CA2082394C

CA2082394C - Pseudomonas exotoxins of low animal toxicity and high cytocidal activity

Info

Publication number: CA2082394C
Application number: CA002082394A
Authority: CA
Inventors: Ira Pastan; David Fitzgerald; Vijay K. Chaudhary
Original assignee: US Department of Commerce
Current assignee: US Department of Commerce
Priority date: 1990-05-11
Filing date: 1991-05-10
Publication date: 1999-07-20
Anticipated expiration: 2011-05-10
Also published as: EP0531434B1; US5705156A; AU646673B2; DE69131449T2; JPH05502380A; CA2082394A1; ATE182175T1; JP2946457B2; US5512658A; JP2665827B2; DE69131449D1; EP0531434A4; JPH08283293A; EP0531434A1; WO1991018100A1; AU7991891A; DK0531434T3

Abstract

Improved Pseudomonas exotoxins of low animal toxicity and high cytocidal activity are described. Substitution of positively charged amino acid residues with an amino acid residue without a positive charge provides markedly changed exotoxins.
Conjugation of the new exotoxins with suitable targeting agents provides cytocidal specificity for killing desired cellular entities.

Description

20 8~94 ~

W O 91/18100 1 PC~r/US91/03238 I~DPROVED PSEIJDOMONAS EXOTOXINS OF I~W A~NI~U~L
TOXICITY PiND HIGH CYTOCIDAiL Acllvl~l Y

The present invention is generally related to making recombinant chimeric toxins. More particularly, the present invention is related to devising improved forms of recom~inant Pseudomonas exotoxins (rPE) of low animal toxicity (when tested in animals) and high cytoci-dal specificity when attached to suitable targeting agents. Active chimeric toxins of the nature and proper-ties as described herein have not heretofore been known orreported.
BAC~GROUND OF THE Ihv~NllON
Recombinant Pseudomonas exotoxins containing deletions in domain Ia of the native toxin and which exhibit low side effects are described in U.S. Patent 4,892,827. However, the role of individual amino acids, either alone or in combination with other amino acid sequences in various domains of the PE molecule were not known. It has been shown, however, that domain Ia is required for the binding of the PE molecule to the target cells.
SUMMARY OF THE INVENTION
It is, therefore, an object of the present inven-tion to identify amino acid residues or sequence(s) responsible for animal toxicity of the PE molecule.
After having determined the role of specific amino acids affecting the animal toxicity of PE, it is a further object of the present invention to construct new forms of recombinant PE molecules (rPE) of low animal toxicity (when tested in animals) but of greater cytocidal efficacy when conjugated with suitable targeting agents, without substantial effect on other cells.
An additional object of the present invention is to provide an efficient method for killing target cells by preparing a variety of improved, active chimeric toxins.
Other objects and advantages will become evident 'y~''3 from the following detailed description of the invention.

2~ 8 2 3 9 4 z~
.~
WO 91/t8100 PCr/US91/03~38 ABBREVIATIONS
Various abbreviations, symbols, terminologies and the like used herein are now set forth.
PE-40 means a PE molecule of about 40,000 Mr and domain II is the region n~C~cs~ry for translocation of the toxin into the cytosol (Hwang et al, 1987. Cell 48:129-136).
IL6-PE66-4Glu means a chi~~~ic protein comprising an IL2 and a PE molecule of about 66,000 Mr in which 4 positively charged amino acids have been replaced by glutamic acid (Glu), IL2 being the targeting agent. When the targeting agent is a different entity such as TGF~ or CD4 and the like, the chimeric protein is accordingly designated TGF~- or CD4-PE66-4Glu and the like. If the replacing amino acid is not glutamic acid, then the replacing amino acid is named accordingly, such as glycine is designated "Gly" and so on.
When a numbering system is used, such as PE-GluS7Gly 246,247,249, it means that the amino acid at position 57 in the sequence of the native PE has been replaced by glutamic acid and the amino acids at positions 246,247 and 249 have been replaced by glycine (Gly).
When a symbol "~" or "D" is used, such as 241-250, or D364-380, it means that the sequence of amino acids following the letter "D" or ~ sign, viz., amino acids 241 through 250 or amino acids 364-380 inclusive in these examples, have been deleted.
BRIEF DESC~IPTION OF THE DRAWINGS
These and other objects, features and many of the attendant advantages of the invention will be better understood upon a reading of the following detailed de-scription when considered in connection with the accompa-nying drawings wherein:
Figure 1 shows a schematic representation of the 3S structure of the expression vector for PE mutants. The vector contains sequences encoding PE under a T7 promoter with ribosome binding site that is appropriately placed before the initiation codon (Chaudhary et al, 1988, Proc.

3 ~ ~ ~

WO91/181~ PCT/USgl/03238 ~atl. Acad. Sci. U.S.A. 85:2939-2943; Studier and Moffatt, 1986, J. Mol. Biol. 189:113-130; Rosenberg et al, 1987, Gene 56:125-235). Protein expression is achieved by IPTG
induction of the cultures of E. coli BL21(ADE3) carrying this plasmid. Because of an OmpA signal sequence, the proteins are secreted into the periplasm. In the absence of a signal sequence, they accumulate within the cell.
There is a three amino acid extension (ala asn leu) remaining after the processing of the signal sequence.
Horizontal solid arrows indicate the direction of the transcription. The residues of PE have been circled and 1 is the first amino acid of mature PE (Gray et al, 1984, Proc. Natl. Acad. Sci. U.S.A. 81:2645-2649). The original pVC45 is lacking a T7 transcription terminator (T) as well as a phage origin (f+). Vertical arrow is the site of signal sequence cleavage.
Figure 2 show~ a schematic diagram of IL6-PE40 derivatives.
Figure 3 shows sodium dodecyl sulfate-polyacryl-amide gel electrophoresis of PE mutant proteins. Sampleswere boiled in T~mmeli buffer and applied on a 10% Sodium dodecyl-polyacrylamide gel (SDS-PAGE). The proteins were stainèd with Coomassie Blue R-250. Lanes 1 and 2, PE; 3 and 4 pplu57; 5 and 6, pplU246,247,249 (PE66-4Glu); 7 and 8 pplu57,246,247,249. L~anes 1, 3, 5 and 7 are periplasm samples, Lanes 2, 4, 6 and 8 are Mono Q fractions.
St~Ard molecular weight markers are shown in kDa.
Figures 4A-4D show Mono Q profiles of PE mutant proteins. Proteins were expressed using plasmids with phage T7 terminator. Each periplasm sample equivalent to 150 ml of the culture was applied on a Mono Q column (HR
5/5) and the column was eluted with a linear gradient of NaCl (0-400 mM in 20 mM Tris, pH 7.6). Fractions of 1 ml were collected. A, PE; B, PEGlU57; C, pEGlU246,247,249; and D, pEGlu57 ~ 249,247,249. Vertical arrow indicates the loca-tion of the peak of interest.
Figure 5 shows the cytotoxicity of PE mutants on swiss 3T3 cells. Various dilutions of proteins were added *

Trademark ~ ~ ~ 2~
.~ .
WO91/18100 PCT/~'S91/03238 to Swiss 3T3 cells and the protein synthesis measured.
The results are expressed as percent of control where no toxin was added. O-O, PE; C}--3, pEGlu57;
pEGlU,246,247,249; and ~ , pEGlus7,246,247,249, Figure 6 shows the NaDodSo4/PAGE of expressed IL6-PE40-PE40 (lane l), IL6-PE40-IL6 (lane 2), (IL6-domainII-PE40 (lane 3), IL6-PE40 (lane 4), IL6-PE40D364-380 (lane 5) and IL6-PE664GlU (lane 6). The l0.0% protein gel is stained with Coomassie ~lue. Molecular masses of the standards are indicated in kDa.
Figure 7 shows the cytotoxic activity of IL6-PE40 derivatives on U266 cells. ~h;~ric toxins were added at various concentrations to the cells ~5 x 105 cells/ml~ and the [3H] leucine incorporation into cellular protein was lS measured. IL6-PE40 (o), IL6-PE40-PE40 (-), IL6-domainII-PE40 (X), IL6-PE40-IL6 (O), IL6-PE664GlU (-).
Figure 8 (appearing after Figure 9) shows the results of IL6 competition assay using U266 cells [5 x 105 cells/ml]. IL6-PE66~G1U and IL6-domainII-PE40 were added to cells in the presence or absence of l000 ng rIL6. Cells were incubated 24 hours and protein synthesis was determined similar to cytotoxic assays.
Figure 9 shows the results of binding displacement assay. IL6 chimeric toxins were added at various concen-trations (in similar molar ratios) to cells in the pres-ence of l0 ng l25I-IL6, rIL6 (o), IL6-PE40 (-), IL6-PE40-IL6 (O), IL6-PE664GlU (~)~
DETAILED DESCRIPTION OF THE Ihv~NllON
The above and various other objects and advantages of the present invention are achieved by making a plurality of modified recombinant PE molecules containing specific point mutations and various deletions in the amino acid sequences of domain Ia and by preparing a num~er of chimeric proteins therefrom. Included among such novel molecular entities are pEGlu246~247~24s pEGlus7,246,247,249 pEGlu57Gly246,247,249, PEGlU57~24l-250, IL6--pEGlu57,246,247,249 IL6-domainII-PE40, TGFa-PE664GlU, CD4-PE664GlU and the like.

2~ 8~394 ~9l/1810~ PCTtUS9l/03238 ..

It is noted that having exemplified the present invention by the preparation and testing of a plurality of the novel molecular entities mentioned above, ~arious other molecular entities are similarly prepared by the methodologies described herein and are included within the pur~iew of this invention.
Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Although any methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present invention, the preferred methods and materials are now described. Unless mentioned otherwise, the techniques employed or contemplated herein are st~n~rd methodologies well kltown to one of ordinary skill in the art. The materials, methods and example~ are illustrative only and not limiting.
The term "recombinantH mutant, molecule, or PE and the like as used herein means that the mutant, molecule or PE, etc., are not the product of nature, having been deliberately made by the techniques of molecular biology and the like.
The term "without substantial effect" means the normal functions of the cells are not detectably affected.
~E~T~LS AND ~THODS
D~ ATION OF ~u~NCES ~ PONSIBLE FOR ANI~AL TOXICITY:
STUDY OF MUTANTS
Mutants were created by standard oligonucleotide-directed mutagenesis (Jinno et al, 1988, J. Biol. Chem.263:13203-13207). DNA fragments containing the mutations were subcloned into PE expression vectors pVC 45 (Chaudhary et al, su~ra) or pVC 45 f+T (Jinno et al, 1989, J. Biol. Chem. 264:15953-15959). Some mutations also introduced new restriction enzyme sites. The mutations were finally confirmed by DNA sequencing using sequenase (United States Biochemicals).
~- Trademark ~O9l/18100 ~ Q ~ ~ 3 ~ ~ PCT/US9l/03238 Protein ExPression and Purification Cultures of E. coli strain BL21 (ADE3) carrying the plasmids (Studier and Moffatt, supra) were grown in LB
medium containing ampicillin (100 ~g/ml). At OD650 ~f 0.6-0.8 the cultures were induced with lmM IPTG and ch~ken for about 90 min at 37~C. The presence of an OmpA signal sequence caused the PE mutant proteins to be secreted into the periplasm. PE was extracted from the periplasm as follows: at the end of the induction period, a 150 ml culture was centrifuged at 2000 x g for 10 min and the pellet was suspended in 7.5 ml of sucrose solution (20%
sucrose in 30 mM Tris-HC1 pH 7.4, 1 mM EDTA) and allowed to stand for 10 min on ice. The sucrose suspension was centrifuged at 5000 x g for 10 min and the pellet saved.
The pellet was gently suspended in 6 ml of cold water and kept on ice for 10 min, followed by centrifugation at 10,000 x g for 10 min. This supernatant (peripla~m) was saved and applied on a Mono Q column (HR 5/5) attached to a Pharmacia PPLC. After wA~hing the column with 5 ml of Buffer A (20 mM Tris HCl, pH 7.6), it was developed with a 40 ml linear gradient of NaCl (0 - 400 mM in Buffer A) followed by a steep gradient of NaCl. The PE mutant proteins were eluted at 0.22-0.26 M NaCl.
Analytical Assays and Animal ToxicitY
ADP-ribosylation activity was estimated as de-scribed by Collier and Kandel (1971, J. Biol. Chem.
146:1496-1503). For measuring cytotoxic activities, Swi8s 3T3 cells were seeded at 105/ml in 24-well dishes 24 hrs.
prior to the toxin addition. Purified proteins were diluted in Dl~lh~cco phosphate buffered saline (D-PBS) containing 0.2% human serum albumin (HSA) and added to the cells for 16-18 hrs. The cells were pulse-labelled with t3H]-leucine for 90 minutes and the trichloroacetic acid (TCA) precipitable cell-associated radioactivity was determined as a measure of protein synthesis. The results were expressed as percent of control where no toxin was ~-~ added. SDS/PAGE was performed on 10% gels as described by Laemmli (1970, Nature 227:680-6~5). The protein bands Trademark ~VO 91/18100 7 ~ ~ 2 3 ~ 4 Pcr/vs9l/03238 were visualized by staining with coomassie ~lue R-250.
The protein concentration was measured by a Coomassie Blue G-250 binding assay (Bio Rad Protein Assay) with bovine serum albumin as a standard.
To test ~ni~l toxicity, the purified toxins were diluted in DPBS con~; n; ng 0.2% HSA and 0.5 ml injected I.P. in 8 week-old mice and 48 hrs later, the number of dead animals was determined.
Ex~ression of PE and mutant forms of PE
The nucleotide sequences of new mutants are shown in Table I. Proteins with multiple mutations were made by subsequent subcloning. To analyze the cytotoxic activi-ties of the mutant forms of PE in mice and in cell cul-ture, it was necessary to purify large amounts of these molecules to near homogeneity. This was accomplished by constructing a T7 promoter based expression vector in which seguences ~n~o~i~q PE are preceded by an OmpA signal sequence (Figure 1). Using this vector, large amounts of a soluble form of PE are secreted into the periplasm. In a typical experiment, PE comprises about 20-50% of the protein in the periplasm (Fig. 3), lanes 1, 3, 5 and 7) and molecules of 70% purity or greater can be obtained by a single ion ~Y~h~ge purification step on Mono Q (Fig.
4A-D and Fig. 3, lanes 2, 4, 6 and 8). Depending upon the mutation, proteins were eluted at NaCl concentrations of 0-22 to 0-26 M. For example, pEGlU57,246,247,249 which had four basic residues converted to acidic residues, eluted later than PE (Fig. 4A and 4D). Typical yields from one liter of culture induced at OD6So 0.8 range from 15-45 mg of substantially pure (> 90% pure) protein (Table II).
CYtoxicity and animal toxicitY of PE and mutant forms of PE
As shown in Table III, pEGlU57 and PE~6-225 had about the same cytotoxic activity on 3T3 cells and the 3s same toxicity for mice (LD50 = 1 ~g), whereas PE40 which has a deletion of amino acids 4-252 had no de~ectable toxicity toward 3T3 cells and had much lower toxicity to - mice (LD50 = 50 ~g)- To determine more precisely the Trademark WO9l/18100 PCTJUS91/03238 sequences at the carboxyl end of domain I that were responsible for the high cytotoxic activity of pplU57 and PE~6-225, a series of deletions were created that removed increasing amounts of domain I. The cytotoxic activity of these mutants on 3T3 cells is shown in Table IV. Almost all of domain Ia could be removed without decreasing the activity of these mutants on 3T3 cells. For example, a mutant molecule with deletion of amino acids 6-245 has the same activity as PEGlU57. These data indicate that amino acids 246-252 might contribute to the high cytotoxicity.
This was confirmed in an experiment in which Lys57 was converted to Glu to decrease cell binding and amino acid 241-250 were deleted (PEGlU57 241-250). ThiR molecule also had no detectable toxic activity towards 3T3 cells (Table IV).
It was noted that the carboxyl terminus of domain Ia, that contained three basic amino acids at positions 246, 247 and 249, was hydrogen honA~ to amino acids 369, 368 and 367 in domain Ib of Pseudomonas exotoxin (Allured et al, 1986, Proc. Natl. Acad. Sci. U.S.A. 83:1320-1324).
It was, therefore, decided to explore the role of these basic amino acids in PE mediated toxicity. Accordingly, these amino acids were mutated singly or in combination (Table V and Fig. 5). To do this, a full length PE
molecule waC utilized in which lysine 57 was converted to glutamic acid to dimini~ or abolish cell binAin~ through the PE receptor. When the three basic amino acids at 246, 247 and 249 were changed to either glutamic acid or glycine, the cytotoxic activity on 3T3 cells was greatly di~ini~ and reached the level seen with PE40. However, when they were changed individually, no decrease in cyto-toxic activity was observed (Table V).
To determined whether the positively charged amino ac ds at 246 (histidine), 247 (arginine), and 249 (histi-dine) could be replaced by other charged amino acids, several other substitution mutants were constructed. When all three amino acids were changed to lysines, the cyto-toxic activity was unaffected (Table V). In addition, WO91/18100 ~ PCT/US91/03238 when the two histidines at 246 and 249 were converted to arginines, the cytotoxic effect was also unaffected However, when glutamic acid was introduced at positions 245, 247 and 248 the cytotoxic effect on 3T3 cells was greatly dimin;shed and the ID50 increased to about 600 ng/ml. The cytotoxic activity of the various PE mutants appears to be related to the charge of the amino acids that lie at the carboxyl end on domain Ia (Table V). If only the charge within positions 245 and 249 is consid-ered, it is evident that retaining a net positive charge maintains cytotoxic activity whereas the presence of a neutral or negative charge greatly decreases cytotoxic activity. The toxic activity of various PE mutants was also Afi-s~Cce~ by injecting several of the purified mutant toxins into mice. As shown in Table VI, only two mole-cules had low activity in mice. One of these is PE40(PE~4-252); the other is pEGlus7~246~247~249 Mutation of Lys57 to Glu and deletion of a large number of ~ur-rounding sequences as in PE 6-229, PE 6-239 and PE 6-245 produced a molecule that had an LD50 in mice of about l ~g. Similarly, in a mutant in which the basic amino acids at 246, 247 and 249 were changed to glutamic acid, and the lysine at position 57 preserved, the LD50 in mice was also about l ~g. Only when the two types of mutations were combined as in PEGlU57~246~247~249 was there a large decrease in cytocidal activity and animal toxicity equivalent to deletion of amino acids 4-252 as in PE40.
CYlOlOXICITY OF ~EW CHIMERIC PRO-l~h'l~S: Studies with Il6-PE40 and Derivatives Thereof Enzymes and chemicals were purchAce~ from stAn~Ard sources. Interleukin 6 was produced and purified as described by Siegall et al, l990, Mol. Cell Bio. ADP-ribosylation assays were performed as described by Collier et al, 1971, J. Biol. Chem. 246:1496-1503. Radioactive 3s materials were purchased from the Amersham Corporation, Arlington Heights, IL.

WO91/181~ ~ ~ ~ PCT/US91/032~

Animals. cell lines and bacterial strains For toxicity and serum level assays with IL6-PE40 and derivatives, 8 week old nude mice weighing 18-20 g were used (strain Balb/C; Frederic Cancer Re~e~rch Facili-ty). H929 and H1112 cells were a gift of A. Gazdar (NCI).
All other cell lines were purch~e~ from ATCC (Rockville, MD). Plasmids were propagated in E. coli strain HB101 and expressed in E. coli strain BL21 (ADE3) which carries an inducible T7 RNA polymerase gene.
10 Plasmids Plasmid pCS68 encoding -IL~-P~4Q was made as described by (Siegall et al 1989, Proc. Natl. Acad. Sci.
USA, 85:9738). To construct IL6-PE40-PE40 and PE40-IL6-PE40, DNA coding for PE40 was removed from the plasmid 15 pVC3875 (Siegall et al 1989, J. Biol. Chem. 264:14256;
Siegall et al 1989, FASEB J 3, 2647) and subjected to site directed mutagenesis (Kunkel et al, 1985, Proc. Natl.
Acad. Sci. U.S.A., 82:488) which illL~Gd~ced NdeI Le_L~ic-tion sites after the last codon in PE40 and prior to the 20 first codon in PE40. The resulting plasmid, pCSA20/A21, was digested with NdeI and the 1080 bp PE40 gene was ligated to the plasmid pCS68 partially cut with NdeI. To construct IL6-domainII-PE40 and domain II-IL6-PE40, pVC3875 was subjected to site directed mutagenesis which 25 introduced a NdeI restriction site before the first codon of PE40 and after the last codon of domain II coAing for amino acid 364. The resulting plasmid, pCSA20/A22 was restricted with NdeI and the 333 bp fragment was ligated to pCS68 which was partially cut with NdeI. To construct 30 IL6-PE40A364-380, IL6-PE40 was partially digested with SalI, completely digested with BamHI, and ligated to the 500 bp SalI, BamHI fragment from pCS9 (Siegall et al, 1989, J. Biol. Chem. 264:14256). To construct IL6-PE40-IL6, IL6 was digested with BstXI and BamHI and ligated to 35 an oligonucleotide duplex containing IL6 sequences located proximal to the BstXI site, a segment coding for the amino acids, Ala, Phe, Leu, Asp, Leu, Ala, Val, Val, and the PE
sequences located distal and up to the PpuMI site at amino wo 91/181~ 2 0 ~ ~ 3 ~ ~ PCT/US91/032~

acids 556 in PE. The resulting intermediate vector, pIL6int was cut with PpuMI and EcoRI and the 580 bp fragment was ligated to the 4kb DNA molecu-le resulting from similarly digested pCS68. To construct IL6-PE664GlU, pCS68 was partially digested with NdeI and completely - digested with EcoRI yielding a 3000 bp vector fragment contAin;ng the T7 promoter and IL6. The cDNA encoding a full length mutated PE was digested with NdeI and EcoRI
and ligated into the similarly digested pCS68 fragment.
The mutant PE was carried in the plasmid pJY3A1136-1.3 (pVC45/4E). To construct IL6-T~inker-pE4o~ pCS68 was partially digested with NdeI and completely digested with Bsu36I. An oligonucleotide duplex enco~ing (Gly4Ser)3 (the linker) and containing the remaining IL6 sequences which follow the Bsu36I site on its 5' end along with sequences to form an NdeI site on its 3' end was ligated into the prepared pCS68 vector. To construct IL6-IL6-PE40, pCS68 was partially digested with NdeI and both the linear (single cut) vector and insert (double cut) band were purified and ligated to each other. Fig. 2 schemati-cally describes the various constructions and Table VII
lists a number of plasmids and the corresponding chimeric proteins derived therefrom in accordance with the method-ologies described herein.
Expression and ~urification of IL6-PE40 and derivatives All fusion proteins were expressed in E. coli BL21 (DE3) followed by isolation and purification from the insoluble fraction (inclusion bodies) of _. Çoli as de-scribed by (Siegall et al 1989. Proc. Nat. Acad. Sci.
U.S.A. 85:9738). Briefly, after denaturation of the inclusion bodies in 7M guanidine-HCl and renaturation in phosphate buffered saline, the fusion proteins were purified to homogeneity using anion exchange and gel filtration chromatography and the ADP-ribosylation activi-ty of each purified toxin preparation measured by st~n~Ard methodology.

W091/181~ ~ ~39 ~ - 12 - PCT/US91/03238 CytotoxicitY of IL6-PE40 and related fusion Droteins The toxicity of all IL6-toxin fusion proteins was measured by assessing the level of protein synthesis in treated versus non-treated tumor cells used in each experiment (Siegall et al 1989, Proc. Ntl. Acad. Sci.
U.S.A. 85:9738). The chimeric proteins were added in various concentrations to the cells and incubated at 37~C
for 24 hrs. Incorporation of [3H]leucine into cellular protein was then measured (Siegall et al 1989, Proc. Natl.
Acad. Sci. U.S.A. 85:9738). Competition analysis were performed by the addition of rIL6 just prior to the addition of IL6-toxin to the tumor cells.
Receptor bin~in~ assays Specific binding of l25I-IL6 and labeling proce-dures were performed as described herein above. In theseexperiments, a fixed tracer amount of 125I-IL6 (0.5 ng) was added to cells and competed with varying amounts of rIL6 or IL6-toxin. rIL6 and IL6-toxin was adjusted to equal molar amounts using their respective molec~ r weights. After l25I-IL6 and competitor were added to the cells, they were incubated for 150 min at 0~C with gentle agitation every 5 min. The cells were then washed by centrifugation at least three times with a large eYc~cs of binding buffer to remove llnho-lnA l25I-IL6. Cell-associ-ated radioactivity was then determined in a Beckman GammaCounter.
Animal toxicity and serum levels of IL6 derivatives Using groups of 2-4 mice, the toxicity of IL6-PE40, IL6-domain II-PE40 and IL6-PE664GlU was determined.
The chimeric toxin was administered intraperitoneally (I.P.) in a single dose and the animals were observed for three days. Serum levels were determined at various times after a single I.P. administration of the chimeric toxins.
Bioactivity was measured by determining the cytotoxicity of the serum sample on U266 cells as described herein above. The concentration of the chimeric toxins were estimated by comparisons of the ID50 ~f each serum sample WO91/181~ - 2 ~ 8 2 3 9 ~ PCT/US91/03238 with a stAnAArd curve generated by the addition of puri-fied chimeric toxin to U266 cells.
Fig. 6 shows SDS-PAGE patterns of several differ-ent chimeric proteins. All the chimeric toxins used in this study were greater than 95% pure and had the expected ADP-ribosylation activity (data not shown).
CytotoxicitY of IL6-PE40 derivatives The data shown in Fig. 7 and summarized in Table VII indicate that the IL6-PE40 derivatives fall into four groups hA~e~ on cytotoxicity to U266 myeloma cells. Group l derivatives were more toxic to U266 cells than ILC-PE40, group 2 were of equivalent toxicity to IL6-PE40, group 3 derivatives were about 3-fold less toxic than IL6-PE40 while group 4 derivatives were not toxic to U266 cells.
Group l consists of two tQXi nc, the first being IL6-PE664GlU which contains IL6 fused to native PE (66 kDa) containing mutations at position 57,246,247 and 249.
These amino acids originally coAin~ for Lys, His, Arg and His were each converted to Glu. IL6-PE664GlU is 8-fold more active than IL6-PE40 on U266 myeloma cells with an ID50 = l.0 ng/ml (Table VII). The second member of group I is IL6-domain II-PE40 which is composed of IL6 fused to PE domain II (amino acids 253-364) followed by PE40.
Domain II is responsible for ~G~essing and translocation of the toxin across cell membranes. IL6-domain II-PE40 is l.6-fold more active than IL6-PE40 on U266 myeloma cells with an ID50 = 5 ng/ml (Table VII).
Group 2 also contains two members, IL6-PE40~365-380 and IL6-linker-PE40). IL6-PE40~365-380 is com~_-e~ of IL6 fused to a PE40 molecule with a deletion of amino acids 365-380 (the amino half of domain IB). It was found that the removal of amino acids 365-380 that contain a disulfide bridge increased the activity of TGF~-PE40. In the IL6 version of PE40~365-380 the cytotoxicity to U266 cells was equal to that of IL6-PE40 (ID50 = 8 ng/ml) although this construction produced a larger yield of chimeric toxin than IL6-PE40 (data not shown).

W091/181~ ~Q6 1~ - 14 - PCT/USgl/03~

There are two derivatives found in 1Group 3. IL6-PE40-PE40 is comprised of IL6 fused to two successive PE40 molecules. By doubling the PE40 portion of the fusion protein, it was attempted to increase the cytotoxic activity of the molecule by including two enzymatically active domains. While the new fusion protein IL6-PE40-PE40 was toxic to U266 cells, it was 3-fold less so than IL6-PE40. IL6-IL6-PE40, composed of two adjacent IL6 molecules fused to PE40, was developed in an attempt to increase binding to the IL6 receptor. The cytotoxicity analysis on U266 cells showed that IL6-IL6-PE40 was 3-fold less toxic than IL6-PE40 with an ID50 of 25 ng/ml.
Gro~-p 4 comprises three members, PE40-IL6-PE40, domain II-IL6-PE40 and IL6-PE40-IL6. The two derivatives PE40-IL6-PE40 and domain II-IL6-PE40 are similar in that there is either a PE40 molecule or domain II (amino acids 253-364) fused to the amino end of IL6-PE40. Both of these molecules were not toxic to U266 cells (ID50 > 250 ng/ml) and yielded low amounts of protein (Data not shown). Since the N-terminus of IL6 was blocked by these additions, the bin~inq of IL6 to its receptor may have been blocked. IL6-PE40-IL6 is comprised of IL6 fused to the amino and carboxyl termini of PE40. This fusion protein was also essentially inactive. This result indicates that IL6 on the carboxyl terminus of PE40 inhibits the toxic activity of the chimeric protein.
Competition of IL6-toxin derivatives with rIL6 on U266 cells To evaluate the binding of the two IL6-PE40 derivatives with increased cytotoxicity on U266 cells to the IL6 receptor, IL6 competition assays were performed.
In these experiments, rIL6 was added in excess to compete for the cytotoxic effect of IL6-toxin on U266 cellc. As shown in Fig. 8, addition of lO00 ng of rIL6 reduced the cytotoxic activity of 25 ng/ml IL6-PE664GlU from 15% of protein synthesis to 98~ on UZ66 cells. Similar re~ults were obtained when 25 ng/ml of IL6-domain II-PE40 was used (Fig. 8). These data indicate that both IL6-PE664GlU and 3 ~ 4 WO91~18100 PCT/US91/03238 IL6-domain II-PE40 act specifically through the IL6 receptor.
Effect of IL6-PE40 IL6-domain II and IL6-PE664GlU on cells exoressinq different amounts of IL6 receDtors It has been previously demonstrated that IL6-PE40 was cytotoxic to both myeloma and hepatoma cell lines expressing different numbers of IL6 receptors (Siegall et al l990 su~ra). To determine if IL6-domain II-PE40 and IL6-PE664GlU are more toxic to other cells expressing IL6 receptors, a variety of tumor cells were surveyed.
Additionally, the cytotoxicity of PE664GlU and PE (native) on these same tumor cell lines was determined. These results are summarized in Table VIII.
IL6-domain II-PE40 is more cytotoxic to the hepatoma cell lines PLC/PRF/5, HEP 3B and HEP G2 than IL6-PE40 (Table VIII), IL6-PE664GlU was more toxic than IL6-domain II-PE40 or IL6-PE40 for the hepatoma cell lines PLC/PRF/5 and HEP G2. Surprisingly, I~6-PE664GlU is slightly less toxic to HEP 3B cells than either IL6-domainII-PE40 or IL6-PE40. The hepatoma cell line SX-HEP
was insensitive to all three IL6-toxin molecules (Table VIII).
The epidermoid carcinoma cell lines A431 and KB
were also A-Cr~-S~ for their sensitivity to the IL6-toxin chimeras. A431 cells which are insensitive to IL6-PE40 are moderately sensitive to both IL6-domainII-PE40 and IL6-PE664GlU. The cell line, RB, was insensitive to all IL6-toxin molecules. Additionally, the myeloma cell line H929 was also found to be sensitive to all three IL6 toxins.
The cytotoxicity of native PE and the mutated version of PE, PE664GlU on these same cell lines was also determined. PE was cytotoxic to all the cell lines tested (ID50 = 5 ny/ml to 68 ng/ml). PE664GlU was not toxic to any of the cell lines tested (ID50 > 625 ng/ml) indicating its potential usefulness in chimeric molecules (Table VIII).
;~ competition analysis was also performed using rIL6 as competitor on A43l epidermoid carcinoma cells and the WO91/t81~ ~ 3 ~ 4 ~ PCT/US91/03238 hepatoma cell lines PLC/PRF/5 and HEP G2. The results confirm that IL6-domain II-PE40 and IL6-PE664GlU are IL6 receptor specific (data not shown).
Dis~lacement of l25I-IL6 bY rIL6, IL6-PE40 and der;vatives Since the chimeric toxins IL6-domain II-PE40 and IL6-PE664GlU were more active than IL6-PE40, it was of interest to determine if the increased activity was due to increased binding. For these experiments, l25I-IL6 was used as the ligand for the binding analysis. U266 myeloma cells were incubated with 0.5 ng of l25I-IL6 per 5 x lo6 cells in 70 ~l of binding buffer with or without increas-ing amounts of added rIL6, IL6-PE40, IL6-domain II-PE40 and IL6-PE664GlU. The results demonstrate that rIL6 dis-places l25I-IL6 from IL6 receptors slightly better than IL6_pE664Glu (Fig g) However, IL6-domain II-PE40 and IL6-PE664GlU displace l25I-IL6 approximately the same as IL6-PE40 indicating that the chimeric ~o~inC bind with similar affinities to the IL6 receptor. Therefore, it was concluded that the increased activity of IL6-domain II-PE40 and IL6-PE664GlU is not due to increased binding to cells, but to another property of the chimeric toxin.
Toxicity of IT6-PE40 and derivatives in nude mice To determine the potential usefulness of IL6-PE40, IL6-domain II-PE40, and IL6-PE664GlU as anti-cancer agents, their toxicity in animals was determined. Since nude mice were used to study anti-tumor responses, they were also used to study the toxicity of the chimeric tQ~i n~ . ~ice (2-4 per group) were injected I.P. with single doses of the IL6-toYi nC in amounts ranging from 5~g to 50 ~g for IL6-PE40, 5 ~g to 30 ~g for IL6-domain II-PE40 and 5 ~g to 20 ~g for IL6-PE664GlU (Table IX). Animals were observed over 72 hours for mortality. The LD50 was 20 ~g for IL6-PE40 and IL6-domain II-PE40 and lO ~g for IL6-PE664GlU.
Serum levels of IL6-toxins in nude mice Nude mice were injected I.P. with IL6-PE40, IL6-domain II-PE40 and IL6PE664GlU and serum samples were ~ei~, removed at 5 min, 30 min, l hr, 2 hr, 4 hr, 8 hr and 24 hr. serum levels of the chimeric toxins were measured by W~91/181~ PCT/US91/032 - 17 ~823~l determ;ni~g the cytotoxic activity of biologically active material found in the mouse serum at various time~ after administration. As shown in Table X, IL6-PE40, IL6-domain II-PE40 and IL6-PE664GlU all reached peak serum concentrations in 1 hr and were detectable until 8 hr.
The peak level was 3 ~g/ml, 6 ~g/ml and 12 ~g/ml for IL6-PE40, IL6-domain II-PE40 and IL6-PE664GlU, respectively.
Tables XI and XII show the properties of the similarly prepared TGFa-PE664GlU and CD4-PE664GlU.
In summary, the data presented herein clearly show that new, improved Pseudomonas mutants and chimeric toxins with high cytocidal specificity have been obtained. When tested in animals, these recombinantly made chimeric proteins have lower animal toxicity than corresponding unmutated molecules. A target-specific cytocidal composi-tion, in accordance with the present invention comprises a cytocidal amount of the chimeric toxin of the p~e~cnt invention in a sterile, non-toxic carrier. A method for killing target cells comprises contacting cells desired to be killed, without substantial effect on other cells with cytocidal amount of the chimeric toxin of the present invention in a single dose or repeated doses. Of course, a targeting agent could be any moiety that recognizes the cells targeted to be killed without substantial effect on other cells. Examples of such targeting agents are antibodies, hormones, cytokines, receptors, growth fac-tors, antigens and the like. It is further noted that although the methodologies described herein are the preferred and the best mode of practicing the invention, other methods well known to one of ordinary skill in the art could also be used to obtain the same results and biologically active chimeric toxins etc., as suggested or taught herein.
DEPOSIT
A deposit of plasmids pVC45/4E and pCS64G, from which various chimeric toxins can be made in accordance with the present invention, has been made at the American Type Culture Collection (ATCC), 12301 Parklawn Drive, WO 91/1810~S3~ PCr/US91/03238 Rockville, Maryland 20852, on April 19 and 23, 1990 under aecession numbers 68310 and 68313, respectively. The deposit shall be viably maintained, replaeing if it beeomes nonviable during the life of the patent, for a s period of 30 years from the date of the deposit or for a period of five years from the last date of a request for the deposit, whiehever is longer, and upon issuance of the patent, made available to the publie without restrietion, of course in accordance with the provisions of the law.
The Commissioner of Patents & Trademarks shall, upon request, have aeeess to the deposit.
It is understood that the examples and emhoAiments deseribed herein are for illustrative ~ s~~ only and that various changes, routes and modifieations in light thereof will be suggested to persons skilled in the art and are to be ineluded within the spirit and purview of this applieation and seope of the appended elaims.

wr) 91/18100 PC~r/US91/03238 - 19 20~23~4 Table I
Nucleotide Sequence of Nutants Restriction site created A.

D A L K L A I D
PE5' GACGCGCTCAAGCTGGCCATCGAC 3' D A L E* L A I D
pEGlus7GACGCGCTCGAGCTGGCCATCGAC XhoI
B.

V I S H R L H F
PE5' GTCATCAGTCATCGCCTGCACTTT 3' E*
pEGlu246GTCATCAGTGAACGCCTGCACTTT none E*
pEGlu247GTCATCAGTCATGAGCTGCACTTT none E*
pEGlu249GTCATCAGTCATGAGCTGGAGTTT none E* E* E*
pEGlU246,247,249 GTCATCAGTGAAGAGCTGGAGTTT none G* G* G*
pEGlu246,247,24s GTCATCAGTGGCGGCCTGGGCTTT none K* K* K*
PELy~246~247~249 GTCATCAGTAAAAAGCTTAAGTTT HindIII
Amino acids are shown as single letter code on the top of the nucleotide sequence and mutant amino acids are marked by an asterisk. The numbers indicate the location in PE.
The location of new restriction endonuclease cleavage sites are indicated by the underlined nucleotides.

WO91/18100 ~ PCT/US91/03238 ~3 Table II
Recovery of Mutant PE Molecules After Mono Q

Amount Purify Proteins mg %

PE 46 >95 pEGlus7 39 9S
pEGlu246,247,249 19 70 pEGlu57,246,247,249 16 80 *Amount of toxin from one liter of culture induced at OD650nm of 0.8. The protein concentration was estimated by the Coomassie Blue G-250 protein assay reagent (BioRad) using Bovine serum albumin as a st~nAArd.

Table III
Toxic Activity of PE and Mutant Forms of PE
on Swiss 3T3 Cells and in Mice Toxic Activity 3T3 Cellsb MiceC
Toxina ID50(ng/ml) LD50(~g) PE 1 0.2 pEGlu57 100 PE~6-225 100 PE~4-252 >2000 50 a The replacement amino acid with its position is shown as superscript. ~ indicates the deletion of amino acids.
b ID5p is the concentration of the toxin required to inhiblt protein synthesis on Swiss mouse 3T3 cells by 50%
as compared to control where no toxin was added. Protein synthesis was measured by [3H]-leucine incorporation in the cells.
c LD50 is the amount of toxin that kills 50% of the mice within 48 hrs. after a single I.P. injection.

W~ 91/18100 P~r/US91/03238 ~~ - 21 ~ ~ ~8239 Table IV
Cytotoxic Activity of Domain I Deletion Mutants on 3T3 Cells Deletion MutantsID50(ng) PE
pEGlu57 100 PE~6-224 100 PE~6-234 120 PE~6-239 80 PE~6-245 100 PE~4-252 >2000 PEGlU57 ~241-250>2000 See Table III for legends Table V
Cytotoxic Activity of Domain I Point Mutants on 3T3 Cells Mutants ID50(ng) Chargea PE 1 (+3) pEGlu246,247,249 ( -3) pEGlu57 100 (+3) pEGlu57,246 1 35 (+1) pEGlu57,247 60 (+1) pEGlus7,249 60 (+1) pEGlu57,246,247,249 >2000 (-3) pEGlu57 Gly246,247,249>2000 (0) pEGlu57 Ly~246,247,249 100 ( +3) pEGlu57 Arg246,249 60 (+3) pEGlus7, 245,247,248 600 (-1) PE40 >2000 a Charge is based on the number of acidic or basic residues in the region 245 to 250 of PE.

22 - ~-' Table VI
Toxic Activity of PE Mutants in Mice Mutants LD50(ng) PE 0.2 PE~4-252 50 PE~6-224 PE~6-239 pEGlu57 pEGlu246,247,249 pEGlu57,246,247,249 30 See Table III for legends Table VII
Chimeric Relative Plasmid protein ID50(ng/ml~ Activity pCS 68 IL6-PE40 8-15 100 pCS 64G IL6-PE66-(4Glu) 0.9-1.5800 Group 1 pCS 6II8 IL6-domain II-PE40 5-10 160 pCS 68D14 IL6-PE40~365-380 8-15 100 Group 2 pCS 6L8 IL6-Linker-PE40 8-15 100 pCS 688 IL6-PE40-PE40 24-36 33-Group 3 pCS 688 IL6-IL6-PE40 25-38 32 pCS 868 PE40-IL6-PE40 >250 <2 Group 4 pCS II68 domain II-IL6-PE40 >250 ~2 pCS 686 IL6-PE40-IL6 >250 <2 ID50 is based on protein synthesis using U266 myeloma cells in a 24 hr assay; experiments were done in duplicate or triplicate. Protein is measured by [3H]-leucine incorporation.

3 ~ 4 ~

Table VIII
ID50(ng/ml) (TYPE)PER CELL PE40 PE40PE664GlU

U266,MYELOMA15,500 8-15 5-10 0.9-1.5 >625 H929,MYELOMA16,500 8-12 5-10 1.5-3 >1250 PLC/PRF/5, HEPATOMA2,300 5-7 3-5 1.5-2 >625 HEP 3B,HEPTOMA 1,200 18-30 7.5-20 40-50 >625 HEP G2,~lOMA200-600 450300-400 70 >625 SR-HEP,HEPTOMA<100 >625 >625 >625 >625 A431,EPIDERMOID
CARC. ND >625 90 80 >1500 KB,EPIDERMOID CARC. ND >625 >625 >1250 >1500 ND = NOT DONE
Effects of IL6-toY;nc on various cell lines expressing different amounts of IL6 receptors. The ID50 listed is a range of 2-4 separate experiments.

Table IX
LDso Anal~sis Molecule Amount Injected ~ Deaths/~ Mice IL6-PE40 5 ~g 0/4 10 ~g 0/4 15 ~g 0/2 20 ~g 2/4 25 ~g 3/4 50 ~g 2/2 IL6-II-PE40 5 ~g 0/2 10 ~g 0/2 20 ~g 1/2 30 ~g 2/2 IL6-PE66 4Glu 0/2 10 ~g 1/2 20 ~g 2/2 Mice were administered a single dose, I.P. with indicated amounts of IL6-toxin and the number of dead mice were determined after 72 hours.

W091/l8100 ~ 3 ~ ~ PCT/US91/03238 Table X
Amount Detection MAX1~t1m Molecule SizeInjected Peak Limit Detected Il6-PE40 60 kDlS ~g 1 hr 8 hr 5 ~g/ml IL6-II-PE40 72 kD15 ~g 1 hr 8 hr 6 ~g/ml IL6-pE664Glu 86 kD15 ~g 1 hr 8 hr 12 ~g/ml Mice were injected I.P. with a single dose and serum levels of the chimeric toxin were determined at 5 min., 30 min., l hr., 2 hr., 4 hr., 8 hr., and 24 hr. by assaying cytotoxic activity on U266 cells. The levels at 8 hr. was approximately 0.5 ~g/ml.

Table XI
Activity of TGFa-PE664GlU and CD4(178)PE664GlU
on TARGET CELLS
ID50(nq/ml) TGF~pE664Glu O . 007a CD4(178)PE664GlU l.Sb a. on A431 cells in a 20 hr. assay.
b. on CV-l cells expressing gpl20, in a 4 hr. assay.

Claims

THE EMBODIMENTS OF THE INVENTION IN WHICH AN EXCLUSIVE
PROPERTY OR PRIVILEGE IS CLAIMED ARE DEFINED AS FOLLOWS:

1. A plasmid selected from the group consisting of pVC45/4E and pCS64G.

2. The plasmid of claim 1 being pVC45/4E deposited at ATCC
under accession number 68310.

3. The plasmid of claim 1 being pCS64G deposited at ATCC under accession number 68313.

4. A method of preparing a chimeric protein composed of at least a targeting agent and a cytotoxic PE fragment, comprising the steps of constructing a new plasmid by adding to the plasmid of claim 2 a gene encoding a targeting agent and then obtaining a chimeric protein containing said targeting agent by expressing the new plasmid in a suitable expression vector.

5. A recombinant mutant Pseudomonas exotoxin (PE) selected from the group consisting of PE Glu-57 .DELTA.241-250 and PE-Glu-57-Gly246,247,249.

6. The PE of claim 5 attached to a targeting agent which recognizes a specific site on a cell targeted to be killed, the resulting PE with the targeting agent having improved properties compared to the unsubstituted PE molecule attached to the same targeting agent.

7. The PE of claim 6 wherein said targeting agent is selected form the group consisting of an antibody or a fragment thereof, a peptide hormone, a growth factor, a cytokine, an antigen and a receptor.

8. The PE of claim 7 wherein said targeting agent is an antibody or a fragment thereof.

9. The PE of claim 7 wherein said targeting agent is a peptide hormone.

10. The PE of claim 7 wherein said targeting agent is a growth factor.

11. The PE of claim 7 wherein said targeting agent is a cytokine.

12. The PE of claim 7 wherein said targeting agent is a receptor.

13. The PE of claim 7 wherein said targeting agent is an antigen.

14. A recombinant mutant Pseudomonas exotoxin (PE) selected from the group consisting of IL6-PEGlu57Gly246,247,249, TGF.alpha.-PE-Glu-57,246,247,249 and CD4-PE-Glu-57,246,247,249, attached to a targeting agent which recognizes a specific site on a cell targeted to be killed, the resulting PE with the targeting agent having improved properties compared to theunsubstituted PE molecule attached to the same targeting agent, wherein said targeting agent is selected from the group consisting of an antibody or a fragment thereof, a peptide hormone, a growth factor, a cytokine, an antigen and a receptor.

15. The PE of claim 14 being IL6-PE-Glu-57,246,247,249.

16. The PE of claim 14 being IL6-PEGlu57Gly246,247,249.

17. The PE of claim 14 being TGF.alpha.-PE-Glu-57,246,247,249.

18. The PE of claim 14 being CD4-PE-Glu-57,246,247,249.

19. A composition, comprising a cytocidal amount of the PE of claim 6 and a pharmaceutically acceptable carrier.

20. The use of a cytotoxic amount of the composition of claim 19 for contacting cells targeted to be killed, the targeted cells being those which arerecognized by a targeting agent without substantial effect on other cells.

21. IL6-domainII-PE40.

22. A composition, comprising an effective amount of the PE
molecule of claim 21 to kill cells bearing IL6 receptors, and a pharmaceuticallyacceptable carrier.

23. The use of a cytocidal amount of the composition of claim 22 for contacting and killing cells expressing IL6 receptors.

24. A composition for use in achieving targeted cytotoxicity comprising:
a cytocidal amount of a recombinant mutant Pseudomonas exotoxin according to claim 5, attached to a targeting agent selected from the group consisting of an antibody or fragment thereof, a peptide hormone, a growth factor, a cytokine, an antigen and a receptor; and a pharmaceutically acceptable carrier.

25. Use of the composition according to claim 24, in the manufacture of a medicament for achieving targeted cytotoxicity.

26. A composition for use in killing cells expressing IL6 receptors, comprising an effective amount of IL6-domainII-PE40 to kill cells bearing IL6 receptors, and a pharmaceutically acceptable carrier.

27. Use of a composition comprising a cytocidal amount of an effective amount of IL6-domainII-PE40 to kill cells bearing IL6 receptors, and apharmaceutically acceptable carrier in the manufacture of a medicament for killing cells expressing IL6 receptors.