CA2067114A1 - Sensitive method for measurement of chimeric transcripts of dna containing translocations - Google Patents
Sensitive method for measurement of chimeric transcripts of dna containing translocationsInfo
- Publication number
- CA2067114A1 CA2067114A1 CA 2067114 CA2067114A CA2067114A1 CA 2067114 A1 CA2067114 A1 CA 2067114A1 CA 2067114 CA2067114 CA 2067114 CA 2067114 A CA2067114 A CA 2067114A CA 2067114 A1 CA2067114 A1 CA 2067114A1
- Authority
- CA
- Canada
- Prior art keywords
- mrna
- measuring
- sample
- micro
- translocation
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Abandoned
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
- C12Q1/6886—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/112—Disease subtyping, staging or classification
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Health & Medical Sciences (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Engineering & Computer Science (AREA)
- Immunology (AREA)
- Pathology (AREA)
- Analytical Chemistry (AREA)
- Zoology (AREA)
- Genetics & Genomics (AREA)
- Wood Science & Technology (AREA)
- Physics & Mathematics (AREA)
- Biotechnology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Hospice & Palliative Care (AREA)
- Biophysics (AREA)
- Oncology (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
A novel method for measuring mRNA has been described. The method combines reverse transcriptase and polymerase chain reaction to achieve efficient and sensitive measurement.
Description
WO91/050~ 2 ~ ~ r~ PCT/US90/0~27 A SENSITIVE METHOD FOR MEASUREMENT OF CHIMERIC
TRANSCRIPTS OF DNA CONTAINING TRANSLOCATIONS
The present invention is related generally to the measurement of mRNA present in a biological sample.
More particularly, the present invention is related to a sensitive and ef-~cient method of measuring chimeric mRNA
resulting from a chromosomal translocation, especially from biopsy specimens or the like, by a novel technique combining reverse transcription and polymerase chain reaction (PCR).
BACKGROUND OF THE INVENTION
Follicular lymphoma is a common B-cell neoplasm which has remained largely an incurable disease.
Approximately 95~ of follicular lymphom~s carry the t(l4;18) (q32;q21) chromosomal translocation which results in joining of the putative oncogene bc1-2 on chromosome 18 to the immunoglobulin heavy chain joining region gene, JH, on chromosome 14 (Tsujimoto et al, 1984, Science 226:1097; Tsujimoto et al, 1985, Science 228:1440). This creates a unique segment of DNA composed of a joined bc1-2/JH seauence. Studies with cell lines have indicated that this translocation results in deregulation of bc1-2 expression, perhaps due to the effect of the IgH enhancer, leading to inappropriately high levels of the bcl-2 fusion transcript (Seto et al, 1988, Embo.J. 7:123; Hua, 1988, Oncoaene Res. 2:263).
The high level expression of this chimeric transcript in follicular lvmphoma has been proposed as a factor involved in the pathogenesis of follicular lymphoma (Tushjimoto, Y., 1989, Proc. Natl. Acad. Sci 86:1958) and the level of expression may be correlated with clinical course. Howeve , the levels of the bcl-2-Ig fusion -: :, . .,, : : . . .
,~ - ' :
- . . : .
W091/050~ ~ PCT/US90/05427 transcript in follicular lymphoma tissue has not been studied and correlated to clinical prognosis due to the relatively low levels of expression compared with other gene products and inherent difficulties in isolation of S RNA containing sufficient quantities of the chimeric mRNA
from biopsy specimens. Conventional methods involve preparation of large quantities of ~NA, denaturation of RNA, electrophoresis in agarose formaldehyde gels and transfer to a nitrocellulose paper followed ~ by hybridization with a specific probe and comparison to a product of known level of expression (Graninger et al, 1987, J. Clin. Invest. 80:1512). A reliable method for detecting micro quantities of ~RNA found in biopsy samples is still needed.
SUMMARY OF THE INVENTION
It is, thereore, an object of the present invention to provide a sensitive, reliable and efficient method for detecting micro quantities of mRNA found in biological samples, such as biopsy specimens.
It is a further object of the present invention to provide a diagnostic test for detecting and predicting the course of conditions resulting from t(14;18) translocation, such as follicular lymphoma, Hodgkins disease and the like.
Other objects and advantages will become evident from the following detailed description of the invention.
BRIEF DESCRIPTION OF THE DRANINGS
These and other objects, features and many of the attendant advantages of the invention will be better understood upon a reading of the following detailed description when considered in connection with the accompanying drawings wherein:
. , . , . . . . - .. ,~
WO91/050~ h ~ S 1 ~1 PCT/US90/05427 Figure 1 shows different levels of expression of bc1-2. RNA extracted from tumor cells (lanes 1, 2, 3, 4) and from the cell line S~DHL-6 (lanes 5 and 6) was reverse transcribed and specifically amplified using the polymerase chain reaction technique. The amplified segments are subjected to electrophoresis and Southern blotting. Southern blots were then probed with a 32-P-labeled internal oligo.
The above and various other objects and advantages of the invention are achieved by a method for detecting the presence of mRNA in a biological sample which comprises:
(a) extracting mRNA from a biological sample by any suitable procedure;
(b) then reverse transcribing the extracted mRNA using for example, moloney murine leukemia virus reverse transcriptase to obtain cDNA; and (c) then amplifying by PCR a diagnostic fragment of the cDNA and quantitating the product thus obtained by any suitable means known to one of ordinary skill in the art, such as radiometric, fluorometric, colorometric, densitometric, photometric measurements and the like.
Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Although any methods and materials similar or equivalent to those described herein can be used in the practice or testing of the ' t ' '~ - . '` . ~ . . . ,' ., , ', , -, : .
~al~c~,ur~,l/rlu ~ y P~ US9/ C5 4 present invention, the preferred methods and materials .
are now described. All publications mentioned hereunder are incorporated herein by reference. Unless mentioned otherwise, the techniques employed or contemplated herein are standard methodologies well known to one of ordinary skill in the art. The materials, methods and examples are illustrative only and not limiting.
MATERIALS AND METHODS
Materials. The following is a list of materials and their sources.
Guanidine isothiocyanate - Sigma; Cesium chloride -Bethesda Research Lab (BRL); Moloney murine leukemia :
virus reverse transcriptase - BRL; Fast tract mRNA .;
isolation kit-Invitrogen; Tris and agarose - BRL; EDTA- : :
Fischer; Taq polymerase - Cetus; dATP, dTTP, dCTP, dGTP -Pharmacia; Nusieve and Sea kemp agarose - FMC;
Genescreen - DuPcnt; 32-P-gamma ATP - ICN.
Methods Two methods of. RNA extraction. are used, a . 2Q... micrnprocedure and a.~tanda~-~e~hnd, ThR.micr~procPdu~-.....
- . inYolves pe}letin~ of an.aliquat... nf.. lOQ,QQO .cel~.. in.~ . .
- sterlle Eppendorf tubesj a~ditLon of:about~ g of yeast-. . -R~- and. suspensisn.. cf.. :~e~ls-.an~ RNa.in lOO ~l....... o~
i - guanidin~;isath~Qcyana~ buffer. ~h;5 lS . layered.. o~er~
25 100 ~1 of -:.5.~ ~.~sCl:~and..centrif~ged at 75,000 L~ for-two hours in the Beckman TL-100. The resulting pellet is, precipitated with ammonium acetate and ethanol and resuspended in 10 ~l of sterile Tris EDTA buffer.
The standard method uses the Fast Tract mRNA
Isolation Xit (Invitrogen) and provides polyA selected mRNA. The extracted RNA is reverse transcribed using Moloney Murine Leukemia Virus Reverse Transcriptase (BRL) SUBSTITUTE S~
., . . - .
. . .... ~ -.. : .. , - : .
.
, , .. ~ . .~, . .` . .
WO9l/OSO~ ~O~ PCT/US90/05427 and one of two types of primers, oligo dT12-18 and a mixture of a specific immunoglobulin heavy chain mu constant region primer Cmu(GAGGGGGAAAAGGGTTGGGGCGGAT) and a specific immunoglobulin heavy chain gamma constant region primer C gamma (CAACTGTCTTGTCCACCTTGGTGTT). The reverse transcription reaction is terminated after production of the first strand by addition of Na-EDTA, phenol chloroform extraction and ethanol precipitation.
The cDNA is resuspended in 10-15 ~1 of tris EDTA bu~fer and 5 ~1 are amplified using the polymerase chain reaction technique (PCR) with Taq polymerase (Cetus).
The primers for PCR are the mu constant region and gamma constant region primers described above and the bc1-2 primer adjacent to the major breakpoint region (TTAGAGAGTTGCTTTACGTGGCCTG) reported by Stetler-Stevenson et al (1988, Blood 72:1822) as well as 5' and 3' primers for a standard housekeeping gene such as beta actin.
PCR is performed in the Thermocycler (Perkin Elmer Cetus) using a 100 mM Tris HCl buffer, pH8.~, containing 500 mM KCl, 15 mM MgCl, 0.1% gelatin, 2.5 units of Taq polymerase, 200 ~M each of dATP, dTTP, dCTP, and dGTP as well as 1 ~g of each primer. The reaction mixture is heated to 91C for 5 minutes, cooled to 55 C
for 5 minutes and brought to 74C for 5 minutes.
Following this first round, samples are heated at g4C, 55C, and 74C for 1.5, 1.5, and 2 minutes, respectively, for a total of forty cycles. Fifty percent of the PCR
sample (25~1) is resolved by electrophoresis (lOOV, 4-6 hr) in either 1.5% agarose (BRL) or 3% NuSieve (FMC) and 1% SeaKemp (FMC) a irose with O.5 ~g ethidium bromide/ml in Tris-Borate buffer. Alkaline Southern transfers are performed overnight using Genescreen Plus nylon filters - . .
- . . : . : , . . . ., ..... : . , . . ~ . : , - . - ~ :
: . . -: , . , . . ~ .
: : , .- :: : : .
WO91/050~ 2 0 ~ PCT/US90/05427 (DuPont) and 0.4 N NaOH as a transfer buffer. Blots are then probed with a 32P-labeled 2.8 kb EcorRI/HindIII
fragment of the bc1-2 major breakpoint region, a 32P-labeled genomic JH SauIIIA fragment, and a 32P-labeled oligo with a sequence complimentary to a region immediately 3' to the bc1-2 primer (CAACACAGACCCACCCAGAGCCCTCCTGCCCTCCTTCCGCGGGGGC).
Amplified segments ranging between 125 and 300 base pairs are detected by autoradiography. PCR amplification~of contaminating genomic DNA produces a product several kilobases in length due to the nontranscribed region (intron) between JH and C mu or C gamma that is present in the rearranged gene, but not in the mRNA transcript.
Thus, the technique of the present invention allows easy discrimination between PCR amplified products from the mRNA and genomic levels. The blots are also probed for the housekeeping gene amplified segment, such as beta actin. Comparison of the chimeric bc1-2/JH amplified segment intensity to the intensity of the beta actin amplified segment allows relative quantitation of the expression of bc1-2.
Utilities:
1. This technique can be used to diagnose tissue or ~-peripheral blood involvement with lymphoma. RNA
is extracted from tissue or mononuclear cells isolated from blood and subjected to the procedures described herein above. Presence of the translocation is indicative of tumor involvement in the setting of follicular lymphoma.
TRANSCRIPTS OF DNA CONTAINING TRANSLOCATIONS
The present invention is related generally to the measurement of mRNA present in a biological sample.
More particularly, the present invention is related to a sensitive and ef-~cient method of measuring chimeric mRNA
resulting from a chromosomal translocation, especially from biopsy specimens or the like, by a novel technique combining reverse transcription and polymerase chain reaction (PCR).
BACKGROUND OF THE INVENTION
Follicular lymphoma is a common B-cell neoplasm which has remained largely an incurable disease.
Approximately 95~ of follicular lymphom~s carry the t(l4;18) (q32;q21) chromosomal translocation which results in joining of the putative oncogene bc1-2 on chromosome 18 to the immunoglobulin heavy chain joining region gene, JH, on chromosome 14 (Tsujimoto et al, 1984, Science 226:1097; Tsujimoto et al, 1985, Science 228:1440). This creates a unique segment of DNA composed of a joined bc1-2/JH seauence. Studies with cell lines have indicated that this translocation results in deregulation of bc1-2 expression, perhaps due to the effect of the IgH enhancer, leading to inappropriately high levels of the bcl-2 fusion transcript (Seto et al, 1988, Embo.J. 7:123; Hua, 1988, Oncoaene Res. 2:263).
The high level expression of this chimeric transcript in follicular lvmphoma has been proposed as a factor involved in the pathogenesis of follicular lymphoma (Tushjimoto, Y., 1989, Proc. Natl. Acad. Sci 86:1958) and the level of expression may be correlated with clinical course. Howeve , the levels of the bcl-2-Ig fusion -: :, . .,, : : . . .
,~ - ' :
- . . : .
W091/050~ ~ PCT/US90/05427 transcript in follicular lymphoma tissue has not been studied and correlated to clinical prognosis due to the relatively low levels of expression compared with other gene products and inherent difficulties in isolation of S RNA containing sufficient quantities of the chimeric mRNA
from biopsy specimens. Conventional methods involve preparation of large quantities of ~NA, denaturation of RNA, electrophoresis in agarose formaldehyde gels and transfer to a nitrocellulose paper followed ~ by hybridization with a specific probe and comparison to a product of known level of expression (Graninger et al, 1987, J. Clin. Invest. 80:1512). A reliable method for detecting micro quantities of ~RNA found in biopsy samples is still needed.
SUMMARY OF THE INVENTION
It is, thereore, an object of the present invention to provide a sensitive, reliable and efficient method for detecting micro quantities of mRNA found in biological samples, such as biopsy specimens.
It is a further object of the present invention to provide a diagnostic test for detecting and predicting the course of conditions resulting from t(14;18) translocation, such as follicular lymphoma, Hodgkins disease and the like.
Other objects and advantages will become evident from the following detailed description of the invention.
BRIEF DESCRIPTION OF THE DRANINGS
These and other objects, features and many of the attendant advantages of the invention will be better understood upon a reading of the following detailed description when considered in connection with the accompanying drawings wherein:
. , . , . . . . - .. ,~
WO91/050~ h ~ S 1 ~1 PCT/US90/05427 Figure 1 shows different levels of expression of bc1-2. RNA extracted from tumor cells (lanes 1, 2, 3, 4) and from the cell line S~DHL-6 (lanes 5 and 6) was reverse transcribed and specifically amplified using the polymerase chain reaction technique. The amplified segments are subjected to electrophoresis and Southern blotting. Southern blots were then probed with a 32-P-labeled internal oligo.
The above and various other objects and advantages of the invention are achieved by a method for detecting the presence of mRNA in a biological sample which comprises:
(a) extracting mRNA from a biological sample by any suitable procedure;
(b) then reverse transcribing the extracted mRNA using for example, moloney murine leukemia virus reverse transcriptase to obtain cDNA; and (c) then amplifying by PCR a diagnostic fragment of the cDNA and quantitating the product thus obtained by any suitable means known to one of ordinary skill in the art, such as radiometric, fluorometric, colorometric, densitometric, photometric measurements and the like.
Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Although any methods and materials similar or equivalent to those described herein can be used in the practice or testing of the ' t ' '~ - . '` . ~ . . . ,' ., , ', , -, : .
~al~c~,ur~,l/rlu ~ y P~ US9/ C5 4 present invention, the preferred methods and materials .
are now described. All publications mentioned hereunder are incorporated herein by reference. Unless mentioned otherwise, the techniques employed or contemplated herein are standard methodologies well known to one of ordinary skill in the art. The materials, methods and examples are illustrative only and not limiting.
MATERIALS AND METHODS
Materials. The following is a list of materials and their sources.
Guanidine isothiocyanate - Sigma; Cesium chloride -Bethesda Research Lab (BRL); Moloney murine leukemia :
virus reverse transcriptase - BRL; Fast tract mRNA .;
isolation kit-Invitrogen; Tris and agarose - BRL; EDTA- : :
Fischer; Taq polymerase - Cetus; dATP, dTTP, dCTP, dGTP -Pharmacia; Nusieve and Sea kemp agarose - FMC;
Genescreen - DuPcnt; 32-P-gamma ATP - ICN.
Methods Two methods of. RNA extraction. are used, a . 2Q... micrnprocedure and a.~tanda~-~e~hnd, ThR.micr~procPdu~-.....
- . inYolves pe}letin~ of an.aliquat... nf.. lOQ,QQO .cel~.. in.~ . .
- sterlle Eppendorf tubesj a~ditLon of:about~ g of yeast-. . -R~- and. suspensisn.. cf.. :~e~ls-.an~ RNa.in lOO ~l....... o~
i - guanidin~;isath~Qcyana~ buffer. ~h;5 lS . layered.. o~er~
25 100 ~1 of -:.5.~ ~.~sCl:~and..centrif~ged at 75,000 L~ for-two hours in the Beckman TL-100. The resulting pellet is, precipitated with ammonium acetate and ethanol and resuspended in 10 ~l of sterile Tris EDTA buffer.
The standard method uses the Fast Tract mRNA
Isolation Xit (Invitrogen) and provides polyA selected mRNA. The extracted RNA is reverse transcribed using Moloney Murine Leukemia Virus Reverse Transcriptase (BRL) SUBSTITUTE S~
., . . - .
. . .... ~ -.. : .. , - : .
.
, , .. ~ . .~, . .` . .
WO9l/OSO~ ~O~ PCT/US90/05427 and one of two types of primers, oligo dT12-18 and a mixture of a specific immunoglobulin heavy chain mu constant region primer Cmu(GAGGGGGAAAAGGGTTGGGGCGGAT) and a specific immunoglobulin heavy chain gamma constant region primer C gamma (CAACTGTCTTGTCCACCTTGGTGTT). The reverse transcription reaction is terminated after production of the first strand by addition of Na-EDTA, phenol chloroform extraction and ethanol precipitation.
The cDNA is resuspended in 10-15 ~1 of tris EDTA bu~fer and 5 ~1 are amplified using the polymerase chain reaction technique (PCR) with Taq polymerase (Cetus).
The primers for PCR are the mu constant region and gamma constant region primers described above and the bc1-2 primer adjacent to the major breakpoint region (TTAGAGAGTTGCTTTACGTGGCCTG) reported by Stetler-Stevenson et al (1988, Blood 72:1822) as well as 5' and 3' primers for a standard housekeeping gene such as beta actin.
PCR is performed in the Thermocycler (Perkin Elmer Cetus) using a 100 mM Tris HCl buffer, pH8.~, containing 500 mM KCl, 15 mM MgCl, 0.1% gelatin, 2.5 units of Taq polymerase, 200 ~M each of dATP, dTTP, dCTP, and dGTP as well as 1 ~g of each primer. The reaction mixture is heated to 91C for 5 minutes, cooled to 55 C
for 5 minutes and brought to 74C for 5 minutes.
Following this first round, samples are heated at g4C, 55C, and 74C for 1.5, 1.5, and 2 minutes, respectively, for a total of forty cycles. Fifty percent of the PCR
sample (25~1) is resolved by electrophoresis (lOOV, 4-6 hr) in either 1.5% agarose (BRL) or 3% NuSieve (FMC) and 1% SeaKemp (FMC) a irose with O.5 ~g ethidium bromide/ml in Tris-Borate buffer. Alkaline Southern transfers are performed overnight using Genescreen Plus nylon filters - . .
- . . : . : , . . . ., ..... : . , . . ~ . : , - . - ~ :
: . . -: , . , . . ~ .
: : , .- :: : : .
WO91/050~ 2 0 ~ PCT/US90/05427 (DuPont) and 0.4 N NaOH as a transfer buffer. Blots are then probed with a 32P-labeled 2.8 kb EcorRI/HindIII
fragment of the bc1-2 major breakpoint region, a 32P-labeled genomic JH SauIIIA fragment, and a 32P-labeled oligo with a sequence complimentary to a region immediately 3' to the bc1-2 primer (CAACACAGACCCACCCAGAGCCCTCCTGCCCTCCTTCCGCGGGGGC).
Amplified segments ranging between 125 and 300 base pairs are detected by autoradiography. PCR amplification~of contaminating genomic DNA produces a product several kilobases in length due to the nontranscribed region (intron) between JH and C mu or C gamma that is present in the rearranged gene, but not in the mRNA transcript.
Thus, the technique of the present invention allows easy discrimination between PCR amplified products from the mRNA and genomic levels. The blots are also probed for the housekeeping gene amplified segment, such as beta actin. Comparison of the chimeric bc1-2/JH amplified segment intensity to the intensity of the beta actin amplified segment allows relative quantitation of the expression of bc1-2.
Utilities:
1. This technique can be used to diagnose tissue or ~-peripheral blood involvement with lymphoma. RNA
is extracted from tissue or mononuclear cells isolated from blood and subjected to the procedures described herein above. Presence of the translocation is indicative of tumor involvement in the setting of follicular lymphoma.
2. This technique can be used to determine the level of bc1-2 expression and this may be ~ . . ,, - .
' ~
W091/OSO~ ~ PCT/US90/05427 ~.c,,O,, utilized in determination of prognosis and thus in selection of proper treatment modalities.
' ~
W091/OSO~ ~ PCT/US90/05427 ~.c,,O,, utilized in determination of prognosis and thus in selection of proper treatment modalities.
3. This technigue can be used to measure the expression of any known oncogene in tumor tissue and thus be utilized as a prognostic indicator and for selection of appropriate therapy.
4. This technique can be used to determine the presence of leukemic cells containing a translocation and thus allow early detection of relapse following therapy.
5. This technique can be used to determine the level of expression of proteolytic enzymes involved in tumor invasion and metastasis and thus provide an indicator of metastatic potential in tumors.
6. This technique is also useful in staging of Hodgkins disease in cases with known t(14:18) translocation. As mentioned herein before, mRNA
is isolated, reverse transcribed and the cDNA
fragment amplified and quantitated by standard methodologies well known in the art; a difference from the known steady state level of mRNA being indicative of the presence of t~14;18) translocation.
In summary, the combined reverse transcription polymerase chain reaction is a novel technique for measurement of bc1-2 transcripts requiring only small quantities of RNA that can be easily obtained at the time of biopsy. Low levels (nanogram quantities) of bc1-2/JH
mRNA can still be detected because following reverse transcription the specific bc1-2/JH segment is amplified up to a million fold by the polymerase chain reaction , ' ' , , W091~050~ 2 0 5 ~ PCTtUS90/05427 technique (Saiki et al, 1988, Sci. 239:487).
Furthermore, amplified segments are run in agarose gels without formaldehyde thus removing a significant health hazard to laboratory personnel. Detection of a segment of genomic DNA or of RNA containing the t(14;18) translocation is diagnostic for tissue or peripheral blood involvement with follicular lymphoma in patients with this primary diagnosis and in addition, determination of levels of expression allows prediction of clinical cause. Therapy modified according to the prognosis indicated by this determination may achieve better patient survival. The t(l4;18) translocation has recently been found in Hodgkins disease and, therefore, the combined reverse transcription polymerase chain reaction measurement of bc1-2/JH transcripts can be applied to this disease as well.
The method could also be applied to measure the expression of oncogenes and enzyme markers involved in tumor invasion and metastasis in other neoplasms.
Furthermore, this diagnostic test allows a more accurate assessment of the aggressiveness of individual tumors and appropriate adjustment of therapy. A diagnostic test for predicting the clinical course of a malignancy where aggressive behavior by malignant cells is associated with deregulation of an oncogene, lower expression of an antioncogene, or excessive production of proteolytic enzymes associated with metastasis, comprises the step of measuring the level of target gene (oncogene, antioncogene or enzyme and the like) mRNA in tumor specimens by the method of the present invention and comparing the level of this mRNA with mRNA of normal uninvolved tissue, any statistically significant . - . : : -.
. :. ~- . - - . ~ :
. . - ~ , :
.
wo gl~oSo~ ~ d S ~J i l ~ PCT/US90/0~27 .,~".
deviation from the normal levels being indicative of the clinical behavior of the tumor.
It is understood that the examples and embodiments described herein are for illustrative purposes only and that various modifications or changes in light thereof will be suggested to persons skilled in the art and are to be included within the spirit and purview of this application and scope of the appended claims. ~ -. - . , . . , - ...... , ., ., . . . . . , :
- ~ - . . . , , :-:. . . : . ., : : . : . : : . ~
,. ~ . . , .. . . , . . . . ~ . . .
is isolated, reverse transcribed and the cDNA
fragment amplified and quantitated by standard methodologies well known in the art; a difference from the known steady state level of mRNA being indicative of the presence of t~14;18) translocation.
In summary, the combined reverse transcription polymerase chain reaction is a novel technique for measurement of bc1-2 transcripts requiring only small quantities of RNA that can be easily obtained at the time of biopsy. Low levels (nanogram quantities) of bc1-2/JH
mRNA can still be detected because following reverse transcription the specific bc1-2/JH segment is amplified up to a million fold by the polymerase chain reaction , ' ' , , W091~050~ 2 0 5 ~ PCTtUS90/05427 technique (Saiki et al, 1988, Sci. 239:487).
Furthermore, amplified segments are run in agarose gels without formaldehyde thus removing a significant health hazard to laboratory personnel. Detection of a segment of genomic DNA or of RNA containing the t(14;18) translocation is diagnostic for tissue or peripheral blood involvement with follicular lymphoma in patients with this primary diagnosis and in addition, determination of levels of expression allows prediction of clinical cause. Therapy modified according to the prognosis indicated by this determination may achieve better patient survival. The t(l4;18) translocation has recently been found in Hodgkins disease and, therefore, the combined reverse transcription polymerase chain reaction measurement of bc1-2/JH transcripts can be applied to this disease as well.
The method could also be applied to measure the expression of oncogenes and enzyme markers involved in tumor invasion and metastasis in other neoplasms.
Furthermore, this diagnostic test allows a more accurate assessment of the aggressiveness of individual tumors and appropriate adjustment of therapy. A diagnostic test for predicting the clinical course of a malignancy where aggressive behavior by malignant cells is associated with deregulation of an oncogene, lower expression of an antioncogene, or excessive production of proteolytic enzymes associated with metastasis, comprises the step of measuring the level of target gene (oncogene, antioncogene or enzyme and the like) mRNA in tumor specimens by the method of the present invention and comparing the level of this mRNA with mRNA of normal uninvolved tissue, any statistically significant . - . : : -.
. :. ~- . - - . ~ :
. . - ~ , :
.
wo gl~oSo~ ~ d S ~J i l ~ PCT/US90/0~27 .,~".
deviation from the normal levels being indicative of the clinical behavior of the tumor.
It is understood that the examples and embodiments described herein are for illustrative purposes only and that various modifications or changes in light thereof will be suggested to persons skilled in the art and are to be included within the spirit and purview of this application and scope of the appended claims. ~ -. - . , . . , - ...... , ., ., . . . . . , :
- ~ - . . . , , :-:. . . : . ., : : . : . : : . ~
,. ~ . . , .. . . , . . . . ~ . . .
Claims (6)
1. (Amended) A method for measuring micro quantities of mRNA in a bilogical sample, comprising the steps of:
(a) isolating micro quantities of mRNA sample by adding carrier RNA in a micro volume of RNase inhibiting buffer and recovering the mRNA
contained in said biological sample in a resuspending medium;
(b) reverse transcribing the isolated mRNA from step (a) to obtain cDNA;
(c) amplifying the cDNA obtained from step (b) by polymerase chain reaction and measuring the product thus obtained by any suitable quantitating means.
(a) isolating micro quantities of mRNA sample by adding carrier RNA in a micro volume of RNase inhibiting buffer and recovering the mRNA
contained in said biological sample in a resuspending medium;
(b) reverse transcribing the isolated mRNA from step (a) to obtain cDNA;
(c) amplifying the cDNA obtained from step (b) by polymerase chain reaction and measuring the product thus obtained by any suitable quantitating means.
2. A diagnostic test for predicting the clinical course of a malignancy where aggresive behavior by malignant cells is associated with deregulation of an oncogene, lower expression of an antioncogene, or excessive production of proteolytic enzymes associated with metastisi, comprising the steps of measuring the level of target gene mRNA in tumor specimen by the method of claim 1 and comparing the level of said mRNA with mRNA
of normal uninvoved tissue, a deviation from the normal level being indicative of the clinical behavior of the tumor.
of normal uninvoved tissue, a deviation from the normal level being indicative of the clinical behavior of the tumor.
3. A diagnostic-test fur determining the presence of a disease caused by translocation, comprising the step of measuring the chimeric mRNA produced by the DNA
segment containing the translocation, by the method of claim 1.
segment containing the translocation, by the method of claim 1.
4. (New) A method for measuring micro quantities of bc1-2 in a bilogical sample, comprising the steps of:
(a) isolating micro quantities of mRNA sample by adding carrier RNA in a micro volume of RNase inhibiting buffer and recovering the mRNA
contained in said biological sample in a resuspending medium;
(b) reverse transcribing the isolated mRNA from step (a) to obtain cDNA;
(c) amplifying the cDNA obtained from step (b) by polymerase chain reaction involving the use of at least a single specific primer and measuring the product thus obtained by any suitable quantitating means.
(a) isolating micro quantities of mRNA sample by adding carrier RNA in a micro volume of RNase inhibiting buffer and recovering the mRNA
contained in said biological sample in a resuspending medium;
(b) reverse transcribing the isolated mRNA from step (a) to obtain cDNA;
(c) amplifying the cDNA obtained from step (b) by polymerase chain reaction involving the use of at least a single specific primer and measuring the product thus obtained by any suitable quantitating means.
5. (New) A method as claimed in claim 4 wherein the specific primer is bc1-2/Cmu.
6. (New) A method as claimed in claim 4 wherein the specific primer is bc1-2/Cgamma.
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US41611789A | 1989-10-02 | 1989-10-02 | |
| US416,117 | 1989-10-02 |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CA2067114A1 true CA2067114A1 (en) | 1991-04-03 |
Family
ID=23648611
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CA 2067114 Abandoned CA2067114A1 (en) | 1989-10-02 | 1990-09-27 | Sensitive method for measurement of chimeric transcripts of dna containing translocations |
Country Status (4)
| Country | Link |
|---|---|
| EP (1) | EP0494968A4 (en) |
| AU (1) | AU630001B2 (en) |
| CA (1) | CA2067114A1 (en) |
| WO (1) | WO1991005064A1 (en) |
Families Citing this family (9)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US5618670A (en) * | 1988-08-26 | 1997-04-08 | The United States Of America As Represented By The Department Of Health & Human Services | Detection method for c-raf-1 genes |
| WO1993006248A1 (en) * | 1991-09-16 | 1993-04-01 | The United States Of America Represented By The Secretary, Department Of Health & Human Services | Detection method for c-raf-1 genes |
| EP0534640B1 (en) * | 1991-09-23 | 1996-10-02 | Pfizer Inc. | Process for detecting specific mRNA and DNA in cells |
| GB2260811B (en) * | 1991-10-23 | 1995-07-05 | Yorkshire Cancer Research Camp | Detection of malignant tumours |
| EP0642590A1 (en) * | 1992-05-27 | 1995-03-15 | AMERSHAM INTERNATIONAL plc | Rna fingerprint analysis |
| JPH06145196A (en) * | 1992-11-10 | 1994-05-24 | Tosoh Corp | Protein secreted by cancer cell |
| US5529925A (en) | 1993-12-03 | 1996-06-25 | St. Jude Children's Research Hospital | Nucleic acid sequences and fusion proteins present in human t(2;5) lymphoma |
| US6696548B2 (en) | 1993-12-03 | 2004-02-24 | St. Jude Children's Research Hospital | Antibodies for recognition of alk protein tyrosine/kinase receptor |
| DE4431174A1 (en) * | 1994-09-01 | 1996-03-07 | Deutsches Krebsforsch | Detecting tumour specific mRNA by conversion to cDNA and amplification |
Family Cites Families (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US4358586A (en) * | 1980-12-23 | 1982-11-09 | Harvey Rubin | Detection and isolation of endorphin mRNA using a synthetic oligodeoxynucleotide |
| US4483920A (en) * | 1982-05-17 | 1984-11-20 | Hahnemann University | Immobilization of message RNA directly from cells onto filter material |
| US4800159A (en) * | 1986-02-07 | 1989-01-24 | Cetus Corporation | Process for amplifying, detecting, and/or cloning nucleic acid sequences |
| WO1990009456A1 (en) * | 1989-02-16 | 1990-08-23 | Viktor Balazs | Malignancy test (cancer test) using the polymerase chain reaction |
-
1990
- 1990-09-27 WO PCT/US1990/005427 patent/WO1991005064A1/en not_active Application Discontinuation
- 1990-09-27 AU AU66061/90A patent/AU630001B2/en not_active Ceased
- 1990-09-27 CA CA 2067114 patent/CA2067114A1/en not_active Abandoned
- 1990-09-27 EP EP19900915643 patent/EP0494968A4/en not_active Withdrawn
Also Published As
| Publication number | Publication date |
|---|---|
| AU630001B2 (en) | 1992-10-15 |
| EP0494968A4 (en) | 1992-11-25 |
| WO1991005064A1 (en) | 1991-04-18 |
| EP0494968A1 (en) | 1992-07-22 |
| AU6606190A (en) | 1991-04-28 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| USRE49542E1 (en) | Method for the detection of cancer | |
| US7709233B2 (en) | Method enabling use of extracellular RNA extracted from plasma or serum to detect, monitor or evaluate cancer | |
| US6607898B1 (en) | Method for detection of hTR and hTERT telomerase-associated RNA in plasma or serum | |
| US6720144B1 (en) | Detection of clonal T-cell receptor-γ gene rearrangement by PCR/temporal temperature gradient gel electrophoresis (TTGE) | |
| JP2008505644A (en) | Identification of markers in esophageal cancer, colon cancer, head and neck cancer, and melanoma | |
| CA2467629A1 (en) | Methods for evaluating drug-resistance gene expression in the cancer patient | |
| EP0760010B1 (en) | Methods of screening for crohn's disease using tnf microsatellite alleles | |
| US6087098A (en) | Enhanced reverse transcriptase polymerase chain assay to detect MN in patients with renal cell carcinoma | |
| WO1998046798A9 (en) | Enhanced reverse transcriptase polymerase chain assay to detect mn in patients with renal cell carcinoma | |
| EP1080227A1 (en) | A novel method of diagnosing, monitoring, and staging colon cancer | |
| WO1999004037A1 (en) | Detection of k-ras mutations in cancer | |
| AU630001B2 (en) | A sensitive method for measurement of chimeric transcripts of dna containing translocations | |
| Okegawa et al. | Detection of mucin 7 gene expression in exfoliated cells in urine from patients with bladder tumor | |
| US6153388A (en) | Method of determining melanoma micrometastasis using tyrosinase | |
| JP2800850B2 (en) | Methods for detecting neoplasia | |
| WO1999060162A1 (en) | A novel method of diagnosing, monitoring, and staging prostate cancer | |
| Goodison et al. | Rapid analysis of distinctive CD44 RNA splicing preferences that characterize colonic tumors | |
| De Vries et al. | Melanoma-inhibiting activity (MIA) mRNA is not exclusively transcribed in melanoma cells: low levels of MIA mRNA are present in various cell types and in peripheral blood | |
| KR20070116567A (en) | Detection of lymph node metastasis from gastric carcinoma | |
| Max et al. | Quantitative nested real-time RT-PCR specific for tyrosinase transcripts to quantitate minimal residual disease | |
| JP4315812B2 (en) | Molecular diagnosis and prognosis of carcinoma | |
| Kaufmann et al. | Real time RT-PCR analysis of thyroglobulin mRNA in peripheral blood in patients with congenital athyreosis and with differentiated thyroid carcinoma after stimulation with recombinant human thyrotropin | |
| US6861215B1 (en) | Method of diagnosing, monitoring, and staging prostate cancer | |
| Wang et al. | Comparison of gene expression in breast cancer using laser capture microdissection and quantitative RT-PCR | |
| Wang et al. | Technical Advancement |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| EEER | Examination request | ||
| FZDE | Dead |