nitrocellulose 20 filter) or a microtiter well, and detection of the HTLV
antibody carried out by measuring binding of the antibody to the solid phase. Solid phases may also include latex particles, which, when coated with the antigenic peptide and subjected to reactive antibody, will agglutinate.
2S Other examples of solid phases to which the antigenic peptide may be attached include, without limitation~ test tubes, vials, titration wells, and the liXe. Antibody may be detected by double antibody techniques or Protein-A dependent techniques.
The diagnostic methodologies of the invention are incorporated into test kits. Such kits are compartmentalized; the first compartment includes one or more of the antigenic peptides of the invention, in detectably labelled form (e.g., any of the forms above) 35 or immobilized on a solid phase (e.g., those listed SUBSTITUTE Sl~'ET
, , . . , - , . . .
: , . ; ~ i . . .

.
, WO92/07961 PCT/US91/0~802 2~832 above). The second container may include elements necessary for detection of the label on the antigen (e.g., chromogenic substrates) or, alternatively, a second antibody (e.g., monoclonal or polyclonal anti IgG) 5 directed to the antibody in the biological sample which is specific for the HTLV-encoded antigen. Particular examples of such immunoassays are described in Gallo et al. (U.S. Patent No. 4,520,113, hereby incorporated by reference).
Any biological specimen may be tested, however, of particular interest is the screening of blood to ascertain whether such samples are contaminated with HTLV-I or HTLV-II or both.

` SUBSTITUTE SHEET
. .
... . . ., -. . .

:. .' ' . , : .
: . ., .' . ` ; " :

W 0 92/07961 PCr/US9l/07802 ~ 8 3 2 30 _ SEOUENC~ LISTING

(1) GENERAL INFORMATION:

(i) APPLICANT: Essex, Myron E.
Chen, Yi-Ming A.

(ii) TIT$E OF IN~ENTION: SPECIFIC DETECTION OF
., ANTIBODIES TO HU~AN T-CELD
LEUKEMIA VIRUSES

(iii) NUMBER OF SEQUENCES: 5 ~i~) C02RESPONDENCE ADDRESS:

(A) ADD~ESSEE: Fiqh ~ Richardson (B~ STREET: One Financial Center (C) CITY: Boston (D) STATZ: Massachusetts ' (E) COUNTRY: U.S.A.
(F) 8IP COD~: 02111-2658 : ~v) COMPU~ER ~EADABLE FORM:
'' .
: (A) MEDIUM TYPE: 3.5" Diskette, 1.44 Mb ~torage (B) COMPUI~R: IBM PS/2 Model 50Z or 55SX
.~ (C) OPERATING SYSTEM: IBM P.C. DOS (Version 3.30 (D) SO~TWARE: WordPerfect (Version 5.0) (vl) CURRENT APPLICATION DATA:

(A) APPLICATION NUMBER: N/A
(B) FILING DATE: October 26, 1990 ~ (C) CLASSIFI QT$0N: N/A
,:~
~ ~Yii) PRIOR APPLICATION DATA:
-.' : `
':
SUBSTITUTE S~E-T
.:
. ~ ,. ..
. .
.
.

. ~ . . . . . .. . . . .
. . ~ . . ~ .
: - . . . .
j . : ~ `: . :
- . : : ``, . : :

2~9~Lg32 ' " ' ' Prior application~ total, including applicati~n described balow: o (A) APPLICATION NUMBER: 0 (8~ FILING DATE: 0 .
(viii) ATTORNEYJA~ENT INFORMATION:

(A) NAME Freeman, John W.
(B) RE~ISTRATION NUMBER: 29,066 (C) REFERENCE/DOCKET #: 00379-009001 (ix) TELECOMMUNSCATION INFORM~TTON:
.
- (A) TE~EP~ONE: ~617~ 542-5070 (B) TELFFAS: (617) 542-8906 ~C) TELES: 200154 , ~
TOTA~ NU~B~R OF SEQUENCES TO BE LISTED: 5 (2) INFORMATION FOR SEQUENCE IDENTIFICATION NUMBER:
.~
~i) SEQUENCE C~ARACTE~STICS:

: (A) LENGT~: 2486 (~) TYPE: . nucleic acid (C) ST~ANDEDNESS: ~ingle (D) TOPOLgGY: linear ; (E) NAME: SEQ ID NO.: 1 , -. (ii) SEQUEWCE DESCRIPTION FOR SEQUENCE ID NUMBER: 1 '' TGACAATGGC GACTAGCCTC CCAAGCCAGC CACCCAGGGC GA&TCATCGA CCCAAAAGGT 60 ' ' SUBSTITUTE SHEET

.
. . : :, .~ - . ` .

,.. ~, ~ , ` . :.. . .. .

2~832 TCGGCACCTC CTGAACTGCT CCTCCCAAaG TAAGTCTCCT CTCAGGTCGA GCTCGGCTGC 4Q0 GATTTGAATT CCTCCATTCT CACATT ao6 Met Gly Gln Ile His Gly Leu Ser Pro Thr Pro Ile Pro Lys Ala Pro Arg Gly Leu Ser Thr Hi~ Hi~ Trp Leu Asn Phe Leu Gln Ala Ala Tyr Arg Leu Gln Pro Arg Pro Ser Asp Phe Asp Phe Gln Gln Leu Arg Arg Phe Leu Lys Leu Ala Leu Lys Thr Pro Ile Trp Leu Asn Pro Ile Asp Tyr Ser Leu Leu Ala Ser Leu Ile Pro Lys Gly Tyr Pro Gly Arg Val Val Glu Ile Ile Asn Ile Leu Val Lys Asn Gln Val Ser Pro Ser Ala Pro Ala Ala Pro Val Pro Thr Pro Ile Cys Pro Thr Thr Thr Pro Pro Pro Pro Pro Pro Pro Ser Pro Glu Ala His Val Pro Pro Pro Tyr Val ''',~' . ~ .
- SUBST~ . E S~--E

. i . . . . .. . . .. . . ......... . ..... ....

... ... ; ~ . . ... .
. . . .

WO 92/07961 PCI/US9t/07802 2~94832 Glu Pro Thr Thr Thr Gln Cys Phe Pro Ile Leu Hig Pro Pro Gly Ala Pro Ser Ala His Arg Pro Trp Gln Met Lys ABP Leu Gln Ala Ile Ly~ I
145 150 155 160 .~ .:

Gln Glu Val Ser Ser Ser Ala Leu Gly Ser Pro Gln Phe Met Gln Thr Leu Arg Leu Ala Val Gln Gln Phe Asp Pro Thr Ala Lys Asp Leu Gln A~p Leu Leu Gln Thr Leu Cy~ Ser Ser Leu Val Val Ser Leu His His Gln Gln Leu Asn Thr Leu Ile Thr Glu Ala Glu Thr Arg Gly Met Thr .~:

., .
GGC TAC AAC CCC ATG GCA GGG CCC CTA AGA ATG CAG GCT AAT AAC CCC 1526 :.
Gly Tyr A~n Pro Met Ala Gly Pro Leu Arg Met Gln Ala Asn Asn Pro ~ 225 230 235 240 ~
., GCC CAG CAA GGT CTT AGA CGG GAG TAC CAG AAT CTT TGG CTG GCT GCT 1574 ::
Ala Gln Gln Gly Leu Arg Arg Glu Thr Gln Asn Leu Trp Leu Ala Ala ~i TTC TCC ACC CTG CCA GGC AAT ACC CGT GAC CCC TCT TGG GCA GCT ATC 1622 Phe Ser Thr Leu Pro Gly Asn Thr Arg Asp Pro Ser Trp Ala Ala Ile 260 265 . 270 r` CTA CAG GGG CTG GAG GAA CCC TAT TGC GCG TTC GTA GAG CGC CTT AAC 1670 Leu Gln Gly Leu Gly Glu Pro Tyr Cys Ala Phe Val Glu Arg Leu Asn 'I 275 280 285 `'' GTG GCC CTT GAC AAC GGC CTC CCC GAG GGT ACC CCC AAA GAG CCC ATC 1718 Val Ala Leu A~p A~n Gly Leu Pro Glu Gly Thr Pro Lys Glu Pro Ile ~ TTA CGT TCC CTA GCG TAC TCA AAC GCC AAC AAA GAA TGC CAA AAA ATC 1766 .. Leu Arg Ser Leu Ala Tyr Ser Asn Ala Asn Lys Glu Cys Gln Lys Ile ~, 305 310 315 320 , TTA CAA GCC CGC GGA CAC ACT AAC AGC CCC CTT GGG GAG ATG CTC CGG 1814 :~ Leu Gln Ala Arg Gly His Thr Asn Ser Pro Leu Gly Glu Met Leu Arg ".~ ACA TGT CAG GCG TGG ACA CCC AAG GAC AAA ACC AAG GTC CTT GTG GTC 1862 ,~ Thr Cys Gln Ala Trp Thr Pro Lys Asp Lys Thr Lys Val Leu Val Val SUBSTITU~E SHEET
. .

~ 32 - 34 -340 34s 350 Gln Pro Arg Arg Pro Pro Pro Thr Gln Pro Cys Phe Arg Cys Gly Lys Val Gly His Trp Ser Arg Asp Cyq Thr Gln Pro Arg Pro Pro Pro Gly Pro Cyq Pro Leu Cya Gln Asp Pro Ser His Trp Lys Arg Asp Cys Pro 385 . 390 395 400 CAA CTC AAA CCC CCT CAG GAG GAA GGG GAA CCC CTC CTG TTG GAT CTC 20s4 Gln Leu Lys Pro Pro Gln Glu Glu Gly Glu Pro Leu Leu Leu Asp Leu Pro Ser Thr Ser Gly Thr Thr Glu Glu Lys Asn Ser Leu Arg Gly Glu Gly Lys Lys Leu Leu Lys Gly Gly Ile A~p Leu Ile Ser Pro His Pro Asp Gln Asp Ile Ser Ile Leu Pro Leu lo 15 20 ;: TCC CCC TGC GGC AGC AAC AGC AAC CAA TTC TAG GGG TCC GGA TCT CCG 2198 Ile Pro Leu Arg Gln Gln Gln Gln Pro Ile Leu Gly Val Arg Ile Ser ~ 2s 30 3s 40 His Arg Ser Val Met Gly Gln Thr Pro Gln Pro Thr Gln Ala Leu Leu Asp Thr Gly Arg Pro Tyr Gly Tyr Thr Pro Asp Thr Arg Ala Arg Ala Gly Lys Ala s lo 15 Ala Asp Leu Thr Val I le Pro Gln Thr Leu Val Pro Gly Pro Val Lys `-. 60 65 70 .
~ TCC ACG ACA CCC TGA TCC TAG GCG CCA GTG GGC AAA CCA ACA CCC AGT 2342 : Pro Arg His Pro Asp Pro Arg Arg Gln Trp Ala Asn Gln His Pro Val . 20 2s 30 3s ; Leu His Asp Thr Leu Ile Leu Gly Ala Ser Gly Gln Thr Asn Thr Gln ~:
7s 80 85 ; TCA AAC TCC TCC AAA CCC CCC TAC ACA TAT TCT TGC CCT TCC GAA GGT 2390 ~, ~ SUBSTITUTE SHEET :

`

.

WO 92/0796t PCI/US91/07802 ~
20~8~
- 35 - - .
Gln ~hr Pro Pro A~n Pro Pro Thr Hi~ Ile Leu Ala Leu Pro Lys Val Phe Lys Leu Leu Gln Thr Pro Leu His Ile Phe Leu Pro Phe Arg Arg Pro Arg Tyr Pro Phe Leu Leu Pro Leu Arg His Pro Gln Gln Met Asp Ser Pro Val Ile Leu Ser Ser Cy~ Leu Leu Asp Thr His Asn Lys Trp 105 110 lI5 12D

His His Trp Lys Gly Arg Pro Thr Thr Met Pro Gly Ala Ser Ile Pro Thr Ile Ile Gly Arg Asp Ala Leu Gln Gln Cys Gln Gly Leu Leu Tyr Pro Arg Arg pro Gln Pro Pro Pro Ile Ala Ala Asn Ser His Ser Lys : 85 90 95 Leu Pro A~p Asp Pro Ser Pro His Gln Leu Leu Pro Ile Ala Thr Pro ~40 145 150 . ACA CCA TAG GCC TCG AAC ACC TTC CCC CAC CTC CCC AAG TGG ACC AAT 2582 His Hi~ Arg Pro Arg Thr Pro Ser Pro Thr Ser Pro Ser Gly Pro Ile ', 100 105 110 A~n Thr Ile GLy Leu Glu Hi~ Leu Pro Pro Pro Pro Gln Val Asp Gln : TTC CTT TAA ACC TGA GCG CCT CCA GGC CTT AAA TGA CCT GGT CTC CAA 2630 Ser Phe Lys Pro Glu Arg Leu Gln Ala Leu Asn Asp Leu Val Ser Ly~

Phe Pro Leu Asn Leu Ser Ala Ser Arg Pro ~ 170 175 :

Ala Leu Glu Ala Gly His Ile Glu Pro Tyr Ser Gly Pro Gly Asn Asn . :~

Pro Val Phe Pro Val Lys Lys Pro Asn Gly Lys Trp Arg Phe Ile His ~'~ 150 155 160 : TGA CCT AAG AGC CAC CAA TGC CAT TAC TAC CAC CCT CAC CTC TCC TTC 2 774Asp Leu Arg Ala Thr Asn Ala Ile Thr Thr Thr Leu Thr Ser Pro Ser '~ 165 170 175 Pro Gly Pro Pro Asp Leu Thr Ser Lue Pro Thr Ala Leu Pro His Leu .::

, Gln Thr Ile Asp Leu Thr Asp Ala Phe Phe Gln Ile Pro Leu Pro Lys :-, ' ; SU~STITUTE SHEET
r ,, ' '~:: ' ' ~ . , :

. .

2~9~83æ

Gln Tyr Gln Pro Tyr Phe Ala Phe Thr Ile Pro Gln Pro Cys Asn Tyr Gly Pro Gly Thr Arg Tyr Ala Trp Thr Val Leu Pro Gln Gly Phe Lys AAA CAG CCC CAC CCT CTT CGA AC~ ACA ATT AGC AGC CGT CCT CAA CCC 3014 A~n Ser Pro Thr Leu Phe Glu Gln Gln Leu Ala Ala Val Leu A3n Pro Met Arg Lys Met Phe Pro Thr Ser Thr Ile Val Gln Tyr Met Asp Asp Ile Leu Leu Ala Ser Pro Thr Asn Glu Glu Leu Gln Gln Leu Ser Gln ,.~ . .

Leu Thr Leu Gln Ala Leu Thr Thr His Gly Leu Pro Ile Ser Gln Glu 295 30~ 305 ,, Lys Thr Gln Gln Thr Pro Gly Gln Ile Arg Phe Lue Gly Gln Val ~le . CTC CCC TAA TCA CAT TAC ATA TGA GAG TAC CCC TAC TAT TCC CAT AAA 3254 Ser Pro Asn His Ile Thr Tyr Glu Ser Thr Pro Thr Ile Pro Ile Lys ` 325 330 335 Ser Gln Trp Thr Leu Thr Glu Leu Gln Val Ile Leu Gly Glu Ile Gln :.:

,~ Trp Val Ser Lys Gly Thr Pro Ile Leu Arg Ly~ His Leu Gln Ser Leu : -; 355 360 365 370 i'; `

Tyr Ser Ala Leu Hi~ Gly Tyr Arg Asp Pro Arg Ala Cys Ile Thr Leu .

Thr Pro Gln Gln Leu His Ala Leu Hi~ Ala Ile Gln Gln Ala Leu Gln : .
390 395 400 ~.
.~ ACA TAA CTG CCG TGG CCG CCT CAA CCC CGC CCT ACC TCT CCT TGG CCT 3494 : His Asn Cys Arg Gly Arg Leu Asn Pro Ala Leu Pro Leu Leu Gly Leu ~ , ::
: SU{3STITUTESHE-~T
. ~ .

.. : . . -::. , -, ~ .. ,. . . . . - . , ... .. . `.. . `,~ ~ . .
. . . .
.. .~ . . .. .

WO 92/07961 PCT/~591/07802 - 2~9~832 Ile Ser Leu Ser Thr Ser Gly Thr Thr Ser Val Ile Phe Gln Pro Lys - GCA AAA TTG GCC CCT GGC TTG GCT CCA CAC CCC CCA CcC TCC GAC CAG 3590 Gln Asn Trp Pro Leu Ala Trp Leu His Thr Pro His Pro Pro Thr Ser - TTT ATG TCC TTG GGG TCA CCT ACT GGC CTG CAC CAT CTT ~AC TCT ~GA 3638Leu Cy5 Pro Trp Gly His Leu Leu Ala Cyq Thr Ile Leu Thr Leu Asp CAA ATA TAC CCT ACA ACA TTA TGG CCA GCT CTG CCA ATC TTT CCA CCA ~686 Lys Tyr Thr Leu Gln His Tyr Gly Gln Leu Cys Gln Ser Phe His His CAA CAT GTC AAA GCA AGC CCT TTG CGA CTT CCT GAG G~A C~C CCC TCA 37~4 Asn Met Ser Lys Gln Ala Leu Cy9 Asp Phe Leu Arg Asn Ser Pro Hiq Pro Ser ~al Gly Ile Leu Ile His His Met Gly Arg Phe His Ash Leu Gly Ser Gln Pro Ser Gly Pro Trp Lys Thr Leu Leu His Leu Pro Thr ,.~

Leu Leu Gln Glu Pro Arg Leu Leu Arg Pro Ile Phe Thr Leu Ser Pro : CGT CGT GCT TGA CAC GGC CCC CTG CCT TTT TTC CGA TGG CTC CCC TCA 3926 :: Val Val Leu Asp Thr Ala Pro Cys Leu Phe Ser Asp Gly Ser Pro Gln ., Lys Ala Ala Tyr Val Leu Trp Asp Gln Thr Ile Leu Gln Gln Asp Ile CAC TCC CCT GCC CTC TCA CGA AAC ACA TTC CGC ACA A~A GGG GGA GCT 4022:. Thr Pro Leu Pro Ser Hi~ Glu Thr His Ser Ala Gln Lys Gly Glu Leu Leu Ala Leu Ile Cys Gly Leu Arg Ala Ala Lys Pro Trp Pro Ser Leu Asn Ile Phe Leu Asp Ser Lys Tyr Leu Ile Lys Tyr Leu His Ser Leu ', 615 620 ~25 ~ SUBSTITUTE SHEET

. .
.. .. . . ,, .. : . ..
.
- ::
-.
.,'~ .

C~ a 3 ~ 8 3 ~ - 38 -Ala Ile Gly Ala Phe Leu Gly Thr Ser Ala His Gln Thr Leu Gln Ala Ala Leu Pro Pro Leu Leu Gln Gly Lys Thr Ile Tyr Leu Hi~ His Val Arg Ser His Thr Asn Leu Pro Asp Pro Ile Ser Thr Phe Asn Glu Tyr Thr Asp Ser Leu Ile Leu Ala Pro Leu Val Pro Leu Thr Pro Gln Gly Leu His Gly , Leu Thr His Cys Asn Gln Arg Ala Leu Val Ser Phe Gly Ala Thr Pro - Arq Glu Ala Lys Ser Leu Val Gln Thr Cys His Thr Cys Gln Thr Ile A0n Ser Gln His Hi~ Met Pro Arg Gly Tyr Ile Arg Arg Gly Leu Leu ., 730 735 740 ~` CCC AAC CAC ATA TGG CAA GGT GAT GTA ACC CAT TAT AAG TAC AAA AAA 4512 Pro Asn His Ile Trp Gln Gly Asp Val Thr His Tyr Lys Tyr Lys Lys Tyr Lys Tyr Cys Leu His Val Trp Val Asp Thr Phe Ser Gly Ala Val -., 760 765 770 . TCC GTC TCC TGT AAA AAG AAA GAA ACC AGC TGT GAG ACT ATC AGC GCC 4608 Ser Val Ser Cys Lys Lys Lys Glu Thr Ser Cys Glu Thr Ile Ser Ala ,~ GTT CTT CAG GCC ATT TCC CTC CTA GGG AAA CCA CTC CAC ATT ACC ACA 4656 Val Leu Gln Ala Ile Ser Leu Leu Gly Lys Pro Leu His Ile Asn Thr :~ 790 795 800 805 ., :

Asp Asn Gly Pro Ala Phe Leu Ser Gln Glu Phe Gln Glu Phe Cys Thr : -SlJ~S~ - Sh'~EJ

.

, .

W O 92/0796~ P~T/US91/07802 2~9~3~

Ser Tyr Arg Ile Lys His Ser Thr His Ile Pro Tyr Asn Pro ser Gly Leu Val Glu Arg Thr Asn Gly Val Ile Lys Asn Leu Leu Asn Leu Asn Lys Tyr Leu Leu Asp Cys Pro Asn Leu Pro Leu Asp Asn Ala Ile Hi3 Lys Ala Leu Trp Thr Leu Aan Gln Leu Asn Val Met Asn Pro Ser Gly Lys Thr Arg Trp Gln Ile Hig His Ser Pro Pro Leu Pro Pro Ile Pro 890 895 gO0 Glu Ala ~er Thr Pro Pro LyQ Pro Pro Pro Lys Trp Phe Tyr Tyr Ly~

Leu Pro Gly Leu Thr A~n Gln Arg Trp Lys Gly Pro Leu Gln Ser Leu 92~ 925 930 Gln Glu Ala Ala Gly Ala Ala Leu Leu Ser Ile Asp Gly Ser Pro Arg Trp Ile Pro Trp Arg Phe Leu Lyc Lys Ala Ala Cys Pro Arg Pro Asp 9S0 955 g60 965 Ala Ser Glu Leu Ala Glu His Ala Ala Thr Asp His Gln His His Gly Met Gly . .

A~n Val Phe Phe Leu Leu Leu Phe Ser Leu Thr Hi~ Phe Pro Leu Ala ~' CAG CAG AGC CGA TGC ACA CTC ACG ATT GGT ATC TCC TCC TAC CAC TCC 5281 . Gln Gln Ser Arg Cys Thr Leu Thr Ile Gly Ile Ser Ser Tyr His Ser Ser Pro Cy~ Ser Pro Thr Gln Pro Val Cys Thr Trp Asn Leu Asp Leu : SU8YITUTE SHEET

. . .
,; ~ - .. ~ ~ .

9~32 Asn ser Leu Thr Thr Asp Gln Arg ~eu His Pro Pro Cys Pro Asn Leu Ile Thr Tyr ser Gly Phe Hi5 Lys Thr Tyr Ser Leu Tyr Leu Phe Pro His Trp $1e Lys Lys Pro Asn Arg Gln Gly Leu Gly Tyr Tyr ser Pro 85 9~ 9~

Ser Tyr Asn Asp Pro Cy9 Ser Leu Gln Cys Pro Tyr Leu Gly Cys Gln Ala Trp Thr Ser Ala Tyr Thr Gly Pro Val Ser Ser Pro Ser Trp Lys Phe Hi~ Ser Asp Val Asn Phe Thr Gln Glu Val Ser Gln ~al Ser Leu 135 1~0 145 CGA CTA CAC TTC TCT AAG TG~ GGC TCC TCC ATG ACC CTC CTA GTA GAT 5665 :
Arg Leu ~is Phe Ser Lys Cys Gly Ser Ser Met Thr Leu Leu Val Asp : 150 155 160 .

Ala Pro Gly Tyr Asp Pro Leu Trp Phe Ile Thr Ser Glu Pro Thr Gln ;~ 165 170 175 Pro Pro Pro Thr Ser Pro Pro Leu Val Hi~ Asp Ser Asp Leu Glu His . GTC CTA ACC CCC TCC ACG TCC TGG ACG ACC AAA ATA CTC AAA TTT ATC 580g Val Leu Thr Pro Ser Thr Ser Trp Thr Thr Lys Ile Leu Lys Phe Ile ; CAG CTG ACC TTA CAG AGC ACC AAT TAC TCC TGC ATG GTT TGC GTG GAT 5857 Gln Leu Thr Leu Gln Ser Thr Asn Tyr Ser Cys Met Val Cys Val A~p Arg Ser Ser Leu Ser Ser Trp ~is Val Leu Tyr Thr Pro Asn Ile Ser Ile Pro Gln Gln Thr Ser Ser Art Thr Ile Leu Phe Pro Ser Leu Ala ,. .

S~JB~U, E S"~ T

. .. . . . - ~ :
. . . . . ...

. . ..

wo g2/07961 PCI/US91/078S~2 2 ~ 9 4 8 3 2 Leu Pro Ala Pro Pro Ser Gln Pro Phe Pro Trp Thr His Cys Tyr Gln Pro Arg Leu Gln Ala Ile Thr Thr Asp Asn Cys Asn Asn ser Ile Ile Leu Pro Pro Phe Ser Leu Ala Pro Val Pro Pro Pro Ala Thr Arg Arg 29g 300 305 Art Arg Ala Val Pro Ile Ala Val Trp L~u Val Ser Ala Leu ~la Ala Gly Thr Gly Ile Ala Gly Gly Val Thr Gly Ser Leu Ser Leu Ala Ser Ser Ly~ Ser Leu Leu Leu Glu Val Aqp Lys Asp Ile Ser His Leu Thr Gln Ala Ile Val Ly~ Asn Hi~ Gln Asn Ile Leu Arg Val Ala Gln Tyr :~
.' 355 360 365 370 :

Ala Ala Gln Asn Arg Arg Gly Leu Asp Leu Leu Phe Trp Glu Gln Gly . 375 380 3as :' GGT TTG TGC AAG GCC ATA CAG GAG CAA TGT TGC TTC CTC AAC ATC AGT 6385 Gly Leu Cys Lys Ala Ile Gln Glu Gln Cys Cy9 Phe Leu Asn Ile Ser ; AAC ACT CAT GTA TCC GTC CTC CAG GAA CGG CCC CCT CTT GAA AAA CGT 6433 : Asn Thr His Val Ser Val Leu Gln Glu Arg Pro Pro Leu Glu Lys Arg r 405 410 415 G$C ATC ACC GGC TGG GGA CTA AAC TGG GAT CTT GGA CTG TCC CAA TGG 6481 Val Ile Thr Gly Trp Gly Leu Asn Trp Asp Leu Gly Leu Ser Gln Trp Ala Arg Glu Ala Leu Gln Thr Gly Ile Thr Ile Leu Ala Leu Leu Leu . CTC GTC ATA TTG TTT GGC CCC TGT ATC CTC CGC CAA ATC CAG GCC CTT 6577 Leu Val Ile Leu Phe Gly Pro Cys Ile Leu Arg Gln Ile Gln Ala Leu ''~

~, .
: SUBSTITUTE Sh'EET

.... . . . .... .

- `li' '- ~ ` .

... .
'' W O 92/07961 PCT/US91/0~802 ' ~ 32 42 -Pro Gln Arg Leu Gln Asn Arg His Asn Gln Tyr 5er Leu Ile Asn Pro Glu Thr Met Leu Leu Gln Ser Cys Leu Leu Ser Ala His Phe Leu Gly Phe Gly Gln Ser Leu Leu Tyr Gly Tyr Pro Val Tyr Val Phe Gly Asp Cys Val Gln Ala Asp Trp Cys Pro Yal Ser Gly Gly Leu Cy5 ser Thr Arg Leu ~is Arg His Ala Leu Leu Ala Thr Cys Pro Glu His Gln Leu Thr Trp Asp Pro Ile Asp Gly Arg Val Val Ser Ser Pro Leu Gl~ Tyr Leu Ile Pro Arg Leu Pro Ser Phe Pro Thr Gln Arg Thr Ser Arg Thr Leu Lys Val Leu :
: ACC CCT CCC ACC ACT CCT GTC TCC CCC AAG GTT CCA CCT GCC TTC TTT 75~7 ~ SU~S~lTl~T~ T

.

.: .
.

W 0 92/07961 PCTtUS91/07802 2 ~

Thr Pro Pro ~hr ~hr Pro Val ser Pro Ly~ Val Pro Pro Ala Phe Phe 100 110 11~

Gln Ser Met Ar~ Ly~ His Thr Pro Tyr Arg Asn Gly Cys Leu Glu PrG

Thr Leu Gly A~p Gln Leu Pro Ser Leu Ala Phe Pro Glu Pro Gly Leu CGT CCC CAA AAC ATC TAC ACC ACC TGG GÇA AAA ACC GTA GTA TGC ~TA 7671 Arg Pro Gln Asn Ile Tyr Thr Thr Trp Gly Lys Thr Val Val cys Leu Tyr Leu Tyr Gln Leu Ser Pro Pro Met Thr Trp Pro Leu Ile Pro His ~70 175 180 Val Ile Phe Cys His Pro Ar~ Gln Leu Gly Ala Phe Leu Thr Ly~ Val ' Pro ~eu Ly~i Art Leu Glu Glu Leu Leu Tyr Lys Met Phe Leu His Thr Gly Thr Val Ile Val Leu Pro Glu A~p Asp Leu Pro Thr Thr Met Phe CAA CCC GTG AGG GCT CCC T&T ATC CAG ACT GCC TGG TGT ACA GGA CTT 7911 Gln Pro Val Arg Ala Pro Cys Ile Gln Thr Ala Trp Cys Thr Gly Leu Leu Pro Tyr His Ser Ile 1eu Thr Thr Pro Gly ~PU Ile Trp Thr Phe ' 2~0 255 2~0 ..
- AAT GAC GGC TCA CCA ATG ATT TCC &GC CCT TAC CCC AAA GCA GGG CAG 8007 Asn Asp Gly ser Pro met Ile Ser Gly Pro Tyr Pro Lys Ala Gly Gln Pro Ser Leu Val Val Gln Ser Ser Leu Leu Ile Phe Glu Lys Phe Glu . 280 285 290 "

Thr Lys Ala Phe His Pro Ser Tyr Leu Leu Ser His Gln Leu Ile Gln . Tyr Ser Ser Phe His Asn Leu His Leu Leu Phe Asp Glu Tyr Thr Asn ,:"' ~' : SUBSTITUTE SHE~T
, .. . . . . .
.
. ik " ~ , , ~ , , :~ . . : . ~ : ~ . : .
'.

., :

W O 92/07961 P(~r/US9~/07X02 2Ql~32 Ile Pro Val Ser Ile Leu Phe Asn Lys Glu Glu Ala A~p A~p Asn Gly Agp AACTGCTCCT CCCAAGGTAA GTCTCCTCTC AGGTCGAGCT CGGCTGCCCC TTAGGTAGTC 86~2 GCTCCCCGAG GGTCTTTAGA GACACCCG&G TTTCCGCCTG CGCTCGGCTA GACTCTGCCT 8742 TAAACTTCAC TTCCGCGTTC TTG~CTCGTT CTTTCCTCTT CGCCGTCACT GAAAACGAAA 8802 Gly Ly~ LYB Leu Leu Ly~ Gly Gly Asp Leu Ile Ser Pro His Pro A~p Gln Asp Ile Ser Ile Leu Pro Leu Ile Pro Leu Arg Gln Gln Gln Gln CCA ATT CTA GGG GTC CGG ATC TCC GTT ATG &GA CAA ACA CCT CAG CCT 9096 Pro Ile Leu Gly Val Arg Ile Ser Val Met Gly Gln Thr Pro &ln Pro Thr Gln Ala Leu Leu A9R Thr Gly Ala A~p Leu Thr Val Ile Pro Gln ' ' . :

- SUBSTlTU~E S~_E T

. ~

wo 92/n7961 PCl/US91/07802 2~g~83"

Thr Leu Val Pro Gly Pro Val Lys Leu Hi~ ABP Thr Leu Ile Leu Gly GCC AGT GGG CAA ACC ~AC ACC CAG TTC AAA CTC CTC CAA ACC CCC CTA 9240 Ala Ser Gly Gln Thr A~n Thr Gln Phe Lys Leu Leu Gln Thr Pro Leu His Ile Phe Leu Pro Phe Arg Arg Ser Pro Val Ile Leu Ser Ser Cys Leu Leu Asp Thr His A~n Lys Trp Thr Ile Ile Gly Arg Asp Ala Leu Gln Gln Cy~ Gln Gly Leu Leu Tyr Leu Pro Asp Asp Pro Ser Pro His Gln Leu Leu Pro Ile Ala Thr Pro Asn Thr Ile Gly ~eu Glu His Leu Pro Pro Pro Pro Gln Val A~p Gln Phe Pro Leu Asn ~eu Ser Ala Ser Ar~ Pro ,~
~.~
SlJBSTlTUTE SHEET

. ~ .
-~

.

Wo 92/07961 PCI/US91~07802 :
i~9~ 46 -(2~ INFORMATION FOR SEQU~NC~ ID~NTIFICATION NU~BER: 2 ~ (i) 8ÆQUENCE C~ARAC~5RISTICS: ..
(A) ~ENGT~: 505 ~B) TYPE: nucleic acid (C) SIRANDZDNESS: ~ingle (D) ~OpOLOa~ lineas (~) NAME: SEQ ID NO.: 2 (ii) S~QUENCE DESCRIPTION FOR S~QUENCE ID NUM3ER: 2 .

Tyr Tyr Ser Pro Ser Tyr Asn Asp Pro Cys Ser Leu Gln Cys Pro Tyr Leu Gly Cys Gln . 5 10 15 20 Ala Trp Thr Ser Ala Tyr ~hr Gly Pro Val Ser Ser Pro Ser Trp Lys . 30 35 .:
. TTT CAT TCA GAT GTA AAT TTC ACC CAG GAA GTC AGC CAA GTG TCC CTT 156 Phe His Ser Asp Val Asn Phe Thr Gln Glu Val Ser Gln Val Ser Leu :CGA CTA CAC TTC TCT AAG TGC GGC TCC TCC ATG ACC CTC CTA GTA GAT 204 : Arg Leu His Phe Ser Lys Cys Gly Ser Ser Met Thr Leu Leu Val Asp ; 55 60 65 ~:GCC CCT GGA TAT GAT CCT TTA TGG TTC ATC ACC TCA GAA CCC ACT CAG 252 -Ala Pro Gly Tyr Asp Pro Leu Trp Phe Ile Thr Ser Glu Pro Thr Gln Pro Pro Pro Thr Ser Pro Pro Leu Val His Asp Ser Asp Lau Glu His - 85 90 95 lOQ ., .

;~Val Leu Thr Pro SPr Thr Ser Trp Thr Thr Lys Ile Leu Lys Phe Ile ~,CAG CTG ACC TTA CAG AGC ACC AAT TAC TCC TGC ATG GTT TGC GTG GAT 396 'Gln Leu Thr Leu Gin Ser Thr Asn Tyr Ser Cys Met Val Cys Val Asp .:
,120 125 130 :;-.AGA TCC AGC CTC TCA TCC TGG CAT GTA CTC TAC ACC CCC AAC ATC TCC 444 i.. ~ Arg Ser Ser Leu Ser Ser Trp .His Val Leu Tyr Thr Pro Asn Ile Ser .

, SlJB~T~T~

W O 92/07961 2 ~ ~ 4 ~ 3 2 PC~r/US91/07802 Ile Pro Gln Gln Thr Ser Ser Art Thr Ile Leu Phe Pro Ser Leu Ala Leu Pro Ala Pro .

: . .
.. . .

!~,, '''`' SUBSTITUTE SHEET

.
, WO 92/07961 PCI /I]S91/07802 .
:
2~94~3' - 48 - ~.
(2) INFO~MATION FO~ S~QUENC~ ID~NTIFIC~TION NUMBER: 3 (i) SEQU~NC~ C8ARACTgRISTICS:
(A) LENGT~: 106 (B) 5YPE: nucleic acid (C) STRANDEDN~ss ~ingl~
~D) TOP0LOGY: linear (~) NAME: SEQ ID NO.: 3 (ii) SEQUENOE DESCRIFTION FOR 5EQU~NCE ID NUMBER: 3 ., .
.. CC ATC TGG TTC CTT AAT ACC GAA CCC AGC CAA CTG CCT CCC ACC GCC 48 Pro Ile Trp Phe Leu Asn Thr Glu Pro Ser Gln Leu Pro Pro Thr Ala . . .

Pro Pro Leu Leu Pro Hi~ Ser Asn Leu A~p His Ile Leu Glu Pro Ser : Ile Pro Trp Ly~
:~ 35 (2) INFOgMaTION FOR SEQU~NC~ IDENTIFICA~ION NUMBER: 4 (i) SEQUENCE C~AR~CTE~ISTICS: .,~
(A) IJ~NGTll: 2 8 (B~ TYPE: nucleic acid (C) STRANDEDNESS: ~ingle '`~ (D) ~OPOLOOY: linear (E) NAMæ: SEQ ID N0.: 4 ,., (ii) SEQUENCE DESCRIPTION FOR SEQUENCE ID NUM8E~: 4 :,. .

.. .
. ' .
.
~ :

;. .

., . .: .
SUE3STI~U I E S~-E~

. -: ' '' ' ' . :' ~ :

W O 92t07961 PC~r/US91/07802 2~4~32 (2) INFORNA~ION FOR SEQUENCE IDENTIFI QTION NUMBER: 5 (i) SEQU~NOE C~ARACTERISTICS:
(A) L~NOT~: 30 (B) TYPE nucleic acid (C) STRAND~DNFSS: ~ingle (D) TOPOLoay linear (E) NAME: SEQ ID NO.: 5 (ii) SEQUENCE DESCAIPTION F~R SEQUENCE ID NUMB~2: 5 k~

SUBSTITUTE SHEET

, . , . ~:

Claims (24)

Claims

1. A method for detecting in a biological sample an antibody to a virion of a human T-cell leukemia virus (HTLV) or to a cell infected with said HTLV, said method comprising providing an antigen encoded by HTLV-type II
(HTLV-II);
contacting a biological sample with said antigen, and detecting formation of an antigen-antibody complex by immunoassay.

2. A test kit for detecting in a biological sample an antibody to a virion of a human T-cell leukemia virus (HTLV) or a cell infected with said HTLV, said kit being compartmentalized to receive in close confinement therein one or more containers which comprise a first container containing an antigen encoded by HTLV type II (HTLV-II), and a second container containing a means for detecting the formation of an immunocomplex between said antibody and said antigen.

3. The method of claim l, wherein said antigen comprises the HTLV-II envelope protein or an antigenic segment or analog thereof.

4. The method of claim l or 3, wherein said human T-cell leukemia virus is human T-cell leukemia virus type II.

5. The method of claim 4, wherein said HTLV-II-encoded antigen comprises the carboxy-terminal half of the HTLV-II envelope protein.

6. The method of claim 5, wherein said HTLV-II-encoded antigen comprises HTLV-II RP-IIB or a segment or analog thereof which is reactive with RP-IIB antibodies.

7. The method of claim 6, wherein said HTLV-II-encoded antigen comprises HTLV-II RP-B2 oar a segment or analog thereof which is reactive with RP-B2 antibodies.

8. The method of claim l, wherein said human T-cell leukemia virus is human T-cell leukemia virus type I
and said antigen is reactive with antibodies to HTLV-I.

9. The method of claim l or 3, wherein said method further comprises contacting said biological sample with at least one antigen encoded by HTLV-type I.

10. The method of claim 8, wherein said antigen encoded by HTLV-I is an HTLV-I envelope segment or analog reactive with HTLV-I sera and not with HTLV-II sera.

11. The method of claim 10, wherein said antigen encoded by HTLV-I is RP-B1 or a segment or analog thereof which is reactive with RP-B1 antibodies.

12. The method of claim 8, wherein said antigen encoded by HTLV-II and said antigen encoded by HTLV-I are combined and contacted with said biological sample simultaneously.

13. The method of claim 8, wherein said antigen encoded by HTLV-II and antigen encoded by HTLV-I are maintained in separate containers and are contacted with the sample sequentially or with different aliquots of the sample.

14. The method of claim 1 or 3, wherein said immunoassay is a Western blot.

15. The method of claim 1 or 3, wherein said immunoassay is an ELISA.

16. A method for detecting in a biological sample an antibody to a virion of a human T-cell leukemia virus type I (HTLV-I) or to a cell infected with said HTLV-I, said method comprising providing HTLV-I recombinant protein RP-B1 or an antigenic segment or analog thereof;
contacting said biological sample with said RP-B1 or said antigenic segment or analog, and detecting formation of an antigen-antibody complex by immunoassay.

17. A test kit for detecting in a biological sample an antibody to human T-cell leukemia virus type I
(HTLV-I), said kit being compartmentalized to receive in close confinement therein one or more containers which comprise a first container containing HTLV-I recombinant protein RP-B1 or an antigenic segment thereof, and a second container containing a means for detecting the formation of an immunocomplex between said antibody and said antigen.

18. The method of claim 16, wherein said immunoassay is a Western blot.

19. The method of claim 16, wherein said immunoassay is an ELISA.

20. A peptide which is the RP-IIB peptide or a segment or analog, thereof, which is reactive with RP-IIB antibodies.

21. The peptide of claim 20, wherein said peptide is RP-B2 or a segment or analog, thereof, which is reactive with RP-B2 antibodies.

22. The peptide of claim 20, wherein said peptide is not reactive with antibodies specific for RP-B1.

23. Purified nucleic acid encoding the RB-IIB
peptide or a segment or analog, thereof, which is reactive with RP-IIB antibodies.

24. Purified nucleic acid encoding the RP-B2 peptide or a segment or analog, thereof, which is reactive with RP-B2 antibodies.