CA2069741C - Cloning cartridges and expression vectors in gram-negative bacteria - Google Patents

Abstract

Cloning cartridges comprising a positive regulatory gene nahR from plasmid NAH7, a promoter Pg that is regulated by nahR, a multiple cloning site, a transcription terminator, and a gene conferring tetracycline resistance. Such cartridges can be in-serted into plasmids of choice to form novel expression vectors in which high level gene expression is inducible with an inexpen-sive non-toxic inducer at low concentrations.

Description

3 (gq ~

grk~ CATION

TITLE: Cloning Cartridges and Expre~sion Vectors in Gram-Negative Bacteria 1NV~N 10R: ~wang-Mu Yen W O 92/06186 PCT/Us91/06006 20~i~'741 pA~ )IJND OF T~E lh~/~h-lUI!I
An expression plasmid vector is an indispensable tool for the study of gene expression in bacterial cells. The need to tevelop expression vectors is particularly acute for little-studied bacterial strains in which gene expression needs to beassessed. At least two approaches can be i ~ginPd for the introduction of an expression vector into these bacterial strains.
A native plasmid, if it is known, can be converted into an expression vector or a broad host range expression vector can be introduced into these strains. The native plasmid of a poorly-studied strain is usually not very well characterized. Genetic elements essential for regulated gene expression have to be introduced from other sources in order to convert it into an expression vector. A number of broad host range vectors have been developed for Gram-negative bacteria (see Bagdasarian et al., 1983, Gene 26: 273-282; Mermod et al., 1986a, In: Sokatch, J.R
and Ornston, L.N., (Ets.), The Bacteria. A Treatise On Structure and Function, Vol. 10. A~dl ic Press, Orlando, p. 325-355; and Schmi~h~cer et al., 1988, Vectors A SurveY of Molecular Clonin~ Vectors and Their Uses (Rodriguez & Denhardt, eds.), Butterworth, Boston, pp. 287-332 for reviews). However, only a few of these vectors (Bagdasarian et al., 1983, Gene 26: 273-282; Mermod et al., 1986b, J. Bacteriol. 167: 447-454; Furste et al., 1986, Gene 48: 119-131) allow any type of regulated gene expression.
The regulation of naphthalene catabolic genes carried by the NAH7 plasmid has been well studied (for review, see Yen and Serdar, 1988, CRC Crit. Rev. Microbiol., 15: 247-268). The NAH7 plasmid is a naturally-occurring plasmid in the Pseudomonas putida (P. putida) strain G7 (~TCC 17485). It carries catabolic genes for the degradation of naphthalene to Krebs cycle intermediates These ~enes are organized in two operons. The first operon encodes enzymes for the conversion of naphthalene to salicylate (upper pathway) and the second operon enco~es e..zy -s for the oxidation of salicylate to acetylaldehyde and pyruvate (lower pathway). Both operons are activated in the presence of the -206974~

in~Vcer salicylic acid, or some of its analogs, and the product of the regulatory gene, nahB. The nahR gene maps upstream from the lower pathway operon and next to the nahG gene which encodes the enzyme salicylate hydroxylase. The two genes, nahR and nahG, are transcribed in opposite directions and their promoters, PR and PG. share sequences. While PG is subject to the positive regulation of NahR protein, PR directs the synthesis of NahR protein constitutively. The nucleotide sequences of nahR, PR and PG have all been determined (Schell, 1986, J.
10 Bacteriol. 166: 9-14; You et al., 1988, J. Bacteriol. 170: 5409-5415; and Schell and Sukordhaman, 1989, J. Bacteriol. 171: 1952-1959). A bacterial DNA expression unit based on the nahR-pG
regulatory system has not been suggested or prepared for use in the construction of expression vectors. New vectors of broad or narrow host range that allow regulated and more efficient gene expression and are more convenient to use still need to be developed. Construction of a DNA restriction fragment carrying all of the elements essential for gene cloning, selection and expression would facilitate the development of expression vectors.
Such a cloning cartridge, if it could be constructed, could then be inserted into a replicon of either broad or narrow host range to convert it into an expression vector. PCT Application PCT/GB89/00341 (Publication No. W089/09823, 10-19-89) describes a xYlR-derived regulatory cassette from a TOL plasmid for bacterial expression vectors. This cassette contains only the x~lR gene with the binding site of its gene product XylR and associated promoter (Pu)~ The gYlB~Pu cassette is not easily transferable among replicons because there is no selective marker on the cassette. In addition, there is: (i) no transcription terminator, (ii) a paucity of cloning sites, and (iii) no engineering of the promoter to allow precise insertion of a fcreign gene for optimal expression. In particular, with respect to (iii), there is no restriction site engineered to include the ATG sequence encoding the initiation codon, and there appears to be -1.5 kb of uncharacterized DNA separating the promoter region from the cloning site (see Keil et al., J. Bacteriol. 169: 76~--W O 92/06186 PC~r/US9l/06006 206974~.
.

770 (1987) and Harayama et al., J. Bacteriol. 171: 5048-5055 (1989)) which could likely reduce expression of a cloned gene The regnl~tion of the ~Y13/PU cassette requires the use of toxic chemical in~eers, such as toluene. Several constructs using a ~YlB/PU cassette are mentioned, but no expression data is given to det~, 'n~ the usefulness of such constructs. There is, therefore, a need to develop new cloning cartridges and expression vectors that overcome the deficiencies of previously describet expression units, including the cassette and vectors 10 described in PCT/GB89/00341.

SFVVA~ OF THE ~hv~h~lON
According to the prese~t invention~ a Gloning cartridge and its derivative have been s~rcessfully constructed based on the NahR-regulated gene expression system. The two cartridges (also called cassettes) were tested on a derivative of the broad host range plasmid pKT231 (Bag~ rian et al. 1981, Gene 16: 237-247) for use in gene cloning and expression in different bacterial hosts. Plasmid vectors ca..~ing one of the cartridges have allowed cloning and in~urihle expression of several tested genes in all of the Gram-negative bacteria tested to date. High-level protein production from a cloned gene was also demonstrated. The DNA elements assembled in the cloning cartridges provide previously unavailable convenienre and efficiency in gene cloning and expression in Gram-negative bacteria. In addition, cloning cartridges according to the present invention cont~i ned on an -3.6 kb restriction fragment allow efficient (e.g., single-step) construction of expression vectors in a wide variety of Gram-negative bacteria.
The present invention is directed to a cloning cartridge or cassette which comprises five el~ ~.te essential for efficient gene cloning and expression, based on the NahR-regulated expression system. The five elements comprising a cloning cartridge according to the present invention are: a gene encoding drug-resistance, a nahR gene, a promoter PG regulated by the D~k~ gene product, a multiple cloning site, and a transcription terminator. A useful drug-resistance gene is the gene encoding tetracycline-resistance (tetr) derived from the pBR322 plasmid. In the cloning cartridge, the sequence upstream from the Hind III site in the promoter of the tetr gene was replaced with the nahR seq~enre. This sequence substltution generated a new hybrid promoter for the tetr in the cartridge and had the effect of stabilizing a plasmid carrying a cloning cartridge according to the present invention in the absence of selection. The nahR gene in the cloning cartridge is derived from the NAH7 plasmid naturally occurring in P. putida. It e~ro~es the protein, NahR, that positively regulates the promo~er WO 92/06186 PCr/US91/06006 PG of the lower pathway operon for naphrhslenP degradation. The promoter PG is activated in the presence of the NahR protein and an j.~ ,c~ c and inexpensive in~cer, sodium salicylate at low conrentrations (0.35 mM or lower). Uithin the promoter PG of the cloning cartridge, a sequence of 3 nucleotides upstream of the ATG se,~ence enroding the initiation codon was altered to create an NdeI cloning site which was followed by a number of other cloning sites in the order of 5' - HpaI - ClaI - ~_I - K~nI -SscI - ~b~I - 3'. The 5' end of a characterized gene can be converted into an NdeI site without altering the coding property and cloned into this cartridge for regulated expression. A
transcription tDrminltor derived from plasmid pCFM1146 was placed r~ly downstream to the multiple cloning site of PG.
A novel five-element portable cloning cartridge according to the present invention was assembled as an -3.6 kb EcoRI -PstI fr~ ~ t, which can be easily inserted into a variety of tifferent replicons. Such a cloning cartridge, when inserted into a replicon of either broad or narrow host range, converts it into an expression vector. Thus, the present invention is also directed to plasmid vectors of broad or narrow host range cont~ining the cloning cartridge. A particularly preferred embodiment is the broad host range expression vector pK~Y299, constructed by replacing the EcoRI - PstI fragment of plasmid pKMY286 with the -3.6 kb EcoRI - ~I cloning cartridge. In particular, plasmid pRMY299 was precisely designed for cloning and expression of genes that contain, or are engineered to contain an NdeI recognition sequence (CATATG) at the 5' end of the gene. For cloning and expression of restriction fragments carrying genes of unknown sequences, the cloning cartridge in pKMY299 was modified by the deletion of the sequence encoding the start codon AUG within the multiple cloning site. This derivative of pKMY299, designated pKMY319, thus comprises a modified cloning cartridge. The sequence deletion prevents false translational initiation in gene expression from the PG promoter in pKMY319.

W O 92/06186 PC~r/US91/06006 -zo~974~ 7 The usefulness of pKMY299 and pKMY319, as examples of expression vectors cont~ini~ a cloning cartridge according to the present invention, was temonstrated. Genes of various origins whose products could be easily assayed were cloned into the pKNY299 or pKMY319 expression vector. Regulated (e.g., inducible) gene expression was observed in a variety of Gra~-negative host cells. Overproduction of certain gene ~products was also demonstrated.

W O 92J06186 PC~r/uS9l/06006 ~s 8RIEF DF~TPTION OF THE DRA~INGS
Figure 1 shows a restriction map of an -1.7 kb ~indIII,~PctI
fra~ent from a region of plasmid NAH7 cont~inin~ the nahR gene ant part of the ~h~ gene. P~ and PG are promoters of nahR and 5 nahG, respectively, with the arrows indicating direction of transcription.
Figure 2 shows the initial steps (from plasmid pKMY256 to pKMY292) in the construction of a cloning cartridge according to the present invention.
Figure 3 shows the subsequent steps (from plasmid pKMY292 to pKMY297) leading to the construction of a cloning cartridge in plasmid pKNY297.
Figure 4 shows the derivation of an expression vector pKMY319 from the pKNY299 expression vector.
Figure 5 shows the SDS-PAGE analysis of protein products from expression vectors pKMY299 and pKMY319, which comprise a cloning csrtridge or modified cloning cartridge according to the present invention, in Pseudomonas ~utida G572. Expression of firefly luciferase under in~ced and ~minduced conditions is shown 20 in lanes 2,8 and 3,9, respectively. Expression of catechol 2,3 dioxygensse under in~ced and l~nin~u~ed conditions is shown in lanes 4,6 and 5,7, respectively.

DETAILED DESCRIPTION

A cloning cartridge according to the present invention is designed to contain five elements essential for efficient gene cloning and expression based on the NahR-regulated expression system. These five elements, on a conveniently portable cartridge or cassette, comprise a drug resistance gene tetr, nahR, PGI a multiple cloning site, and a transcription terminator. Such a cloning cartridge can be easily inserted into a variety of vectors for efficient and regulated gene expression. A recognition site for the frequently-cutting restriction endonuclease RsaI is located three base pairs upstream from the nahG
coding region (Figure 1). Initial steps in the construction of the cloning cartridge involved converting this RsaI site into a ScaI restriction site convenient for inserting a multiple cloning site and placing the tetr gene of the E. coli plasmid pBR322 (Bolivar et al., 1977, Gene 2: 95-113) next to the PR region.

Plasmid pKMY256 is an E. coli plasmid pUC19 (Yanisch-Perron et al., 1985, Gene 33: 103-119), carrying an ~5.3 kb PstI insert which contains the nahR gene, PGI and ~200 base pairs (bp) of the nahG gene. Digestion of pKMY256 DNA
with the enzymes PstI and SalI and self-ligation led to the cloning of a ~400 bp SalI-PstI fragment containing PR and PG
into pUC19. The resulting plasmid was designated pKMY288 (Figure 2). In pKMY288, the promoters PR and PG are located on a ~200 bp SalI-RsaI fragment (Figure 2). The RsaI site of this fragment can be ligated to the ScaI site of pKMY256 to regenerate the ScaI site. Replacement of the ~1.4 kb SalI-ScaI fragment of pKMY256 with the ~200 bp SalI-RsaI
fragment of pKMY288 resulted in the deletion of the remaining nahG sequence and the conversion of the RsaI site in PG into a ScaI site (Figure 2). The newly formed plasmid was designated pKMY289 (Figure 2).

W O 92/06186 P~r/US91/06006 X069741 I: ' In order to place the tetr gene next to PR . the -470 bp E~ ScaI fragment of pKKY289 ca--~ing P~ and P~ was used to replace a -4.4 kb ~g~ ScaI fragment in a pBR322 plasmid ca,.~ing a copy of the LL~YOS3 Tn5 (Ss~sk~wa et al., 1982, 5 Proc. Natl. Acad. Sci. USA 79: 7450-745~; (Figure 2). The resulting plasmid was desig~9ted pKMY291 (Figure 2). A pKMY291 derivative, designated pKMY292, was constructed by deleting the intervening sequence between the HindIII site within nahR and the ~i~dIII site within the promoter of the tetr gene (Figure 2).
This step placed the tetr gene ~ tely downstream from PR.
In the following steps, a multiple cloning site was inserted at the newly-created ScaI site within PG and a transcription ter~inAtor was inserted at the end of the cloning site. In most bacterial genes, the nucleotide sequence ATG
specifies the initiation codon. This trinucleotide and the sey~ence prece~in~ it can be converted by site-specific mutagenesis into the recognition site of the restriction endon~clesce ~I (CATATG) without affecting the coding property of the gene. In order to ~o-~ -d~te genes modified in this manner, a ~I site can be similarly created in an expression vector at the junction between the promoter and the 5' end of a gene coding region. Other restriction sites can be introduced downstream of the NdeI site for accepting the 3' end of a cloned gene. In such an expression system, the distance between the transcription start site and the gene coding region is unaltered, regardless of the gene cloned. The promoter PR was modified to contain a NdeI restriction site at the 3' end, followed by a number of other cloning sites.
An oligonucleotide contsining the following sequence was synthesized and ligated into the ScaI and PstI sites of pKMY292:

RsaI HpaI XbaI

3' TGGTATACCAATTGTAGCTAAGATCTCCATGG-NdeI ClaI KpnI
SacI SacII PstI
GAGCTCCTCGAGCCGCGGACAGATCTCTGCA 3' CTCGAGGAGCTCGGCGCCTGTCTAGAG 5' XhoI BglII

Insertion of this sequence converted the ScaI site into the RsaI site naturally occurring within PG~ restored the distance between the RsaI site and the coding region, generated a NdeI cloning site at the 3' end of the PG
sequence and placed a number of other cloning sites immediately downstream of the NdeI site. The resulting plasmid was designated pKMY293 (Figure 3).

The E. coli plasmid pCFM1146 carries a transcription terminator that can be easily incorporated into other systems. Other sources of transcription terminators are described in co-assigned U.S. Patent No. 4,710,473.
Downstream from the transcription terminator there is a restriction site for the enzyme BglII and immediately upstream from the transcription terminator, there is a multiple cloning site including an EcoRI site, a XhoI site and a number of other restriction sites (Figure 3). The transcription terminator in pCFM1146 was placed immediately downstream of the multiple cloning site in pKMY293 in two steps. The BspMII-PstI fragment of pKMY293 carrying the tetr gene, PRI PGI and the multiple cloning site was initially cloned into the XmaI and the PstI sites of the plasmid pUC9 (Vieira and Messing, 1982, Gene 19: 259-268) to place the EcoRI site of pUC9 downstream of the tetr gene (Figure 3). The resulting plasmid was designated pKMY294 (Figure 3). In the next step the EcoRI-XhoI fragment of pKMY294 was cloned into the EcoRI and XhoI sites of pCFM1146 to place the transcription terminator immediately downstream of the multiple cloning site Of PG ( Figure 3).
The resulting plasmid was designated pKMY295 (Figure 3).

The rs ~ininE steps established a unique cloning site downstream from the transcription terminator and restored the nahR
gene. In pKMY295, the E~lII site downstream from the transcription terminator needed to be replaced with a restriction site uni~ue in the cloning cartridge for the convenience of transferring the cartridge among replicons. To achieve this end, a pUC9 derivaeive without a HindIII s~te, designated pKMY513, WaS
initially constructed by cleaving pUC9 with the enzyme ~indIII
followed by end-filling and blunt-end ligation (Figure 3). The ~_RI-~lII fragment of pR~Y295 carrying the tet~ gene, PR~ PG~
the multiple cloning site, and the transcription terminator WaS
cloned into the ~RI and ~HI sites of pKNX513 to eliminate che II site and incorporate a uni~ue PstI site next to the destroyed ~lII site (Figure 3). The resulting plasmid was designated pKMY296 (Figure 3).
In pKMY296, the part of the nahR gene downstream from the HindIII site within nahR is still missing. To ensure correct and convenient assembly of the nahR gene, an indicator plasmid, designatet pKMY512, was constructed which contained the naphthalene dioxygenase gene cluster and its NahR-regulated promoter from the plasmid NAH7. In the presence of an inducer sodium salicylate and the NahR protein, the naphthalene dioxygenase genes of pK~Y512 can be turned on, which in turn catalyzes the formation of indigo dye in ~. ÇQli (Ensley et al., 25 1983, Science 222: 167-169). Two intermediate plasmids pN400 and pKMY239 were involved in the construction of the indicator plasmid pRMY512. The plasmid pN400 was constructed by cloning the PvuII-~lII fragment of plasmid pE317 (Ensley et al., 1983, su~ra) cont~ini~g the naphthalene dioxygenase genes into the SmaI
and BamHI sites of the plasmid pUC18 (Yanisch-Perron et al., 1985, su~ra). ~-e plasmid pRMY239 was constructed by inserting the -6.4 kb ~acI fragment of pN400 conr~ining the naphthalene dioxygenase genes into the SacI site of the broad host range plasmid pRMY223.

Deletion of the ~ QRI fragment of pKMX239 carrying a portion of the nahR gene generated pKMY512- The ~
kb ~iadIII fragment of pKMY289 (Figure 2) carrying the portion of nahR downstream from the ~iadIII 5ite was inserted into the ~i~dTII site of pKMY296 to complete construction of the cloning cartritge (Figure 3). In this step the desired plasmid was selected for its ability to render E. coli cells harboring pKMY512 to protuce indigo in the presence of sodium salicylate.
This plasmid was designated pKMY297 (Figure 3). Thus, in pKMY297, an -3.6 kb EcoRI-PstI fragment cont~ n~ the tetr gene, nahR, Pc~ a multiple cloning site, and a transcription terminator was successfully assembled as a cloning cartridge.
To test the -3.6 kb ~ç~RI~ I fragment from pKMY297 for use as a cloning cartridge in different hosts, this fragment was inserted into a replicon derived from the broad host range plasmid RSF1010 (Scholz et al., 1989, Gene 75: 271-288). Plasmid pKT231 is a derivati~e of RSF1010 (B~ rian et al., 1981, sutra) and served as a source of the RSF1010 replicon. In pKT231, a ~E_I site is located -200 bp from a SacI site both of which occur in the polylinker of the cloning cartridge. These two sites were removed from pKT231 by di~estion of the plasmid DNA with ~I and SacI followed by treatment with the Klenow fragment of E. coli DNA polymerase I to generate blunt ends and self-ligation. The resulting plasmid was tesignated pKMY286.
The broad host range expression vector pKMY299 was constructed by replacing the EcoRI-~I fragment in pKMY286 with the 3.6 kb ~s_RI-PstI cloning cartrid~e (Figure 4).
In pKMY299, the expected nucleotide sequences at the junction between PG and the multiple cloning site and at the PstI
junction between the cloning cartridge-and the RSF1010 replicon ~ere completely confirmed by DNA sequence analysis. Sequences of 79 bp in PG. upstream of the ~I site and of 158 bp downstream of this site were determined. The sequence data demonstrated that, as expected, the 5' end of the synthetic polylinker was ligated at the RsaI site close to the 3' end of PG and that the polylinker sequence downstream of the ~h~I site was replaced by W O 92/06186 PC~r/Us91/06006 20~i9~

pCF~1146 sequences (Figure 3). Downstream from PG. seven unique restriction sites including a NdeI site followed by H~aI, ClaI, ~ I, K~nI, SacI, and ~QI sites, can be used for precise insertion of genes with the 5' end lying within a NdeI
recognition sequence. A sequence of 337 bp including 54 bp of the cloning cartridge upstream of the PstI recognition sequence - and 277 bp of the RSF1010 replicon downstream of this sequence, was dete_ ~Dd. This sequence indicated that the PstI end of the cloning cartritge was ligated, as expected, at the corresponding 10 PstI site in RSF1010 DNA starting at nucleotide 7768 (Scholz et al., 1989, su~a).
Similar sequence analysis of 303 bp of the RSF1010 replicon upstream of ~he ~çQRI recognition sequence and 36 base pairs of the cloning cartridge downstream of this sequence, also demonstrated, as expected, that the ~_RI end of the cloning cartridge was ligated at the corresponding ~QRI site in RSF1010 DNA starting at nucleotide 8676 (Scholz et al., 1989, su~ra).
However, the same analysis revealed that the sequence from nucleotides 1 to 1653 in RSF1010 DNA (Scholz et al., 1989, su~ra) was completely deleted in pKMY299. The deleted region contains the entire strA gene and most of the strB gene deter~ini~g streptomycin resistance (Scholz et al., 1989, .supra). Restriction patterns of pKMY286 and pKT231 DNA suggested that this deletion occurred in the plasmid pKT231 used, as described herein.
25 Further analysis of pK~Y286 and pKMY299 DNA with various restriction e~ ^s did not detect other aberrations in pKMY299.
Plasmid pKMY299 can be considered, therefore, as an RSF1010 plasmid with nucleotides 1 to 1653 deleted and nucleotides 7768 to 8676 replaced with a 3.6 kb cloning cartridge.
Plasmid pKNY299 was designed for precise cloning and regulated expression of genes that contain, or are engineered to contain, an ~deI recognition sequence at the 5' end. For cloning and expression of restriction fragments carrying genes of unknown sequences, the cloning cartridge in pKMY299 was modified. The sequence ATG within the ~I recognition sequence in pKMY299 was removed to prevent false translational initiation in gene W O 92/06186 P ~ /Us91/06006 Z~69~41 expression from PG. This was achieved by digestion of pKMY299 DNA with ~1 and ~E_I followed by treatment with Mung Bean nuclease to reDove the overhang, and self-ligation of the ~ -inin~ plasDid DNA. The resulting plasmid was designated S pKMY319 (Figure 4). Sequence analysis confirmed the expected location of the five ,. -ining cloning sites in pKMY319 in the order of ClaI, ~ I, and ~hQI sites. The same analysis revealed that in addition to removal of the AT overhang generated by ~I digestion as expected, the Mung Bean nuclease ~ Yrectedly reDoved anotber eight bp. The expected sequence and the actually observet sequence around the ligation site in pK~Yl9 are shown as follows:
* * * * *
expected T C A C G A G T A C C A A A C A T C G A T
ClaI
* * * *
observed T C A C G A C A T C G A T
ClaI

The asterisks mark bases comple - ~Ary to the 3' end of the Pse~d~ -,as aerU~in~c~ 16S RNA and define a coding region for the putative ribosoDe-binding site (Shine and Delgarno, 1975, Nature ~54: 34-38). One of the important bases encoding ribosome-binding site was removed in pKMY319. A disruption of this ribosome binding site might prove ad~antageous in the use of pKMY319 for the expression of cloned frAg - -c contAinin~ genes of unknown ~e~e.lce. A Shine-Delgarno sequence, which is normally located only a few bp upstream from a gene, is usually cloned on a fragment along with the gene. A second ribosome binding site enroded by the expression vector might act to reduce expression (Schauder and McCarthy, 1989, Gene 78: 59-72).
To evaluate the use of pK~Y299 and pKMY319 as expression vectors, genes of ~arious origins whose products could be easily assayed were cloned into the plasmids and their expression tested. An intronless luciferase gene constructed from Photinus ~Yralis (firefly) cDNA and genomic clones (de Uet et al., 1987, Mol. Cell. Biol. 7: 725-737), was reconstructed to contain 8 NdeI
site at the 5' end. The reconstructed luciferase gene was cloned into pKMY299 at the NdeI and Asp718 (KpnI) sites and the resulting plasmid, pKMY520, was introduced into E. coli and P. putida host cells. Expression of the luciferase gene was analyzed in the presence or absence of sodium salicylate as an inducer in both recombinant host cells.
Luciferase activity was determined by measuring the light produced in a reaction catalyzed by this enzyme.
Production of luciferase protein in P. putida was also analyzed by SDS polyacrylamide gel electrophoresis (SDS-PAGE) of a crude extract. Luciferase production in uninduced recombinant P. putida cells carrying pKMY520 was barely visible on an SDS gel (Figure 5). However, the high sensitivity of the luciferase assay (de Wet et al., 1987, supra) allowed detection of relatively high enzyme activity from uninduced recombinant P. putida or E. coli host cells carrying pKMY520 (Table II). The same assay detected a ~90 fold induction of the luciferase activity in recombinant P. putida host cells (Table II) and an ~80 fold induction of the same activity in recombinant E. coli host cells.
The amount of luciferase produced in induced P. putida cells carrying pKMY520 represented ~3.7~ of the total soluble proteins (Figure 5). These results demonstrated regulated expression of a eukaryotic gene from pKMY299 in two different Gram-negative hosts.
To test the use of pKMY319 as an expression vector, restriction fragments carrying the toluene monooxygenase (TMO) gene cluster tmoABCDEF from Pseudomonas mendocina KR1 or the catechol 2,3-dioxygenase gene from the plasmid NAH7 (see Yen and Serdar, 1988 supra, for review) were individually cloned into pKMY319 to generate plasmids pKMY342 and pKMY517, respectively. Recombinant plasmid pKMY342 carrying the TMO gene cluster was introduced into a number of Gram-negative bacterial species and plasmid pKMY517 carrying the catechol 2,3-dioxygenase gene was introduced into P. putida. Expression of these genes was measured under induced and uninduced conditions.

W O 92/06186 PCT/uS9l/06006 2~i9~41 Significantly higher specific activities of both toluene monooxygenase and csrechol 2,3-dioxygenase were observed from inAll~e~ cultures than from l~in~ced cultures of all bacterial strains testet (Tables I ant III). These results demonstraeed 5 the wide we of pKMY319 as an expression vector in obt~ining regulated gene expression in Gram-negaeive bacteria. Comparing to the level of catechol 2,3-dioxygenase produced from NAH7, a 25-fold overproduction of this enzyme from pKNY517 was observed under the experi -ll conditions (Table I). Production of catechol 2,3-dioxygenase protein in P. ~utida harboring the plasmid pKMY517 was analyzed by SDS-PAGE of a crude cell extract.
The amount of catechol 2,3-dioxygenase produced represented -10%
of the total soluble proteins, as detected by densitometer analysis of the gel (Figure 5). These results demonstrated the usefulness of pK~Y319 in the overproduction of gene product(s).
The stability of the cloning cartridges was tested in view of reports that a plasmid carrying the tetr gene, used as an element of the cloning cartridges described herein, was not stably inherited in P. putida or E. coli in the absence of selection (8agdasarian et al., 1982, supra; Kolot et al., 1989, Gene 75: 335-339). It has been suggested that a short sequence within the promoter of the tetr gene forms a ~hot spot" for recombination (James and Kolotner, 1983, in Mechanisms of DNA
ReDlication and Reco~bination, Cozzarelli, (ed.), pp. 761-772, Liss, New York), and might be responsible for destabilization of this plasmid carrying the tetr gene (Kolot et al., 1989, su~ra).
This sequence contains a ~indIII site and tisruption of the HindIII recognition sequence or the sequence in its vicinity stabilized the plasmid carrying the tetr gene (Kolot et al., 1989, su~ra). In the construction of a cloning cartridge according to the present invention, the sequence upstream from the HindIII site in the promoter of the tetr gene was replaced with the nahR sequence (Figure 3). This sequence substitution generated a new hybrid promoter for the tetr gene and stabilized the plasmid carrying either of the cloning cartridges according to the present invention.

The hybrid promoter in the cloning cartridges described herein, allowed the use of the tetr gene as a selection marker in all of the bacterial strains tested (Tables 2, 3 and 4). To test the stability of a plasmid carrying a cloning cartridge according to the present invention, P. putida KT2440 and P. putida G572 host cells (Table l) harboring pKMY299 or pKMY319 were grown in L-broth in the absence of tetracycline for over 50 generations. Each of the cultures was streaked on L-agar plates for single colony formation and 100 colonies from each culture were tested on L-agar plates supplemented with tetracycline (50 mg/ml) for tetracycline resistance. All of the colonies tested were tetracycline resistant. This result suggested that use of the tetr gene in the form carried by the cloning cartridges according to the present invention did not lead to the elimination of either cartridge or elimination of a plasmid carrying either of the cartridges, in the absence of selection.
The invention is now illustrated by the following Examples, with reference to the accompanying drawings.

Construction of Intermediate Plasmid pKMY289 A. Preparation of Plasmid pKMY256 The starting material for the construction of pKMY256 was plasmid pKY217 described by Yen and Gunsalus, 1985, J.
Bacteriol. 162: 1008-13. Plasmid pKMY256 was constructed according to the following series of steps. In the first step, an ~4.3 kb HindIII fragment from plasmid pKMY217 containing the nahR and nahG genes was cloned into the HindIII site of the pKT240 plasmid described by Bagdasarian et al., 1983, Gene 26: 273-82. The resulting plasmid from this first step was designated pKMY219. In the second step, an ~7 kb BamHI - SacI fragment from pKMY219 containing the nahR and nahG genes was cloned into the BamHI and SacI sites of the pKT231 plasmid W O 92/06186 Z~69741 P~/USg1/06006 described by ~g~n~ian et al., 1981, Gene 1: 237-47. The resulting plasmid was designated pY~Y223. In the next step, an -6 kb PstI fr~ e from FVMY?~3 contAining the ahR gene, -200 base pairs of the nah gene and the gene conferring ~An ~in resistance, was cloned into the ~I site of the pUCl9 plasmid described by Yanisch-Perron et al., 1985, supra. The resulting -8.0 kb plasmid was designated pKMY256. (Figure 2). The orientation of the -6 kb PstI fragment in pKMY256 placed the multi-cloning site of pUC19 from the SalI to the EcoRI site i -~iAt~ly downstream of the PstI site in the nahG gene.
Plasmid pKMY256 was then used to construct intermediate plasmid pKMY289 as follows.
B. Preparation of Plasmid pKMY288 Plasmid pKMY256 DNA was digested with PstI and SalI, resulting in 4 PstI-~lI frA~ -q of -4.9 kb, -2.7 kb, -420 bp, and -10 bp. The digestion mixture was self-ligated and used to transform ~. ~Qli JM109 cells. The transformed cells were plated on L-agar with ampicillin (250 ~g/ml), IPTG (isopropyl-B-D-thiogalact~.~.oside) as inducer and X-gal (5-bromo-4-chloro-3-indolyl-~-D-galactoside)as substrate for the lacZ gene product.
The desired construct was screened by picking colorless colonies followed by miniprep analysis. It contained the -420 bp PstI-I fragment carrying P~ and PG. The resulting -3.1 kb plasmid was designated pKMY288 (Figure 3), and comprises pUCl9 (-2.7 kb), -60 bp of the pahR gene, PR . PG and -200 bp of the nahG gene (originally derived from pKY217 as described above). Plasmid pKMY288 is thus the equivalent of subcloning the -420 bp PstI-SalI fragment of pKMY256 into plasmid pUCl9.
C. Preparation of Plasmid pKMY289 Plasmid pKNY288 DNA (Section B above) was digested with I and RsaI. Plasmid pKMY256 DNA (Section A above) was digested with ~31I, ScaI (compatible with RsaI) and ~_I (to prevent reformation of original plasmid pKMY256 during subsequent ligation). The digested pKMY288 and pKMY256 DNAs were mixed, ligated, and used to transform E. coli JM109. Transformants were selected by plating on L-agar with ~nl ~cin (50 ~g/ml).

W O 92/06186 P ~ /~S91/06006 Z069741.

The resulting -6.8 kb plasmid was designated pKMY289 (Figure 2), and comprises the -6.6 kb ~alI-ScaI fragment of pKMY256 and the -200 bp SalI-RsaI (after ligation, RsaI is converted to ScaI) fragment of pKMY288. This -200 bp fragment comprises -60 bp of the D~h~ gene, PR. PG (minus the 5 bp sequence ACAGC before the ATG of the Dah~ gene). None of the Dah~ gene re ninC. In the construction of pKMY289, the 3s~I site i -~iQtely upstream of the nahG gene has been converted to a ScaI site, which allows certain manipulations in the following construction steps.

Construction of Intermediate Plasmid ~K~Y293 A. Preparation of Plasmid pKMY291 Plasmid pKKY289 DNA (Example 1) was digested with ~glII, ~_I and PstI (to prevent reformation of original plasmid pKMY289 during subseq~ent ligation). Plasmid pBR322::Tn5 (S~-c~wa et al., 1982, Proc. Natl. Acad. Sci. USA 79: 7450-7454) DNA was digested with ~lII and ~aI- The digested pKMY289 and pBR322::Tn5 DNAs were mixed, ligated and used to transform ~.
coli JM109 cells. Transfo rc were selected by plating on L-agar with tetracycline (10 ~g/ml). The resulting -6.1 kb plasmid was designated pKKX291 (Figure 2) and comprises the -5.6 kb EglII-ScaI fragment of pBR322::Tn5 cont~inine DNA regions essential for replication and the -470 bp ~glII-ScaI fragment of pKMY289 cont~inine -330 bp of the nahR gene, PR and PG (minus the bp sequence ACAGC before the ATG of the nahG gene). In addition to positionine the nahR region with respect to the tetr gene for further manipultion, this step placed a desirable restriction site (PstI) downstream of the ScaI si~e for unidirec~ional insertion of a polylinker at the ScaI site.
B. Preparation of Plasmid pKMY292 Plasmid pK~Y291 ~NA (Section A above) was digested with HindIII and ~k~I. The digestion mixture was ligated, digested again with XhoI (to prevent the reformation of pKMY291), then used to transfor~ E. coli JM109 cells. Transformants were selected by plating on L-agar with tetracycline (10 ~g/ml). The W O 92/06186 PC~r/US91/06006 Z069741.

tesired -4.2 kb plasmid was designated pKMY292 (Figure 2).
Plasmit pKMY292 resulted from the teletion of an -1.9 k~ Hin~ITI
frag~ent, including the tesiret deletion of the PstI site. In attition, the deletion eli n~red the nucleotide sequences upstream of the tetr promoter ant brought the tet~ gene of pBR322::Tn5 as close as possible to the nahR gene sequence, and in a tesired orientation.
C. Preparation of Plasmid pKMY293 Plasmid pKMY292 DNA (Section B above) was digested with ScaI and PstI. An -240 bp ScaI-PstI fragment of pKMY292 was deleted and replaced with a polylinker of the following sequence:
5~-AcrATATGGTT M CATCGATTCTAGAGGTA~C~A~lC~lCGAGCCGCG~ACA~ATCTCTGCA
3'-TGGTATACrAATTGTAGCTAAGATCTCCA~GG~C~Arr-Ar-~lCGGCGCCl~l~lAGAG
This double-stranded polylinker cort~inc multiple restriction sites in the order of 5'-B~aI-~I-H~aI-ClaI-~ 2~I-SacI-XhoI-SacII-~glII-PstI-3'.
The single-stranded DNA fr~ ~ ~s used in the construction of the polylinker of the above-tescribet sequence were chemically synthesized by using an ABS 380B DNA synthesizer (Applied Biosystems, Inc., 850 Lincoln Centre Drive, Foster City, CA
94404). Many DNA synthesizing insL~ c are known in the art and can be used to make the frag~ents. In addition, the fragments can also be conventionally prepared in substantial accordance with the procedures of Itakura et al., 1977, Science 198: 1056 and Crea et al., 1978, Proc. Natl. Acad. Sci. US 75:
5765. The synthesized single strands were annealed to form the double-strantet polylinker as follows. Four single strands were synthesized for Ann~l ing and tesignated 140-27 (31 mer), 140-28 (35 mer), 140-29 (32 mer) and 140-30 (24 mer), having the following sequences, respectively:
140-27 5'-ACC ATA TGG TTA ACA TCG ATT CTA GAG GTA C-3' 140-28 5'-CTC GGT ACC TCT AGA ATC GAT GTT M C CAT ATG GT-3' 140-29 5'-CGA GCT CCT CGA GCC GCG GAC AGA TCT CTG CA-3' 140-30 5'-GAG ATC TGT CCG CGG CTC GAG GAG-3' The 5' ends of strants 140-28 and 140-29 were kinased (marked witb an asterisk below) prior to Ann~l ing according to c~ ..tional methods, for example, Yansura, et al., 1977, Biochem.
~:1772-1780. The scheme for AnnsAling was:
5' 140-27 3' 5'. 140-29 3' 3' 140-28 .5' 3' 140-30 5' The ScaI and E~I digested pKMY292 DNA was ligated with the above-described 5'-RsaI-PstI-3' polylinker, and the ligation mixture was used to transform ~. coli B 101 cells. Transformants were selected on L-agar plates with tetracycline (10 ~g/ml). The desired -4.1 kb plasmid, designated pKMY293 (Figure 3), was identified by miniprep analysis of ~h~I and As~718 digested DNA.
The pKMY292 DNA L. -ine uncut by ~h~I and As~718 digestion.
Plasmid pKMY293 comprises the synthetic polylinker, PG ~ PR ~
-270 bp of the D~_R gene, and the tet~ gene i ~~iAtely downstream. The synthetic polylinker replaced the deleted 5 bp sequence ACAGC at the ScaI site of plasmid pRNY292 with the sequence ACCAT to generate the ~I site in the polylinker.
Thus, the insertion of the synthetic polylinker as described:
(i) converted the ScaI site into the Rsal site naturally occurring within PG; (ii) restored the distance between the RsaI
site and the coding region; (iii) generated an NdeI cloning site at the 3' end of the PG sequence; and (iv) placed a number of other cloning sites i -~iAtely downstream of the NdeI site.

Eg~XPLE 3 Construction of Intermediate Plasmid DKMY295 25 A. Preparation of Plasmid pKMY294 Plasmid pKMY293 DNA (Example 2) was digested with PstI and ~s~MII. In addition, plasmid pUC9 DNA (Vieira and Messing, 1982, Gene 19: 259-268) was digested with pstI and maI. The digested pK~Y293 and pUC9 DNAs were mixed, ligated and used to transform E. coli JM109 cells. Transformants were selected by plating on L-agar with tetracycline (10 ~g~ml) and ampicillin (500 ~g/ml).
The desired -4.8 kb plasmid, designated pKMY294 (Figure 3), was identified by miniprep analysis of ~hQI and EcoRI digested DNA.
Plasmid pKNY294 comprises the -2.0 kb PstI-~pMII fragment of -23- 206q74l pKMY293 inserted by ligation into the PstI and XmaI sites of pUC9. The ligation eliminated the XmaI and BspMII sites and placed an EcoRI site downstream of the tetr gene.
B. Preparation of Plasmid pKMY295 Plasmid pKMY294 DNA (Section A above) was digested with XhoI and EcoRI. In addition, plasmid pCFM1146 DNA was similarly digested with XhoI and EcoRI. The XhoI-EcoRI-digested pKMY294 and pCFM1146 DNAs were mixed, ligated and used to transform E. coli FM5 cells. E. coli FM5 cells were derived from a strain of E. coli K-12 and contained an integrated A phage repression gene, CI857 (Burnette et al., 1988, Bio/Technology 6: 699-706). Transformants were selected by plating on L-agar with tetracycline (10 ~g/ml) and kanamycin (50 ~g/ml). The resulting ~6.8 kb plasmid was designated pKMY295 (Figure 3). Miniprep analysis of XhoI-EcoRI digested pKMY295 confirmed that an ~2.0 kb fragment of pKMY294 had been successfully inserted in pCFM1146 with the concomitant deletion of a small segment of the pCFM1146 cloning site comprising the EcoRI-HpaI-KpnI-NcoI-HindIII-XhoI sites. In pKMY295, the transcription terminator in pCFM1146 is located immediately downstream of the multiple cloning sites of PG.

Construction of Intermediate Plasmid pKMY297 A. Preparation of Plasmid pKMY296 The starting materials for the construction of plasmid pKMY297 were plasmid pKMY296 DNA (Example 3) and plasmid pKMY513 DNA. Plasmid pKMY513 is essentially the pUC9 plasmid (Vieira and Messing, 1982, supra) in which the HindIII site has been deleted as follows. HindIII-digested pUC9 DNA was treated with the Klenow fragment of DNA
polymerase I to fill in the sticky ends created by the HindIII digestion. The Klenow-treated DNA was ligated, treated with Hind III, and used to transform E. coli JM109 cells. Transformants were selected on L-agar plates with W O 92/06186 P(~r/US91/06006 20697~

a~picillin (250 ~g/ml). Miniprep analysis of selected transformants confi ~ that the DNA was resistant to HindII~
digestion. The ~ III resistant plasmit DNA was designated pKMY513.
The pKKY513 DNA thus obtained was digested with EcoRI and E~HI. Plasmid pRMY295 DNA (Example 3) was digested with EcoRI
and EglII. The digested DNAs were mixed, ligated, and the ligation mixture used to transform ~. coli JM109 cells.
Transformants were selected on L-agar plates contAinin~
tetracycline (10 ~g/ml) and ampicillin (500 ~g/ml). The desired -5.1 kb plasmid, designated pKMY296 (Figure 10), contained the -2.4 kb EcoRI-BElII fragment of pKMY295 ligated with the -2.7 k~
EcoRI-~HI fragment of pKMY513. The ligation eliminated the EglII and ~HI sites ant placed a unique ~ I site downstream of the transcription te nAtor.
B. Preparation of Plasmid pKMY297 Plasmid pKMY296 DNA (Section A abo~e) was digested with Hin~TI~. Similarly, plasmid pKKY289 DNA (Example 1) was digested with ~ TI~. The digested pKMY296 and pKMY289 DNAs were mixed, ligated and used to transform ~. coli HBlOl cells conrAining plasmid pKMY512. Plasmid pKMY512 was used, in order to specifically select only those transfo ~nr~ that contained a plasmid ha~ing the -1.1 kb ~i_dIII fragment of pKMY289 inserted into the unique ~indIII site of pKMY296 to recreate a complete nahR gene. The construction of pKMY512 and its use in the selection of the desired transformant are described as follows.
The starting material for the construction of pKMY512 was plasmid pN400 DNA. Plasmid pN400 was itself constructed by cloning the -7.5 kb PvuII-B lII fragment of plasmid pE317 (Ensley et al., 1983, Science 222: 167-169), which contains the naphthalene dioxygenase genes from plasmid NAH7, into the SmaI
and BamHI sites of plasmid pUC18 (Yanisch-Perron et al., 1985, su~ra). Plasmid pN400 DNA was digested with SacI and an -6.4 kb SacI fragment conrAininp the naphthalene dioxygenase genes was inserted by ligation in the same orientation as the nahG gene into SacI-digested pKKY223 DNA to yield intermediate plasmid W O 92/06186 PCT/uS91/06006 Z0~97~

pKMY239. The desired plasmit pKMY512 was obtained by deletion of an -6.1 kb ~g~ EcoRI fragment from pKMY239 to delete a portion of the nahR gene and its activity. Plasmid pK~Y512 thus contains all the structural naphthalene dioxygenase genes, but no functional nahR gene. The nahR gene product positively controls the expression of the naphthalene dioxygenase structural genes, and these structural gene products are able to catalyze the production of indigo in E. coli as shown by Ensley et al., 1983, suDra. Without the nahR gene product, no expression of naphthalene dioxygenase activity and no indigo production is possible in transformants with pRMY512 alone. Uhen a transformant contains plasmid pKMY512, and a derivative of plasmid pKMY296 in which the -1.1 kb HindIII fragment of pKMY289 has been inserted in the correct orientation so as to yield a functional nahR gene, such a transformant contains two comple - ting plasmids and will be able to p od~ce indigo in the presence of an inducer of the naphth~enD dioxygenase genes.
Using this complementation system, transformants were initially selected on L-agar plates with 500 ~g/ml ampicillin (pRMY296 selection marker), 50 ~g/ml ~n- ~cin (pKMY512 selection marker), and 1.0 mM sodium salicylate as inducer of the naphthalene dioxygenase genes. Blue colonies, due to indigo production, were selected for further analysis. Miniprep DNA
from the blue colonies was used to transform E. coli H~101 cells, and these secondary transfor~ants were selected on L-agar plates with 500 l~g/ml ampicillin only. Miniprep analysis of HindIII
digested DNA from these secondary transformants confirmed that the -1.1 kb ~indIII fragment of pK~Y289 had been successfully cloned into the HindIII site of pK~Y296, thus generating the desired -6.2 kb plasmid designated pKMY297 (Figure 3).
Uith the successful construction of plasmid pKMY297, the -3.6 kb EcoRI-PstI cloning cartridge (or cloning cassette) conr~ining the 5 desired elements was completed. The cartridge contains a regulatory gene, a promoter regulated by the regulatory gene, a multiple cloning site (polylinker), a W O 92/06186 PC~r/US91/06006 Z069741.

transcription te n~tor, and 8 gene en~o~ing antibiotic resistance.

EaA~PLE 5 Con~truction of Plasmid oKMY299 To test the -3.6 kb EcoR I-Pst I fragment from pKMY297 for use as a cloning cartridge or cassette in different hosts, this fragment was inserted into a replicon derived from a broad host range plasmid RSF1010 (Scholz et al., 1989, supra). The broad host range expression vector pKMY299 was constructed as follows.
A. Preparation of Inre~ te Plasmid pKMY286 Plasmid pKT231 DNA (Example 1) was digested with SacI and HoaI. The HoaI site is between the EcoRI and SacI sites of pKT231, -200 bp from the SacI site. The SacI- and HoaI-digested pKMY231 DNA was treated with the Klenow fragment of DNA
polymerase I to create blunt ends. The Klenow-treated DNA was then ligated and used to transform ~. coli B 101 cells.
Transfo_ ~ne~ were selected on L-agar plates with 50 ~g/ml ~n ~cin. The resulting -10.3 kb plasmid was designated pKMY286. In pR~Y286, the HoaI and SacI sites from pKT231 were deleted, so that these two sites within the polylinker would be available as cloning sites.
B. Preparation of Plasmid pKMY299 Plasmid pKMY286 DNA (Section A above) was digested with p~RI and ~I. Plasmid pKMY297 DNA (Example 4) was also digested with EcoRI and PstI, and, in addition, with ScaI (to prevent regeneration of plasmid pKMY297). The digested pKMY286 and pKMY297 DNAs were mixed, ligated and used to transform E.
coli HB101 cells. Transformants were selected by plating on L-agar with tetracycline (10 ~g/ml). Tetracycline-resistant colonies were picked and tested on L-agar with tetracycline (10 ~g/ml) and ampicillin (500 ~g~ml). Tetracycline-resistant and ampicillin-sensitive colonies were picked and ~Ya~ined by miniprep analysis for the ligation of the -3.6 kb EcoRI-PstI cassette of plasmid pKMY297 with the -6.1 kb EcoRI-PstI fragment of plasmid 35 pKMY286. The desired -9.7 kb plasmid containin~ this cassette W O 92/06186 PC~r/US91/06006 2069741~

was desigr~ted pKMY299 (Figure 4). Pl~smit pKMY299 in E. coli ~B101 cells has been depositet with the American Type Gulture Collection as strain EcY5103 on September 25, l9gO and given accession number A.T.C.C. 68427.
C. Selected Sequence Analysis of Plas~id pKMY299 DNA
In pKMY299 the expected nucleotide sequences at the junction between PG and the multiple clo~ing site snd at the PstI junctlon between the cloning cartridge and the RSF1010 replicon were completely confi -~ by DNA sequence analysis. Sequences of 79 base pairs in PG~ upstream of the NdeI site and of 158 base pairs downstream of this site were determined. The sequence data demonstrated that, as expected, the 5' end of the synthetic polylinker was ligated at the ~_I site close to the 3' end of PG and that the polylinker ~eiuence downstream of the XhoI site was replaced by pCFM1146 sequences (Figure 3). Downstream from PG~ seven unique restriction sites including a ~deI site followed by ~E_I, ClaI, ~ 2~I, SacI, and ~hQI sites can be used for precise insertion of genes with the 5' end lying within a NdeI
recognition sequence. A oeq~e..ce of 337 bp, including 54 bp of the cloning cartridge upstream of the PstI recognition sequence and 277 bp of the RSF1010 replicon downstream of this sequence, was determined. This sequence indicated that the PstI end of the cloning cartridge was ligated, as expected, at the corresponding PstI site in RSF1010 DNA starting at nucleotide 7768 (Scholz et al., 1989, supra).
Similar sequence analysis of 303 bp of the RSF1010 replicon upstream of the EcoRI recognition sequence and 36 bp of the cloning cartridge downstream of this sequence, also demonstrated, as expected, that the EcoRI end of the cloning cartridge was ligated at the corresponding EcoRI site in RSF1010 DNA starting at nucleotide 8676 (Scholz et al., 1989, su~ra). However, the same analysis revealed that the sequence from nucleotides 1 to 1653 in RSF1010 DNA (Scholz et al., 1989, supra) was completely deleted in pKKY299. The deleted region contains the entire strA
gene and most of the strB gene dete ining streptomycin resistance (Scholz et al., 1989, supra). Restriction patterns of W 0 92/06186 P ~ /US91/06006 20~974~

pKNY286 and pKT231 DNA suggested that this deletion occurred in the plasmid pKT231 used, as described herein. Further _r~lysis of pKMY286 and pKMY299 DNA with various restriction enzymes did not detect other aberrations in pKMY299. Plasmid pKMY299 can be S considered, therefore, as an RSF1010 plasmid with nucleotides 1 to 1653 deleted and nucleotides 7768 eo 8676 replaced with a 3.6 kb cloning cartridge.

sr~YPLE 6 Construction of Plasmid DKMY319 Plasmid pKMY299 conr~ining the -3.6 kb EcoRI-PstI cloning cartridge, described in Example 5 above, was designed for the cloning and expression of genes conr~inine the NdeI recognition sequence at the 5' end. For the cloning and expression of restriction fragments ca.-~ing genes of unknown sequences, the cloning cartridge in pKHY299 was modified to remove the sequence ATG within the NdeI recognltion sequence in pKMY299 to prevent false translational initiation in gene expression from PG.
Specifically, the ATG equence within the NdeI recognition sequence of the polylinker from plasmid pKMY299 was removed as follows. Plasmid pKMY299 DNA (Example 5) was digested with NdeI
and ~_I, then treated with Mung Bean nuclease (New F.ngl ~n~
Biolabs, 32 Tozer Road, Beverly, MA 01915) according to the ontlf~rturer's instructions, to remove the overhang. The nuclease-treated DNA was then ligated and used to transform .
coli B 101 cells. Transformants were selected on L-agar plates with tetracycline tlO ~g/ml). The desired plasmid, in which the NdeI and HDaI sites were effectively deleted was designated pKMY319 (Figure 4). Plasmid pK~Y319 in . coli HB101 cells has been deposited with the American Type Culture Collection as strain EcY5110 on September 25, 1990 and given accession number A.T.C.C. 68426. When the sequence around the ligation site in pK~Y319 (i.e., ligation after NdeI, HDaI and Mung Bean nuclease treatment of pKMY299 DNA) was analyzed, it was found that in addition to removing the single-stranded AT overhang created by NdeI, ~ung Bean nuclease had L_ ~ed 8 bp of sequence, including Z069~41 -at least one of the nucleotides thought to be important for enro~ing the r~hoss -1 binding site 5' to the AUG translation start codon. (The seq~ence of this ribosomal binding site is reviewed in Yen and Serdar, 1988, CRC Crit. Rev. Microbiol. 15:
247-267 (see Figure 4 at p. 255). The expected sequence and the actually observed sequence around the ligation site in pK~Y319 is shown as follows:
* * * * *
expected T C A C G A G T A C C A A A C A T C G A T
ClaI
* * * *
observed T C A C G A C A T C G A T
ClaI

A disruption of this ribosomal binding site may prove advantageous in the use of pKNY319 for the expression of cloned fragments cont~ining genes of ~ sequences. Such a fragment often contains sequence(s) enroAing the rihos~ ~1 binding site(s) for the gene(s) it carries. In such cases, a second ribosome binding site might act to effectively reduce expression (Schauder and McCarthy, 1989, Gene 78: 59-72).

EXA~PLE 7 Construction of a pKMY319-derived Expression System for the Catechol 2.3-Dioxvgenase Gene of Plasmid NAH7 A. Preparation of Inte ~~iAte Plasmid pKKY514 Plasmid pKY67 is the NAH7 plasmid cont~in;ng a Tn5 insertion in the nahG gene (Yen and G~lnc~lac, 1982, Proc. Natl.
Acad. Sci. 79: 874-878). Plasmid pKY67 DNA and plasmid pUC19 DNA
(Yanisch-Perron et al., 1985, su~a) were digested with XmaI.
The digested pKY67 and pUCl9 DNAs were mixed, ligated and used to transform E. coli B101 cells. Transformants were selected by plating on L-agar with k~n~ ~cin (50 ~g/ml) and ampicillin (500 ~g/ml). The desired -5.4 kb plasmid, designated pKMY514, was pUC19 carrying an -2.7 kb ~_I insert Conr~ i n; ng the Tn5 gene e~o~;ne k~n: ~cin resistance and the NAH7 gene nahH encoding catechol 2,3-dioxygenase.

W O 92J06186 PC~r/uS91/06006 ~* l - / .

B. Preparation of ~nte ~ te Plasmid pKMYS15 Plasmid pKMY514 DNA (Section A above) was digested with ~s~I and ~h~l. A ~coI site and an ~h~I site have been mapped upstream and downstream of the nahH gene respectively (Ghosal et S al., 1987, Gene 33: 19-28). Plasmid pCFM1146 DNA (Example 3) was also treated with NcoI and ~kQI. The digested pKMY514 and pCFK1146 DNAs were mixed, ligated and used to transform E. coli FM5 cells. Transformants were selected by plating on L-agar with ~n ~cin (50 ~g/ml) at 28C. At 28C, the temperature inducible ~ promoter derived from pCFM1146 is off and transcription of the nahH gene is not inAvred. This master plate is kept under conditions whereby the nahH gene is not induced. Replica plates were made from the master plate. The replica plates were then incubated at 42C, so as to turn on the temperature inducible promoter ant induce the production of the nahH gene product, catechol 2,3-dioxygenase. To detect those colonies producing catechol 2,3-dioxygenase, the replica plates were sprayed with 0.5 M catechol. The o~eo~l is converted to a yellow-colored product, 2-~ LO~ ronic sr Al~ehyde, to yield yellow colonies.
The colonies on the master plate corresponding to the yellow colonies on the replica plate were picked, and grown at 28C.
The desired -6.2 kb plasmid designated pKMY515 was thereby obtained, comprising an -1.5 kb ~çQI-~h~I fragment from p~MY514.
This fragment contains the ~ahH gene inserted into the NcoI and 25 XhoI sites of the -4.7 kb pCFM1146. The ~_I site in pKMY514 which was derived from pCFM1146 is thus available for cloning the nahH gene in pKMY319 in the last step in the construction of the plasmid pKMY517 as described in Section C below.
C. Construction of pKMY517 for the Expression of NAH7 Catechol 2,3-Dioxygenase Gene Plasmid pKMY515 DNA (Section B above) was digested with ~I and Xhol. Similarly, plasmid pK~Y319 DNA (Example 6) was digested with Xbal and Xhol. The digested pKMY515 and pK~Y319 DNAs were mixed, ligated, and used to transform E. coli HB101 cells. Transformants were selected on L-agar plates cont~j ni ng tetracycline (10 ~g/ml). Io detect those colonies producing catechol 2,3-dioxygenase, the plates were sprayed with catechol, W O 92/06186 PC~r/US91/06006 - zo~9741. ~

as described in Section B above, and yellow colonies were selected. The tesired -11.2 kb plasmid for the expression of the NAH7 catechol 2,3-dioxygenase 8ene was obtained and designated pKMY517. It comprised an -1.5 kb ~ L I-~hQI fragment from pKHY515 co~rRininE the nah~ gene inserted into the XbaI and ~QI sites of pKMY319. These results suggested that inducible promoter in pKMY517 that was derived from pKMY319 was slightly leaky so that when a very sensitive assay with catechol was used, even small ts of rPtechol 2,3-dioxygenase were easily tetected in the pKMY517-transformed cells in the absence of induction. When the cells are inA~lred, large rc of catechol 2,3-dioxygenase may be produced, as described in Example 9 below.

E~AXPLE 8 Construction of a pKMY299-derived Expression System 15 for the Luciferase Gene of FireflY Photin-.~ Dyralis A. Preparation of pLu2 A double-stranded synthetic oligonucleotide was prepared with the following seq~ence:
NdeI
5~ .AAr.AcGC~AAAAA~ATAAA~AAA~GCCCGGCGCCATTCTATCCT-3' 3'-ACCTTCTGCG~ lAl~ CCGGGCCGCGGTAA~ATA~GATC-5' XbaI
Each strand was synthesized using an Applied Biosystems Model 380B nucleic acid synthesizer. The two strands were annealed by conventional methots, for example, Yansura et al., 1977, supra.
The two termini of the annealed oligonucleotide are compatible with termini generated by cleavage with ~I and ~_I. This touble-strandet oligonucleotide was mixed with pUCl9 DNA (Yanisch-Perron et al., su~ra) that had been digested with NdeI and XbaI, then ligated and used to transform E. coli JM83 cells (Vieira and Messing, 1982, Gene 19: 259-268). Transformants were selected by plating on L-agar with ampicillin (100 ~g/ml), IPTG (1 mM) and ~-gal (2 mg/ml~. The desired transformants, in which the -230 bp ~deI- aI fragment of pUCl9 conrRininE the lacZ gene was replaced by the synthetic oligonucleotide during the ligation, were ampicillin resistant and colorless. Miniprep analysis of the DNA

WO 92/06186 ~ PCI /1 IS91/06006 206~7~-from such transforoant colonies conf~ -c the presence of an -2.5 kb plasmid with expected ~I and 3p_I sites. One such isolate was designated pAD6. Plasmid pAD6 thus contains a coding s~qu~nce for the 5' end of the firefly luciferase gene begi~ning 5 with the seiuellce ATG enro~;ng the start codon (within the synthetically derived ~I site) and ending with the XbaI site at codon 16 (nucleotide 100) (see Figure 1 of de~et et al., 1987, Mol. Cell. Biol. 7:725-737).
In order to construct an intact firefly luciferase gene, plasmit pAD6 DNA was digested with NdeI and XbaI, releasing the synthetic oligonucleotide insert. The small insert fragment was isolated from a 10% polyacrylamide gel according to conventional methods. Plasmid pJD201 (deWet et al., l9B7, suDra) comprises a full-length, intronless Photinus Dyralis (firefly) luciferase gene constructed by a genomic DNA-cDNA fusion cloned into plasmid pUCl9. Plasmid pJD201 DNA was digested with XbaI and KDnI. The -1.7 kb frag~ent cont~;nin~ the majority of the fire n y luciferase gene coting sequence (i.e. from the ~_I cleavage site at codon 16 (nucleotide 101) to the ~I site in the polylinker of pUCl9) was isolated from a 0.7% agarose gel according to cu~ r.~ional methods. The ewo purified fragments (NdeI~ I and XbaI-KDnI ) enro~i n~ the complete firefly luciferase gene were mixed with plasmid pCFM1156 DNA that had been digested with NdeI
(at the ATG of pCF~1156) and ~I. Plasmid pCFM1156 is identical 25 to plasmid pCFM4722 described by Burnette et al., 1988, Bio~Technology 6: 699-796, and contains an inducible PL promoter, a rihos~ - binding site, a cloning cluster, . coli origin of replication, a transcription te_ n~tor, genes regulating plasmid copy number, and a ~n ~cin-resistance gene. The 3-fragment mixture was ligated and used to transform E. coli FM5 cells.
Transformants were selected on L-agar plates cont~i~ing 50 ~g/ml ~n ~in. The desired -6.4 kb plasmid was designated pLu2.
Miniprep analysis of restriction endonuclease digested pLu2 DNA
con~i d that an -1.7 kb ~ XbaI-K~nI insert had been successfully cloned into pCFM1156. The NdeI-H~aI-MluI-EcoRI-NcoI-KDnI linker was thus deleted from pCFM1156. Since there was W O 92/06186 ~069741.~ P ~ /US91/06006 a possibility that multiple copies of the small fragmen~ purified from pAD6 for the ligation could have been insertet, plasmid pLu2 DNA was subjected to DNA sequence analysis. The sequence analysis showed that a single copy of the small fragment of pAD6 had been inserted and confirmed the desired coding sequence of luciferase.
B. Preparation of Plasmid pKMY520 Plasmid pLu2 DNA (Section A above) was digested with NdeI
and ~p718 (Boehringer Cat. No. 814253). Asp718 recognizes the same 6 bp sequence as ~E~I, but cuts at a different site, as follows:
G'GTACC
CCATG~G
Similarly, plasmid pKMY299 DNA (Example 5) was digested with NdeI
and As~718. The designated pLu2 and pKMY299 DNAs were mixed, ligated and used to transform ~. ~1i B 101 cells. Transfo -n~5 were selected on L-agar plates with tetracycline (10 ~g/ml).
Colonies were picked, screened for luciferase activity, and tested by miniprep analysis as follows. Each colony picked was grown -15 hours in 5 ml of L-broth with 10 ~g/ml tetracycline.
Luciferase activity of each was assayed in accordance with the procedure of Example 10. Those with detectable luciferase activity were chPrk~d by miniprep analysis, using HindIII and Asp718 to digest the miniprep DNA. The desired plasmid contained three fragments: an -1.1 kb ~ndIII fragment, an -2.2 kb HindIII-As~718 fragment and an -8.1 kb (vector) HindIII-As~718 fragment.
It had a size of -11.4 kb and was designated pKMY520. Plasmid pKMY520 thus contains an -1.7 kb NdeI-As~718 fragment derived from pLu2 comprising the firefly luciferase gene inserted into the NdeI and K~nI sites of pKMY299.

F~MPLE 9 Ca~echol 2.3-Dioxvgenase Assav Cells were grown in 50 ml of PAS medium (Chakrabarty, et al., 1973, Proc. Natl. Acad. Sci. USA ~Q: 1137-1140) cont~;ning 0.4% glutamate or 50 ml of L-broth in the presence or absence of W O 92/06186 P ~ /US91/06006 .~ .. ..
Z06974~ -34-O.35 mM sodium salicylate (as in~..rer) for ^13-14 hrs. at 30~C.
The cells were harvested by centrifugation, the pellet wsshed with 20 ml of 100 ~M sodium phosphate buffer at pH 8.3. T~e cells were resua~el~ded in 5 ml of the same buffer with 10% (v/v) acetone for enzyme stabilization. The resuspended cells were sonicated using a cell disrupter ~f~tured by ~eat Systems -Ultrasonics, Inc. (Plainview, New York; available as model No.
U-375) and giving 5 pulses of 10 seconds/pulse with 1 minute between each pulse. After sonication, the suspension was centrifuged for 30 in~tes at 15,000 rpm in a Beckman Instruments, Inc. (Somerset, NJ 08875) J2-21 centrifuge with a JA20 rotor to yield a crude extract for assay and for SDS-PAGE
analysis. The pellet was discarded and the supernatant (crude extract) was used in the assay for catechol 2,3-dioxygenase activity essentiAlly according to Sala-Trepat and Evans, 1971, Eur. J. Biochem. 20: 400-413, as follows. The total volume for the assay was 1 ml. One to 10 ~1 of crude extract (or an appropriate dilute of extract) was mixed with 100 ~1 of 3.3 mM
catechol (substrate) and then ~lute~ up to 1 ml with assay buffer (100 mM sodium phosphate, pH 8.3 with 10% (v/v) acetone).
Formation of the yellow product, 2-1-ydrO~ conic semialdehyde (extinction coefficient ~ - 33.4 mM~~ cm~1) was measured at O.D.375 using a ~ec~ ~n DU-70 spectrophotometer. An aliquot of the crude extract was also used for the determination of protein concentration by the method of Bradford, 1976, Anal. Biochem. 72:
248 using the Bio-Rad Protein Assay Kit obtained from Bio-Rad Laboratories, Richmond, CA 94B04. The calculated specific activity (~mole/min/mg) is reported in Table I below. Strain PpG1901 (Yen and GtlnC~l AC, 1982, Proc. Natl. Acad. Sci. 79: 874-878; Yen and G~mc~l~c, 1985, J. Bacteriol. 162: 1008-1013) is Pseudomonas utida G1343 contAinin~ the wildtype NAH7 plasmid.
Strain PpY1006 is Pseudomas ~utida G572 (Shaham et al., 1973, J.
Bacteriol. 116: 944-949) con~inine plasmid pKMY517 (Example 7).
Table I shows that when cells from these 2 strains were grown in the presence of an inducer of the PG promoter (e.g., 0.35 mM
sodium salicylate), significant amounts of enzymatically active W O 92/06186 PCTtUS91/06006 Z06!~741 catechol 2,3-dioxygenase were expressed. The plasmid pKMY517 cO~esin~ the cstechol 2,3-dioxygenase gene derived from the NAH7 plasmid. Even ~ninA-~eed pKNY517-co~t~ining cells exhibit detectable levels of catechol 2,3-dioxygenase activity, indicating that the inA,~cihle promoter is somewhat ~leaky~ (i.e,, a small amount of enzyme is made even without an inducer of the D~
gene), Nonetheless, the results shown in Table I clearly demonstrate that when cells cont-~inin~ pKMY517 were grown in the presence of inA~cer, the highest levels of catechol 2,3-dioxygenase activity were observed, TABTF I
Expression of the Catechol 2,3-dioxygenase Gene of the Plasmit NAH7 from NAH7 ant the Plasmid Vector pKMY319 in Pse~ 95 putida Specific Activity of catechol 2,3-dioxygenase Plasmid Host Cell (~mole min~lm~
NAH7 l~ninA~ed P, Putida G1343 0.02 NAH7 inAuced P. Dutida G1343 0.8 pKMY517 l~ninA~ced P. utida G572 1.7 pKMY517 inA,l~ced P. D~t~da G572 20.0 These results demonstrated the usefulness of pKMY319 as an expression vector in obr~inin~ regulated gene expression.
Comparing the level of catechol 2,3-dioxygenese produced from NAH7 with that from pKMY517, a 25-fold overproduction was observed under the experimental conditions (Table I). Production of caeechol 2,3-dioxygenase relative to other proteins produced in P. ~utida harboring plasmid pKMY517 was analyzed on SDS-polyacrylamide gels (Figure 5). SDS-PAGE was performed essentially according to T r- 81i 1970, Nature 227: 680-685.
Protein samples (crude extracts prepared as described above) were heated at 65C for 15 min~tes in a loading buffer cont~inlng 2%
SDS, 5% 2-mercaptoethanol, 10% glycerol, 0.02% bromophenol blue and 62.5 mM Tris-Cl (pH 6.8) before they were loaded on the gel.

206974~

The gel was stained with C~ ~csie blue and sc~nn~d with a laser densitometer (Ultrascsn XL, Pharmacia LKB Biotechnology, Inc., Picc~e~sy~ NJ 08854) to dete~ in~ relative protein productions.
As shown in Figure 5: lanes 1 and 10 are molecular weight 5 standards (hen egg white l~soz~ ~, 14,400; soybean trypsin inhibitor, 21,500; bovine carbonic anhydrase, 31,000; hen egg white ov~ll n, 42,699; bovine serum albumin, 66,200; and rabbit muscle phosphorylsse b, 97,400): lanes 4 and 5 are PpY1006 in PAS, jn~red and ~in~ ed, respectively: and lanes 8 and 9 are PpY1006 in L-broth, in~uced and l~ninA~ced, respectively. Similar percentages of catechol 2,3-dioxygenase were produced whether the cultures were grown in PAS medium or L-broth. The amount of catechol 2,3-dioxygenase produced represented -10% of the total soluble cell proteins (Figure 5, lanes 4 and 8). These results demonstrated the usefulness of the pKMY319 expression vector for the oveL~Iu~ction of gene product(s).

T~ iferase AssaY
Strain Ppn 009 cells were grown in 5.0 ml of L-broth with 20 10 ~g/ml tetracycline at 30C to a density of O.D.~50 - 4.5 in the presence or sbsen~e of 0.35 mM sodium salicylate as an inducer. Strain Ppn 009 is Pseudomas putida G572 (Shaham et al., su~ra) cont~inin~ plasmid pKMY520. An aliquot of cell suspension (3-10 ~1) was mixed with water and 30 ~1 of assay buffer (0.2 M
25 HEPES, pH 7.7, 50 mM MgS0~) in a total volume of 100 ~1 in a cuvette. The cuvette was placed in a 1~ ter, for example, a LVMAC BIOCuu-~l~K M 2500 (LUMAC B.V., P. 0. Box 31101, 6370 AC
Landgraaf, The Netherlands). The light-emitting reaction was initiated by injection of 100 ~1 of 1 mM luciferin (Sigma 30 Chemical, St. L~uis, M0 63178) in 5 mM citrate buffer, pH 5.5, and 100 ~1 of 100 mM rATP in water. [The BIOCOuNl~K M 2500, a very sensitive photon counter controlled by a microprocessor, was operated for these analyses in the "A2 mode n ] . The light produced was displayed in relative light units (RLU) by the 35 1~ ter. [According to the Biocounter manufacturer's W O 92/06186 2069741 PC~r/US9l/06006 instructions, the photomultiplier is calibrated such that 200 pg ATP in 100 ~1 LDMIT-P~ gives 7,200 RLU]. The tata are reported as specific activity of luciferase (RLU/~g protein). Protein concentration was measured as describet in Example 9, using the methot of Bradfort, 1976, suDra ant the Bio-Rat Protein Assay Kit. Cells were resuspended in 0.1 N NaOH and incubated in a boiling water bath for 20 n~)tes before protein determination.

~r~RT.F II
Expression of the Luciferase Gene of the Firefly Photinus ~ralis from the Expression Vector pKMY299 in Pseudo~onas ~utida and Escher~chia çoli Specific activity of luciferase' Plasmit~ Host Cell~ (~TTI Der ~F ~rotein~
pKMY520 lminAllced ~. ~utida G572 4.5 x 10~
pKHY520 in~red P. ~utida G572 4.1 x 106 pKMY520 ~in~ced ~. coli JM103 1.9 x 103 pKMY520 in~lc~d _. coli JM103 1.5 x 105 'Plasmit pKMY520 is pKMY299 csrrying an insert co~inine firefly luciferase gene.
~Cells grown in L-broth as describet in this Exa~ple 10.
CCells not carrying the luciferase gene gave a background value of less than 30 RLU per ~g protein.

Production of luciferase protein in P. ~utida was also analyzed by SDS-PAGE, according to the methot described in Exa~ple 9 for the analysis of catechol 2,3-dioxygenase. Luciferase production in unin~t~ced P. ~utida cells harboring pKMY520 was barely visible on SDS gels when the cells were grown in PAS medium (Figure 5, lane 3) or in L-broth (Figure 5, lane 7). However, the high sensitivity of the luciferase assay allowed detection of relatively high enzyme activity from ~nin~ced P. ~utida or E.
s~l~ cells harboring pKMY520, as shown in Table II above. This assay also allowed detection of an -90-folt induction of activity in P. ~utida and an -80-folt intuction in E.coli (Table II).

_ -38- 206974 1 The SDS-PAGE analysis revealed that the amount of luciferase produced in induced P. putida harboring pKMY520 represented ~3.7~ of the total soluble proteins whether the cells were grown in PAS medium (Figure 5, lane 2) or in L-broth (Figure 5, lane 6). These results demonstratedregulated expression of a eukaryotic gene from pKMY299 in two different Gram-negative host cells.

Construction of and Assay for pKMY319-Derived Expression System for Toluene Monooxygenase (TMO) Genes The tmoABCDEF gene cluster from Pseudomonas mendocina KR-1 has been cloned and sequenced. To further test the use of pKMY319 as a regulated expression vector in Gram-negative bacteria, restriction fragments carrying the TM0 gene cluster from P. mendocina KR1 were cloned into pKMY319. Specifically, pKMY342 was constructed by cloning the ~4.7 kb XbaI-SacI fragment of pKMY341 carrying the TM0 gene cluster into pKMY319. Plasmid pKMY341 was constructed by cloning the ~4.7 kb XbaI-BamHI fragment of pKMY336 carrying the TM0 gene cluster into the E. coli vector pT7-5. The construction of pKMY336 has been described in detail in the above-referenced co-pending and co-assigned application. Analysis of pKMY342 DNA with restriction enzymes demonstrated that two copies of the XbaI-SacI
fragment joined by a SacI-KpnI-XbaI linker derived from the multiple cloning site in pKMY319 had been cloned into pKMY319. The pKMY342 recombinant plasmid carrying the TM0 gene cluster was then introduced into a number of Gram-negative bacterial species as shown in Table III below.
Expression of the TM0 genes was measured under induced and uninduced conditions. As shown in Table III, significantly higher specific activities of toluene monooxygenase were observed from induced cultures as compared with 21~69~4~
-inAl-red cultures of all bacterial strains tested. These results demonstrated the wide use of pKMY319 as an expression vector in obtsin;n~ regulated gene expression in Gram-negative bacteria.

TART ~ III
Expression of the Toluene Monooxygenase Gene Cluster ABCDEF of Pseudomonas mendocina KRl from the Plasmid Vector pKMY319 in Gram-Negative Bacteria Specific Acti~ity of Toluene Monooxygenaseb Bacterial Strain- (nmole min~lmg~
Aeromonas hydro~hila Y21, Iminduoed 0.3 Aeromonas hvdro~hila Y21, inAllre~ 17.0 15 Enterobacter cloacae Y81, min~-lced 0 9 Enterobacter cloacae Y81, indllred 23.0 Escherichia coli Y5250, min~l~ced 0.9 Escheri~hia Qli Y5250, in~l~ced 19.0 Kl ebsiella pl,e: niae Y61, min~lred 1.3 Klebsiella Dneumoniae Y61, ind~ced 15.0 Pseudomonas ~utida Y2511, l~nind~ced 0.8 Pseudomonas ~utida Y2511, 1n~ced 27.0 Pseudomonas mendocina Y4075, ~nin~uced 1.2 Pseudomonas mendocina Y4075, ;n~vred 19.0 'All bacterial strains contain the recombinant plasmid pKMY342, which is pKMY319 carrying an insert contAining the toluene monooxygenase gene cluster from P. mendocina KR1. The parent strains into which pKMY342 was introduced are all natural isolates.
bThe specific activities in toluene-inAvced and llnin~lced P.
mendocina KRl cells were 30 and 0.5 nmole min ~mg 1, respectively.

W O 92/06186 ~ PCT/US91/06006 EgA~PLE 12 Tailoring 5' End of Known Genes for Inser~ion into Plasmid D~MY299 EYnression Svstem Since the ~I recognition site ends with the sequence ATG, altering the 5' end of anv gene beg; nni ne with the sequence ATG
to generate an NdeI site does not lead to a change in the coding property of the gene. This is an ideal manner of generating a suitable 5' end restriction site for precise cloning of a gene for expression and requires the alteration of no more than 3 nucleotides. The 3 nucleotides that are 5' to the sequence ATG
~n~o~ing the start codon of a gene may be specifically converted by site-directed mutagenesis to CAT, thus creating an NdeI
recognition site for cloning into the pKMY299 broad host range expression system.
Site-directed mutagenesis is either accomplished according to conventional methods (for example, see Chapter 15 of Sambrook et al., 1989, Molecular Clonin~ - A Laboratory Manual (Second Edition), Cold Spring Harbor Laboratory Press, N.Y.; Chapter 8 of Current Protocols in Molecular BioloYY, Ausubel et al., eds., 1989, Greene Publiching A~soci~tes and Wiley-Interscience) or accomplished with the following steps: (i) locate a restriction site just inside the coding region; and ~ii) attach a synthetic oligonucleotide linker at this restriction site that restores the reading frame of this gene and contains an NdeI site at the 5' end. Examples of generating an NdeI site at the 5' end of a gene using the latter method can be found in Burnette et al., 1988, supra, or in Example 8 above. Such modified genes are useful for cloning into the pKMY299 broad host range expression system according to the present invention.

Claims (28)

THE EMBODIMENTS OF THE INVENTION IN WHICH AN EXCLUSIVE
PROPERTY OR PRIVILEGE IS CLAIMED ARE DEFINED AS FOLLOWS:

1. A cloning cartridge comprising: a positive regulatory gene nahR from plasmid NAH7; a promoter PG that is regulated by nahR, the promoter PG having a sequence of 3 nucleotides upstream of an ATG sequence encoding an initiation codon that has been altered to create an NdeI cloning site; a multiple cloning site; a transcription terminator; and a modified gene conferring tetracycline resistance.

2. A cloning cartridge according to Claim 1, further comprising a cloned characterized gene, wherein the 5, end of the gene has been converted into an NdeI site without altering coding of the gene.

3. A cloning cartridge according to Claim 2, wherein the cloned characterized gene is luciferase.

4. A cloning cartridge according to Claim 1, wherein the ATG sequence has been deleted.

5. A cloning cartridge according to Claim 4, further comprising a cloned restriction fragment containing a gene or a gene cluster.

6. A cloning cartridge according to Claim 5, wherein the cloned restriction fragment comprises a gene encoding catechol 2,3-dioxygenase.

7. A cloning cartridge according to Claim 5, wherein the cloned restriction fragment comprises genes encoding toluene monooxygenase.

8. A bacterial expression vector comprising the cloning cartridge of Claim 1.

9. A bacterial expression vector comprising the cloning cartridge of Claim 2.

10. A bacterial expression vector comprising the cloning cartridge of Claim 4.

11. A bacterial expression vector comprising the cloning cartridge of Claim 5.

12. A bacterial expression system comprising pKMY299.

13. A bacterial expression system comprising pKMY319.

14. A bacterial DNA expression unit comprising the cloning cartridge of Claim 1, operably linked to a heterologous gene.

15. A bacterial DNA expression unit comprising the cloning cartridge of Claim 1, operably linked to a heterologous gene.

16. A bacterial DNA expression unit comprising the cloning cartridge of Claim 4, operably linked to a heterologous gene.

17. A unicellular host transformed with the bacterial expression vector of Claim 8.

18. A unicellular host transformed with the bacterial expression vector of Claim 9.

19. A unicellular host transformed with the bacterial expression vector of Claim 10.

20. A unicellular host transformed with the bacterial expression vector of Claim 11.

21. A unicellular host transformed with the bacterial expression system of Claim 12.

22. A unicellular host transformed with the bacterial expression system of Claim 13.

23. A unicellular host transformed with the bacterial expression unit of Claim 14.

24. A unicellular host transformed with the bacterial expression unit of Claim 15.

25. A unicellular host transformed with the bacterial expression unit of Claim 16.

26. A process for inducibly expressing a protein in a bacterial host cell comprising the steps of:
(a) transforming the host cell with the bacterial DNA
expression unit of Claim 14;
(b) growing the transformed host cell in an appropriate medium; and (c) inducing the transformed host cell to express the protein by adding an inducer.

27. A process according to Claim 26, wherein the host cell is a gram-negative bacterial cell.

28. A process according to Claim 27, wherein the inducer is sodium salicylate or an analog of sodium salicylate.