CA2077461C

CA2077461C - Inhibition of the formation or activity of human leukocyte 12-lipoxygenase pathway

Info

Publication number: CA2077461C
Application number: CA002077461A
Authority: CA
Inventors: Jerry L. Nadler; Rama D. Natarajan; Jiali Gu
Original assignee: City of Hope
Current assignee: City of Hope
Priority date: 1992-08-28
Filing date: 1992-09-03
Publication date: 2000-02-15
Anticipated expiration: 2012-09-03
Also published as: JPH07500254A; AU674339B2; AU4840393A; EP0621895A1; EP0696193A4; EP0621895A4; CA2077461A1; EP0696193A1; WO1995018609A1; AU7090694A; WO1994005777A1

Abstract

The discovery of a new form of 12-lipoxygenase RNA
and protein in human adrenal, mononuclear, vascular smooth muscle and endothelial cells is disclosed.
Activation of this 12-LO pathway mediates angiotensin II and glucose induced vascular and renal actions. A
rationale for the development of pharmaceutical or molecular methods to inhibit this newly discovered lipoxygenase pathway is described.

Description

INHIBITION OF THE FORMATION
OR ACTIVITY OF HUMAN

FIELD OF INVENTION
This invention relates to a new form of 12-lipoxygenase (12-LO) RNA and protein in human adrenal, vascular smooth muscle, endothelial and mononuclear cells. The invention also relates to the mediation of angiotensin II (AII) and glucose induced vascular and renal actions by activation of this 12-LO pathway.
BACKGROUND OF THE INVENTION
Enhanced atherosclerotic cardiovascular and renal disease continue to be major causes of morbidity and mortality in patients with diabetes mellitus and hypertension. All activity and elevated glucose are known to play a role in increased propensity to these disorders.
Applicant has found that All can increase the activity of a 12-lipoxygenase (12-LO) pathway of - arachidonic acid. The 12-LO pathway can produce active products including 12-hydroperoxyeicosatetra-enoic acid (12-HPETE) and more stable 12 hydroxyeico-satetraenoic acid (12-HETE). In addition, some 12-LO
enzymes can also metabolize linoleic acid to produce additional active lipids called hydroxyoctadecadienoic acid (HODES).
The LO products may play a key role in the development of vascular and renal disease. 12-HETE
and 12-HPETE have been shown to be important mediators of All induced effects on inhibition of renin release from kidney (1) stimulation of F
aldosterone synthesis from rat and human adrenal cells (2,3) and increase in blood pressure in rats (4). Furthex'more, 12-HETE and 12-HPETE can lead to vascular smooth muscle cell migration at concentrations as low as 10-14M (5), and both products can inhibit the synthesis of the vasoprotective eicosanoid prostacyclin (6,7). The linoleic acid metabolities including 13 and 9 HODS
have been recently found to be capable of producing mitogenic effects in certain cell types including the liver and fibroblasts (8,9) and can mediate epidermal growth factor induced proliferative actions (9).
Recent studies in several species have shown the presence of two forms of 12-LO (10,11). One type has been cloned from porcine leukocytes (10), which shares 85~ sequence homology to a human tracheal 15-LO enzyme (12). Another type of 12-LO found almost exclusively in human platelets is only 65%
homologous to the porcine leukocyte type of 12-LO
(11). These two forms of 12-LO not only differ in amino acid sequence, but also show differences in preferred substrates. The platelet type of 12-LO
exclusively reacts with arachiodonic acid to form 12-HETE. However, the porcine leukocyte type of 12-LO reacts with linoleic acid and to form 9 and 13-HODE as well as arachidonic acid to form 12-HETE.
In a recent study it has also been found that 12-LO
products can mediate AII-induced bovine adrenal cell proliferation (13).
Prior to this invention it was not known that a leukocyte type of 12-LO is also expressed in human tissue.

SUMMARY OF THE INVENTION
This invention includes the discovery of a new form of 12-LO RNA and protein in human adrenal mononuclear, vascular smooth muscle and endothelial cells. Activation of this 12-LO pathway plays a key role in mediating All and glucose induced vascular and renal actions. Products of this newly discovered 12-LO pathway can directly activate protein kinase C
and led to increased vascular smooth muscle cell growth, a hallmark atherosclerotic vascular disease.
Another aspect of the invention postulates treatment or prevention of vascular disease in patients with diabetes mellitus or hypertension by inhibition of this new form of 12-LO. The invention thus provides a rationale for development of a new pharmaceutical or molecular method to inhibit this newly discovered lipoxygenase pathway.
In accordance with an aspect of the invention, isolated and purified 12-lipoxygenase expressed by human vascular smooth muscle cells, adrenal cells, mononuclear cells or endothelial cells, wherein the polypeptide sequence of said isolated and purified 12-lipoxygenase is an expression product of the nucleotide sequence comprising SEQ ID No. 7.
In accordance with a further aspect of the invention, isolated and purified human 12-lipoxygenase RNA from human vascular smooth muscle cells, adrenal cells, mononuclear cells or endothelial cells, wherein the RNA
sequence of said isolated and purified 12-lipoxygenase RNA is transcribed from the nucleotide sequence comprising SEQ. ID no. 7.
In accordance with another aspect of the invention, a method for regulating the expression of human 12-lipoxygenase protein and RNA
comprises culturing human vascular smooth muscle cells, adrenal cells, mononuclear cells or endothelial cells in vitro in a medium in which the concentration of angiotensin II is controlled.
In accordance with a further aspect of the invention, an in vifro method for mediating angiotensin II and glucose-induced vascular and renal action on cells by controlled activation of the expression of the 12-lipoxygenase according to claims 1 or 5 comprises regulating the levels of ambient glucose concentration, angiotensin II concentration or both bathing said cells.

..
DESCRIPTION OF THE FIGURES
Figure 1 is a bar graph which depicts the effect of All on 12- and 15-HETE released by porcine smooth muscle cells (SMC) grown in normal glucose.
Figure 2 is a bar graph which depicts the effect of All on cell associated 12-HETE levels in porcine vascular smooth muscle cells (PVSMC) cultured in normal (5.5 mM) or high (25 mM) glucose.
Figure 3 is a bar graph which depicts the effect of high glucose (25 mM) on 12- and 15-HETE levels in porcine aortic smooth muscle cells.
Figure 4 is a Western immunoblot which depicts the effect of All (10-' M) on 12-LO 72K expression in PVSMC in normal (5.5 mM) or high (25 mM) glucose.
Figure 5 is a Western immunoblot which depicts specific porcine leukocyte 12-LO protein expression in PVSMC. Lane 1, antigen-porcine 12-LO; Lanes 2 and 3, PVSMC cytosols. A: with 12-LO antibody 1:600, B: With 12-LO antibody preincubated with 12-LO antigen.
Figure 6 is a Southern blot analysis of 12-LO
mRNA levels in PVSMC by reverse transcriptase PCR
(RT-PCR). The results show marked increase in 12-LO
expression in cells cultured in high glucose. There was no effect of glucose on CAPDH (ma:rker gene) expression.
Figure 7 depicts a Southern blot analysis which shows regulation of 12-LO mRNA by All in PVSMC.
Figure 8 is a bar graph which depicts the effect of All on protein synthesis in PVSMC cultures in normal or high glucose.
Figure 9 is a bar graph which depicts the effect of baicalein, a 12-LO synthesis inhibitor, on AII-induced DNA and protein synthesis in PVSMC.
Figure 10 is a bar graph which depicts protein synthesis after direct addition of 12 and 15-LO
products in PVSMC cultured in normal glucose.
Figure 11 is a bar graph which depicts protein synthesis after addition of 12 and 15-LO products in PVSMC cultured in high glucose.
Figure 12 depicts growth curves of PVSMC in normal and high glucose.
Figure 13 illustrates the regulation of 12-LO
protein expression by All in human adrenal glomerulosa cells.
Figure 14 is a Southern blot analysis showing expression of 12-LO RNA in human adrenal glomerulosa and U937 mononuclear cells.
Figure 15 is a Northern blot analysis that shows expression of 4.1 kb size 12-LO RNA band in human adrenal glomerulosa.

~~~~~s~.

Figure 16 is a Southern blot analysis that illustrates the regulation of 12-LO RNA levels by All as determined by RT-PCR.
Figure 17 depicts regulation of 12-LO protein expression by All in human aortic vascular smooth muscle (HVSMC) .
Figure 18 illustrates the presence: of leukocyte type 12-LO in human aortic smooth muscle and mononuclear cells and also shows induction of 12-LO
expression by All in human vascular smooth muscle cells (HSMC).
Figure 19 shows the release of 12-LO product 12-HETE by All in human vascular smooth muscle cells.
Figure 20 depicts the effect of baicalein (10-6M) a 12-LO inhibitor on smooth muscle cell growth in normal glucose (5.5 mM) and high glucose (25 mM) conditions. Cell number is significantly reduced by baicalein in high glucose only.
G High glucose without baicalein ~ High glucose with baicalein o Normal glucose without baicalein ~ Normal glucose with baicalein Figure 21 depicts RT-PCR Southern blot analysis showing the presence of human leukocyte type 12-LO in human aortic endothelial cells. Lane 1, cDNA
positive control. Lane 2, 12-LO expressed DNAase treated showing band is not from DNA contamination and Lane ~ is total RNA from endothelial cells showing 333 base pair product.
Figure 22 depicts RT-PCR, Southern blot analysis showing that human aortic endothelial cells do not express the 15-LO RNA but only the 12-LO RNA of leukocyte type. Presence of positive control amplification of 15-LO cDNA but complete absence of ~, l5-LO RNA in two separate samples of human aortic endothelial cells is depicted.
Figure 23 shows specificity of PCR method for amplification and expression of either leukocyte 12-LO or 15-LO RNA.
DETAILED DESCRIPTION OF THE INVENTION
I. Profile and Mechanism of LO Product Formation LO product formation: In PVSMC cells cultured in normal glucose (5.5 mM, 100 mg/dl), All increased the release of both 12-- and 15-HETE into the media (Figure 1). However, All did not increase cell associated HETE levels in normal glucose (Figure 2).
In contrast, cells grown in high glucose (25 mM, 450 mg/dl) showed markedly elevated levels of cell associated 12- as well as 15-HETE (Figure 3) (12-HETE; 1413~174 normal glucose vs 2600~181 high) and 15-HETE: (1530*134 normal vs 3322-1225 high pg/106 cells, both p<0.01 high vs normal glucose).
Figure 2 also shows that All further increased the cell associated 12-HETE concentrations in high glucose.
These results indicate that All stimulates 12-and 15-LO product (HETE) formation in PVSMC. In addition, PVSMC cultured in elevated glucose media produce more LO products and have an enhanced LO
response to AII.
LO ~arotein expression: Figure 4 is a Western immunoblot using an antibody against porcine leukocyte 12-LO showing effects of high glucose (25mM) and All (10-7M) on 12-LO enzyme (72 KD) expression at 45 hours. It is clearly seen that basal 12-LO enzyme expression is markedly increased in PVSMC cultured in high glucose. In addition, All caused a significant stimulation in 12-LO expression _7_ in normal ad high glucose. The specificity of these results using antibody blocking studies was also confirmed. Figure 5 shows that the bands obtained with authentic porcine leukocyte 12-LO enzyme (lane 1) as well as with PVSMC cytoso7.s (lanes 2 and 3) (Aj all disappeared when treated with 12-LO
antibody which had been preincubated 9:or two hours with the 12-LO enzyme (S).
These results indicate that PVSMC express the leukocyte form of 12-LO and that porcine 12-LO enzyme expression is increased by high glucose as well as AII.
LO mRNA expression: The invention also includes the discovery that AII, as well as high glucose, can upregulate 12-LO mRNA expression. To demonstrate this discovery, a specific reverse transcriptase polymerase chain PCR procedure was designed for evaluating basal and stimulated 12- and 15-LO mRNA
levels in PVSMC, human adrenal glomerulosa, human vascular smooth muscle and monocytes.
The sequences of the primers and the probes were designed based on known gene sequences (10,12,13,14), and selected from regions displaying most divergence between porcine 12-LO and 15-LO sequences (11).
Human 15-LO (Ref. 12). All sequences are 5°-3'.
SEQ ID. 1: Primer 1:5'AACTCAAGGTGGAAGTACCGGAG3' nucleotides 146 to 168 SEQ ID. 2: Primer 2:5'ATATAGTTTGGCGCCAGCCATATTC3' complementary to nucleotides 453 to 477 SEQ ID. 3: Probe: 5'AGGCTCAGGACGCCGTTGCCC3°
complementary to nucleotides 305 to 326.
Porcine Leukocyte 12-LO (Ref. No. 10).
SEQ ID. 4: Primer 1:5' TTCAGTGTAGACGTGTCGGAG3' nucleotides 145 to 165.

-g-SEQ ID. 5: Primer 2:5' ATGTATGCCGGTGCTGGCTATA
TTTAG 3' complementary to nucleotides 451 to 477.
SEQ ID. 6: Probe: 5' TCAGGATGCGGTCGCCCTCCAC 3' complementary to nucleotides 301 to 322.
Total RNA from both human adrenal glomerulosa tissue and cultured cells was extracted with guanidium thiocyanate-phenol-chloroform using RNAzol*
(Cinna/Biotecx Laboratories International, Inc., Texas). Poly (A)+RNA was purified by oligo (dT) cellulose chromatography column (5 prime ~ 3 Prime, Inc., West Chester Pennsylvania). 1 ~g of total RNA or mRNA was mixed with the PCR buffer (10 mM Tris-HC1, pH 8.3, 50 mM KC1, 1.5 mM MgCl2, 0.001%
gelatin), 200 ~M of each of the four deoxynucleotide trisphosphates, 25 pmole each of 5' and 3' primers 5'TTCAGTGTAGACGTGTCGGAG3' (SEQ ID. 4) and 5'ATGTATGCCGGTGCTGGCTATATTTAG3' (SEQ ID. 5), 2 units of Avian Myeloblastosis Virus reverse transcriptase (20 U/ul, Lie Sciences, St. Petersburg, FL) and 2.5 units Taq polymerise (Perkin Elmer Cetus), in a final volume of 50 ~1. In some reactions, 5 pmole of each 5' and 3' primers of ~2 microglobuiline or GAPDH were added as an internal standard. The samples were placed in a thermal cycler at 37°C for 8 minutes for the reverse transcriptase reaction to proceed. Then conditions used for PCR were a denaturation step at 94°C for 1 minute, annealing at 50°C for 2 minutes and extension at 72°C for 2 minutes for 25-30 cycles.
Blank reactions with no RNA template, or with no reverse transcriptase were carried out through the RT
nd PCR steps. RNA samples from HEL cells or IM-9 cells were run as controls in both PCR nd in Northern analysis. The human 15-LO cDNA, porcine leukocyte 12-LO cDNA and human platelet 12-LO cDNA
amplifications were carried out by mixing 2-5 ng of * trademark -g-cDNA in 50 ,ul volume containing 10 mM Tris-HC1, pH
8.3, 50 mM KC1, 1.5 mM MgCl2, 0.001 gelatin, 200 ~aM
of each of the four deoxynucleotide triphosphates, 25 pmole of 5' and 3° primers, and 2.5 U of Taq polymerase.
The size of the amplified fragmen~k: is 333 by for both of 12-LO and 15-LO. The 333 by PCR amplified fragment obtained with porcine leukocyte 12-LO cDNA
or with human 15-LO cDNA as a template could be seen in an ethidium bromide stained gel after 25 cycles of amplification (data not shown). However, using RNA
samples from the human cells, the 333 by amplified product could not be seen in an ethidium bromide stained gel even after 35 cycles of amplification.
The product could only be detected by autoradiography of a blot hybridized with a porcine leukocyte 12-LO
oligonucleotide probe.
Since the amino acid sequences of porcine leukocyte 12-LO and human 15-LO are highly homologous, the porcine leukocyte 12-LO cDNA probe could not readily distinguish the 333 by amplified products corresponding to porcine leukocyte 12-LO or to human 15-LO (data not shownj. Moreover, human 15-LO oligonucleotide and porcine leukocyte 12-LO
oligonucleotide probes can cross hybridize to the 12-LO or 15-LO amplified product, respectively using 12-LO or 15-LO eDNA as templates of amplification.
At high stringency, e.g., hybridized membrane wash temperature of 60°C, the 333 by PCR amplified products of porcine 12-LO and human 15-LO were distinguished by the cDNA probe.
Figure 23 depicts comparison autoradiograms of PCR of cDNA for human 15-LO and cDNA for porcine leukocyte 12-LO. cDNAs samples were amplified for 25 cycles with specific primers for the gene (Table 1j -1~_ and were hybridized with a labeled porcine leukocyte 12-LO o:ligonucleotide probe (panel A) or with a labeled human 15-LO oligonucleotide probe (panel. B).
Lane 1 is porcine leukocyte 12-LO primers on cDNA for porcine leukocyte 12-LO. Lane 2 is human 15-LO
primers on cDNA for human 15-LD.
Direct DNA sequencing of PCR product PCR amplification: RNA was reverse transcribed as follows: the reactian mixture contained porcine leukocyte 12-LO complementary primer 5°ATGTATGCCGGTGCTGGCTATATTTAG3° (SEQ ID. 5), dNTP and 2 ug of RNA in a final volume of 9 ~1. The mixture was heated to 80°C for 5 minutes and cooled to 37°C.
Two units of AMV reverse transcriptase was added and maintained for three minutes at 37°C. Then an additional two units of AMV reverse transcriptase was added, the sample was heated to 95°C to denature, arid then amplified for 40 cycles by PCR as described before. The PCR product was analyzed by hybridization. In order to obtain sufficient amount of PCR product for sequencing, 1 ~l of total product of the PCR reaction was used as a template for secondary PCR amplification with 5° and 3° primers, (145-165 and 451-477) primers for U937 cells;
(177-198 and 428-450) primers far human adrenal. The reaction conditions were as described before except that 30 cycles was used.
Preparation of DNA for sequencing: The products of secondary PCR were purified by electrophoresis on nondenaturing 8% polyacrylamide gel. The isolated DNA fragment was directly used for sequencing.
Sequencing: Two approaches were used for sequencing.

(A) Sequencing reaction of purified PCR product of U937 cells was set in the presence of 0.5% NP-40 detergent and [y32-P] ATP labeled porcine leukocyte 12-LO oligonucleotides 145-165, 451-477 and 301-322.
DNA sequencing reactions were performed by the dideoxynucleotide chain termination method using Sequenase (United States Biochemicals, Cleveland, Ohio), sequencing in both directions with 5' primer and 3' primers.
(B) Sequencing reaction of PCR products of human adrenal glomerulosa tissue and U937 cells was performed by a cycle sequencing method of AmpliTaq(trade-mark) DNA polymerase with a cycle sequence kit (Perkin Elmer Cetus, Norwalk, CT). 15 ng of human adrenal PCR product and 2 pmole of [~32-P] ATP labeled porcine leukocyte 12-LO oligonucleotide (177-198 or 428-450) were used. The cycling program was 1 minute at 95°C, and 1 minute at 60°C for 20 cycles.
As Figure 23 shows, amplification of their cDNAs has confirmed that specific expression of leukocyte type 12-LO and human 15-LO is accomplished.
Regulation of Porcine 12-LO mRNA:
Another aspect of the invention is the regulation of porcine leukocyte-type 12-LO mRNA in PVSMC
cultured in normal (5.5 mM, NG) or high 25 mM, HG) glucose using quantitative RT-PCR. Figure 6 is a Southern blot analysis of the RT-PCR (25 cycles) amplified products from PVSMC total RNA.
Hybridization was performed with the porcine leukocyte type 32P-labeled 12-LO oligonucleotide probe. It is seen that cells cultured in high glucose have a much greater expression of the 333 by 12-LO PCR amplified product than those cultured in normal glucose. GAPDH mRNA amplification was used as an internal standard (280 bp). Densitometric analysis revealed nearly a 20-fold greater 12-LO
expression in high glucose. In addition, experiments were performed to study the regulation of 12-LO mRNA
expression by All (10-~M) at 24 hours using RT-PCR.
Figure 7 shows that 12-LO mRNA expression 333 by is much greater in high glucose (with little basal expression in normal glucose). In addition, All caused a significant 3-4 fold increase in expression in both normal and high glucose. These results represent the first demonstration of regulation of 12-LO mRNA and indicate that glucose and All regulate 12-LO protein expression at the transcriptional level. The size of the transcript (4.0 kb) was confirmed using Northern analysis (data not provided).
II. Effects on Hypertrophy and Hyperplasia Effects on hypertrophy: Figure 8 shows that All (10-6M) increased total cell protein (126 of control) in PVSMC cultured in normal glucose.
Similar results were obtained with All 10-~ and 10-$M. However, the effects of All on total cell protein were significantly greater in PVSMC grown in elevated glucose (147 of control). These results indicate that elevated glucose enhances the hypertrophic response of AII.
The hypertrophic response of All is mediated at least in part by activation of the 12-LO pathway.
The role of the LO pathway in AII-induced hypertrophic effects is illustrated by Figure ~ which shows that AII-induced protein synthesis in normal glucose was blunted by a specific 12-LO inhibitor baicalein. Similar results were obtained in high glucose. In addition, Figure 10 shows that the 12-LO
product 12°HETE could directly increase protein synthesis with the same potency as All in normal glucose. Moreover, the effect of not only AII, but also 12-HETE was enhanced in elevated glucose (Figure 11). 15-HETE was less potent than 12-HETE
showing significant effects only in e7.evated glucose (Figures 10 and 11).
Effects on hyperplasia: Growth curves in PVSMC
in 5.5 mM and 25 mM glucose are shown in Figure 12.
The proliferation rates were approximately 30% faster in cells grown in elevated glucose. rioreover, in Figure 20 it is seen that the specific 12-LO
inhibitor baicalein (10°6M) attenuated the growth responses suggesting that LO product formation may play a role in the proliferative response.
The effect of All alone and with LO inhibition on DNA synthesis as determined by [3H] thymidine incorporation has been measured. All caused a small but significant increase in DNA synthesis in normal glucose. The 12-LO inhibitor, baicalein, blocked AII-induced DNA synthesis (Figure 9), suggesting that products of the 12-LO pathway may mediate in part, AII-induced proliferative effects. AII-induced DNA
synthesis was also enhanced in elevated (25 mM) glucose (normal glucose, 146~7% vs high glucose 174~8% control, p<0.05) (data not shown).
Therefore elevated glucose enhances basal proliferation and also enhances AII-induced proliferative responses. In addition, blockade of the 12-LO pathway can reduce the proliferative actions of glucose and AII.
III. Mechanism of Action of LO Products Table 1 shows the results of Protein Kinase C
(PKC) activity measurements in PVSMC grown in normal and high glucose.

-14- ~'~d ''d ~ ~.
TA~~E 1 The Effect of Various Agents on PKC
Activity in PVSMC (Normal oar High Glucose) Normal ~ Hfgh rune i c:vzosol t Membrane Control 185 63.2 126 94.5 TPA (lOnM) 109 181 72.4 242 All (lOnM) 159 65.1 97.3 78 All+9HODE(100nM) 142 89.8 109 121 AIT+13HODE(100nM1 127 102 120 117 It is seen that in comparison to normal glucose, cytosolic activity in high glucose is lower, while membrane activity is higher indicating increased PKC
activity in high glucose. Cells were treated with agents for 15 minutes. All alone showed only slight activation of PKC relative to TPA. However, in combination with 13- or 9_HODE, All showed increased activity in membrane fraction with reciprocal decrease in cytosolic activity, Immunoblotting experiments show that PVSMC express a and a isoforms of PKC but not p or y forms.
These results show that cells cultured in high glucose show increased PKC activity and All can induce higher PKC activity in combination with LO
products. Therefore, increased activity of certain PKC isoforms may be a key mechanism for vascular cell proliferation in response to glucose All and the LO
products.
IV. Studies in Human Adrenal, Mononuclear Vascular Smooth Muscle and Endothelial. Cells Previously published studies show that All induced aldosterane synthesis in rat and human adrenal glomerulosa cells is mediated by activation of a 12-LO pathway (2,3). This application presents new evidence that the particular isoform of 12°LO in human glomerulosa cells is a '°porcine leukocyte type". Figure 13 shows the effect of All (10-7M) on the expression of the 12-LO protein in normal human adrenal glomerulosa cells as assessed by Western immunoblotting. All increased the expression of 12-LO (Fig. 13A) approximately two-fold over basal as determined by densitometric analysis (Fig. 13B).
Thus, the 12-LO protein is present in cultured human glomerulosa cells as seen using an antibody against a porcine leukocyte 12-LO. Furthermore, the 12-LO
protein ea:pression is increased in cells cultured in the presence of All for 30 hours. A: shows immunoblot of data while B: represents a densitometric analysis of the data in A.
In Figure 14, the identification of the RNA for this form of 12-LO in human glomerulosa cells and mononuclear leukocyte type cells (U937 cells) can be seen using the previously described PCR assay, which is specific for this form of 12-LO. RNA samples were amplified for 30 cycles with SEQ ID. 4 and 5 porcine leukocyte 12-LO primers. Membranes were hybridized with internal porcine leu3cocyte 12-LO oligonucleotide probe (SEQ ID. 6). Panel A, lane 1 represents total RNA from normal human adrenal glomerulosa using RT-PCR. Lane 2 is a negative control without template and lane 3 is a negative control using human 15-LO cDNA. Samples in panel B are mRNA or total RNA
from human U937 cells. Lanes 1 and 5 represent negative controls without reverse transcriptase (RT) for mRNA and total RNA respectively. Lane 2, mRNA
and lane 6, total RNA are true RT-PCR. Lane 3 is a positive control using the porcine leukocyte 12-LO

cDNA. Lane ~ is another negative control without RNA
template.
Figure 15 is a Northern analysis using the 12-LO
probe (SEQ ID. 6). 20 ug of RNA from human adrenal glomerulosa in lanes 1 and 2 showing that the size of the RNA expressed (approximately 4.1 kb) is similar to the porcine leukocyte 12-LO RNA size.
Figure 16 shows regulation of 12-;LO mRNA levels by All determined by RT-PCR. Total RNA was extracted from cultured adrenal glomerulosa cells that were incubated alone or with 10°~M All for 24 hours. RNA
samples were amplified for 25 cycles with primers amplifying porcine 12-LO. All reactions in the ' experiment also contained primers amplifying human GAPDH. Controls without RNA or with RNA pretreated with RNAase were simultaneously run. The position of the specific products are indicated by arrows. 284 by and 333 by represent amplified products of human GAPDH.and porcine leukocyte 12-LO respectively.
Panel A is the autoradiogram of the blot hybridized with oligonucleotide probe specific for the porcine 12-LO gene. Panel B is the autoradiogram of the same blot subsequently hybridized with oligonucleotide probe for the GAPDH. Lanes 1 and 4 are glomerulosa cells in the control incubation. Lanes 2 and 5 are glomerulosa cells incubated with 20-~M AII. Samples in lanes 4 and 5 were treated with RNase A prior to the RT-PCR. Lane 3 is without RNA. These results Shaw that 12-LO gene is present in human glomerulosa and monocytes and that the RNA is upregulated by AII.
To confirm that the amplified PCR product in human monocytes and adrenal cells is not due to contamination of the porcine 12-LO cDNA, the amplified product was sequenced. As shown in .Cable 2, the sequence in human cells is 2 base pairs different than the porcine sequence.

_ 17 --U
U

7 t~ U ~
C -U -7 -C o ~1' U H H-H t7-L9 M O

U-U

~
~
~

t 7 -i ~ U
N

~ C H-H~
O 7-~
H

N U U U
~ U U ~
~ M

r - - 7 -r 7 i -U C
t .N H U U-U (~-C7 U d v ~
1a N

d~ C7-C7 U-U U-U
O

t1 ~

.N ~-~ C7-C9 N O
U
S~

O U -U ~cC C9 la In -~ -i9 ~
O

U N U

~~ H-H -Hcw O ~
~

O i7-C7 -U C7-C7 .~ M O
N
U
~

~

U-U H-H ~-~
~1 M

N H-H ~- ~7C9 1 ~
.tl N

N _ U
O U U
U

~ H - 7 7 ~ H - -R C C
a C 7 N ~ V-~
~

R4 ~-H -cr rt f'~ ~
e-1 -4-1 ~
M M
~
n M

N ~ ~ ~ H ~7 ~-~
H ~ ~7 v WU r-1 t0 - -C U-U
'~ U-U C
O U' -U' rl~ rc3 N H--H H-H H-H
tn M

~1v O a~ H - C7 H
t~' ~ H N - -o ~CO N ~ O U' -C7 (7 C7 N -U' -U' o H4 ~-I tn H U
H
M

~ ~ H --H - -O

N V U U
a1 V ~ U
Q ~
~
O

= 7 7 C --C

C

C ---U
rl ~

U

~ N H-H U-U
~ ~
~

N L U-U H-H -~ 7-C o ~ H-H
Sp N
O

, Q'.-.Q',C7-U' U-U C7-C9 a 01 N
Cla .a C7-C7 H-H U--U H -H
z1 N o N
.~

U Ch-U' U-U U-U U -U
O ~
~
~
Rf rtJ ~-~ U-U ~--~ ~ = o O M

O
N
O

d H-H U-U H-H H -H ~r +~
fa 'w H-H H-H ~&-~C c9 -C7 ~
.~
~
c6 O U-U H-H C7-C7 c7 -C9 La o cU
U

U U-U Ch-C7 U-U C7 -C7 .L1 ~
O
N

~ 7 n U-U o U -.. o ' O ~- -C
~
U

N U-U U-U t7-C7 U -C7 O
~

rI ~C -~C H H C9 -C9 .1 -H -H
rl m N

S~ U-U H-H C7-C7 U -U o ~
~

rtf t7-C7 t9-C7 ~-~ H -H N
N
N
N

f1 U' -C7 FC U A,'-~,' d~
rl -~C -U
~1 W

U U-U ~-~ CU7.--~ H -H
~ o ' O - N C7-C~ U-U U -U

O
~ ~

a ~ a ~ a 0-~1 ri e-I wl N
N N N

Qa ~; G~ L4 f~la _ag_ Furthermore, amplified genomic DNA from human leukocyte nuclei shows that the gene size in the segment amplified (1 Kb) was substantially larger than the expected size in the same region in the porcine gene.
Figure 17 shows identical procedures as outlined previously for protein expression that All can increase 12-LO protein expression in human aortic smooth muscle cells. The increase of expression was seven fold as measured using a computerized video densitometric system. Figure 18 shows expression of 12-LO RNA in human vascular smooth muscle cells using a similar RT-PCR procedure. Lane 5 shows expression of the expected 333 base pair 12-LO band in human vascular smooth muscle cells, while lane 3 shows an identical RNA band in samples taken from mononuclear cells. Basal expression of 12-LO in unstimulated smooth muscle cells is below the detection limit of this experiment (lane 7). However, smooth muscle cells stimulated by All show a marked increase in 12-LO expression (lane 5). Panel B represents an ethidium bromide stain of the RT-PCR experiment showing internal marker RNA (B2 micoglobulin) for these experiments (lanes 2, 4, 6). Figure 19 illustrates the stimulatory effect of All at 10°9 and 10-8 M on 12-HETE synthesis and release from human aortic smooth muscle cells. 12-HETE was assayed by HPLC and specific radioimmunoassay.
These studies confirm that a new gene has been found in several human tissues which encodes a 12-LO
which is distinct from the one already found in human platelets. These studies indicate that this 12-LO
gene and protein is present in human adrenal, mononuclear and aortic smooth muscle cells and that All markedly upregulates both protein and RNA

_19_ expression of 12-LO in several of these tissues (Figures 13, 16, 17 and 18).
In further studies using RNA from human aortic endothelial cells and the RT-PCR procedure described a leukocyte 12-LO was found to be expressed in these cells. Figure 21 depicts RT-PCR Southern blot analysis showing the presence of human leukocyte type 12-LO in human aortic endothelial cells. Lane 1, cDNA positive control. Lane 2, total RNA from endothelial cells that have been treated by DNAase showing that band is not from DNA contamination and Lane 3 is total RNA from endothelial calls showing 333 base pair product. These results suggest that a 12-LO is expressed in this key vascular wall. Figure 22 depicts the evidence against a 15-LO being expressed in human aortic endothelial cells. 'Osing 15-LO specific primers and probes (SEQ ID. 1-3 respectively) revealed specific amplification of the 15-LO cDNA used as a template. However, in two separate experiments no 15-LO RNA band is seen when RNA from endothelial cells is used. Therefore, only a leukocyte type of 12-LO is expressed in human aortic endothelial cells.
The presence of a new form of 12-LO gene in human tissues has been described. This 12-LO gene appears to encode a protein which forms active products that mediate angiotensin II and glucose-induced vascular and probably renal actions.
No agent has yet been developed with the indication of blocking the activity or formation of this 12-LO pathway for prevention of hypertensive and diabetic vascular and renal disease. Several compounds are available for in vitro use that do block 12-LO activity. However, none have been developed for clinical use.

~20-Increasing evidence suggests that All and elevated glucose are each factors involved in accelerated vascular and renal disease. In addition, the mechanisms for increased atherosclerotic cardiovascular and renal disease in patients with diabetes remains unknown. The invention described here is apparently the first therapy designed to reduce or prevent a critical pathway involved in these disorders.

-21°
REFERENCES
1. Antonipillai, I, et al., J. Endocrinology 125:2028-2034 (1989).
2. Nadler, J.L., et al., J. Clin. Imrest, 80:1763-1769 (1987).
3. Natarajan, R., et al., J. Clin. Endocrinol.
Metabl. 67:584-591 (1988).
4. Stern, N., et al., J. Am. J. Physiol.
257:H434-443 (1989).
5. Nakao, J., et al., Atherosclerosis 44:339-342 (1982).
6. Setty, B,N,Y., et al. J. Clin. Invest. 77:202-211 (1986).
7. Hadjiagapiou, C., et al. ProstaGlandins 31:1136 (1986).

8. Ku, G., et al., Clin. Res. 39:335A (Abstraa~t) (1991).

9. Glasgow, w.C., et al., Mol. Pharmacol. 38:503-510 (1990).

10. Yoshimoto, T., et al., Proc. Natl. Acad. Sci. USA
87:2142-2146 (1990).

11. Funk, C.D., et al. Proc. Natl. Acad. Sci.
X7:5638-5642 (1990).

12. Sigal, E., et al., Biochem. Bio hys. Res. Commun.
157:457-464 (1988).

13. Natarajan R., et al., Endocrinology September 1992.

14. Tzumi, T., et al., Proc. Natl. Acad, Sci. USA
87:747?-7481 (1990).

15. Tso, J.Y., et al., Nucleic Acid Research 13:2485-2502 (1985).

_22_ SEQUENCE LISTING
(1) GENERAL INFORMATION:
(i) APPLICANT: Jerry L. Nadler Rama Devi Natarajan Jiali Gu (ii) TITLE OF INVENTION: Inhibition of the Formation or Activity of Human Leukocyte 12-Lipoxygenase Pathway (iii) NUMBER OF SEQUENCES: &
(iv) CORRESPONDENCE ADDRESS:
(A) ADDRESSEE: City of Hope (B) STREET: 1500 East Duarte Road (C) CITY: Duarte (D) STATE: California (E) COUNTRY: United States of America (F) ZTP: 91010°0269 (v) COMPUTER READABLE FORM:
(A) MEDIUM TYPE: 3M Double Density 5 1j4" diskette (B) COMPUTER: Wang PC
(C) OPERATING SYSTEM: MS-DOS (R) Version ' 3.30 (D) saFTWARE: Microsoft (R) (vi) CURRENT APPLICATION DATA:
(A} APPLICATION NUMBER:
(B) FILING DATE:
(C) CLASSIFICATION: Unknown (vii) PRIOR APPLICATION DATA: None ~~~r~.
°23°
(viii) ATTORNEY/AGENT INFORMATION:
(A) NAME: Irons, Edward S.
(B) REGISTRATTON NUMBER: 16,541 (C) REFERENCE/DOCKET NUMBER: None (ix) TELECOMMCTNICATTON INFORMAT~:ON:
(A) TELEPHONE: (202) 785°6938 (B) TELEFA?C: (202) 785-5351 (C) TELEX: 440087 LM WSH
(2) INFORMATION FOR SEQ ID NO: 1:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 23 (B) TYPE: Nucleotide (C) STRANDEDNESS: Single (vii) IMMEDIATE SOURCE: Synthetically produced (xi) SEQUENCE DESCRIPTION: SEQ TD NO. 1:
AACTCAAGGT GGAAGTACCG GAG
INFORMATION FOR SEQ ID NO: 2:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 25 (B) TYPE: Nucleotide (C) STRANDEDNESS: Single (vii) IMMEDIATE SOURCE: Synthetically produced (xi) SEQUENCE DESCRIPTION: SEQ ID N0. 2:
ATATAGTTTG GCCCCAGCCA TATTC

_2~_ INFORMATION FOR SEQ ID NO: 3:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 21 (B) TYPE: Nucleotide (C) STRANDEDNESS: Single (vii) IMMEDIATE SOURCE: Synthetically produced (xi) SEQUENCE DESCRIPTION: SEQ ID NO. 3:
AGGCTCAGGA CGCCGTTGCC C
INFORMATION FOR SEQ ID NO: 4:
( i ) SEQUENCE 'CHARACTERISTICS
(A) LENGTH: 21 (B) TYPE: Nucleotide (C) STRANDEDNESS: Single {vii) IMMEDIATE SOURCE: Synthetically produced {xi) SEQUENCE DESCRIPTION: SEQ ID NO. 4:
TTCAGTGTAG ACGTGTCGGA G
INFORMATION FOR SEQ ID NO: 5:
(i) SEQUENCE CHARACTERISTICS:
(A) LED1GTH: 27 (B) TYPE: Nucleotide (C) STRANDEDNESS: Single (vii) IMMEDIATE SOURGE: Synthetically produced (xi) SEQUENCE DESCRIPTION: SEQ ID NO. 5:
ATGTATGCCG GTGCTGGCTA TATTTAG

_25_ INFORMATION FOR SEQ ID NO: 6:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 22 (B) TYPE: Nucleotide (C) STRANDEDNESS: Single (vii) IMMEDIATE SOURCE: Synthetically produced (xi) SEQUENCE DESCRIPTION: SEQ ID NO. 5:
TCAGGATGCG GTCGCCCTCC AC
INFORMATION FOR SEQ ID NO: 7:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 239 (B) TYPE: Nucleotide (C) STRANDEDNESS: Single (vii) IMMEDIATE SOURCE: Synthetically produced (xi) SEQUENCE DESCRIPTION: SEQ ID NO. 7:
AAACGGCACC TCCTTCAGGA TGACGCGTGG TTCTGCAATT GGATCTCCGT
GCAGGGTCCG GGAGCAAACG GGG,ACGAGTT CAGGTTCCCC TGCTACCGCT
GGGTGGAGGG CGACCGCATC CTGAGCCTCC CTGAGGGCAC TGCCCGCACA
GTGGTCGATG ACCCTCAAGG CCTGTTCAAG AAACACAGGG AGGAGGAGCT
GGCAGAGAGA AGGAAGCTGT ATCGGTGGGG TAACTGGAA
INFORMATION FOR SEQ ID NO: 8:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 239 (B) TYPE: Nucleotide (c) STRANDEDNESS: single -26°
(vii) TMMEDIATE SOURCEc Synthetically produced (xi) SEQUENCE DESCRTPTIONs SEQ ID NO. Sa AAACGGCACC TCCTTCAGGA TGACGCGTGG TTCTGCAATT GGATCTCCGT
GCAGGGCCCG GGAGCAAATG GGGACGAGTT CAGGTTCCCC TGCTACCGCT
GGGTGGAGGG CGACCGCATC CTGAGCCTCC CTGAGGGCAC TGCCCGGACA
GTGGTCGATG ACCCTCAAGG CCTGTTCAAG AAACACAGGG AGGAGGAGCT
GGCAGAGAGA AGGAAGCTGT ATCGGTGGGG TAACTGGAA

Claims

1. Isolated and purified 12-lipoxygenase expressed by human vascular smooth muscle cells, adrenal cells, mononuclear cells or endothelial cells, wherein the polypeptide sequence of said isolated and purified 12-lipoxygenase is an expression product of the nucleotide sequence comprising SEQ ID No. 7.

2. The use of an inhibitor of the expression of the 12-lipoxygenase according to claim 1 to mediate angiotensin II and glucose induced vascular and renal actions.

3. The use according to claim 2 wherein the inhibitor is baicalein.

4. Isolated and purified human 12-lipoxygenase RNA from human vascular smooth muscle cells, adrenal cells, mononuclear cells or endothelial cells, wherein the RNA sequence of said isolated and purified 12-lipoxygenase RNA is transcribed from the nucleotide sequence comprising SEQ. ID no. 7.

5. Human leukocyte 12-lipoxygenase comprising the expression product of SEQ. ID. No. 7.

6. An isolated purified or substantially purified nucleotide sequence which consists essentially of SEQ. ID. No. 7.

7. A method for regulating the expression of human 12-lipoxygenase protein and RNA comprising culturing human vascular smooth muscle cells, adrenal cells, mononuclear cells or endothelial cells in vitro in a medium in which the concentration of angiotensin II is controlled.

8. A method as defined by claim 7 in which the concentration of angiotensin II is increased to upregulate expression of 12-lipoxygenase protein and RNA or decreased to down regulate expression of 12-lipoxygenase protein and RNA.

9. An in vitro method for mediating angiotensin II and glucose-induced vascular and renal action on cells by controlled activation of the expression of the 12-lipoxygenase according to claims 1 or 5 comprising regulating the levels of ambient glucose concentration, angiotensin II concentration or both bathing said cells.

10. A method as defined by claim 9 in which said activation of expression is controlled by regulating the level of ambient glucose concentration bathing said cells.

11. The use of baicalein to inhibit the expression of the human

12-lipoxygenase of claims 1 or 5.