CA2093356A1 - Synthesis of oligonucleotides - Google Patents

Abstract

A method for the synthesis of a plurality of oligonucleotides in which an oligonucleotide is formed by sequential reactions of precursors of individual nucleotides on a support, comprising the steps of (a) forming a first oligonucleotide; (b) attaching to said first oligonucleotide a cleavable linker moiety; (c) forming a second oligonucleotide on the cleavable linker moiety; and (d) optionally cleaving the linker moiety to give the desired oligonucleotides. The invention also concerns nucleoside and non-nucleoside reagents suitable for incorporating cleavable linker moieties during automated oligonucleotide synthesis, cleavage of which produces oligonucleotides having a hydroxy or phosphate group at the 3' and 5' positions, and solid supports suitable for use in automated oligonucleotide synthesisers.

Description

~;;

W O 92/06103 PCTt~B91/0l687 2~333~

SYNTHESIS OF OLIGO~UCLEOTIDES

This invention relates to a method for the synthesis of oligonucleotides, to novel compounds ~hich may be used during operation of the method, and to a solid support suitable for use in an automated oligonucleotide synth~sisPr.
The availability of relatively low cost synthetic oligonucleotides has been of considerable importance in the develop~ent of modern molecular biology. The polymerase chain reaction (PCR) technique (described EP 201184-~) is an example of an important, recently developed, technique which relies upon the ready availability of synthetic oligonucleotide primers. Although the basis of this technique was originaIly described by Rleppe et al (J. Mol. Biol.
(1971), 56, 341-361), it did not assume its present importance until convenient sources of oligonucleotides became available. Th~re is a continuing need for rapid and efficient methods for preparing and pnri~ying oligonucleotide sequences.
Oligonucleotide sequences or derivatlves thereof are routinely synthesised for use as linkers, adaptors, building bloc~s for synthetic genes, synthetic regulatory sequences, probes, primers and other purposes and a number of methods have been developed for producins such sequences. These methods generally rely on the initial attachment of a first suitably protected nucleoside to a solid support by a cleavable linkage followed by sequential reactions of precursors of individual nucleotides to the growing oligonucleotide strand with each addition of a precursor involving a number of chemical reactions. ~t present the method ~ost generally employed for the production of a lone oligonucleotide is the method based on phosphoramidite chemistry. This is fully described by Caruthers et al in Tetrahedron Letters 1981, 22, (20~ pp 1859-62 and European Patent No. 61746 and additionally by ~oster et al in US Patent ~725677 (EP 152459) and by M.J. Gait ('Oligonucleotide Synthesis, a Practical Approach', IRL Press Ox~ord p35-81).

~UE35-, iTU ~ E S~EET

, ~ . , ~ ~ ........................ . .

.

~' ~,~.33;;~ 2 Several types of automated D~A synthesisers are now commercially a~ailable which enable oligonucleotides of good quality to be prepared using phosphoramidite chemistry in a reasonable amount of time - e.g. an oligonucleotide containing 30 nucleotides (a 30-mer) may be prepared routinely using a commercially available automated synthesiser in approximately 3 to 5 hours.
In response to the rapid increase in demand for oligonucleotides, improvements are desirable which will increase the throughput of such commercial synthesisers, i.e. increase the number of oligonucleotides synthesised per day.
An illustrative description of how a lone oligonucleotide may be formed by sequential reactions of precursors of the individual nucleotides on a support is provided in the protocol for the Applied 9iosystems DNA Synthesiser Model 380B, particularly Section 2 thereof, which is incorporated herein by reference thereto.
We have now developed a method for t:he production of oligonucleotides in which more than one oligo~1ucleotide can be synthesised on the same support in, e.g. a cos~mercial automated synthesiser, using a cleavable linker moiety introduced as required in the growing oligonucleotide chain.
According to a first aspect of the present invention we provide a method for the synthesis of a plurality of oligonucleotides in which an oligonucleotide is formed by sequential reactions of precursors of indiYidual nucleotides on a support, comprising the steps of (a) forming a first oligonucleotide; (b) attaching to said first oligonucleotide a cleavable linker moiety; (c) forming a second oligonucleotide on the cleavable linker moiety; and (d) cleaving the linker moiety to give the desired oligonucleotides.
As will be appreciated the first oligonucleotide is preferably formed on a support, which is p~eferably a solid support such as is used in automated oligonucleotide synthesis. The identity of the support is not critical and may be any of the supports used in the automated synthesis of oligonucleotides, for example, modified inorganic polymers such as those disclosed in the ~S Patent Specification 4,458.066, silica gels, Porasil C, kieselguhr PD~A, polystyrene, polyacrylamide, Silica ~U25, 1, 'JTE ~,~EE ~

"~ " :,, " ' -. : .., ... ,.; .
.

.
3 2~33~ ~

CPG (LCAA) or controlled pore glass as used in, for example, the Applied Biosystems DNA synthesiser ~odel 380B. The support can have a precursor of a first nucleotide cleavably attached to it, e.g. a solid support connected to an optionally protected nucleoside by means of a conventional cleavable link as described for example in the book by M.J. Gait.
T~e first oligonucleotide may be forned by conventional technology used for synthesisi~g oligonucleotides, for example by using phosphoramidite chemistry on an automated oligonucleotide synthesiser as described above. The first oligonucleotide is preferably co~nected to the support by a hydrolysable group (e.g. a base labile group) as is known in the art.
The cleavable linker moiety may be attached to the first oligonucleotide by means of a reagent, for example a modified nucleoside, or alternativelY a ~eagent which does not contain a nucleoside element, which is capable of co~necting to said first oligonucleotide and upon which a second oligonucleotide may be formed, and which can be broken to separate the first and second oligonucleotides under conditions which do not significantly affect the oligonucleotides.
~ y "Conditions which do not signifioantly affect the oligonucleotide" it is meant conditions which do not degrade the oligonucleotide. Examples of such conditions will be apparent to those skilled in the art, for example use of neutral or alkaline p~, for exa~ple p~ above 2, and conditions which are free from strong electrophilPs. Strong nucleophiles, and condition~ ~hich use os~ium tetroxide a~d othes known oligonucleotide ~odifying agents are preferably avoided.
The first aspect of the invention may be illustrated by the formation of 2 oligonuc~eotides using different combinations of the phosphoramidites of 2'-deoxyadenosine ~dA), 2'-deoxyyuanosine ~dG), 2'-deoxycytidine (dC), and 2'-deoxythymidine (dT) separated by the cleavable linker moiety L' built up sequentially in a 3' to 5' direction f~om the 3' hydroxy of ribose on a solid support according to the above SIUBSTITUT!E: S~E:ET

.
.;. :

., . ` , .. . .
. . ~ '; . . , `., , . , . `, ~ ~ 4 ~

method described by M.J. Gait. After synthesis the sequence attached to the solid support is:
3' d(ACTTL'AGCTA) (I) After cleavage of the linker moiety L' and the linkage by which the irst oligonucleotide is attached to the solid support two oligonucleotides result:
5' 3' 5' 3' d(ACTT) d(AGCTAj Thus two oligonucleotides have been synthesised on a single solid support.
Accordingly, a preferred first aspect of the present invention provides a method ~or the synthesis of a plurality of oligonucleotides comprising the steps of:
(a) orcing a first oligonucleotide on a first cleavable link attached to a solid support;
~b) attaching to the ~irst oligonucleotide a cleavable linker moiety;
(c) forming a second oligonucleotide on the cleavable linker moiety; and ~d) cleaving the first cleavable link and the cleavable linker ~oiety to give a plurality of oligonucleotides.
It is preferred that the cleavable linker moiety connects the first and second oligonucleotides by a 3' and a 5' oxygen, more preferably via a phosphate, phosphite, phosphate ester, phosphite ester or ~-phosphonate ester, one on each oligonucleotide.
~ he identity of the ~irst cleavable link is not believed to be critical, it is preferably base labile, and may be for example any of the cleavable links used in automated oligonucleotide synthesisers, such as a link which contains a base labile ester group.
As will be apparent organic residues of the cleaved linker moiety, such as hydrocarbon chains, may remain attached to the oligonucleotides after cleavage step (d). It is, however, preferable 8U~3SmUTE Sl IEET

, .. . .. .. .

" ,, ':",. ~:.
.. ..
,; . . : :., ~' ~

20933a~
s that after cleavage step (d) organic residues of the cleaved linker m~iety d~ not remain attached to the ~ligonucleotides t~ av~id aDy adverse affects on the properties o~ the oligonu;cLeotides which ~c~ -resi~ues can have The method of invention does not contain a gtep in which hybridisatio~ of the first or second oligonucleotide with a further oligonucleotide is attempted, ~or example by contact ~ith a solu~ion containing an oligonucleotide which may be complementary to the first or second oligonucleotide because this is unnecessary.
The first aspects of the inv~ntion include repetition of steps (b) and (c) any desired number of times, for example l to lO0 times, or preferably l to 5 times, to produce further oligonucleotides which are each connected through a cleavable linker moiety. As will be appreciated, when steps (b) and (c) are repeated the ~urther oligonucleotides are formed on the cleavable linker moiety attached to the previously formed oligonucleotide and may be the same as or dif~erent to the previously formed oligonucleotides.
The cleavable linker moieties may be cleaved, e.g. by base hydrolysis, to give a mixture of individual oligonucleotides which may, if required, be purified and separated.
It will be understood that in this specification the term "oligonucleotide" preferably includes an oligodeoxyribonucleotide, an oligoribonucleotide imd analogues thereof ~for example those which bear protecting groups), including those with methyl-phosphonate and phosphorothioate or phosphorodithioate diester backbones, and oligonucieotides with oligodeoxyribonucleotides, especially the 2'-oligodeoxyribonucleo~ides being more usually synthesised by the method of the invention. The preferred oligonucleotides are oligodeoxyribonucleotides, are essentially single stranded, and are preferably from at least two, more preferably at least 5, especially from lO to 200 bases long.
To users of DNA synthesisers the method of the invention gives the advantage of more effective use of thie apparatus and subsequently reducing the cost of production and purification of oligonucleotides.
~ he DNA synthesiser can produce two or more oligonucleotides ~which may be the same or different) on any one of its columns without ~UBSTiTUTE SHEET

.. .. .: ; , .. ... . . : ;,.. . , ., , . .... : . . . ;

;~; ~ , ~ . . . . . ..

`
~ 933~ 6 being re-progra~med between each oligonucleotide. Thus when synthesis of one oligonucleotide is completed at a time outside the working day the synthesiser can go on to produce another without any intervention by an operative. This can significantly increase the productivity of such apparatus.
The method of the invention is particularly useful for the synthesis of primers for the Polymerase Chain Reaction (PCR) technique.
At present a large proportion of oligonucleotides synthesised are for this purpose. Such primers are typically required in pairs and the method of the invention is convPnient since it allows production of oligonucleotides in pairs. This is particularly an advantage when using single column synthesisers and~or for heavily used facilities for out-of hours working.
It is preferred that the precursors of the individual nucleotides are nucleoside phosphoramidites which are protected at the 5' oxygen atom and are optionally base protected. ~ethods of protecting nucleoside bases are known in the art, for exa~ple by a protecting group which is removable by treatmer1t with mild acid or alkali. Adenine and cytosine may be protected by an optionally substituted N-benzoyl group and 5uanine by an N-isobutyryl group.
Thymine and uracil generally do ~ot require protection. Adenocsine and Guanine may also be protected by a dimethylfonnamide or phenoxyacetyl group, and cytosine by an isobutyryl group. The protecting groups are desirably removed after separation of the protected oligonucleotide from the support. Cleavage of the linker moiety may be effected before, during or after the removal of the protecting groups depending upon the chemistry employed. -It is preferred that the protecting groups are removable by treatment with aqueous base, particularly concentrated ammonia solution. In an embodiment of the invention the linker is cleavable under basic or alkaline conditions so that protecting group removal and cleavage of linker moieties can be effected in one step.
Typical basic conditions employed, are to mix th~ protected oligonucleotide with concentrated ammonia, or example at around 55 C
for up to 2~ hours, especially from about 5 to 24 hours. It is preferred that a linker moiety is chosen such that cleavage is comDleted under these conditions.

I

: . . .
. . .. :.:. :. ..
,.. -. ::
: : . ,.: :

,~ , 7 209337~ ~

Other bases, preferably volatile bases may be employed to effect cleavage. ~hese may conveniently be organic amines in water, for example piperidine or methylamine, preferably at a concentration from 20-70%.
As examples of precursors of individual nucleotides suitable for use in the method there may be mentioned the 2-cyanoethyl-N,N-diisopropylaminOphOsphOramidites of 5'-di~ethoxytrityl-N-4-benzoyl-2'-deoxycytidlne, 5'-dimethoxytrityl-N-2-isobutyryl-2'-deoxyguanosine, 5'-dimethoxytrityl-N-6-benzoyl-2'-deoxyadenosine, and 5'dimethoxytritylthy~idine.
For the synthesis of oligoribonucleotides precursors are for example the same as for oligodeoxyribonucleotides except that on the 2' position of the ribose there is a protected hydroxyl group, for example a tertiary butyl dimethyl silyloxy group or l-[(2-chloro-4-methyl) phenyl]~4-methoxy piperidin-4-yloxy group which is abbreviated to CTNæ, as described by T.S. Rao et al in Tet. Lett., 28, 4897 (1987~.
In a known application of oligonucleotides, i.e. as primers for PCR, it is uni~portant whether the 5' end of the oli~onucleotide bears a phosphate group or hydroxy group. ~owever, there is an increasing interest in the use of oligonucleotides having a 5' phosphate group (see e.g. ~iguchi ~ Ockman (l9~9), N1~cl. Acid Res. I7~l4), p5865).
~herefore a synthetic method that gives rise to an oiigonucleotide having a S' phosphate group is o~ value. A further advan~ageous use ~or oligonucleotides ha~ing a 5' phosphate group is in the chemical synthesis of genes where 5' phosphorylated oligonucleotides a~e desired.
Acoordingly the cleavable linker moiety used in the method of the invention preferably comprise either (I) a moiety whose cleavage gives rise to O~ groups at both the 5' and 3' ends of the desired oligonucleotides or tII) a moiety whose cleavage gives rise to a free 3' O~ group on one oligonucleotide and a 5' phosphate group on another oligonucleotide.
Thus, in a preferred aspect the method of the present invention step td) preferab7y yields desired oligonucleotides each having at the 3' and 5' position a group selected from hydroxy and phosphate.
8UBSl-5TUTE SHEET

,: , . . . . .

, . , . . ~ , , , ., , ~

" ~ .~ . ~
9~ 8 ~:.

i The reagents currently used to synthesise oligonucleotides include the protected nucleoside phosphoramidites. It would therefore be convenient if the cleavable linker moiety used in the present methods is attached by means of a modified nucleoside.
Accordingly the invention also provides a modified nucleoside reagent of general structure (II) which is capable of connecting to said first oligonucleotide and upon which a second oligonucleotide may be for,~ed:
Z-Nuc-L'-O-PA (II) wherein: , Nuc is a nucleoside in which the base optionally is protected;
Z is a protecting group attached to the 5' oxyyen of ~uc;
-O-PA is a phosphoramidite group, a phosphate ester group, a ~-phosphonate group or other group capable of conversion to a phosphodiester group: and ~, L' is a cleavable linker moiety, which is preferably a hydrolysable separating group atl:ached to the 3' oxygen of Nuc.
By the term "hydrolysable" it is meant that L' may be cleaved or split into two or more parts by treatment with base, for example with aqueous alkali, ammonium hydroxide or piperidine.
The modiied nucleoside of for~ula Z-Nuc-L ' -O-PA is preferably of Formula tIII):

4 ~ 1' ~J -' t L --O D
O - P A

SUæSTlTaJTE 51~:ET

. .. ~ . . -. , , ,, , ,; ,, : ; . " : :. .:
. . :
.
, . ,~

, 9 20933~6 wherein Z, L' and -O-PA are as hereinbefore described, B is an optionally protected base such as optionally protected uracil, thymine, cytosine, adenine or guanine, or analogues thereof, and D is or a protected hydroxyl group.
As examples of phosphate ester groups and ~-phosphonate groups these may be Mentioned groups which, in the ~ree acid form, are respectively of for~ula:

O O
--O--1--O~aad --O--P--OH
~Z3 wherein Z3 is a protecting group, preferably a base labile protecting group, for example 2-chlorophenyl or 2,4-dichlorophenylO
Preferably, -O-PA is a phosphoramidite of general structure:

~O--P S
o - R6 wherein R4 and R5 are each indepe~dently optionally substituted alkyl, especially C1 4-alkyl; optionally substituted aralkyl, especially optionally substituted ~enzyl; cycloalkyl and cycloalkylalkyl containing up to ten carbon ato~s, such as cyclopentyl or cyclohexyl; or R4 and R5 taken together with th~ nitrogen atom to which they are attached ~orm an optionally substituted pyrollidine or pipe~idine ring or R4 and R wnen taken together with the nitrogen atom to which they ~re attached rorm a saturated nitrogen heterocycle which optionaliy includes one or more additional hetero atom from the group consisting of nitrogen, oXygen anc sulphu.. ~4 and R; are preferably iso-propyl.

Sl_l5~T;Tu'~ r SlttET

", -, . : . :
. . . . . ..

,. . . ~

. --.
,~6 lo R6 represents a hydrogen atom or a protecting group, for example a phosphate protecting group. As examples of phosphate protecting groups there may be mentioned optionally substituted alkyl groups, for example methyl, 2-cyanoethyl, 2-chlorophenyl, 2,2,2-trihalo-l,l-dimethyl ethyl, 5-chloroquin-8-yl, 2-methylthioethyl and 2-phenylthioethyl groups in which the phenyl ri~g is optionally substituted, for exa~ple by a group selected from halogen, eg. chlorine, or ~2 Preferably R6 is methyl or, more preferably, 2-cyanoethyl.
Nuc in the structure II above represents the conventional nucleoside and deoxynucleosides (deoxy~cytidine, (deoxy)adenosine, ~deoxy)guanosine, (ribo)thymidine or (deoxy)uridine as well as analogues thereof. The base portion of the nucleoside optionally is protected by a protecting group. Thus, for example, the amine substituent in adenine, cytosine and guanine may be protected by any of the protecting groups used in the art (for example, as described in E Ohtsuka et al, Nucleic Acids Research, (1982), I0, 6553-6S70).
Noreover appropriate base protecting groups are apparent to nucleotide chemists and include particularly isobutyryl and optionally substituted benzoyl; the isobutyryl group being particularly appropriate as a protecting group for guanine and the optionally substituted benzoyl group being particularly appropriate as a protecting g~oup for cytosine and adenine. Nucleosides in which the base is protected include, for example, N -benzoylcytosine, N -benzoyladenine and N -isobutyrylguanine. It will be appreciated that not all bases will require protection, for example thymine and uracil.
Z in the above formulae represents a protecting group for the 5'-hydroxyl group of the nucleoside, especially an acid labile protecting group. Suitable protecting groups will be apparent to those skilled in the art and include those discussed in 'Protective Groups in Organic Synthesis' by T.W. Greene, Wiley Interscience.
Examples of such protecting groups include, tetrahydropyranyl e.g.
tetrahydropyran-2-yl, 4-methoxytetrahydropyranyl e.g. 4-methoxytetra-hydropyran-2-yl, methoxytrityl (preferably for oligoribonucleotide S'r~ T

. " .....
. . . .
.
,;; ,; ~ :

` 2~9335~ ~

synthesis only~, dimethoxytrityl, pixyl, isobutyloxycarbonyl, t-butyl dimethylsilyl and like protecting groups. Preferably, Z is dimethoxytrityl.
As will be understood when -O-PA is a ~-phosphonate or a phosphoramidite these are oxidised to respectively a phosphate diester or phosphate tri-ester groups during operation of the method, for example using aqueous iodine or peroxide. In the case of ~-phosphonate the oxidation is preferably performed after step (c) and before step (d), ~hilst in the case of phosphoramidite it is preferably performed during step (a) and step (c).
In a modified nucleoside reagent of Formula (II) h' pre~erably comprises or consists of three sections (i), (ii) and (iii) which have the structures discussed below.
Section (i) suitably comprises a group which upon cleavage, for example by hydrolysis, leads to the generation of a 3' hydroxyl group at the 3' terminus of the oligonucleotide to which it was previously attached. As examples of such groups there may be mentioned carbonyl, CON~ and imidate groups. Preferably section (i) is a carbonyl, co~a or -C(=N~2+)- group which combines with the oxygen atom of a 3' hydroxyl group of an oligonucleotide to give an hydrolysable moiety, especially a carboxylic acid ester moiety.
O
Preferably therefore section (i) is a -C- group.
Section (ii) can be any spacer group, preferably a spacer group compatible with automated oligonucleotide synthesis, for example a divalent organic spacer group or a hydrocarbon spacer group. Conveniently section (ii) is a divalen_ organic spacer group, for example of 2 to 15 atoms in length, pre~erably 2 to 6 atoms in length. The preferred divalent organic spacer group comprises or consists of one or more substituted or unsubstituted methylene groups optionally interrupted by other groups such as 1,2-,1,3-, or 1,4-phenylene, cyclohex-1,4-ylene, ~S-, -O-, -S02-, -N~CO~, -S-S-, -N-~ O-C-, -IC-O-, -C-N-, O O O O

UB.~,I`U.~S~ET

, . : ... .. - . ~ : , .
" ~

W O 92/06~03 PCT/GB91/01687 3~3~ ` :

The optional interruptions are introduced in order to facilitate synthesis of the reagent and/or to provide elements to reduce the possibility of the spacer group folding in on itself. A
particularly convenient method of extending from the 3' hydroxyl of an oligonucleotide is by reartion with succinic anhydride and accordingly a separating group in which section ~i) is -CO.- and section (ii) is or contains the group -tCH2)2CO.-O- is especially suitable.
Section (iii) may comprise a group capable of giving rise to beta-elimination of a phosphate ester group. This group can be of two types, ~ype A or Type B:
Type A is of the structure:

-Q2-C~Rl-CR2R3-where Q2 is a electron withdrawing group such as -SO2- and Rl, R2 and R3 are each independently ~ or a non-electron withdrawing group such as alkyl, especially Cl 4-alkyl, or a substit~ent that is not itsel~ a leaving group in a beta-eli~ination reaction and does not otherwise interfere when a phosphate ester group, introdu~ed by means of -O-PA, is eliminated. Alternatively, Rl may be an electron-withdrawing group.
Type B is of the general or~ula.

Ql ; -I -CR R3-- where Ql is an electron withdrawin~ group, for example -F, -CF3, -NO2, -phenyl, aryl (for exa~ple phenyl, substituted phenyl, or preferably p-nitrophenyl~, cyano, -SO3R (R-alkyl) and R2 and R3 are as defined above.
It is preferred that Rl, R2 and R3 are each independently ~ or Cl 4-alkyl, more preferably ~ or methyl, especially ~.

J''ST;~ T- S'JE~T - -"
' ~' .' ''~ .'; .
' ,.,. ' ' " :

.:

2Q9~

Alternatively section (iii) is a group of formula R -CR (OZ2)-CR R - or -CO.-O-CR R -CR R
wherein;
each R7 independently is ~ or Cl 4-alkyl;
one of R8 & Rg is a s:ingle bond and the other is ~ or Cl 4-alkyl;
Rlo ~ Rll are each independently ~ or Cl 4-alkyl or ~lO together with Rll and the carbon atoms to which they are attached form an optionally substituted 4,5,6 or 7 membered alicyclic or heterocyclic ring; and z2 is a protecting group, preferably a base labile protecting group.
It will be appreciated that the group (i) may be suficiently electronegative to serve as element Q2 in group (iii).
In such instances, the 3' oxygen of ~uc is attached directly to group (iii) and group (ii) is obviated.
~, The sections are preferably linked ~ogether in the order :~ (i), (ii), (iii) with (i) and (iii) being connected to nucleoside (~uc) and -O-PA respectively, as shown in structure ~III).
Preferably the cleavable linker moiet~ L' is of the fosmula:

`, .0 0 11 1~
-C-W-~I-(C~2)2-O

wherein W is a divalent organic spacer group as defined in Section (ii), especially C~2C~2-CO.OCH2CH2-.
It is preferred that h' is of formula (IV):

Il 11 11 1 1,~
-C-CH2-CH2-CFO-CH2-GH2-S-C-c-O H H

' " ' ' ' ' ' i., " ' ' .~' ' :: ', ' ,, W 0 92/06l03 PCT/GB91/01687 9~ 14 When the method according to the first aspect of theinvention has been performed~to give a plurality of oligonucleotides connected by a group or groups of formula (IV) treatment with base cleaves at the points marked with arrows on (IV) to give a plurality -of oligonucleotides, one of which is 5' phosphorylated.
The modified nucleoside is preferably of the formula (V):

Z-O~B o_PA

O `S=o (Y) O~ o~
o wherein Z, B and PA are as hereinbefore defined.
Compounds of Formula (II) or (III) wherein -O-PA is a phosphoramidite group may be prepared by reacting a compound of formula Z-Nuc-L'-O~ with a compound of formula X -PA in C~2Cl2 using diisopropylethylamine as base, wherein PA is a phosphoramidite as defined above for -O-PA except that -O- is absent, and X is a eaving group, for example Cl or Br.
When -O-PA in Formula (II) or ~III) is a phosphate ester group, the compound of Formula ~II) or ~III) may be prepared by reaction of a compound of formula Z-Nuc-L'-O~ with the triazolide of the corresponding free phosphate ester using a method analogous to that -described in the above book by M.J. Gait.
When -O-PA in Formula ~II) or ~III) is a ~-phosphonate group the compound of Formula ~II) or ~III) may be prepared by reaction of a compound of formula Z-Nuc-L'-O~ with PCl3 in the presence of 1,2,4-triazole using a method analogous to that described by B.C.
Froeher et al, i~ Nucleic Acids Research, ~1986), 14, 5399-5407.

~BSTITUTE SHEET

, .
, .

'',~
, ' ' ' ' ' W 0 92/06103 PCTtGB91/01687 i : , 15 20933~7~ ~:

The compound of the formula Z-Nuc-L'-O~ may be prepared in two steps by reaction of a compound of formula Z-Nuc-O~ with the anhydride of a suitable bifunctional carboxylic acid, for example succinic acid, followed by coupling of the acid derivative so produced with a suitable dihydroxy compound, for example 2,2'-sulfonyl diethanol. For this coupling of the carboxylic acid derivative with the dihydroxy compound, the carboxylic acid may be activated toward reaction with a hydroxyl group by methods known in the art, for example by ~n situ formation of the symmetrical anhydride by the condensation of two molecules of the carboxylic acid derivative vla the intercession of a coupling agent such as for example 1,3-dicylclohexyl carbodiimide. The reaction of the hydroxy compound with the activated carboxylic acid derivative may be performed in an aprotic solvent in the presence of one molar equivalent of base. The compound of formula Z-Nuc-L'-O~ so produced is preferably purified from the reaction mixture by some suitable means, for example chromatography.
The compound of formula Z-Nuc-O~ ma~ be prepared by reaction of a compound of formula ~O-Nuc-O~ with a compourld o~ formula Z-X (wherein X and Z are as defined above) preferably in an aprotic solvent in the presence of a molar equivalent of base. Preferably Z-X is a compound that reacts preferentially at only one of the two (or three if ~O-Nuc-O~
is a ribonucleoside) available hydroxyl groups. Preferably, Z-X
reacts selectively with the primary hydroxyl at the 5'- position of ~O--~uc--O~ .
A convenient modi~ied nucleoside is o formula ~VI):

OCH~

N

OC~I, o wherein B is as hereinbefore defined.

SU3S,T, I U, -- S'~,ET
. , . : ~.; . - `: " . i.

:,. ' . " ,` ` ' ~'' ', "; ' .` ',, ` : ' ~ .

WO 92/06103 PCI~/GB91/016~7 It will be appreciated that in the example of structure I, the cleavable linker moiety L' can be either introduced by means of a reagent (for example of structure II) which comprises a nucleoside that will become the 3' nucleotide of the second oligonucleotide or by means of a reagent that does not contain a nucleoside element. Ths modified nucleosides of general structure (II~ are of great value for introducing a cleavable linker moiety as described in the method of the invention.
~owever, five such nucleosides are required depending on whether the 3' nucleoside of a second desired nucleotide is A, G, T, C or U. For economy and convenience it would be desirable to have a single reagent, which does not contain a nucleoside element, which is capable of connecting the first and second oligonucleotides together and is compatible with phosphoramidite chemistry or other chemistry used in oligonucleotide synthesis, for example in DNA synthesisers, and is capable of being completely removed from the oligonucleotides, for example by treatment with ammonium hydroxide.
Accordingly the present invention provides a compound of Formula ~VII): .

Zl_o_~l_E_A2_0-pA (VII) wherein A and A are each independently of the formula (VIIa), ~VIIb), (VIIc) or (VIId~ wherein the carbon atom . marked with an asterisk is attached to the oxygen atom shown in formula (VII);

C' IES . . I '. ~ - S-~.T .

'' ' i . 1 ,, ' , WO 92/06~03 P~tGB91/01687 2~93356 17 :~

R R

Y I i a ) --~--C R g R O Z~
,~' ,~R2 Rl R7 c~c-a2-c ~R2 H ~-(V l l c ) -- t--C -R3 Ql ~t R 7 R 7 t) (Vl Id) --C--C ~)--C-- -.
z1 is a protecting group;
R1, R2, R3, ~1, Q~ and -O-PA are as hereinbefore defined;
each R7 independently is ~ or C1 4-alkyl;
one of R8 and Rg~is a single bond by means of which the group of formula (VIIa) is attached to E, and the-other is ~ or C1_4-alkyl;
Z is a protecting group, preferably a base labile protecting group;
R1o & R11 are each independently ~ or Cl 4-alkyl or R1o together with Rll and the carbon atoms to which they are attached form an optionally substituted 4, 5, 6 or 7 membered alicyclic or heterocyclic ring;

' ,~ J ~
SU~i; 'J ~ 'T ~ ~

W O 92/06103 PCT~GB91/01687 , _ ,, ~3~ 1~ :

E is a single covalent bond or a spacer group; and provided that when A and A are both of Formula (VIId) E is a spacer group.
The protecting group represented by Z is preferably an acid labile protecting group, more preferably an acid labile protecting group listed above for Z, especially dimethoxytrityl.
When Z is a base labile protecting group it is preferably selected from the base labile protecting groups disclosed in the abovementioned book by T.W. Green, especially a silyl group, for example t-butyl dimethylsilyl, or more preferably an acyl group such as a Cl 4-alkanoyl group or especially an optionally substituted benzoyl group which has been found, surprisingly, to result in particularly stable compounds of Formula (VII).
1' 2' R3~ R7~ R~ Rg~ Rlo and Rll is ~ or Cl 4-alkyl it is preferably methyl, more preferably H. Q2 is preferably -SO2-.
When E is a spacer group it is preferably a spacer group as hereinbefore defined in section (ii), more preferably an optionally substituted alkyl, alicycic or aryl group, especially phenylene or an alkyl group containing up to 6 carbon atoms.
The preferred alicyclic ring is a 5 or 6 membered ring, for example a cyclohexyl or cyclopentyl ring. The preferred heterocyclic ring is a 5 or 6 membered ring, for example furanyl or pyranyl ring.
When A and A are both of Formula (VIIa) it is preferred that E is a single covalent bond, -(C~2)m-, -CO.N~(C~2)m~-CO.-, -O-CO.-G-CO.-O- or -CO.-O-G-O-CO.- wherein G is -(C~2)m-, aryl, especially phenyl, or an alicyclic group such as cyclohexyl, cyclohexylmethylene or cyclopentyl, and each m independently has a value of from l to 6, preferably 2 to 6, especially 2.

~ . .

'' ~ ~IIBSTITUTE SHEET
, . . ..

, , ,, . . , ,. .:, .. ..... ... . .. . .. .

' ~ :

; . ~
19 2~933~

When A and A are both selected from Formula (VIIb) or (VIIc) it is preferred that E is of ~ormula -(CH2) - or -(CH2) -O-CO.-G-CO.-O-(C~2)m~ wherein m and G aze as hereinbefore defined.
When A and A are both of Formula (VIId) it is preferred that E
is of formula G as hereinbefore defined, especially -(C~z)2- or phenyl.
When A is of Formula (VIIa) and A is of Formula (VIIb) or (VIIc) it is preferred that E is of formula -(C~2) -, -G-CO.-O-(CH2) -or -G-O-CO.-(C~ ) - wherein m and G are as hereinbefore defined.
2~m When A is of Formula (VIIa) and A is of Formula (VIId) it is preferred that E is of formula -(C~2) -, -O.CO.-G- or -G-CO.-O G-wherein m and G are as hereinbefore d fined.
When A is of Formula (VIIb) or (VIIc) and A is of Formula (VIIa) it is preferred that E is of formula ~(C~2)m~, -(C~2) -O-CO.-G-or -(C~ ) -CO.-O-G- wherein m and G are as hereinbefore defined.
2 m ~ q When A is of Formula (VIIb) or (VIIc) and A is of Formula (VIId) it is preferred that E is of formula ~(C~2)m~ or -(C~2) -OCO.-G- wherein m and G are as hereinbefore defined.
When A is of Formula (VIId) and A is of Formula (VIIa) it is preferred that F is of formuIa -(C~2)m-, -G-O-CO. G- or -G-CO.-~-G-wherein m and G are as hereinbe~ore de~ined.
When A is o~ Formula (VIId) and A is of Formula (VIIb) or (VIIc) it is pre~erred that E is of for~ula -(C~2) - or -(C~2) -OCO.-G-or -(C~2) -CO.-O-(C~2j - wherein m and G are as hereinbefore defined.
It is preferred that A and A are each independently selected from Formula (VIIa), (VIIb) and ~VIId)- wherein ~he carbon atom marked with an asterisk is attached to the oxygen atom showD in Formula (VII).
As examples of groups represented by Formula (VIIa) there may be mentioned - CH~-C~tOZ2)-, - CH2-C(OZ2)-C~3, and -C~-C~(OZ )-C~3.
' .
.~ :

~;UE~SrlTUTE Sl~ T
. .

~.

, . . : ,, ~, : :;,,; :.. .
. .. :: .. .

W 0 92/06103 ~ PCT/GB91/01687 As examples of groups represented by Formula (VIIb) there may be mentioned -*CH2CH2-SO2-CH2- and C~C~3 2 2 2 As examples of groups represented by Formula (VIIc) there may be mentioned -*C~2C~F- and -*C~2C~.CF3-.
As examples of groups represented by Formula (VIId) there may be mentioned -~C~2C~2-OCO.- and -~C~(C~3)~2-OCO.-.
The compounds of formula (VII) are suitable reagents for attaGhing a cleavable linker moiety of formula -A -E-A - between a first and second oligonucleotide as described by the method of the invention.
~nder suitable conditions, for example treatment with ammonium hydroxide, the compounds cleave to give the desired oligonucleotides free from any organic residue of the compound of formula (VII~. This is of particular value where oligonucleotides are desired with free or phosphated 3' or 5' termini.
The utility of compounds of Formula (VlI) can be illustrated by reference to the preparation of the sequence oE Formula (I~ as discussed above. For example, when L in Formula (I) is derived from a compound of Formula (VII) in which A is of Formula ~VIIa) or (VIId) the oligonucleotide of formula dtAGCTA) results having a 5'-O~ group, and when A is of Formula ~VIIb) or (VIIc) d(AGC~A) results having a 5'-phosphate group. Accordingly, by appropriate selection of A in a ; compound of Formula ~VII) from (VIIa), (VIIb), (VIIc) and (VIId) the method of the invention provides the great benefit of enabling one to select whether the irst, second, and subsequent oligonucleotides prepared according to the method of the invention have a hydroxy group at the 3' position and ~ hydroxy or phosphate group at the S' position.
Compounds of Formula tVII) wherein -O-PA is a phosphoramidite may be prepared by reacting a compound of formula Z -O-A -E-A -O~ with a compound of formula X -PA in C~2Cl2 using di~N-isopropyl)ethylamine as base. PA is preferably a phosphoramidite as defined above for -O-PA
except that -O- is absent, and Z , A , E and A are as hereinbefore defined, and X is a leaving group, for example Cl or Br.
,~

~U~STITUTF SHEET

,: ` . ' .

.
., W O 92/06103 PCT~GB91/01687 21 2~33~f) When -O-PA in Formula (VII) is a phosphate ~ster group as hereinbefore defined the compound of Formula (VII) may be prepared by reaction of a compound of formula ~ -O-A ~E-A -O~ with the triazolide of the corresponding free phosphate ester using a method analogous to that described in the above book by M.J. Gait.
Wh~n -O-PA in Formula (VII~ is a ~-phosphonate group as hereinbefore defined the compound of Formula (VII~ may be prepared by reaction in a co~pound of formula Z -0-A -E-A -O~ with PCl3 in the presence of l,2,4-triazole using a method analogous to that described by B.C.Froehler et al, ~ucleic Acid Research, (1986), 14, 5399-5407.
~ he compound of formula Z -O-A -E-A -O~ may be prepared by deprotection of a compound of formula Z -O-A E-A -O-TBDNS, wherein ~BDNS is a t-butyldimethyl silyl group (which is removable using tetrabutyl ammonium fluoride in lY~) or other protecting group which is removable under neutral conditions.
When A or A is of formula (VIIa~ the compound of formula Z -O-A -E-A -O-~BDMS may be prepared by reaction of the compound of formula Z -O-A -E-A -O-TBDMS (wherein A is as; defined for A except that Z , when present, is ~ and A is as defined for A except that Z , when present, is ~) with a compound of formula Z -X wherein X
is a leaving group, for example Cl or Br (e.g. a Cl_4-alkanoyl halide such as acetyl chloride or propanoyl bromide, or an optionally subs~ituted benzoylhalide). The compound of formula Z -O-A -E-A -O-~BDMS may be prepared by reaction of Z -O-A -E-A -O~
with TBD~S-Cl. Z -O-A -~-A -0~ may be prepared by reaction of ~O-A -E-A -O~ with Z -Cl, preferably in an aprotic solvent and with l equivalent of base suGh as pyridine, and removing any Z -O-A -E-A -O-Z by a standard purification technique such as chromatography.
When A and A are each of formula (VIIb), (VIIc) or (VIId) the compound o4 formula Z -O-A -E-A -O~ may be prepared by reaction of a compound of formula Z -O-A -E-CO2~ with a compound of formula ~O A -O~, preferably in an aprotic solvent using a suitable condensing agent such as the aforementioned DCCI or 1-(3-Dimethylaminopropyl)-3-ethylcarbodiimide.

SUIBSTITUTE SHEET

.. . ..

W O 92/06103 ~ PCT/GB91/01687 C~ 22 The compound of~formula Z -O-A -E-CO2~ may be prepared by the reaction of the compound of formula Z -O-A -O~ with an activated form of the compound of formula ~O2C-E-CO2~, preferably an aprotic solvent in the presence of a molar equivalent of base. The dicarboxlic acid may be activated to attack by the hydroxyl group by being present as the acid anhydride, the acid chloride or some other suitable derivative, or the reaction may be mediated by the presence of a coupling agent as described above.
The compound o~ formula Z -O-A -O~ may be prepared by the reaction of the compound of formula HO-A -O~ with Z -Cl (or some other suitably activated form of Z ) in an anhydrous aprotic solvent in the presence of a molar equivalent of base.
In the above processes for the preparation of the compound of Formula tV~I), and precursors thereof, Z , A , E. A , O, PA and Z are as hereinbefore defined except where stated otherwise and DCCI is l,3-dicylohexylcarbodiimide.
According to a further aspect of th~ invention there is provided a compound comprising two or more olisonucleotides linked, preferably by 3' and S' oxygen atoms, by a group or groups containing a cleavable linker moiety of formula -A -E-A - or -h'- wherein A , E, and ~' and A are as hereinbefore defined. It is preferred that the cleavable linker moiety and formula -A -E-A - or -L'- is connected to each oligonucleotide via a ~-phosphonate, phosphate, phosphite, phosphate ester or phosphite ester linkage. It is preferred that one of the oligonucleotides is connected to a support.
~ -phosphonate linkages are of for~ula -~P(=O)-, preferred phosphate ester linkages are of formula -P(=O)-OR6.- and prefe~red phosphite linkages are of formula -P(-O~6) wherein R6 is as -hereinbefore defined.
One feature of most of the currently used methods for synthesising a los~e oligonucleotide on a support is that the synthesis starts with a commercially available support containing the first (the , . . .
;. , ~ ,. ;,;. - ., ;,; ., .. ;, . . . : ., .
. . ::, ' .... . . ... .. .
-; : , .. . .

:. , , : .i 23 2 ~ 5 ~

3') nucleoside already attached. This i5 primarily because of the need to provide a cleavable link between the lone oligonucleotide and the solid support. ~itherto this has prevented the use of protected nucleoside precursors as the sole means for introducing nucleotide elements into the oligonucleotide. There is a need for a method whereby oligonucleotides can be synthesised on a support without the use of a support with the first nucleoside already attached.
We have found that a compound of Formula (II~ or ~VII) may also be used to convert a support which does not have a first cleavable link attached to it to a support which does have a first cleavable link attarhed.
Accordingly, a further aspect of the present invention comprises a method for the preparation of solid support bearing a cleavable link by condensation of a solid support which does not bear a cleavable with a compound of For~ula ~II) or ~VII) as hereinbefore defined.
In this further aspect the solid support is preferably one of the conventional supports which has hydroxyl or amino groups, preferably hydroxyl groups, for exa~ple one of the afore~lentionéd solid supports used in automated oligonucleotide synthesis. Reaction with a reagent of Formula ~II) or ~VII) may be performed by analogous method to these which are known. Depending on the nature of -O-PA in the reagent tII) or ~VII), the cleavable link may be introduced by means of an automated nucleic acid synthesiser, in the same ma~ner as for the nucleotide precursors. In this aspect of the invention use of a reagent of Formula ~II) or ~VII) which does not contain a beta-elirlination moiety (eg, where A2 is of Formuia (VIIa) or ~VIId~ are preferred, since these do not give rise after cleavage to undesirable phosphorylation of the solid support. A convenient feature of the reagents which do not contain the beta-eli~ination group is that the hydroxyl group of hydroxyl containing supports is re-generated allowing the possibility of re-use of the support for the synthesis of further oligonucleotides.
A general advantage of this further aspect of the invention i5 the avoidance of purchasing or synthesising the support with the first nacleoside attached. This is especially advantageous for the ~ynthesis of oligonucleotides of non-conventional structure where the support containing the first attached nucleoside may not be readily obtainable.

.

s~
~ ~ 24 :

A still further aspect of the present invention provides a solid support, suitable for use in an:,~utomated oligonucleotide synthesiser, of Formula (VIII) or (IX~:

S~P-pl-L~_Nuc_z (VIII~
Sl~p_pl_A2_E_Al_o_zl tIX) wherein;
L', Nuc, Z, A , E, A and Z are as hereinbe~ore defined;
SUP is a solid support, preferably a solid support having hydroxy or amino groups suitable for use in an automated oligonucleotide synthesiser; and P is of the formula:

OR O O O

-O-P-O- , -O-P-O- , -O-P-O- or -O-P-O-; O OZ3 wherein;
~ R6 and Z3 are as hereinbefore defined.
`~ SUP is preferably one of the aforementioned solid supports used in automated oligonucleotide synthesis.
The invention is illustrated by the following non-limiting examples:
Exam~le 1 Preparation of rea~ent M --- 5'-0-(4,4'-dimethoxytrityl)-2'-deoxyth~midin-3'-yl 2-(2-[ ~-cvanoethox~)N,N-(diisoproplyamino)phosphanvloxv1ethyl-sulfony-l)ethyl succinate.
This was synthesised using the steps nu~bered l to 3 described below.
`

~'~,'-ST,-.U,~ S',._ET

.. . . ........ . . .. . .
, . : :.. ..

, ' , .
2a~33~ `

Reagent M is of formula (VI) wherein B is thymidinyl.
Step 1:
Pyridinium5'-0(4,4'-dimethoxytr tvl)-Z'-deoxythvmidin-3'-vl 2-pyridinium succinate.

OCH~

N H

pyridi~lu=

This compound was prepared by the method described by Gait et al in ~ucleic ~cids Research (1980), 8(5), 1090.
` Step 2:
, . .
ûCH~ ~
`'' ' g~ CH~NH

~0 C H ~ C i l ~ S C N ~ C l l o H

5'-0-(4,4'-dimethoxytrityl)-2'-deoxQthymidin-3'-yl 2-(2_hydroxyethyl-~ulfonvlLethyl succinate.
5'-0~4,4'-dimethoxytrityl)-2'-deoxythymidin-3'-yl 2-pyridinium succi~ate (3.0 9, 4.2 ~moles) was added to a solution of dicyclohexyl-carbodiimide (0.43 g, 2.1 mmoles) in dichloromethane (40 ; ml) under an atmosphere of argon. The reaction mixture was stirred at room temperature for 40 minutes and, after filtration, reduced to dryness under vacuum. The residue was dissolved in dry, distilled .

~:VE3STITUTE SHEET

. . .

~ ~ 26 pyridine (30 ml) and sulphonyldiethanol (0.38 g, 3.14 mmole dried by azeotropic distillation with toluene below 45 C ~caution explosion hazard) was added to the solution under an atmosphere of argon. The reaction mixture was stirred at room temperature overnight and then the solvent was removed under reducPd pressure. The crude product (2.7 g) was obtained as a pale yellow foam after the residue was azeotroped with dry toluene (2 x 30 ml). The product, (0.38 g, 0.5 mmole, 12.5%) was obtained as a white solid after chromatography on silica gel (Nerck Art ~o. 9385, 250 9~ with eluant of methanol:dichloromethane (3:47, 2000 ml).
nmr (delta) (CDCL3,400 N8z); 8.56 (l~,s,N8), 7.25 (9~,m, aromatic protons), 6.83 (4~,d, aromatic protons), 6.38 (l~,dd,~-1'), 5,46 (l~,m,~-3'), 4.58 ~2~,t,2~-9), 4.15 (l~,m,~-4'), 4.86 ~2~,t,2~-12 3.80 ~6~,s,2 x OC83), 3.47 ~4~,m,2~-10 and 2~-5'), 3.27 ~2~,t,2~-11), 2.90 (l~,t,0~), 2.68 (4~,s,2~-7 and 2~-8) 2.47 (2~,m,2~-2'), 1.38 r (3~,s,C~3).
Step 3:
5' 0-~4,4'-dimethoxytrityl~-2'-deox~thy~idin-3'-yl 2-~2-t~2-cvanoethoxY)N~N-(diisopr~pvlamino)phosphanvloxv]eth sulfonvl)ethvl_succinate ~ie, Reaqent M ).
5'-0-(4,4'~dimethoxytrityl)-2'-deoxythymidin-3-yl 2-(2-hydroxyethylsulfonyl)ethyl succinate (200 mgs, 0.26 mmoles) was added to a solution ~f N,N-diisopropylethylamine (1.0 mmoles, 0.13 9, 9.17 ml) in dry dichloromethane (5 mls). The stirred solution was maintained under an atmosphere of argon at room temperature and a solution of chloro-N,N-diisopropylamino-0-cya~oethylphosphine (0.26 mmoles, 61.5 mgs, 41 microlitres) in dichloromethane (1 ml) was added over a period of 10 minutes. After 60 minutes a further addition of chloro-~,~-diisoprop~lamino-0-cyanoethylphosphine (0.13 mmoles, 30.75 mgs, 20.5 microlitres) was made. The crude product was obtained by evaporation of the solvent under reduced pressure and the product was isolated as a colourless oil (45.3 mgs, 18%) from chromatography on silica gel (Merc~ Art ~lo 9385, 13g) with eluant of triethylamine:
ethylacetate:dichloromethane (4:3:3, 100 mls).

SUEISTITUTE SHEET
.

" , . ..
, W O 92/06103 PCTtGB91/01687 .i , 27 ~09335~

~ nmr (delta) (CDCL3, 400 M~z); 7.61 (lH,s,N~), 7.25 l9H,m, aromatic protons), 6.83 (4~,d, aromatic protons), 6.4 (l~,dd,H-1'), 5.48 (l~,m,~-3'), 4.58 (2~,t,~-9), 4.17 l~,m,~-4'), 4.08 (2~,m,2~-12), 3.82 (2~, complex m, 0C~2C~2CN), 3.6 (2~,m,2C~(C~3)2) 3.48 (4~,m,2~-5' and 2~-10~, 3.30 (2~, co~plex m, 2~-11), 2.68 ~6~,m,2~-7, 2~-8, CE2CN) 2.45 (2~,~,2~-2'), 1.36 (3~,s,C~3), 1.18 (12~,dd,2C~ (C~3)2).
Example 2 The product of Preparation 3 above was used as described below to introduce the cleavable }inker moiety L'in the synthesis of two oligonucleotides from one nucleoside bound to a solid support The fully protected oligodeoxyribonucleotides of sequence TCTAACAGCTGATCTL'CAGCTGATCC was prepared on an Applied Biosystems 380B
DNA Synthesiser from 5'-dimethoxytrityl-N-4-benzoyl-2'-deoxycytidine bound to controlled pore glass via 3' -0~ and a succinylglycylglycylamino-propyl spacer (Applied Biosystems Inc) and the 2-cyanoethyl-N,N-diisopropylaminophosphoramidites o~
5'-dimethoxytrityl-N-4-benzoyl-2'-deoxycytidine, 5'-dimethoxytrityl-N-2-isobutyryl-2'-deoxyguanosine, 5'-dimethoxytrityl-N-6-benzoyl-2'-deoxyadenosine, 5'dimethoxytritylthymidine (Cruachem Ltd? and 5'-0-(4,4'-dimethoxytrityl)-2'-deoxythymidin-3'-yl 2-(2-[(2-cyanoethoxy)N,N-(diisopropyiamino)phosphanyloxy~ethylsulfonyl) ethyl succinate (Reagent N ). In this example I.' i5 represented by the structure:

, . .
:, ' O ' O O
: I I I I I I .
C CH -CH -C-O-CH -CH2-S-CI12CH2- : .

.. . . ~ . : :: ,, , , ,,, .,: ,: .:., , 9~3~ 28 ' As will be understood, the 3' oxygen at the end of one oligonucleotide is attached;directly to the left hand side of 1' (as drawn) and the 5' oxygén at the end of the other oligonucleotide is attached to the right side of L' via the phosphite linkage -O-P(=0)~-Ol:~I2C~I2CN)--5'-0-(4,4'-dimethoxytrityl)-2'-deoxythymidin-3'-yl 2-(2-[(2-cyanoethoxy)N,~-~diisoproplyamino)phosphanyloxy]ethyl-sulfonyl)ethyl succinate (90 ~gs) in 1,2-dichloroethane:anhydrous acetonitrile (10:9, 0.95 ml 0.1 M) was used in place of a normal phosphoramidite at position 5 on our Applied Biosystems 380B DMA
Synthesiser to introduce reagent M which will introduce TL' in the r sequence above. The procedure consisted briefly of: (1) removal of the dimethoxytrityl group with 3~ trichloroacetic acid in dichloromethane;
(2) coupling of 5'-0-(4,4'-dimethoxytrityl)-2'- deoxythymidin-3'-yl 2-(2-1(2-cyanoethoxy)N,N-(diisopropylamino) phosphanyloxy]ethylsulfonyl) ethyl succinate (0.1 M solution in 1,2 dichloroethane:anhydrous acetonitrile, 10:9) activated by tetrazole for 1 minute; (3) iodine oxidation of the intermediate phosphite linkage to a phosphate linkage;
(4) a capping step with acetic anhydride.
The detritylated oligodeoxyribonucleotide sequence was cleaved from the solid support and also cleaved at the cleavable link moiety (1') and completely deprotected by treatment with ammonium hydroxide solution (sp.gr. 0.88) for 16h. at 55 C. The ammonium hydroxide solution was evaporated and the residue was dissolved in sterile water (1 ml). This product was analysed by hplc using a Partisil SAX 10 micron colu~n (Jones Chromatography) with eluant A, 60~ -for~amide and eluant B 0.3 M potassium dihydrogen orthophosphate in 60 formamide with a gradient of 0-85% eluant B in 30 minutes. The chromatography revealed the presence of three oligonucleotide sequences in approximately eq~ual amounts which eluted from the column after 10.5, 13.9 and 14.8 minutes. These products were identified by comparing their elution times with those of independently synthesised oligonucleotide sequences and were shown to be oligonucleotides of SlJE~STlTUTE SHEET

., , , ~ , ,: ', , , .

29 20933~

sequence: dCAGCTGATCC (elution time 10.5 minutes); - 5'-phosphorylated dCAGCTGATCC (elution time 13.9 minutes) and dTCTAACAGCTGATCT (elution time 14.8 minutes). The sequence eluting after 10.5 minutes was a result of a partial coupling reaction of reagent M to the oligonucleotide sequence CAGCTGATCC and termination of further chain extension by the capping procedure.
Example 3 The method of the invention was used in the synthesis of two oligodeoxyribonucleotide P.C.R. primers from one deoxynucleoside bound to a solid phase.
The fully protected oligodeoxyribonucleotide of sequence ~' .
5' 3' 5' 3' dCTATTCAAAATCGGAGCTCTAAGATL'TAGGGATTTGATTTTACGAGAGAGA
~;, .
was prepared on an Applied Biosystems 380A DNA Synthesiser from 5'-t4,4'-dimethoxytrityl)-N-6-benzoyl-2'-deoxyadenosine bound to a controlled pore glass support via 3'-O~ and a sucGinylglycylglycyl-aminopropyl spacer. The two P.C.~. primers were o~tained from identical reagents, synthesis procedures, cleavage and deprotection procedures to those described in Example 2, except that reagent M was introduced by treatment with two, 2.5 minute activations with tetrazole.
A~ter completion of the synthesis, cleavage from the solid support, cleavage of the cleavable linker moiety and removal of the base protecting groups were all achieved by incubation in ammonia solution, according to normal oligo synthesis protocols. The am~oniacal solution containing the pair of oligomers was then lyophilized, the residue was redissolved in 1 ml of water and the DNA concentration was determined spectrophotometrically. ~he mixture of oligodeoxynucleotides thus produced is referred to hereinafter as "primer mix 1".

.

.

~v~ 30 s~
, ' '~ ' ' Two other PCR primers were prepared individually by standard means to serve as a comparison ~or the ef~iciencies of the PCR's performed using primer mix 1. The sequences of the primers are:
: : .
Oligo 1: 5'-CTATTCAAA~TCGGAGCTCTAAGAT 3' Oligo 2: 5'-TAGGGATTTGATTTTACGAGAGAGA 3' Polymerase Chain Reaction assays were set up as follows:
In a total volu~e of 100 microlitres, each tube contained final concentrations of 50 mM RCl, 10 mM Tris.Cl ~p~ 9.0), 1.5 mM MgCl2, 0.01% gelatin (w/v), 0.1% Triton X-100. Each tube also contained a "
final concentration of 50 micromolar each of dATP, dGTP, dCTP, dTTP. In ~, .
each tube was contained 30 ng of Chlamydia trachomatis (Serovar ~2) genomic DNA and 2.5 units of Taq D~A polymerase. The amounts of PCR
primers in each tube were as follows: tube 1, 100 pmoles oligo 1, 100 pmoles oligo 2; tube 2, 75 pmoles oligo 1, lO0 pmoles oligo Z; tube 3, ,:
50 pmoles oligo 1, 100 pmoles oligo 2; tube 4, 25 pmoles oligo l, 100 pmoles oligo 2; tube 5, 10 pmoles oligo l, 100 pmoles oligo 2; tube 6, 100 pmoles primer mix 1; tube 7, 200 pmoles primer mix l.
- lO0 mi~rolitres of Nujol oil was placed on top of each solution and the tubes were incubated in a thermal cycler with the following heating proto~ol: 60 C for 1 minute, 72 C for 2 minutes, 94 C for 1 ~inute, and this cycle was repeated 40 times. 20 microlitres from each tube was mixed with 2 microlitres of 50% glycerol containing 0.1%
bromophenol blue, 0.1% xylene cyanol and this mixture was loaded onto a 1% agarose gel containin~ ethidium bromide (0.5 microgrammes/ml). Also included in the gel were O x 174 size markers. The presence of the expected 177 bp PCR product is cloarly visible in lanes 6 and 7, as well as in lanes 1-5, thus demonstrating that the PCR works using a pair of primers prepared according to the method of the invention.
Fiqure 1 Electrophoretic analysis of PCR products described above. Lanes 1-7 contain samples from tubes 1-7 described above, respectively. 1ane M, O x 174 size markers.

$~3~3Sr1TUTE SHFET
.

.. . . .

. . j....................... . . ~ . :"

2~93~6 EX~MPDE 4 Prep ra~ion o~ ReaRent ~2:
l-O-t4.4'-Di~etho~y~_itx12 -2,3-di-O-benzo~1-4- O-t2-cY~noethyl -N!N-di~ opro~ pho~hcroamidltothr _~ol.
Thi~ w~ aynth~ized u~ing the prsp~r~tions numbsred 1 to 5 dascribed below.
The ~truccure o~ re~gent ~2 i8 a~ ~ollow~:

t~2)2 DMT-O-C~2-CH~CH-CH2-0-P~
:~ O O N-C~(C~ j OC CO ~C~tC~3)2 wherein DMT is:
: OC~3 : ~, ., <~C-i', '' ~
OC~

Step 1~ Pre~nration o~ l-O-t4~4'-dime~hoxytri.tYl~ thr-itol.

I~lT-O-C~2 -C~-C}I-C~I2 -O~I
O~ OH

To ~ solu~ion o~ threitol ~Aldrich, 6.1~, 50 m~ol) in dry pyridi~c ~Aldrich, 200ml) at room te~p~r~ture w~ ~dd~d 4,4' dimethoxytrltyl chloride tCourt~uld~. 17g, 50 ~mol~ with stirring. When dis~olution Wd5 complete, 4-tN,N-dimethylAmino)pyridine ~Aldrich, 100~8) was ~dded. The aolution wae atirred ~t ~oo~ tempcrature overnight. Th2 solvent wa~
re~oved by ro~ry evaporation and reaidu~l pyridine w~ removed by repea~ed c-ev~poration with toluene ~BD~), Thc recidu~ was redi~olved in dichloromethane ~3D~), nnd wa~hed thr~e timea with an equal volume o~
s~tur~ted ~odium bic~rbonate ~olution (Aldrich). The organic solueion ~U"`''`,'T'J,~ S','.-~-.T
,. . .. .. . . .
~, . . .
~ . " , . .

: ,, . "~

W O 92/06103 ~ PCT/GB91/0l687 was dried by the ~ddition o~ snhydrou~ ~odium aulphnte tInterchem~ U~) ~nd ~iltered. The ~iltr~te w~ evaporaeed eo ~ gum, redis~olved in the ~inimum ~olume o~ dirhlorome~han~:meth~nol (19~ nd ~pplied to ~ -;
silica column (Merck 7734). ~lution with the ssm~ aolvent g~ve the title compound QB a colourle3~ gum (78. 33%)-H NMR: 8 (CDC13): 3.4-3.2, 2H, two doublo doublet3, CH O-D~T;
3.7-3.6, 2H, complex multiplet, CH ~H;
3.85-3.75, 8H, complex multiplet, ~x -OCH3 snd 2x C-H; 6.ô4-6.81, 4~, complex multiplet, ~rom~tics; 7.42-7.25, 9H, complex multiplet, srom~ticu.
.; .
Seep 2~ Prep2ration o~ 1-0-t4.4'-dimethoxy~_~tYl)-4-0-~eere.)- ;
butyldimethyl~ilyl ~hreitol.
.

CH CH C~ O ~i C(C~ ) 0~ 0~ C~3 To ~ uolueion o~ tho product ~rom seep 1), (~, 16.5 ~ol) in try pyridine tlOOml) wns added eert.butyl timethyl~ilyl chloride tAldrich, 2.7g, 18.15 mmol) with stirring, When di~solution w~ complete, 4-(N,N-dimeehyl~mino) pyridine tlOOmg) w~s ~det, and the solution was otirred at room temperAeUrC overnlght wh~n T~C in dichloromethune:
methanol tl9:1) sh~wod there to be no ae~eing maeerisl present. The uolven~ w~u cvapor eed under reducsd pre~sure, snd re~idu~l pyritine w~s rem~ved by repe~ed co-ev~poration with toluene. The se~idue w~
redi~olved in diGhloromeeh~no (300ml) ~nd ehi~ solution w~ w~hed ehree timea with ~n equ~l volum~ o~ sAtur~ed sodium bicarbon~te solution, dried (30dium ~ulph~te), ~iltered ~nd cvapor~tcd u~der reduced preo~ure eo ~ive a gum which ~3 dis~ol~ed in thc minimum volume o~
dichloromeehAne:meth~nol tl901) and applicd to a ~ilicA column. ~lution wieh the s~ma solvene 8~ve ~he titl~ oompound ~ ~ colourle~s ~um t6.58, 73Z).
NMR: o tCDC13~: -0.042, 6~, two uingloea, 2x CH -Si; 0.8, 9~, ~in~let, tC~3) -C-Si; 3.3-3.1, ~, two double doubleta, CH DMT; 3.7-3.55, 2H, two double doublees, CH2-0-Si; 3.8, 8H, complex muleiplet, 2x OC~3 ~nd ~x C-~; 6.B, 4H, complex multiplet, aromAt-cs; 7.3-7.1, 9H complex multiploe, ~rom~tic~.

C~JJ~ ~ i U I ~ ,T

.

:;, ' ' ` ~
': . . . ; ,; ,~ ; , 2~933~ ~

Step 3) Preparation o~ 1-0-(4,4'-dimethoxytr~yl) -2 3,-di-0-benzoyl -1-0 (tert.)bu~yldlme~hYlsil~l ~hreitol.

DMT-O--CH2--C~--CH--C~2 ~O~S i-C ( C~3 ) 3 . r , ! O~C C-~O
I I
Ph Ph To ~ solution o~ thc product ~rom the st¢p 2) t2.2g, 4.125~mol) in dry pyridine (lOOml) w~ ~dted benzoyl ehloride tAltrich~ 1.05ml, 9.075mmol) drop~iffc with stizrin~. The ~olution wa~ ~tiss~d ~t room temper~ture ~or 3 hour~, when T~C in dichlorumethQne ~howed thore to be no ~arting m~terial prqnen~. The ~olven~ wao removet by e~aporation under retuced pressure, ~nd residual pyridi~e w~ removed by repeQted co-eveporetion with toluene. The re~idue w~a redi~olved in dichlorometh~ne and thi~
~olution was w~hed with three equ~l volumes o~ ~turated ~odium bicn~bon~te solu~ion, driod t~odium ~ulphate), ~iltered ~nd ev~por~ted under reduced preo~ure to ~ ~um wh~ch w~ redi~solved in the mini~u~
volume o~ dichlorometh~ne and applied to a 8ilic~ column. Elueion with the ~eme ~olvent gav- ehe title compound ~ ~ white ~oam (2.78. 87.6%). -~
H NMR: 8 tCDCl ): 0.0- (-)0.1, 6H, multiplr sin~let~, 2x CH -Si;
3 0.~-O.S, 9H, mult~ple ~i~glets, tC~ )3-C-~i; 3.65, 3~, ~inglee, OC~3; 3.75, 3H, single~, OCH ;
4.1-3.85, 4H, co~plex multiplet, C~ -0-D~ and CH -0-Si; 5.7S-S.45, 2H, co~plex mu~tiplet; 2x C-H;

6.~5-6.5S, 2H, complex multiplet, aromatics;
6.~5-6.75, 2H, complex multiplet, arom~tic~;

7.3-7.05, 9H, complex mul~iplet9 eromatics;
7.6-7.35, 6X, complex multiplee, arom~icJ;
5.1-7.8, 4H, eomplex multiplet, ~rom~ic~.

. .
St~ ~ Prewr~tion o~ l-O-t4.4'-dimethoxYtsityl)-2 3~-_di-0-benzoYl threi~ol.
.. - ' D~T-0-CH -CH~CH-C~2-OH

O O
O~C C~O
Ph Ph SU ~ .~ _ S, i ~ _, :., ~, ,: , , : :~ . , , :: , ': : , . . . .
:, W 0 92/06 ~ ~ ~ PCT/GB91/01687 34 r The product ~rom ~ep 3) (2.7g, 3.6~mo}) wa~ tis~olv~d in a mixture o~
tetrahydro~urAn (Aldrich), pyridine and water (lOOml, 8:1:1 r~p~ctively) and a ~olution o~ tetrabutyl a~monium ~luoride in tetrahydro~uran (Aldrich, lM, 15ml) wa~ ~dded. The aolution w~s kept ~t room temperaturc ~or 3 day~ cnd eh~n evapor~ted under reduced pre~uure to an oil which W~8 redi~solved in lOOml o~ dichlorometh~ne. Thia ~olution wao washed ~our times with an squal volum~ o~ w~eer and once with an equal volume o~ aaturated sodium chloride ~olution, dried ~odium sulphate), ~iltered ~nd ev~por~ted under rcduccd pressure to a ~um. This WaD redi~olved in th~ minimum volume o~ dichlorom~than~:
mcehanol (19:1) and applied to a silica cnlu~n. ~lution with the s~me ;olvent g~ve the titlo compound a~ A white ~o~m (1.2g, 52.7Z).
NMR: ~ tCDC13): 3.6-3.35, 2X, complex multiplet, C~ -0~; 3.8-3.7, 6~, ~ultiple singl~t~, 2X OC~3; 4.5~-4.35, 2~, complex multiplet, C~2-0-DMT; 4.72-4.6, 1~, complex multiplet, C-H; S. 6-5.35, 1~ comple~ multiplet, C-H;
6.85-6.7, 4H, compl~x multiplet, ~romati~; 7.6-7.1, , complex multiplet, a~om~io~; 8.1-7.85, 4H, complex multiplet, aromatics.

Step 5~ PrePar~tion o~ Rea~ent M2 To a ~olution o~ th~ product ~rom 0sep 4) ~1.28, l.9mmol) in dry dichloromethane (50ml) w-a ~dd~d dry tby tistillation ~ro~ calcium hydride) dii30propyleehyl~ns tl.4ml, 25m~ol~ by nyri~ge tran~er under ~ream oS dry ~rgon (Air ~roducts). To thi3 stirred 301ution wa~ adted t~lso by ~yringe) 2-cyAnoethyl-N,N-dii~opropylamino chlosophosphine (Aldrioh, O.Slml, 2.3~ol), dropwise with ~tirring. The ~olution was stirred at room temp~r eure under a atre~m o~ dry ~r~on ~or 30 minute~
when T~C in tichlorometh~ne:trieehylEmine (19:1) showed thcre to be no st~r~in8 mceerial pre~ene. Dry meehanol (Sml) was added and the ~olution w~ dilutcd wlth 200ml o~ ethyl aceezte (BD~). Thi~ solution was wa~hed With thrce equal volume~ o$ ~atur~ted sodium chloride ~olution ~nd onc volume o~ w~eer. ~e org~nic layer w~ ~epar~ted, dried (~odium ~ulph~te), ~ilteret a~d evapor~ted to A ~um whieh wa~ dis~olved in ~he minimum volume oS diehloromethane: hexane: trie~hyl~mins (4Z:55:3) ~nd ~pplied to a 8ilic~ colu~n. Elution with the ~amG solvent ~ollowed by elution With dichloromcth~ne: triethyl~mine (19:1) gave the title co~pound ~a ~ colourle~ gum tO.68, 38%).
H ~MR: B ~CDCl ): 1.3-1.0, 14H, complex ~ultiplet, 2x (CH3) C~-;
3 2.S, 2~, pseudo triplct, C~2C~; 3.8-8.4, ~0~, co~plox multipl2t, 2x OC~ , C~ -O-DMT and C~2-0-P;
4.7-4.45, 3~, complex mul~iple~, CH~-O-P ~nd C-H;
5.8-5.5~, lH, complex ~ultipIet, C-~; 6.8-6.6, 4H, complex multiplet, ~rom~tiCs; 7.6-7.1, 15~, complex multiplet, cro~atics; 8.1-7.8, 4~, complex m~ltiplet, arom~tics.

S'~ SHEET

:- . , , , ,, ~ .. . . .
. . . , ~ .

WO 92/06203 PCI`/GB91tO1687 2~933~ ~

.
~XAMPL~ 5 An oligonucleotide W~B ~or~od on ~ ~olid suppore via ~ t (convention~l) cle~v~ble link uqing th~ protocol supplied with the Applied Bio~y~te~ 330B DNA ~ynthc~izer, u~ing th~
3~-t2-cy~noothyl-N~N4diisopropyl~inophosphorcmidite~ o~
5'-dimethoxytrityl-N2-benzoyl-2'd~oxycytidine, 5'-dimethoxytrityl-~ -i B obutyryl-2'd~o~ygu~nosine, 5'dimethoxy~rityl-N -benzoyl-2'-deoxyadenosine ~nd 5'-dime~hoxytritylthymidine ~Cru~chem) ~ the precursorn o~ the individusl nucleo~ideA. A cl~nvable linker ~oieey w~ ~ttached to the ~irst oligonucleotide by ~ean~ o~ reagent MZ. Rz~g~n~ ~2 ~aa tissolved in anhydrous ~c~tonitrile to ~ co~centra~ion o~ 0.1~, ~nd ~ bottle cont~inin~ thia ~olution w~a ~tt~ched to onc Or th~ ~p~re r~a~ent port~
on ehe DNA syn~h~ai~er. A colu~n coneaining Gontrolled pore ~la~
be~rin8 the 5'-prot~cted nucloo~ide (i~ this caso deoxy~deno3ine) connected by ~eAn~ o~ A 5convontion~1) cl~vable li~kqr succinylglycylglycyl~minopropyl ~Cruache~) w~ ~tt~ched to the ~ynthesiser. Th~ ~ynth~Hio-r w~e then progrAmmet to synthe~ise the ~ollowin~ ~equence:
~') CTATTCAAAATCGGAGCTCTAAGAT-L'-~AGGGA m GAT m ACGA ~3') ~whereby che cle~vable link~r moiety L' is i.ntroduced by me~n~ o~
re~8ent N2), using ~tand~rd aynthe~i~ cycle~ e~ployed on thc Appli~d Bio~yetem~ 3~0B DNA ~ynthe~izer. Th~ du~tion o~ the re~ction stops ~nd tho volume Or re~gent~ u~ed for coupling, oxidation, c~ppin~ ~nd detrityl~tion wer~ identic~l ~or ea~h coupling, including thae o~
re~en~ M2. The ~ynthe~iaer w~ progrsmmed t:o per~orm th~ convention~l concentr~eed ammenia w~h o~ th~ col = ~o rele~e the oligonucleotide~
into collectinn vi~
In thi~ manner the ~yntheai~er achieves the step~ o~ or~ng ~ ~irstoligo~u~leotide o~ ~oquonce (5'-3' ) TAGGGA m GATTT~ACGA
by ~ucce~ive reaetion Or the nucleo~ide precursors with connected to the con~rolled por~ gla~ ~uppors vla the 3'-0~ group ~nd a tconventionnl) ~ir~e cleavable link, b) attaching to the rirnt oliognucleotid~ ~
cleAv~ble link~r ~oiety by mean~ o~ rea8ent M:', and c) rormlng ~ ~econd oligonucl~otide WA8 ~or~ed on th~:cle~vable l:n~er ~olaty h~ving the ~aquence ~$'-3') CT~TCAAAATCGGAGCTAAGAT, to give two oligonucleo~ides sep~rAted by ~ cle~v~ble linker moieey ~nd bound to a ~olid ~upporc by cle~v~ble link, ~ illuYtr~ted by the ~or~ul~.:
S' 3' 5' 3' dtCTATTCAl~ rCGGAGCTCT M GAT)-L'-d(TAGGGATTTGATTTTACGA)-X-support wherein -L'- i~ a cle~v~ble linker o~ ~or~ul~
-C~ -C~tO-b~nzoyl)-CHtO-benzoyl)-CH -, ~ttached to the 5' and 3' oxygen of ~he ir~t and 6econd oligonucleo~ide~ respectiv~ly by ~ group o~
~or~ula -PtO)tOC~2C~ CN)-O-, ~nd X ic a ~ir~t cleavable lin~ cont~ined in the auccinyl2lycy~lycyl-a~inopropyl sp~cer. The ~ynthe~i~er alao SU~ST, . UT~- S'r'.,ET
: . . .
.~, . . .. ;

~. :
, W 0 92/06103 ~ ~ PCT/GB91/01687 9~ !

per~orm~ the cle~v~ge o~ the ~ir~t cleavable link X by the ammonia treatment a8 in step d) in the method o~ the invention.
The eluted oligonucleotide in the am~onia solution wa~ incubated ~t S5 C
~or 16 hour~ ~nd evapor~eed to dryne~s undor reduced pre~ure. The r~idue w~ redii~ol~ed in lml o~ w~ter, ~nd lOO~l o~ ~his ~olution were mixed with lOO~l o~ piperitine ~nd incubatad at 55 C ~or beewee~ 16 and 72 hour~.
In thia mann~r tho cl~av~ble link L' i~ cle~ved a8 de~cribed in at3p d)o~ tho meehod or tho invention.
Three o~her oli~onucleotides wese also synsheÆized by conventional procedure~ ~ desorlbed ~bove but omittin~ the treAtmcnt with piperidine. These were de~igned to represene control ~oleculc~ to be u~ed in the ~n~lysi~ o~ products ~onerated by the piporidine trectment ~bove. Thc~e oli~onucleotides h~d the ~ollowing ~equenco~:
1) ~5') CTATTCAAAATCGGAGCTCTMGATTAGGGATTTGATTTTACGA ~3') 2) ~5') C~ATTCAAAATCGGAGCTCTMGAT ~3') 3) (5') TAGGGA m GATTTTACGA ~3') Thus, oli~onucleotides 2) and 3) are o~ identical leDgth and ~equence to the product~ expected ~rom cleavage o~ the oli~onucleotide cont~ining ~he cle~v~ble link.
The pre~ence oX hydroxyl group~ ~t the 3' ant 5' end~ o~ the oligonucleotide~ BO produced w~s detesmined by the incorporation o~
radioactivs phosphorus ~t the~e po~itiona a~ d~acribed below.

Incor~oration o~ radiolebelled ~ho~Phate at the 5' e!nd o~
oligonucleotido~.
A~ter tre~t~ent o~ the oligonuclootides with e~ither concentrased a~monium hydroxide or 50% piperitine thc solut:ion~ were lyophili7ed and ehe oligonucleotid~ ~ore redi~ol~d in w~te~ to ~ conccntr~tion Or approxi~a~ely 1 mg/ml. One microlitre o~ thi~ solution wa~ then added ~o an Eppentor~ tube cont~ining w~r (6~ 0Y re~ction bu er ~"One Phor All", ~hArm~cis, l~l), [gamm~ P~ ~dcnoaine tripho~phate (A~er~ham, 1~1) and T4 Polynucleotite kina~o ~Ph~rm~ci~ his mixture w~
then incubated at 3~ C ~or on~ hour. Ethanol (30~1) W~8 adted, the content~ wcre mixed by rope~ecd inver~ion Or the tube, ~nd the ~mple wa~ incubated at -70 C ~or 15 minute~. ~he tube wa~ ~pun in an Eppendorr c~ntri~uge tModel 5415) ~t 14000 rpm ~or 15 minute~, ~nd the aupern~t~n~
was diacarded. The pellet w~e dried brle~ly in ~acuo nnd wa~ ret'~solved in l0~l o~ a ~olution cont~ining 80~ ~orm~mide, 0.1% bromophenol blue, O.1% xylene eyanol ~nd l0~M ~DTA. Thls aolution wa~ loaded into one o~
the wella Or ~ dcnaeuring polyaGrylamide gel (8% ~rrylamide, 50Z urea) adjacent to the ~ppropriate radiolabelled aize ~rker~, and the gel wa~
run at 40W rOr approxim~tely two houra. The locations and ~izes labelled DNA ~rag~ont~ ~ere de~ermined by autoradiography.
.

SlU13STITlJTE SHEET

- ., ~ ; :, ,.... , ., j . .

. . .

W O 92/06103 PCr/GB91/0l687 20~33~

The presence o~ ~ron~ bandc co-mi~r~ting with band~ tue to oligonucleotides o~ 25 residues t25 phoAphates) ~nd 19 residues ~19 phosphatea) indicnted that ~cis~ion o~ the cleavable link had occurred, thu~ generating the de~ired product~.
Incor~or~tion o~ r~diolabell~d pho~Phate ~t the 3'- ent o~
ol gonucleotide~.
One microlitre o~ th~ ~olution o~ oligonucleotide deocribed above wn~
added to an ~ppendor~ tube containing wat~ (5~1), 5x re~ction bu~er t"TdT Tailing ~u~er", BRL, 2~ alpha Pl 2'-deoxyad~no~ine triphosphate tAmersh~m, 1~ nd termin~l deoxynucl~otidyl trnnsfera~e (BR~ 1). Thi~ mixturc w~s then incub ted at 37 C ror one hour.
Ra~iolabelled D~A WA8 recovered by pr~cipi~ation ~rom cthanol and the~
~nAlyzed by denaturin~ gel electrophore~is exacely as deacribed ~bove ror 5'- end-lAbelled ~ragment~.
The presence o~ ~trong band~ co-migrating with band~ due to oligonucleotidea Or 26 recid~es (25 pho~phates) and 20 resiclue~ ~19 pho~ph~tes) indicatcd that sci~sion o~ the cl~v~ble link had occurred, thus ~enerating the desircd products.
The mixture o~ oli~onucleotidee produced in step (d) de~cribed above was analyzed by reverae-pha~c HPLC on a Waters ~Bondap~k C18 column using line~r gradient ~ro~ 0-30Z bufrer 9 in bu~er A over 45 minutes where bu~er A w~ 0.1~ triethylammonium acet~te (p~ 7.5) and bu~er B was 80%
ace~onitrile in 0.1~ eriethyl~onium ~cetate ~p~ 7.5).
A control oligonucleotide of 19 re~itues ~18 pho~ph~te~) had a retention time o~ 28 minutes, sn oligonuclcotide o~ 25 reaiducs t24 phosphates) had a retention tim2 0~ 31 minu~es ~nd an oligonucleotide o~ 44 re~-idues t43 phosphates) had a retention time o~ 34 minu~e~ under thQsc contition~.
Tho ~PLC pro~ile o~ the mixture o~ oli$onucleotides produced in ~tep (d) above ohowed pe2ks correnponding twithin experimen~al error) to the pre~e~ce o~ oligonucleotides o~ 19 and 25 re~iduea (18 and 24 phosphate~
respectively) ehu~ con~irming that ~ci~sion o~ the cleavable link had occurred 8ener~ti~g the desired products.

Preparation o~ re~Rent M3~ 0-(4.4'-di~ethoxytrityl)-1,2-dihydroxYethan -2-yl-1-tl,4-dicnrboxy~ butano~te-4-tl,2-dihYdrox~,r-2-~2-cy~noe~hl~l-N.N-diisopropylyho~phors~idite~ eeh n-l-yl c~tcr.
This w~u prepared using the pr2parntions nu~b-red 1 to 4 de~cribed below.
The structure o~ Rongent ~3 i~ a~ ~ollows:
O O OC~2CH2CN
D~ O CH CH -o-C-CH2CH2-t-o CH2C 2 ~N-CHtCH ) ~C~tC~3)2 S'.,~ ET

, . . . . .

, ~, ...
. ,-. . ... ..
.. .. .

w o 92/a6l03 ~ ~ PCT/~B91/01687 ~3~ ~-~,~

Step 1) PreParation o~ 1-0-~4,4'-dim o~ytrityl) -1,2-dihydroxyethane~

DMT-O-CH CH -OH

To a solution o~ 1,2-dihydroxye~hane (Aldrich, 6.2~, lOOmmol) in dry pyridine (200ml) wAa addcd 4,4'-dimothoxytrityl chloride (33.8g, lOO~ol) with ~tirring. When dia301ution wa8 complete, 4-(N,N-dimethyl~mino)pyridine t2oomg) wa~ ~ddet. The ~olution w~
~tirred ~ room t~perature overnight. Th~ ~olvent wa~ then removed under red~ced pr~aure ~nd re~idual pyridine wa~ re~oved by repeated co-evaporation with toluene. The residu~ wa~ redi~olv~d in dichloromeehane (300~1) ~nd wa~hed with three equ~l volume~ o~ ~aeurated ~odium bicarbonate solution. The orgAnic layer wa~ ~eparstcd9 dried ~sodium sulphate), ~ilt~red nnd evaporA~ed under reduced pr~as~re to gum which waa redissolved in dichloromethane: mechanol (19:1) and applied to a silica colu~n. Elution with the samQ oolvcnt gave the title compound ns ~ colourl-93 ~um (98, 25Z).
H NM~: 6 (CDC13): 3.3, 2H, pseudo triplet, CH -O-DM~; 3.8, 8H, multiplet, 2x OC~3 and CH20~; 6.~5-6.75, 4H, multipl~t, aro~n~lcs; 7.4-7.1, 9H, co~plex multiplet, ~ro~atic~.

SteP 2~ Prep~ration o~ l-O-C~,4'-dimethoxytritYl~-1.2-dihydroxyethan-O O
DNT-O-C~I2C~I2-0-C'-C~2C~I2-C-OII

The producs ~r~m ~tep 1) (9g, 24.7~molj ~n~ disoolved in dry pyridine (lOOml) ~nd ~uecinic nnh~dràde tAldrich, 2.728, 27.2mmol) w~ ~dd~d.
When dis~olu~ion wn~ complete, 4-~N,N-dimethylamino) pyridine (50~g) wa~
added and th~ aolution wa~ stirred at room te~perature overni~h~. The solvent wa~ evaporated undcr reduced pres~ure and re~idual pyridine wa~
removed by repeated co-cvaporation with toluene. The residus was diaoolved in diGhloromeehane t~OOml) and thi~ aolu~ion wa~ waDhed with three equal volumea o~ ice-cold lOZ ci~ric-acid cnd one volu~e o~ wA~er.-The or~anic layer wad separ~tcd, dried ~sodium au~phate)~ raltered and ev~porntet under reduced preaaure to n gu~ which wae redissolved in the manimum volume o~ dichlorome~hane: m~thanol (19:1) and applied to ~
silica colu~n. ~lu~ion with the ~a~e ~olvent gava the title compound aa a colousl~a~ gum (9g, 78.S%).

~UBSTITIJTE SHEET

., , , , , ., .. , .. :
. . ..

2~33~

H NMR: 8(CDC13): 2.7, 4H, singlet, 2x CH2CO; 3.25, 2H, triplet, CH~O-DMT; 3.~, 6H, ~in~let, 2x -~CH3; 4.25, 2~, complex multiplet, CH2OC0; 6.85-6.75, 4H, complex ~ultiplet, Arom~ticJ; 7.45-7.1, 9H, complex :~
multiplet, _ro~aticA.

Step 3) Pre~aration o~ 1-0-~4,4'-dimethoxYtrity~)-1.2-dihYdroxyeth~n ::
-2-ql -1-(1.4-dic~rboxy?butcno~te-4-(l.Z-dihYdroxY)ethcn-l-yl e~ter. ;~

O
D~T-o-c~2cH2-o-c-c~2c~2 C O C 2 2 The producs ~ro~ ~tep 2) (88, 17.24~ol) waa dia~olved in dry pyridine t200ml) cone~ining 1,2-dihy~roxyec~e t6.2g, lOO~mol). To this ~ulution W~8 ~dded 1-t3-dimoehylaminopropyl)-3-ethyl carbodiimide hyclrochloride Aldrich, 3.7S~, 19.5~ol). Th~ ~olution wa~ ~tirred ~t roo~ eemper~ture overnighe when ~C in dichlorometh~ne: math~nol tl9:1~ showed there to be no st~rtin~ m~ee~iAl pr~on~. The ~olve~ w~ re~oved unter reduced pre3surc ~nd residu~l pyridine *~8 r&moved by repested co-ev~por_tion wiéh toluene. The reaidue ~ reti~olved in ethyl acetAte ~nd w~hed ::
with three eq~al volu~eh o~ n~tur~ted 30dium chloride ~olution and one volume o~ weter. The org~nic l~yer w~3 ~p~r~ed, d~led (sodium sulph~te), rilteret ~nd sv~porated under reduced pre~ure to n ~um which w~ reti~olved in the mini~u~ volume o~ t~chlorometh~n~: ~eth~nol tl9~ nt ~pplied eo ~ 9ilicz column. Elution with the ~m~ ~olvent g~ve the eitle compound ~g ~ colourle~ gu~ t2g. 22.6%).
N~R: ~ tCDC13): 2.7, 4H, si~81ee~ 2x CH C0; 3.25, 2H, pseudo ~riplct, C~ -O-D~T; 3.~-3.79 8~?, complex multiplet, 2x -OC~ n~ C~20H; 4.3-4.2, 4H, complex multiplet, 2x C~ O~0; 6.85-6.75, 4~, co~plex multiple~, ~ro~io3; 7.4-7.1, 9~, cp~plex ~ult~plet, arom~tic~.

S ~ 4~ Propar2tion o~ Re gen~ ~3 The produ~t ~rom 3tep 3) t2g, 3.9m~ol) W~8 dissolved in dry dichlorome~hane t50~ nd th~ ~olution W~B stirred undcr a stre~m o~
try ~rgon. To thi~ ~olution wa~ ~dded dry dii~op~opyleehylamin~ t2.7ml.
16~mol) ~nd 2-Gyano~thyl-N,N~dii~opropylaminochlorophoaphi~ ~1.05ml, 4.72m~ol). The 001ution W~8 ~tirred at room te~peraeure under a ~tre~m o~ dry ~r~on ~or 30 minute~ when TLC i~ dichloro~eth~ne: me~hAnol tl9:1) ahowed there to b~ no ~t~rtinB mRteri~l pre~nt. The r~sction wao quench~d by addition o~ dry mo~hænol t5ml~ ~nd the 001u~ion W~B diluted with cthyl ~cetAte t200~1). Thi~ aolution W~6 w~shod with three cqu~l volumce o~ s~itur~ted ~odium chloride ~olution, ~nd one volumc o~ wæ~er.
The organic l~yer w~e ~epar~ted, driet t~odiu~ sulph~te), ~ilter~t ~nd ~'.JE~ E~T

, ,.. , . ,, i............... ,., ,.,: - , ..

. .. . ... .

W 0 92/0610~ PCT/~B91/01687 c~
C~9 3 " . ~

ev~por~cd under reduoed prc~ure to a gum which w~s redi~olved in ehe mini~N~ volume o~ dichloromethane:triethyl~min~ tl9:1) and ~pplied to ~ilic~ Golu~n. ~lueion with th~ a~mc ~olvent gnvo the title oo~pound ~8 A colourles~ gum (l.~g, 65~).
H NMR:6~CDC13): 1.25-1.1, 148, complçx multiplet, ~C83~ C~ x2; 2.6, 2~, triplet, C8zCN; 2.65, 48, ~in~12t, ~x C~2CO;
3.25, 2H, triplet, CH -O-DMT; 3.7-3.5, 4H complex ~ul~iplot, 2x -CH -O~; 3.8, 6~, ~inglct, 2x -OC8~;
4.25, 4H, p~udo ~riplet, 2x CH2OCO; 6.~S-6.75, 4~, Gomplcx ~ultiplet, aromatic~; 7.4-7.15, 9H, co~plex multiplet, ~romatic~.
EXAMPL~ 7:
The method o~ ~x~mpl~ 5) ~a~ rQpe~ted to syntheui~ twu oli~odeoxyribonucleotide~ bound to ~ ~olid 3upport except th~t rea~ent M3 w~ u~ed, di~solv~d in ~nhydrou~ ~cctonitrilo to ~ conscntration o~
0.15M, in pl~ce o~ re~8ent M2.
The ewo oli~onucleotidee bound to a ~olid support by ~ cl~v~ble link fire illu~trat~d by the Sor~ula given in Lx~mple 5, ~tep c, wherein L' i~
cle~vable linker moieey o~ ~ormul~:
-C~2~ oCoc~2c~2cooc~c8i The twc oligonucleotitc~ ~ound a~ter ~tep td) ~era ~n~ly0ed a~ de~cribed in ~xa~ple 5 nnd Sound to be identical by ~lectrophor~3is ~nt ~P~C to tho~e dc0cri~d in Rx~mple 5, d~onstsati~E~ ~ca~ion o~ the cl~av~ble link.

~XANPL8 B:
~ ,.
1-0-(414'-DilaethoxYtr~t~ l 2-dihYdroxyeth~n-2-yl -1-(2-[~2 oy~noeehox~}-N.N-~dil~oproeylnm~no~Pho~phanx~-x~]

~hi~ w~ 0ynthesi~ed u~in6 eh~ prepnr~tion~ nu~b~red 1 to 2 describod b~low.
The ~tructur~ o~ Rsagent M4 i~ ~8 ~ollow~:

,o, o o ~OC~I2C}~2CN
DMT O-C~ CH -o-c-c~2c~2-c-o-c~2c~2 S, ~ 2 2 ~N-CHtC~3) ~C~tC~3)2 ......... . .. .

~: , : . . . . . . .

W O 92/06~03 PCT/GB91/01687 2 0 ~ 6 .
_____e hyl~ul~on~l~ethYl_3uccinate.

O O O
2C~2 O C-C~2C~2-C-O-CH2C~2-S-C~ C~ -OH

To ~ ~olution o~ l-O-t4,4'-dimethoxytrityl) -1,2- dihydroxye~hnn -2-yl -1~(1,4-dicarboxy)butAno~te prepared ~ de~cribed in ex~ple 6.2 above tl.74~) in dichloromeeh~n~ ~20ml) was ~dded 1,3-N,N-diGyelohexylc~rbodiim~de ~383~g, 0.5meq) And the mixture w~e ~irred at room ~e~p~rature ~or 45 ~inutes. DicyclohexylureA WA~
~iltered Or~ and w~h~d with dichlorom~th~ne ~4ml). The ~iltrate ~nd : washi~g~ ~cre oombined And ev~pora~ed under reduccd pro~ure to ~ yellow oil which wa~ redi~olved in dry pyridin2 ~lSml). To thi~ wa~ ~tded ~ulphonyldicthan~l tl.S4g, 2.7mc~; pr~p~red by soluen~ azeotropic dohydr~ion or 6S% aqu~ou~ matcrial ~upplied by Al~ri h) in dry pyridine ~5ml). The ~olution wa~ ~tisred at room ee~peraeure ~or 23 houra ~nd e~aporsted under reduced pr~urc. Re~idual pyridine w~ removet by rcpeatcd co-evdporation with tolu~ne. Th~ residusl oil was r~di~olved in dichloromcthane:methanol ~19:1) and applied to ~ 8ilic~ colu~n.
Elueion wieh the s~me solvene gsve the title compound 9 a yellow 81 ~S43mg, 48.4%) ~ NNR: ~ tCDCl ~: 2.7, 4~, co~plex ~ult~plet, 2x C~2COO; 3.22, 3~, p~udo triplet, C~ -O-DMS 4nd -0~; 3.3, 2~, triplct, C~20X; 3.43, 2~, triplet, C~2SO ; 3276, 6~, singlee, 2x -OC~ ; 4.03, 2~, triple~, C~2S02;
4.27, 2H, trip~et, C~20CO; 4.53, 2~, triple~, C~20CO, 6.8, 4H, multiplet, ~romatics; 7.3, 9~, complex multiplet, arom~tic~.

The product ~rom ~tep 1) tO.54g, O.9~ol) W~8 di~solved in dry dichloromethane t50ml) ~nd thc ~olution wa~ sti~red under d stre~m o~
dry argon. To this ~olution w~ ~dded dry dii~opropylethylamine tO.61ml, 3.6~ol) ~nd 2-cyanoethyl-N,N-dii~opropyln~inochlorophosphine (0.24ml, l.O~ol). Th~ ~olution w~ ~tisred nt room temper~ture under a ~tre~
oS dry ~rgon ror 30 minute~ when T~C in dichloro~ethAne: ~e~h~nol ~19:1) nho~ed these to b~ no ~rting m~teri~l prcs~n~. Th~ reaction wa~
~uenchcd by ~ddi~ion Or dry meth~nol t5ml) ~nd the oolution w~ diluced with ethyl ~coe~t~ t200ml). Th~ solution wa~ waahcd ~$~h three equal volumes oS s~tu~ted ~odium chlo.ride~olution, ~nd onc volumo o~ wAtcr.
2hc org~nic l~yer wno 3zp~rnted, dried ~ootium sulphntc), ~iltcrcd and ev~por~ed under r~duoed prc~aure to a gum which ~ redi~oolYed in thc minimum volume o4 dichloromethane:triethyl~mine tl9:1) ~nd applied to ~llicn colu~. ~lution with the ~amc solvene g~vo the title co~pound es colourle~ gum tO.4~8, 66.6%).

~B~T~TU~E SH

: . .- .. . ::,.. . . ..

: ' " : ,, ,:: ' :' :

WO 92/06103 PCI`/GB91/01687 ~ , ....
~933~a 1~ NMR: 6 (CDCl ): 1.31-1.17, 14~, multiplet, tCH3) C~ x2; Z.74-2.58, 6H, complex mul~iplet, 2x -C~ C00 ~nd C~CN; 3.33 3.2~, 2~, CX2-OD~T;
3.45, 2~, multiplet, C~ S0 ; ~.65-3.51, ~, complex multiplet, 2x -C~ OP; 3.81, 6~, aingl2t,22x OCH3; 4.15-4.05, 2~, multiplet, C~2S02;
4.2~, 2H, paeudo triplet, CH20C0, 6.84-6.80, 4H, multiple~, ~romatics;
7.45-7.14, 9H, co~plex muleiplet~ nrom~tics.

~! , The me~hod of ~xample S w~ rop85tet to ~ynthe~i~e two oligonucleo~ides bound to ~ aolid s~ppor~, except th~t rea8ent M4 was dissolved in Anhydrou~ ac~toni~rile eo ~ concentr~tion o~ 0.15M ~nd w~ uscd in place o~ r~agent ~2.
Th~ two olizon~cl~otide~ bound ~o ~ Aolld ~upport by ~ cle~v~ble link ~re illuatr~ted by the ~ormNla giv~n in ~xRmple S, ~tep c, wheroin L' is a cle~vable linker moiety o~ ror~ul~:
-C~2CH20CoC~2cH2c~0~2c~2s02c~2~ 2 The two oligonucleotide~ ~ound a~ter ~tep (d) were ~n~lys~t ~ described in ex~mple 5 And ~ound eo be id~ntic~l to tho~e described in ~x~mple 5, demon~tratin~ ~ci~aion o~ eho cleAv~ble link.
EXAMPL~ 10 Prep~rs~ion Or r dii~opropylphoaphora~idlee~ eth~n=l-yl ~eer.
Thi~ wns synthe~izcd uaing the pr-paration~ numb~red 1 to 3 described bolow.
The atructure of rc~gent Mg ia ~a ~ollowll:

DNT-o-c}I2c~2-o-c~o ~ OOX2C~I2CN

~(C~39 2 .; . .
Step 1) Pre~araeion Or 1l4-bia-(1-0-L4.4'-di~ethoxytrit~ 1,2-dihydrox ~ .

O O
DM~r O C~I2C 2 4~c-o-cx2cx2-o-DMT

~U~;~T' ~'~T_ '~'rEET

; .. . ~ . . . . .

. . . .

20933~6 To ~ ~tirred solu~ion o~ 1-0-(4,4'-dimeehoxytrityl)-1,2-dihydroxyethane (prepared a~ de~cribed in examplc 6, ~tPp 1 above) (ca lOe, 27mmol) in dry pyridine (70ml) was added ~olid terophth~lic chloride (1.83g, 9 mmole) ~nd 4-N,N-dimethyl minopyridine (50mg). The ~uspe~aion was ~irred nt room temperature overnight a~ter which mose o~ thc ~olid material w~a obaerved to have dissolved. The ~olvent wa8 then removed under reduced pre~ure. The re~idue w~s redi0001ved in dichloromethane (200ml) and wsehed with three equal volume~ o~ ~aturased ~odium bicarbonate ~olution. The or~anic layer was separated, dried (~odium sulphate), ~iltered and evapornted under reduced preosure. Re~ainin~
pyridin~ wa~ removed by co-evsporAtion with toluene to give a gum which w~ redi~olved in dichlorom~thane: methanol (19:1) and applied to a ~ilic~ column. Elution with the ~ame ~olvent gave the title compound colourles~ gu~ (2.74g, 35%).
H NMR: 8 tCDC13): 3.43, 4H, triplee, 2x -C~2-OD~T; 3.79-3.77, 12~, two ~ingleta, 4x -OC~3; 4.52, 4H, triplet, 2x -CX20CO; 6.a3-6.76, 8H, cs~plex mult~plet, ~romatics; 7.49-7.13, 18H, co~plex multiplet, aromstic~; 8.19, 4H, singlet, ~rom4sics.

Step ~ ration o~ 1-0-(4~ _methox~trit~1) -1.2-dihydrox~ethan -2 yl -1-(1,4-dicarboxyl_enzo~te-4-(1.3-dihYdr xy¦ethan-1-yl e3ter.

D~-o-c~c:l2-o-8~c --C~2C~-I!

Th~ product ~ro~ etep 1 (2.7g, 3.5mmol) wa~ di~colved in dry dichlorom~th~ne (50ml) and a ~olution o~ trichloro~cetic acit in dichloromethane (Cruachem, 37. TCA, 76ml) wa~ adted. The aolu~ion was ~tirred at room temperature when TLC ~howed there ~o be ~ mi~ture o~
product~ preaent. The ~olution wa~ waahsd with ~Aturated ~odium bic~rbonate aolution (4x200ml), drict (eodium eulphate), ~iltered ~nd e~sporated to ~n oil which ~a~ redi~olved in dichlorometh~ne : methanol ~19~ d Appliet to a dilica column. ~l~tion with ehe 8a~0 ~olvent g~ve 300 me of a compound which ra~ more 810wly than the ~tarting ~ateri~l on T~C. ~Fusth~r treatment o~ a aample of thi0 matcrial with TCA convereed it into a ~ore pol~r ~ateri31 with concomit~nt rormation o~ n deep orange colour, thu~ indica~ing the preoance o~ a dimethoxytrityl group). Thio product we~ u~ed in th~ next ~tep wi~hout ~urther characteriz~tion.
StcP 3) PreP~rat-lon Or Rea~ent M5.
The product ~rom ~tep 2 tO.3g, 0.54~ol) w~e di~ol~ed in dry dichlorometh~ne ~50ml) ~nd the ~olution wa~ stirred under a ~tream o~
dry ~rgon. To thi~ ~olution wa~ addet dry tii~opropylethyl~mine ~0..37ml, 2.16mmol) and 2-cyanoethyl-N,N-dii~opropyl~minochloropho~phine (0.15ml, 0.65mmol). Thc ~olution W~8 ~tirred ~t room temper~ture under a Ti ~ UT. S'r.~ET

;
..

wos2/06103 ,. ~ pcr/GB9l/ol687 ,~33 stre~ o~ dry argon ~or 30 minutea when TLC in dichloromethane: methanol tl9:1) ~how~d there ~o be no ~tartin8 ~tzrial pre~en~. Tho reaction wa8 quenched by addition o~ dry ~eth~nol (5ml) and the aolution wa~ diluted with ethyl aceC~te (200ml). Thi~ ~olution wa~ wn~hed with three equ~l volu~ec o~ ~aturated ~odiu~ chloride ~olution, and on~ volumn o~ water.
The organic leyer WaQ separated, dried (sodiu~ ~ulphate), filtered ~nd ev~porated under reduced pres~ure to a ~um which waa redi~olved in the ~inimu~ volu~e o~ dichloromethnne:triethylamino (19:1) ~nd applied to a ~ilica column. Elution with the c~me 801vent gave the title compound colourle~ gum (0.37~, 90%).
H NMR: 6 tCDC13): 1.26-1.15, 14~, complex multiplet, tC~ ) C~ x2;
2.6, 2X, triplet, C~2CN; 3.45, 2~, triplet, C~2-ODMT; 3.72~ 2, 4~, co~plex multiplet, 2x -GX2-OP; 3.79, 6H, ~inglet, 2x -OC~3; 4. S2, 4X, eriple~, 2x -CH2-OCO; 6.a, 4H, ~ultiplet, arom~tic~; 7.49-7.19, 9H, complex ~ultiplot, aro~tic~; 8.16, 4H, Ainglet, aro~tic~.
EXAMPLE 11.
The method o~ ~x~mple 5 was repo~eed to Gynthe~i~e two oligodeoxyribonucleoeide~ bound to a solid aupport, except that in place o~ rea~ent M2 there w~n uced a 0.13M ~olution o~ re~gent M5 in anhydrou3 ecetonitrile.
The two oligonucleotide~ bound to ~ ~olid aupport by a cle~vable link ~se illu~trated by che ~or~ula given in Exa~ple 5, step c, wherein L' i3 le~vable linker ~oie~y o~ ~or~ul~:
-C~2C~20CI~tC6~4)cooc~2c~2 The two oliKonucleotidc~ ~ound a~ter step ~d) were ~n~lysed a8 described in ~xa~ple 5 ~nd round to be identical to tho~o described in ~a~ple 5, demon~rating ccission o~ the cleav~ble link.

Sr~T
.. ..... . . ..

. : : - ,. ; . . . -, . . .: : . . . ,:
, . j , . . ..
,; "-,. . . . . .
.
..:

Claims (18)

Claims

1. A method for the synthesis of a plurality of oligonucleotides in which an oligonucleotide is formed by sequential reactions of precursors of individual nucleotides on a support, comprising the steps of (a) forming a first oligonucleotide; (b) attaching to said first oligonucleotide a cleavable linker moiety; (c) forming a second oligonucleotide on the cleavable linker moiety; and (d) cleaving the linker moiety to give the desired oligonucleotides.

2. A method according to Claim 1 wherein the cleavable linker moiety is attached to the first oligonucleotide by means of a reagent which is capable of connecting to said first oligonucleotide and upon which a second oligonucleotide may be formed, and which can be broken to separate the first and second oligonucleotides under conditions which do not significantly affect the oligonucleotides.

3. A method for the synthesis of a plurality of oligonucleotides comprising the steps of:
(a) forming a first oligonucleotide on a first cleavable link attached to a solid support;
(b) attaching to the first oligonucleotide a cleavable linker moiety, (c) forming a second oligonucleotide on the cleavable linker moiety; and (d) cleaving the first cleavable link and the cleavable linker moiety to give a plurality of oligonucleotides.

4. A method according to Claim 1 or Claim 3 wherein after step (d) has been performed, organic residues of the cleaved linker moiety do not remain attached to the oligonucleotides.

5. A method according to Claim 1 or Claim 3 which does not contain a step in which hybridisation of the first or second oligonucleotide with a further oligonucleotide is attempted.

6. A method according to Claim 1 or Claim 3 wherein cleavage of the cleavable linker moiety results in a plurality of oligonucleotides each having at the 3' and 5' position a group selected from hydroxy and phosphate.

7. A method according to Claim 1 or Claim 3 wherein the cleavable linker moiety is attached by means of a modified nucleoside.

8. A method according to Claim 1 or Claim 3 wherein steps (b) and (c) are repeated from l to 100 times.

9. A modified nucleoside of Formula II:
Z-Nuc-L'-O-PA (II) wherein:
Nuc is a nucleoside in which the base optionally is protected;
Z is a protecting group attached to the 5' oxygen of Nuc:
-O-PA is a phosphoramidite group, a phosphate ester group, a H-phosphonate group or other group capable of conversion to a phosphodiester group; and L' is a cleavable linker moiety.

10. A modified nucleoside of the Formula (III):

(III) wherein;
Z, L' and -O-PA are as defined in Claim 9;
B is an optionally protected base; and D is H or a protected hydroxyl group.

11. A modified nucleoside according to Claim 9 or Claim 10 wherein L' is of formula:
-(i)-(ii)-(iii)-wherein;
(i) is carbonyl, -CONH- or -C(=NH2+)-;
(ii) is a spacer group; and (iii) is a group capable of giving rise to beta-elimination of a phosphate ester group, or a group of formula R9-CR7(OZ2)-CR7R8- or -CO.-O-CR7R11-CR7R10-.
wherein;
each R7 independently is H or C1-4-alkyl;
one of R8 & R9 is a single bond and the other is H or C1-4-alkyl;
R10 & R11 are each independently H or C1-4-alkyl or R10 together with R11 and the carbon atoms to which they are attached form an optionally substituted 4,5,6 or 7 membered alicyclic or heterocyclic ring; and z2 is a protecting group.

12. A modified nucleoside according to Claim 9 or Claim 10 wherein L' is of the formula:

wherein W is a divalent organic spacer group.

13. A compound of Formula (VII):

Z1-O-A1-E-A2-O-PA (VII) wherein;
A1 and A2 are each independently of the formula (VIIa), (VIIb), (VIIc) or (VIId) wherein the carbon atom marked with an asterisk is attached to the oxygen atom shown in Formula (VII):

(VIIa) (VIIb) (VIIc) (VIId) Z1 is a protecting group;
R1, R2 & R3, are each independently H or alkyl;
Q1 is an electron withdrawing group;
Q2 is -SO2-;
-O-PA is a phosphoramidite group, a phosphate ester group, or a H-phosphonate group;
each R7 independently is H or C1-4-alkyl;
one of R8 and R9 is a single bond by means of which the group of formula (VIIa) is attached to E, and the other is H or C1-4-alkyl;
Z2 is a protecting group;
R10 & R11 are each independently H or C1-4-alkyl or R10 together with R11 and the carbon atoms to which they are attached form an optionally substituted 4, 5, 6 or 7 membered alicyclic or heterocyclic ring;
E is a single covalent bond or a spacer group; and provided that when A1 and A2 are both of Formula (VIId) E is a spacer group.

14. A compound according to Claim 13 wherein E is an optionally substituted alkyl, alicyclic or aryl spacer group.

15. A compound according to Claim 13 wherein E is phenylene or an alkyl group containing up to 6 carbon atoms.

16. A compound according to Claim 13 wherein A1 and A2 are each independently selected from (VIIa), (VIIb) and (VIId) wherein the carbon atom marked with an asterisk is attached to the oxygen shown in Formula (VII).

17. A compound comprising two or more oligonucleotides linked by a group or groups containing a cleavable linker moiety of formula -A1-E-A2- or -L'- wherein A1, E and A2 are as defined in Claim 13 and L' is as defined in Claim 9.

18. A solid support, suitable for use in an automated oligonucleotide synthesiser, of Formula (VIII) or (IX):

SUP-P1-L'-Nuc-Z (VIII) SUP-P1-A2-E-A1-O-Z1 (IX) wherein;
SUP is a solid support;
L', Nuc and Z are as defined in Claim 9;
A2, E, A1 and Z1 are as defined in Claim 13; and P1 is of the formula:

, , , or wherein, R6 is H or a protecting group; and Z3 is a protecting group.