CA2051085C - Expression plasmids - Google Patents

Abstract

Novel expression plasmids containing SV40 replication origin and a DNA fragment having a promoter region for a human polypeptide chain elongation factor-1.alpha. gene.
The expression plasmids have high applicability to wide rage of host cells with high expression efficiency in transient expression systems.

Description

'91-09-~ 17:41 ION FRTEhlT 03-854-6280 T-156 P.03 '.

i.,~ ',.. ,.. __ . v~ ~-~
TITLE OF THE INVENTION
Expression Plasmids BACKGROUND Of THE INVENTION
This invention relates to novel expression plasmids containing SV9() replication origin and DNA fragment having tha_ promoter. region of a human pol,ypeptide chain elongation factor gene.
With the advance of gene engineering studies, production of substances by recombinant DNA technology has come into a common rneans. Methods hzwe been established almost Completely for the production of foreign proteins by means of recombinant DNA technology using E, coli as the host cells.
The use of E. Gol.i, however, is still inappropriate for the proCluction of some kinds of proteiris which essentially require the addition of sugar chains or proteins whose physiological activities or antigenicities are altered when they are produced in a different cell type.
1r''or the purpose of solving such problems, various host-vector systems have been developed using animal cells. In general, three signals are required for the gene expression in ana.mal c~rlls; that is, promoter, RNA splicing signals and polyadenilation signals. It is important to select efficient promoter for high expression of the gene for a protein of interest, Promoters which are being used incJ.ude the SV40 (a papovavirus) early promoter, adenovinus major late promoter and metallothionein promoter originated from mouse and the like. The SV40 early promoter is being used frequently, but ' 91-09-0E ~\': 42 I OPJ FRTENT 03-864-6280 T-156 P. 04 na ,.~ _. ~ ',' .,' r.

this promoter still has the disadvantage of low expression efficiency anti narrow host cell range. In other words, tissue-specific expression and cell type-dopandent chsnc~es in the expression efficiency are unavoidable even if the SV90 early promoter iN used. For oxample, the expression efficiency is remarkably low in lymphoid cells and nerve Gells Compared t0 Other Cell types.
Recently, Y. Takebe et al. (Mol. Cell. Biol., vol. 8, p.
966, 1988) have constructed an SROC promoter by incorporating a portion of the terminal repeat sequence of human T-Cell leukemia virus type 1 into downstream of the SV40 early promotez. Accordirig to the report, expression of the downstream gene of the SR(7C promoter was 1 or 2 orders of magnitude more ef~ic.ient than that of the SV40 early promoter when a certain kind of lymphoid cells was used as the host Dells. However, it is still unclear whether the SROI, promoter Gan maintain its high expression efficiency in other host cells. Tf the diversity o.f useful physiologically active substances which will be produced in the future by means of recombinant DNA technology is takQn into consideration, it is necessary to obtain a new promoter that shows high expression efficiency in wider range of host cells and to develop expression plasmids containing such a promoter.
Taking the above-described situation of the prior art in con:cideration, one of the present inventors has performed studies on the sc_reenang of novel expression plasmids which could show high expression efficiency in wide range of host '91-09-0( 7:44 ION FRTEhlT 03-864-6280 T-156 P.05 ___. .....

cells. Through these studies, one of the present inventors has isolated a chromosomal gene encoding human polypQptidc~
chain elongation factor-1cx (to be referred to as human Ef-10t hereinafter.) which is constitutively produced in all human cells and has determined its nucleotide sequence fox the first time(T Uetsuki, et al. ~J. Biol. Chem. Vol. 264, p.5791, 19$9) .
After that, one of the present inventors found that the DN1~ fragment containing the human EF-1Cc promoter region stimulated the expression of its downstream gene, constructed high expression plasmids containing said DNA fragments (D.w,Kim, et,al.jGene, vo1.91, p.217, 1990) and have filed the patent application in Canada Serial No. 2,005,016.
A tz::;nsient expression system, especially in which COS
cells are used, is commonly employed when an attempt is made to clone a new gene by means of a biological assay using its activity as a marker. Such a transient expression system has an advantage in that a protein of interest can be obtained easily within a short period of time for use in the analysis o~ function and structure of the expressed protein. In spite of such an advantage, however, only a few expression plasmids are available from which, when used in the transient ex~~ressi,c~ri system, an expressed product can be obtained in such a large amount that the product can be detected even by a low sensitivity biological assay system, zn addition to that. very little actually is known about an expression ' 91-09--(\.7: 45 I ON PRTENT 03-864-6280 T-156 P. 06 r .-. .. . .._ , plasmid which shows high caxpression efficiency in broad range of host cells.
SUMMARY OF THE INVENTION
Taking snCh prior art problems into consideration, the inventors o:~ the present invention have conduct~ad studies on the combined effects of various promoters with DNA fragments which impart effects of improving expression efficiency, with the aim of developing expression plasmids that show high expression efficiency in transient expression systems. As the results, the present inventors have found for the first time that novHl expression plasmids containing a human EF-lOc promoter region and simian virus 40 (SV40> replication origin can show high expression efficiency in broad range of host cells in the transient expression systems in comparison with prior art ~xpression plasrnids. The present invention has been accomplished as a result of these efforts.
First aspect of the present invention provides expression plasmids having at least SV40 replication origin and a DNA fragment containing a promoter region for a human polypeptide chain elongation factor gene.
The human polypeptide chain elongation factor gene. may be the human polypeptide chaitl elongation factor--ltx gene .
7.'he DNA fragment may comprise at least a portion or a whole of a region of about 2.5 kilo base pairs which is located immediately upstream of the translation initiation colon of the human polypeptide Cha3,n eJ.ongation factor gene.

' 92-09-0E ' /: 46 I ON FpTEtJT 03-864-6280 T-156 P. 07 The DNA fragment preferably contains a promoter region of human. EF'-10c gene comprising at least a portion including TATA bax [underlined position in sequencethe UNA
(1)]of fragment represented the following sequence (T):

TTTTCCCGAGGGTGGGGGAGAACCGTATAT~AGTGCAGTA 560 ' 91-09-0E ~.~~ ~' : 47 I OIJ FRTENT 03-854-6280 T-156 P. 08 ,. ,_. . _ .. ,. ..' GCAAGATAGTC~'TGTAAATGCGGGCCAAGATCTGCACACT 960 GTGCGTCCCAGCGCACA~1~GTTCGGCGAGGCGGGGCCTGCGi090 GGCCGGCCTGCTCTGGTGCCTGGCCTCGCGCCGCCGTGTAl120 GCGCCGTCCAGGCACCTCGA'rTAGTTCTCGAGCTTTTGGA1360 GTACG~!'CGTCTTTAGGTTGGGGGGAGGGGTTTTATGCGAT1400 TT'~TTGAGTTTGGATCTTGGTTCATTCTCAAGCCTCAGAC~52O
AGTGGT'~CAAAGTTTTTTTCTTCCATTTCAGGTGTCGTGA1560 A 1.561 _-It is known commonly that chr.pmosomal nucleotide sequences, exeludinc~ stxu4tural gene, vary from one another CCTCTTTACGGGTTATGGCC

slightly depending on the host cells, mutation and the like, without altering the main activity. Accordingly, it is intended to include within the scope of the present invention all variations of the nucleotide sequence of SV40 replication origin or the DNA fragment represented in sequence (I), wherein the nucleotide sequence is slightly modified by artificial mutation, insertion, deletion and the like, on condition that the function of these variants is the same as that of SV40 replication origin or the DNA of the promoter region of human EF-la gene.
BRIEF DESCRIPTION OF THE DRAWINGS
Fig. 1 is a graph showing a process for the construction of an expression plasmid pEF-SV-CSF.
Fig. 2 is a graph showing a process for the construction of an expression plasmid pEF-BOS.
Fig. 3 is a graph showing the structure of pEF-BOS.
Figs. 4-7 show the construction of several plasmids described in Figs. 4-7 of Laid-open Canadian Patent Application No. 2,005,016.
DETAILED DESCRIPTION OF THE INVENTION
Expression plasmids of the present invention can be prepared in the following manner.
Human EF-la chromosomal gene having promoter region may be obtained by Southern hybridization method from a human gene library using appropriate probes. The gene library constructed from human fetal liver (R. M. Lawn et al.; Cell, vol. 15, p. 1157, 1978), human placenta (H. Matsushime et al.;
Mol. Cell. Biol., vol. 6, p. 3000, 1986) and the like can be used as the human gene library.
The human EF-la promoter region may also be obtained in accordance with the method of T. Uetsuki et al. (J. Biol.
Chem., vol. 264, p. 5791, 1989) or by chemically synthesizing it based on the report of Uetsuki et al.
According to the method of T. Uetsuki et al. (J.
Biol. Chem., vol. 264, p. 5791, 1989), human EF-la cDNA is isolated from cDNA library constructed with mRNA from human fibroblast GM637 cells by using yeast EF-la cDNA as a probe.
To isolate human EF-1a gene, above human gene libraries are screened using the obtained human EF-la cDNA as a probe. It is known that human chromosomes are possessed of pseudogenes each of which having the same DNA sequence of a certain gene but showing no function. For the purpose of avoiding cloning of the pseudogene, sequence of 3'-non-coding region of the human EF-la cDNA can be used as the probe. Then Southern hybridization analysis and nucleotide sequencing are carried out to confirm the isolated gene is the active gene of human EF-la but not a pseudogene.
The transcription initiation site is determined by primer extension method using an mRNA extracted from a human cell line HL-60 cells and a synthetic oligonucleotide which is complementary to 5' region of the obtained human EF-la cDNA.
The promoter region of human EF-1a contains typical TATA box located at about 30 nucleotides upstream of the transcription initiation site.
Preferably, however, the DNA fragment of interest may be isolated from some kinds of plasmids in which human 8a EF-la promoter region has already been incorporated, such as plasmid pEF-321, pEF-204, pEF-223 or pEF-220 prepared by D. W.
Kim et al. (Gene, vol. 91, p. 217, 1990; see Figs. 4-7 of this application which are described in Figs. 4-7 of Laid-open Canadian Patent Application No. 2,005,016). Of these, plasmid pEF-321 may be most convenient from high expression efficiency point of view.
Four transformants were obtained by transforming an E. coli strain with each of these four plasmids introduced chloramphenicol acetyl transferase (CAT) gene into the downstream of the promoter region. These transformants, named E. coli DH5 (pEF220-CAT), E. Coli DH5 (pEF223-CAT), E. coli DH5 (pEF204-CAT) and E. coli DH5 (pEF321-CAT), have been deposited on March 2, 1989, in Fermentation Research Institute, Agency of Industrial Science and Technology, and have been assigned the designations as FERM P-10595, FERM
P-10596, FERM P-10594 and FERM P-10597, respectively.
Any DNA fragment may be useful as the starting material for the construction of expression plasmids of the present '91-~l9-86 ,:59 ION PATENT ~~,W3-864-628lJ T-156 P. 11 invention, provided that it. is possessed of the same ~itxr_leotide sequence as that of the human EF-1CC promoter region contained in the plaemid pEF~321. Tha DNA fragment containing human EF-loc promoter region comprises 2.5 kilo base paixs and contains a DNA fragment represented by the fpllowing nucleotide sequence (I).

GArl"T".~G~'CCCGGACTAGCGAGATGGCAAGGCTGAGGACGG 80 GAGGCTGATTrAGAGGCGAAGGTACACCCTAATCTCAATA 120 C'fGCACGTCCCTTCCAGGCGGCCTCCCCGTCACCACCCCC 200 T'rAAACTCCCACTAACGTAGAACCCAGAGATCGCTGCGTT 320 C-:GGGTCGGCAATTGAACCGGTGCCTAGAGAAGGTGGCGCG 9$0 TCCACGCCCCTGGCTGCAGTACGTG~1TTCTTGATCCCGAG 720 '91-09-05 .~:51 ION PATENT ~ , 03-854-6280 T-156 P.12 Zo GCCTGGGCGCTGGGGCCGCCGCGTGCGAATCTGG'1'GGCAC 890 CTTt:GC'GCCTGTCTCGCTGCTTTCGATAAGTCTCTAGCCA 880 TTTAAAATTTTTGATGACCTGCTGCGACGCT'PTTTT1'CTG 920 GTCCTCAGCCG'1'CGCTTCATGTGACTCCACGGAGTACCGGi320 C,CGCCGTCCAGGCACCTCGATTAGTTCTCGAGCTTTTGGA1360 TTTTTG,AGT.TTGGA~'CTTGGTTCATTCTCAAGCCTCAGAC1520 A 15 61 --- ( z ) ' 91-09-~, '.7: 52 lOtJ FF1TENT ' '«.' 03-854-6280 T-156 P. 13 ,.
When plasmi.d pEF-321-CAT is used as the starting material, expression plasmids which show high expression eff3.cienr_y in transient expression systems can be obtained by inserting a DNA fragment containing SV90 replication origin into an appropriate site in each of the expression plasmids.
'lhe SV90 replication origin can be obtained by digesting any plasmids containing the replication origin with, appropriate restriction enzymes. For example, an SV40 DNA
fragment (311 bp) containing SV40 replication origin can be obtained by digesting plasmid pMLSV.
According to some of the expression plasmids of the present invention, a portion of the upstream Side of the DNA
fragment containing human EF-1a, promoter region may be removed and replaced by a DNA fragmen~ containing SV40 replication origin, provided that function of the human EF"-1d promoter is net altered by the removal of the upstream portion. For example, an upstream portion of the DNA
fragment containing human EF-lOC promoter region, namely a SphI-Sphl DNA fragment of about 1.3 kilo base pairs, can be replaced by a DNA fragment containing SV90 replication origin. In this case of thA expression plasmid, the fragment containing human EF-1a, promoter. region comprises a nucleotide sequence represented by the following sequence (zz).

GC~GGTCGGCAATTGAACCGGTGCCTAGAGAAGGTGGCGCG 480 '91-0q-06 .:53 IOI-1 FATENT ,: J3-864-6280 T-156 F.14 ,.. .. . ... .' ,~_,;:

TT'I'TCCCGRGGGTGGGGGAGAACCGTATATAAGTGCAGTA 560 CCTCTTTACGGGTTATGGCCCTTGCG'I'GCCTTGAATTACT 680 G'PTAAGGAGCCCC'TTCGCCTCGTGCTTGAGTTGAGGCCTG 800 TTTAAAAT'TTTTGATGACCTGCTGCGACGCTTTTTTTCTG 920 GCAAGATAGTC:TTGTAAATGCGGGCCAAGATCTGCACACT 960 TCGCCCCGCCCTGGGCGGCAAGGCTGGCCCGG'PCGGCACC1160 GGGCGGGTGAGTCAC:CC:ACACAAAGGAAAAGGGCCTTTCC1280 GTR'.CTCAGCCGTCGCTTCATGTGACTCCACGGAGTACCGG1320 '91-09-~_ 17:54 ION PRTENT 03-8b4-6c80 T-156 P.15 .. ... ..

CCAGCTTGGCACTTGATGTAATTCTCCTTGGAATTTGCCC7.480 AGTGGTTCAAAGTTTTTTTCTTCCATTTCAGG'.CGTCGTGA1560 A 1561 ---(II) For the purpose of exhibiting function of the expression plasmid o:~ the present z.nvention in mammalian cells, it is necessary to add a polyadenyl.ation signal to the plasmi.d.
For this purpose, the SV40 polyadenylation signal contaic~ed in plasmid pEF-321--CAT may be used conveniently, as well as those in other genes, such as the polyadenylation signal in human granulocyte-COloriy stimulating factor (G-CSF).
In addition, the expression plasmid of the present invention may preferably have appropriate restriction enzyme recognition sates downstream of its promoter region, so that a gene to be expressed or cloned can be inserted easily into downstream of the promoter region. For this purpose, various cloning site-containing DNA fragments can be used, such as a stuffer frsgment of plasmid CDMB. This stuffer fragment has an advantage in that self-ligation does not occur when BstXT
reCOgnit i.On SINS COIItalIled in the fragment are used in cloning. The stuf~fer fragment can be isolated from plasmid Ct7hi8 as a ~Ybal-XbaI DNA fragment (451 bp) .
when the expression plasmid contains a recognition site ;identical to its cloning Site, the object of the present .,_.., '91-09-06 :55 ION PRTENT 03-864-6280 T-156 P.16 i.nv~ention can be attained by removing the recognition site.
Even when such a recognition site is found in a DNA fragment containing human E>~-1a promoter region, a DNA fragment containing SV90 replicat.~.on origin or a DNA fragment containing a polyadenylation signal, the recognition site can be removed with no inconvenience as long as basic functions o~ these pNA fragmonts do not change by the removal. For example, removal of Bst.XI recognition site from a DNA
fragment containing human GF--la promoter region does not alter Function of the promoter region, in this instance, the fragment conte~i.ning human EE-1pC promoter region comprises a nucleotide sequence represented by the following sequence (III) .

CC'TCTTTACGGGTTATGGCCCTTGCGTGCCTTGAATTACT 680 C'TTAAGGAGCCCCTTCGCCTCGTGCTTGAGTTGAGGCCTG a00 ~
'91-09-t. 17:56 ION FHTENT 03-864-6280 T-156 F.:17 CTTCGCGCCTGTCxCGCTGCTTTCGATAAGTCTCTAGCCA 880 GCAAGATAGTCTTG'.L'AAATGCGGGCCAAGATCTGCACACT 960 GTCCTCAGCCGTCGCTTCATGTGACTCCACGGAG'IACCGG1320 AGTGGTTCAAAGTTTTTT'1'CTTCCATTTCAGGTGTCGTGA1560 A 1561 ---(III) A trr~nsformant was obtained by transforming an E. cold strain with one of the obtained plasmids of the present '\
' gi-99-96 : 5'? I Oh! PRTENT 93-86d-6289 T-156 P. 18 invention. The transformant plasmid pEF-sOS, named E. coli DH,S (pEF-BOS), has been deposited by one of the present inventors on September 6, 1991, in Fermentation Research Institute, Agency of 2ndustrial Science and Technology, and has been assigned the designation as FERM BF-359.
Llsdf_ulness of the expression plasmfd of the present invention can be confirmed by inserting an appropriate gene into dow.nsta=eattt of the human EF-1a, promoter region making use of appropriate restriction enzyme recognition sites or the like and by subsequently checking expression efficiency of the inserted gene. As a gene to be expressed for this purpose, CAT gene may be used preferably because its expressed amount can be judged easily, though human G--CSF
cPNA is also useful. When CAT gene is used, the amount of formed CAT can be measured as a formation ratio of acetyiated chloraznpheriicol using thin layer chromatography. In the case of G-CSF, the amount of formed product can be measured by a biological assay technique using an appropriate cell line.
EXAMPLES
Examples of the present invention are given below by way of .~.llustrtltion, and not by way of limitation.
Unless otherwise stated, commonly used abbreviations in this field of studies are used in the following descriptions.
Each experiment in the following examples is based on the common gene manipulation tachniques which can be performed in accordance with any commonly used manual, such as r7oleculax~

u:~
' 91-09-E~~. 1~r : 58 I OtJ PRTENT 03-864-6280 T-156 P. 19 .., .~ ._ ._ . :.e ~:

C,lon,iug, A Laboratory Manual Second Edition (Maniatis et al., Cold Spring Harbar Laboratory, 1989) and Labomanual Gene Technology (written in Japaneset M. Muramatsu, Maruzen Go., Ltd., 1988).
Ex~m1?~
'"Construction of expression plasmids"
(1) Q7.asm~.d pEF-SV-CSF
This plasmid was constructed in the following manner.
Hasic process Eor its construction is shown in Fig. 1.
hay EcoRI-ECORI cDNA fragment containing CAT gene was removed from an expression plasmid pEF-321-CAT whickx has been constructed by D.W.Yim et a1. (Gene, vo1.91, p.217, 1990).
An EcoRT~-EcoRT DNA fragment containing G-CSF cDNA was cut out from plasmid pBR-VII and ligated with the above EcoRI-EcoRI
large fragment to obtain plasmid pEF-321-CSF, Thereafter, an EcoRI-EcoRI DDIA fragment containing a 311 by DNA fragment in which 5V90 replication origin is contained was inserted into the H.indIII recognition site located upstream of EF-lcx promoter region in the thus prepared plasmid pEF-321-CSF to yield the titla expression plasmid pEF-SV-CSF.
(2) Plasmid pEF-BOS
A gist of the process for the construction of this plasmid is illustrated iu Fig. 2. From the G-CSF -containing cDNA moiety in the plasmid pEF-321-CSF prepared in Example 1-(1), a region encoding G-CSF was removed by cutting out its upstream portion starting from the Eco8lI recognition site, °

91-09-06 :59 InIJ FRTENT 03-864-6280 T-156 P.20 At the same time, a XbaT linker was inserted into the EcoRI
recognition site located between the EF-loc promoter region and the G-CSF polyadenylation signal. In this way, a plasmid rontaininy a XbaI recognition site was obtained. Into the XbaI recognition site of the thus constructed new plasmid was inserted t~ 951 by stuffer gene of plasmid CDM8 (Seed, B:
Nature, ~ro1.329, p.840, 1987).
Next, a SphT-.Sphl DNf, fragment which is located upstream portion of the DNA fragment including the EF-loc promoter region in the thus obtained plasmid was removed and replaced >7y EcoRI-ECORI ONA fragment containing a 311 by DNA fragment including SV40 replication origin in the same manner as in Example 1-(1). Thereafter, the BstXI recognition site in the nucleotide sequence containing EF-la, promoter region was removed by deleting a nucleotide sequence GCCC to yield the title e~cpxession plasmid pEF-BOS.
"Production of human GTCSF in COS cells"
Human G-CSF cDNA was inserted into BstXI site of pl;F-BOS
or CDMB, or into BamHI site of pKCR vectox containing SV40 early promoter (0'Hare,K., Benoist,C, and Breathnach,R.
(1981) P.roc. Natl. Aead. Sci. USA 78, 1527-1531). As shown in Table A, when COS cells were transfected with these plasmids by DEAF-dextran/chloroquine method, the construct in pEF-BOS has directed the synthes~.s of human G-CSF alaout 20 I'91-09-c 18:00 IOh! PRTENT 03-8E4-6280 T-156 P.21 a.. ....1 :.,. .., Xt.:l.i :'c ,'~ r.
f~,; ;r ."x .:

times more efficiently than the construct in CLIMB, and 50 -200 t~.rnes more ef~icientJ.y than the construct in pKCR.
G-CSF activities were titrated by a biological assay with mouse interleukin-3 (IL-3)-dependant cell, line NFS-60, which can grow in the presence of G-CSF. Since the number of surviving NFS-60 cells after addition of a sample that contains human G-CSF correlates to the sum of DNA synthesis in the cells. a half-maximal value of [3H]thymidine incarporation into the cells indicates the G-CSF activity of the sample.
Table A.
Vector G-CSF activity in mediums (unitsb/ml) pEF-HOS 33,000 12,000 CDMB 1, 600 1, 200 pKCR160 160 gAt 72 hrs post transfection, the G-CSF activity in the medium was assayed.
b 1 unit of the activity corresponds to about 62 pg of human G-CSF.
AS Shown in Fig. 3, pEF-BOS Carries the SV40 replication origin (311 by of EcoRZI fragment), the promoter region of human IaF-lOt c:hromosamal gene (1.2 kb), the stuffer fragment (451 bp) from CDMB vector and polyadenylation signal from human G-CSF cDNA (about 700 by ECO81I - ECORI DNA fragment) (NagatR,S., Tsuchiya,M., Asano,5., Kaziro,Y., Yamazaki,Y., ~' 91-09-OE ~ ~~: c~1 I ON FRTENT 03-864-6280 T-156 P. 22 "' ~::, .. , a ~ ,' ~ -;
~.: ~,,..s . _ _ .. ..
Yarnamoto,0., Hirata.Y., Kubota,N., Oheda,M., Npmura,H, and Ono,lvl. (1986) Nature 319, 415-918) in HindITT-EcoRT site of pUC119. The promoter region of EF-1a gene is from nucleotide position 373 to 1561, as shown in the sequence (ITI), which includes 203 by S' flanking region, 33 by the first axon, 939 by the first intron and l0bp of the part of the second axon located at 20 by upstream of the ATG initiation cpdon. The size of pf,f-BOS is 5.8 kb, and the cDNA to be expressed can be inserted at bstXT site using BstXI adapter, or XbaT site using XbaI linker.
°'Effect of SV40 replication origin on the expression in COS cells"
Plasmids pEF-BOS, pEF-Sv and pEF-321 were compared in terms ofi their efficiencies to express human G-CSF cDNA in COS cells in the same manner as in Example 2. Of these plasmids, plasmid pEF-SV contains EF-la promoter region of 2.5 kilo base paa.xs and SV40 replication origin, while plasmid pEF-321 Contains EF-1CG promoter region of 2.5 kilo base pairs but with no SV40 replication origin. As summarized in Table B, plasmids pEF-SV and pEF-BOS both containing the SV40 replication origin showed more than ten times higher leveJ.s of G--CSF gene expression in comparison with plasmid pEF-321 whioh contained no SV40 replication Oric~izl.

' ~ .~w~
'A1-09-~ 18:02 I0N PRTENT 03-864-6280 T-156 P.23 r:, ',: :_? _ _ ~,; ,. , , ~abl~ 8 hF-la Sv40 Vector promoter replicationG-CSF activity in mediums region origin unitsb/ml pEF-3212.S Kbp - 700 pEF-SV 2.5 Kbp + 10,000 pF.~_-13051 . 2 ICbp+ 12, 000 .

~: At 72 hrs post tranefection, the G-CSF activity in the medium was assayed.
f: One unit of the activity carresponds to about 62 pg of human G-CSF.
Fxam~nle 9 "Effect of the inventive plasmids in various cell lines"
when a CAT gene was inserted into pEF-BOS, the CAT
activit9.es observed with pEF-BOS-CAT were 1.5 -- 50 times higher than that of pSV2-CAT or pRSV-CAT after introduction into various cell lines including murine L929, human HeLa, CHU-2 and simian COS cells (Table C). The pEF-BOS vector, therefore, will be used to produce a large amount of growth factors and proteins in mammalian cells, to express a high level of anti-sense RNA. Furthermore, the pEE'-BOS-CAT will be an ideal positive control gor CAT assay in various cell types.
F

'' 91-09-06 ~ : 03 I ON PATF_I~lT 03-864-6280 T-156 P. 24 Table G. Promoter activitieain various cells Relative activities CAT

Vector L929 ~TeLa CHU-2 COS

pSV2 2.0 74.3 82.7 10.2 pRSV $,Q 8.5 19.2 22.5 p~~'-gOS 100 100 100 100 CDMB n,t,t n.t. n.t. 25.4_ ~CA'r activities are presented as a percentage of that o~ thp pEF-BOS
bn.t., nct tested.

Claims (8)

1. A DNA fragment consisting of the following DNA sequence (II):

A 1561 ---(II)

2. A DNA fragment consisting of the following DNA sequence (III):
CGTGAGGCTCCGGTGCCCGTCAGTGGGC
AGAGCGCACATCGCCCACAGTCCCCGAGAAGTTGGGGGGA
GGGGTCGGCAATTGAACCGGTGCCTAGAGAAGGTGGCGCG

GGGTAAACTGGGAAAGTGATGTCGTGTACTGGCTCCGCCT
TTTTCCCGAGGGTGGGGGAGAACCGTATATAAGTGCAGTA
GTCGCCGTGAACGTTCTTTTTCGCAACGGGTTTGCCGCCA
GAACACAGGTAAGTGCCGTGTGTGGTTCCCGCGGGCCTGG
CCTCTTTACGGGTTATGGCCCTTGCGTGCCTTGAATTACT
TCCACCTGGCTGCAGTACGTGATTCTTGATCCCGAGCTTC
GGGTTGGAAGTGGGTGGGAGAGTTCGAGGCCTTGCGCTTA
AGGAGCCCCTTCGCCTCGTGCTTGAGTTGAGGCCTGGCCT
GGGCGCTGGGGCCGCCGCGTGCGAATCTGGTGGCACCTTC
GCGCCTGTCTCGCTGCTTTCGATAAGTCTCTAGCCATTTA
AAATTTTTGATGACCTGCTGCGACGCTTTTTTTCTGGCAA
GATAGTCTTGTAAATGCGGGCCAAGATCTGCACACTGGTA
TTTCGGTTTTTGGGGCCGCGGGCGGCGACGGGGCCCGTGC
GTCCCAGCGCACATGTTCGGCGAGGCGGGGCCTGCGAGCG
CGGCCACCGAGAATCGGACGGGGGTAGTCTCAAGCTGGCC
GGCCTGCTCTGGTGCCTGGCCTCGCGCCGCCGTGTATCGC
CCCGCCCTGGGCGGCAAGGCTGGCCCGGTCGGCACCAGTT
GCGTGAGCGGAAAGATGGCCGCTTCCCGGCCCTGCTGCAG
GGAGCTCAAAATGGAGGACGCGGCGCTCGGGAGAGCGGGC
GGGTGAGTCACCCACACAAAGGAAAAGGGCCTTTCCGTCC
TCAGCCGTCGCTTCATGTGACTCCACGGAGTACCGGGCGC

CGTCCAGGCACCTCGATTAGTTCTCGAGCTTTTGGAGTAC
GTCGTCTTTAGGTTGGGGGGAGGGGTTTTATGCGATGGAG
TTTCCCCACACTGAGTGGGTGGAGACTGAAGTTAGGCCAG
CTTGGCACTTGATGTAATTCTCCTTGGAATTTGCCCTTTT
TGAGTTTGGATCTTGGTTCATTCTCAAGCCTCAGACAGTG
GTTCAAAGTTTTTTTCTTCCATTTCAGGTGTCGTGAA
--- (III)

3. An expression plasmid containing the DNA fragment of claim 1 or 2.

4. The expression plasmid according to claim 3, which further contains SV40 replication origin.

5. The expression plasmid according to claim 3, which is pEF-BOS.

6. An expression plasmid which is capable of expressing a structural gene coding for a polypeptide in a mammalian cell when the structural gene is inserted and comprises from upstream to downstream:
(a) a DNA fragment containing SV40 replication origin;

(b) a DNA fragment consisting of a promoter region for human polypeptide chain elongation factor-1.alpha. gene which has the following sequence (I), (II) or (III) from which a restriction enzyme recognition site is optionally deleted;
and (c) a DNA fragment containing a polyadenylation signal, the plasmid having a restriction enzyme recognition site downstream of the promoter region so that the gene coding for a polypeptide may be inserted downstream of the promoter region:
Sequence I:

A 1561 ---(I) Sequence II:

A 1561 ---(II) Sequence III:
CGTGAGGCTCCGGTGCCCGTCAGTGGGC
AGAGCGCACATCGCCCACAGTCCCCGAGAAGTTGGGGGGA
GGGGTCGGCAATTGAACCGGTGCCTAGAGAAGGTGGCGCG
GGGTAAACTGGGAAAGTGATGTCGTGTACTGGCTCCGCCT
TTTTCCCGAGGGTGGGGGAGAACCGTATATAAGTGCAGTA
GTCGCCGTGAACGTTCTTTTTCGCAACGGGTTTGCCGCCA
GAACACAGGTAAGTGCCGTGTGTGGTTCCCGCGGGCCTGG
CCTCTTTACGGGTTATGGCCCTTGCGTGCCTTGAATTACT
TCCACCTGGCTGCAGTACGTGATTCTTGATCCCGAGCTTC
GGGTTGGAAGTGGGTGGGAGAGTTCGAGGCCTTGCGCTTA
AGGAGCCCCTTCGCCTCGTGCTTGAGTTGAGGCCTGGCCT
GGGCGCTGGGGCCGCCGCGTGCGAATCTGGTGGCACCTTC
GCGCCTGTCTCGCTGCTTTCGATAAGTCTCTAGCCATTTA
AAATTTTTGATGACCTGCTGCGACGCTTTTTTTCTGGCAA
GATAGTCTTGTAAATGCGGGCCAAGATCTGCACACTGGTA
TTTCGGTTTTTGGGGCCGCGGGCGGCGACGGGGCCCGTGC
GTCCCAGCGCACATGTTCGGCGAGGCGGGGCCTGCGAGCG
CGGCCACCGAGAATCGGACGGGGGTAGTCTCAAGCTGGCC
GGCCTGCTCTGGTGCCTGGCCTCGCGCCGCCGTGTATCGC

CCCGCCCTGGGCGGCAAGGCTGGCCCGGTCGGCACCAGTT
GCGTGAGCGGAAAGATGGCCGCTTCCCGGCCCTGCTGCAG
GGAGCTCAAAATGGAGGACGCGGCGCTCGGGAGAGCGGGC
GGGTGAGTCACCCACACAAAGGAAAAGGGCCTTTCCGTCC
TCAGCCGTCGCTTCATGTGACTCCACGGAGTACCGGGCGC
CGTCCAGGCACCTCGATTAGTTCTCGAGCTTTTGGAGTAC
GTCGTCTTTAGGTTGGGGGGAGGGGTTTTATGCGATGGAG
TTTCCCCACACTGAGTGGGTGGAGACTGAAGTTAGGCCAG
CTTGGCACTTGATGTAATTCTCCTTGGAATTTGCCCTTTT
TGAGTTTGGATCTTGGTTCATTCTCAAGCCTCAGACAGTG
GTTCAAAGTTTTTTTCTTCCATTTCAGGTGTCGTGAA
---(III)

7. An expression plasmid comprising SV40 replication origin and a DNA fragment which is a promoter region of human EF-1.alpha. gene consisting of the following sequence (I):

A 1561 ---(I).

8. The expression plasmid according to claim 6, wherein the polyadenylation signal is a SV40 polyadenylation signal.