CA2046919A1 - Oligonucleotide primer pairs for sequence independent gene amplification and methods which employ them - Google Patents

Abstract

The present invention relates to methods for amplifying isolated nucleic acid sequences, particularly DNA sequences, whose nucleotide sequences are unknown. The invention also relates to oligonucleotide primer pairs that may be employed in the amplification methods of the present invention.

Description

WO90/~94~7 P~T/US90/00866 2046~

OLIGONUCLEOTIDE PRIMER PAIRS FOR
SEQUENCE INDEPENDENT GENE AMPLIFICATION
AND METHODS W~ICH EMPLOY THEM

TECHNICAL FIELD OF INVENTION

The present invention relates to methods ~or ~.
amplifying isolated nucleic acid se~uences, particularly DNA se~,uenc,as, whos,a nucl~otide ,3equence,s ' .
are unknown. The inv,ntlon also relates to oligonucleotidc primer pair~ that may be employe,d in the amplificat~on mQthods o~ the present invention.
BACKGROUND ART
The study of genes and the DNA which encodes them is, in some instances, limited by the amount of starting material available for analysis. For example, the successful isolation of a single copy chromosomal '~ ~
. gene in~the human genome re~uires the painstaking :' -- ~ process of creating a hum,an genomic library and ; scree,ning millions of genomic clones. Such a screening .
~: ~ 20 pro,~ess would undoubtedly utilize hybridization ~ techniques that employ one or more oligonucleotides. :'' : ~ :.: These oligonucleotides would be designed based on some known partial DNA sequence o~ the gene or on a known ' ' partial amino acid..sequence or'thè;protein'ëncoded by the.desired gene. If and when the olone`containing the desired.'gene:: i8 ~inally isolated,' the clone must then be replicated before a useful quantity'of. the gene is WO90/os4~7 PCT~VS90/00866 i æ~9~9 ` ~:

obtained. If the genomic library is contained in a vector in which the production of large quantities of the gene is not practical (in a bacteriophage, for example), the gene, once isolated, must be removed from the first vector and subcloned into a more suitable second vector (such as a plasmid). This entire procedure would also be necessary ~or the isolation of cDNA clones which correspond to rare messenger RNAs (mRNAs) from a cDNA library.
The recent development of polymerase chain reaction (PCR) technology has, in certain circumstances, overcome many o~ the above di~iculties ~K. B. Mullis and F. A. Faloona, "Speci~ic Synthesis of DNA ~ V~rQ ~ia a Polymerase~Catalyzed Chain Reaction", Me~ho~ mQlL, 155, pp. 335-50 ~1987);
. K. Saiki ct al., "Enzymatic Ampli~iaation oP
~-Globin Genomic Segu~nGe~ and ~e~triction Site Analysis ~or Diagnosis of Sickle Cell Anemia", Science, 230, pp. 1350-54 ~1985)]. PCR amplification involves the synthesis o~ two oligonucleotide primers tha~ are complementary to speci~ic sequences that ~lank the DNA
segment to be amplified. Initially, the double-stranded DNA is heat denatured into single strands.
The primers are then added and allowed to anneal to their complementary seguences. The primers hybridize to opposite strands at opposite ends of-~the target DNA
sequence. DNA replication is then effected by the addition of DNA pol~merase and proceeds across the region between the primers, effectively doubling the amount of that DNA sequence. Since the replicated sequences are also complementary to the added primers, each successive round o~ replicatian essentially doubles the amount o~ DNA ~ynthesized in the previous cy~le. This results in the exponential accumulation of .
the apecL~io aequence to be replioated. ~here~ore, PCR

wogo/09457 PCT/US90/00866 . . 20~9~9 . .,.; ~

is a technique enabling those of skill in the art to obtain useful quantities of sp~cific, known DNA
sequences heretofore available only in minute amounts.
A main drawback associated with the PCR
technique was the tharmolability of the Klenow fragment of ~ QQl~ DNA polymerase I used to catalyze the DNA
replication. Because heat denaturation is required to separate the newly ~ynthesized ~trands at each cycle of replication, fresh Klenow fragment had to be added during each cycle. Such a process was tedious, error-prone and costly.
More recently, a thermostable DNA polymerase has been purified from the thermophilic bacterium ~h~Y~ ~gY~iÇ~ ~European patent applicatlon 258,017;
R. K. Saiki et al., "Primer-Directed Enz~matic Ampli~ication o~ DNA with a Thermostable DNA
Polymerase~, ~g~Qn~, 239, pp. 487-91 ~198a)]. This ~ " polymerase i~ ~able a~ temper~tures up to 95C
and is thus ideally ~uited ~or PCR. The use of obviated the need ~or repeated additions of DNA
polymerase and paved the way ~or automated PC~ ~DNA
Thermal Cycler, Perkin-Elmer/Cetus, Norwalk, CT~.
PCR has been used to generate cDNAs [C. C.
Lee et al., "Generation of cDNA Probes Directed by ' 25 Amino Acid Sequence: Cloning of Urate Oxidase", ' ' Science, 239, pp. 1288-91 (1988) ] . In this case, two sets of oligonucleotides based on the known amino-terminal amino acid sequence of urate oxidase were synthssized. One set of oligonucleotides was sense strands and the other set was anti-sense strands. The sense oligonucleotides hybridized to the non-coding strand of urate oxidase cDNA present in'a mixture of cDNAs. Thsn both sense and anti-sense oligonucleotides - were used to ampli~y the urate oxidase c~NA. ~ a result, the amount o~ urate oxidase double-stranded , :

woso/os4s7 P~T/US~0/00866 9~9 cDNA was specifically amplified, permitting ease of cloning as compared ~ith standard cDNA library screening techniques employing similar oligonucleotide probes.
The PCR technique has also been used to amplify sequences outside the boundaries o~ known sequences ~T. Triglia et al., "A Procedure ~or In Vitro Amplification of DNA Sagments that Lie Outside the Boundaries o~ Known Sequences" Nucleic Acids Research, 16, p. 8186 (1988~ ] . In this application of PCR, termed "inverted PCR" (IPCR), a piece of DNA containing both known and unknown DNA sequences is circularized.
The circular DNA is then linearized by cleavage at a site that lies within the boundaries o~ the known ~quences. Oligonucleotide primer~ corresponding to the ends o~ the known ~equence are syn~he~ized in opposite orientation ~rom that u8ed in normal PCR
bQcau~e the known ~equence has been inverted and now flanks the unknown DNA sequence. These primers are then used to amplify the unknown sequences.
Despite these dëvelopments, PCR technology is still limited because the oligonucleotide primers must be synthesized based on some specific known sequence which flanks the DNA to be amplified. tSee, ~or example, T. L. Bugawan et al., "The Use of Non-Radioactive Oliyonucleotide Probes to Analyze Enzymatically Amplified DNA for Prenatal Diagnosis and Forensic HLA Typiny", Bio/Technoloqy, 6, pp. 943-47 (1988~.] Therefore, different oligonucleotides must be synthPsized every time a di~ferent sequence is amplified. Moreover, PCR cannot be employed in situations where no sequence information is available.
, Such applications, however, are desirable ~or a number o~ purposes, including the identi~ication o~
previously unknown lnPectious agents. The causes of Woso/09457 PCT/VS90/00866 2 0 4 ~ g 1 9 many disease~ that affect humans, and other animals are unknown. It has been hypothesized that diseases, such as insulin-dependent diabetes mellitus (IDDM), multiple sclerosis (MS), Kawasaki disease, rheumatoid arthritis and juvenile rheumatoid arthritis, are caused by highly infective viruses or microorganisms that are present in the patient in subdete~table amounts ~G. T. Horn et àl., "~llelic Sequence Variation of the HLA-DQ Loci:
Relationship to Serology and to Insulin-Dependent Diabetes Susceptibility, Proc. Natl. Acad. Sci. USA, 85, pp. 6012-16 (1988); H. Kikuta et al., "Epstein-Barr Virus Genome-Positive T Lymphocykes in a Boy with Chronic Active EBV Xn~ection Associated with Kawasaki-Like Disease", N~ure, 333, pp. 455-57 (19~8); R. ~.
Sayetta, "TheorlQs o~ thc Etiology o~ ~ulkipl~
Sclero~is: A Critical ~eview", ~ 9~, ~1, pp. 55~70 (1986); E. P. R~ddy et al., "~mpli~lcation and Molecular Cloning o~ ~ITLV~l Sequences from DNA of Multiple Salerosis Patients, Science, 243, pp. 529-33 ~1989); P. E. Phillips, "Evidence Implicating Infectious Agents in Rheumatoid Arthritis and ~uvenile Rheumatoid Arthritis", Clin. Exp. Rheum., 6, pp. 87-94 (1988)]. Accordingly, the need exists for a technique by which unknown infectious agents can be identified and studied, i.e., a technique which can be used to amplify any desired nucleotide sequence regardless of whether its sequence or those sequences flanking it are known. -, SUM~A~Y OF_~E INVENTION
The present invention solves the problems referred to above-by providing sequence-independent gene amplification me~hods. These;methods allow ~or the ampli~ication o~ any isolated double stranded DNA
segment even in the absence of information regarding ; ~ , ?~
, : . .. : :: ;: . .:. ,.. " .. . . .. . . . .

WO90t0~457 PC~/US9~/00~66 2a~6~

its nucleotide sequence or the sequence of its flanking regions. The methods of this invention are especially u~eful in producing clonable quantities of DNA or cDNA
when such amounts are not available in nature. The present invention also provides methods ~or amplifying any isolated nucleic acid fragment. The invention also relates to "universal oligonucleo~ide primer pairs"
which are u~ed in the sequence-independent gene amplification methods of this invention.
The methods of this invention are advantageously used when about 100 molecules or less of one or more target DNA sequences are initially availahle. The universal oligonucleotide primer pairs of the present invention are ligated onto the ends o~
the DNA ~ragment to be ampli~ied to areate spcc.ific targets ~or PCR. ~n thi~ manner, analyzablo and clonable quantitie~ o~ ~NA may be ~ynthesized.
As will be appreciated ~rom the disclosure to follow, the universal oligonucleotide primer pairs of this invention and the methods which employ them may be used to amplify any double-stranded DNA segment or group of DNA segments. These ~ethods produce use~ul quantities o~ the segment(s) faster and at less cost than conventional methods. The methods of this invention are useful in a wide variety of situations such as amplifying unknown nucleic acid sequences from a low titer of an infective agent, producing useful quantities of cDNA initialIy synthesized from trace amounts of tissue and directly producing useful amounts of cDNA or DNA from an isolated recombinant clone.
BRIEF DESCRIPTION OF THE DRAWINGS
,. ~. .. ~, .. .... . .. . ........... .
Figure 1 depicts-a photograph of an agarose gel on whioh target DNA ~equences amp~i~ied by a method of this invention have been electrophoresed.

. ~. ~ ' , ' ,; ' " ; ,~ ` ~, ' , ' ',' ' ' ' ' ' ' . ` ` ' ' ' "''` ` ` "

w~so/os4s7PCT/US90/00866 204~919 ~ETAILED DESCRIPTION OF THE INVENTION
The present invention relates to methods for amplifying nucleic acid molecules whose nucleotide sequence is unknown. The methods of this invention are especially useful in amplifying nucleic acid sequences which are present in minute amounts. The invention also relates to pair6 o~ complementary oligonucleotides which are useiful in the methods of this invention.
Throughout the specification and in the claims the terms "universal primer pairs", "primer pairs" and "linker pairs" refer to the complementary oligonucleotide pairs o~ this invention and are used interchangeably. The individual single-stranded oligonucleotides which make up the primer pairs are re~erred to ae "primer pair members" or "link~r pair member~". Throu~hout the speci~ication and in the claims, the DNA ~equence to be amplified is re~erred to as "target DNA". The term "linkered target DNA" as used in the present specification and in the claims re~ers to the product o~ a ligation between the universal primer pairs of this invention and the target DNA. The term "biological sample" re~ers to any `
tissue, or~an or body fluid sample obtained from any animal, especially a human. And, the term "patient" ~-refers to any animal, particularly a human ~eing.
The universal primer pairs of this invention may range in length ~rom about 12 to about 40 nucleotides. They are preferably about 20 nucleotides in length. Each member of the pri~er pair is substantially e~ual in length and at-least 70~
complementary to the other member o~ the pair. Most preferably, the individual members of the primer pair are exactly the samQ length and are 100% complementary.

'. ! . ' ` ' . , ' ' . . . . . .
' '..... '' ` ' '.' .' ', ~ .', , '., " .' ''" '~`.""'.. . .. .. ' : .. ' '` ~

WO90/09457 P~T~US90/~0866 20~91~

There are no specific nucleotide sequence requirements for the universal primer pairs of the present invention. However, it should be understood that certain structural requirements should be considered in oxder for the primer pairs to be most useful in the methods o~ this invention. The structural factors that should be considered in designing the primer pairs include the melting ~emperature o~ the primer pair, the amount of self-complementarity within each individual member of thepair, the state of phosphorylation of the 5' ends of the primer piair members and the length of the individual members of the pair. Each of these factors will have an e~Pect on the e~iciency o~ the ampli~ication reactlon, which, in turn, will e~ect th~
maxlmum amount o~ DNA thak ma~ be produced by the method~ o~ th~ invention.
There ig, how~vor, on~ ~tuatlon in which a speci~ic nucleotide sequenca requirement may exist. I~
the ampli~ied, linkered target DNA is to be subsequently inserted into a vector such that the racombinant DNA molecule codes for a ~usion protein (e.g., in the unique EcoRI site of the ~-galactosidase gene of lambda gtll) it is preferable that neither primer pair member encode a stop codon in any translational reading frame. The existence of an in-frame stop codon in the transcribed fusion protein DNA
strand will ultimately prevent tranclation of the fusion protein. Since the correct reading frame of the target DNA cannot be determined prior to amplification, the elimination of stop codons in all reading frames of each primer pair member avoids'the problem r'eferred to 'above. i - ~ ~
- Of all the above ~actors, the"melting temperature i9 probably the most important. The ~0~691~
g melting temperature of the primer pair is the temperature at which hydrogen bonds, which normally hold the pair together, are destroyed. Above this temperature, the individual pair members separate and exist in solution as single-stranded DNA. To be effective in the sequence-independent amplification methods o~ this invention, the primer pair should have a melting temperature lower than the melting temperature of the target DNA sequences to be lo amplified. Most preferably, the melting temperature of the primer pair will be below about 70c.
Several factors contribute to the melting temperature of the primer pair, as well as to the melting temperatures of all complementary DNA
sequences. These factors are well known to those of skill in the art and include the length o~ the DNA
~equence, the G-C contcnt o~ the DNA se~uena~ and th~
ionic strength o~ the ~olution containing the primer pair.
For example, the melting temperature of the universal primer pairs of the present invention may be calculated by assigning a 4C contribution to each G-C
base pair, a 2C contribution to each A-T base pair and a 0C or negative contribution to each mismatched base pair present in the oligonucleotide primer pair. It will be understood by those of skill in the art that the position of mismatched base pairs in the primer pairs of the present invention (i.e., 5!, 3' or middle) - which ~re not-100% complementary will also effect the melting temperature.
According to a pre~erred embodiment of this - invention, theise~uence of the~linker pair is selected from;the group~consisting of~
NANB 15 i`5lAGCAGGCAGAAGTATGC~AA 3!
NANB 16 3'TCGTCCGTCTTCAT~CGTTT 5', . '.' '. ': ' . , ' ' ' ' ' ' ' ~

~4~919 NANB 19 5'TAAGTAGGTGAGTAAGTGAG 3' NANB 20 3'ATTCATCCACTCATTCACTC 5', and PCR 01 5'GTTATTGCGGCCGCTTATTG 3' PCR 02 3~CAATAACGCCGGCGAATAAC 5'.
Most prePerably, the primer pair is PCR 01/PCR 02. The melting temperature o~ PCR 01/PCR 02 is about 600c.
Another ~actor important in choosing primer pairs for use in the methods of the present invention is the absence of 3' self-complementarity. As used herein, the term "self-complementarity" refers to the ability o~ one molecule of an individual primer pair member to hydrogen bond to a second molecule of the same primer pair member to ~orm double-~tranded DN~.
Self-aomplementarit~ i~ most o~ten character~zed by the pre~nae of a restri~t~on endonualease s~te in the sequence o~ th~ oligonucleotide primer pair m~mber.
When sel~-complementarity exists at the 3' end o~ a primer pair member, the annealing of two molecules o~ that primer pair member creates an appropriate substrake for DNA polymerase ~i~e., a template and a primer). Because primer pair members are present in great excess over target DNA in the methods of the present invention, the above undesirable substrates rapidly consume the deoxynucleoside triphosphate molecules, resulting in--drastically reduced efficiency o~ target DNA amplification.-Self-complementarity at either the 5' end or in the middle o~ a primer pair member is not detrimental to the methods of this invention. The 30 double-stranded DNA molecule ~ormed by the~annealing of two molecules of a primer pair mem~er displaying such self-complementarity is not a ~ubstrate ~or ~NA
polymerase. As used throughout the speci~ication and .~ I

`; 20~691~

~, in the claims, the term "significant self-complementarity" refers to that type of self-complementarity which would favor the annealing of individual molecules of a primer pair member to one another so as to create a DNA polymerase substrate.
Finally, to be most effective in the methods o~ the present invention, the 5' ends of the primer pair should be non-phosphorylated. The absence of phosphorylation prevents the ligation o~ the linker pairs or individual primer pair members to each other.
A structure which consists solely of concatamers of oligonucleotide primer pairs would create a substrate for DNA pol~merase during the melting and reannealing steps o~ the methods o~ thi~ inven~ion. Such a reaction is undesirable because ~t dramatically decreases the e~iciency o~ the ampli~icat~on reaction.
rrhe oligonucleotid~ prim~r pair~ o~ this invention may be synthcs~zed by any s~andard method known in the art. Preferably, both first and second strands of the primer pair are synthesized separately, using an automated oligonucleotide synthesizer.
The methods of the present invention require the presence of double-stranded target DNA in order to ~ carry out amplification. Once the target DNAs have been isolated, the next step is to ligate on the primer pair. Because the amplification methods of the present invention require the ligation of the primer pair onto : the target DNA by blunt-end ligation, the target DNA
should first be rendered blunt-ended. This may be achieved b~ any conventiona} method, including the use of restriction enzymes which produce blunt ends, as well as:.by singIe-strand specific.exonucleases which :generate blunt.ends..from~.overhangs previously produced . by restriction enzymes; or enzymes used in th~
35 synthesis o~ cDNA. .: .:

.: - . ~. . . .. .... ;.: .;, , . , . , .. . . , , . i. .

Wog~/094~7 PCT/US90/00866 2~9i9 It will be obvious that the need for blunt- ~.
ending is obviated if the target DNA is initially present as a blunt-ended molecule. The optimum concentration of primer pair used in the ligation reaction will range ~rom about 1 femtomole to about 1 picomole/~l of reaction mix. In addition, the concentration of primer pair i~ ideally many-fold greater than that of the target DNA.
Ligation may be performed by any number of con~entional techniques. Because the primer pair is not phosphorylated, the products of the ligation will consist of a first primer pair member covalently attached to the blunt 5' texminus o~ the target fragments and the second primer pair member anne~led to the first primer pair member via hydrogen bonding, but not covalently attached to the 3' terminu~ of the target DNAs.
Becau~e ligation is achieved via blunt-ends, the primer pairs may be oriented in either direction at either end of the target DNAs, resulting in ~our possible combinations:
(1) 5'(top)3'~ 5'(top)3' 3'(bottom)5' -------------------3'(bottom)5' (2) 5'(bottom)3'------------------- 5'(top)3' 3'ttop)5' ~ ---3'(bottom)5' (3) 5'~top)3'------------------- 5'(bottom)3' 3'(bottom)5' ----------- -------3'(top)5' (4) 5'(bottom)3'------------------- 5'~bottom)3' ~ 3-l(top)5l--------------------3l(top)5l wherein ---- - represents the targQt..DNA;~ (top) and (bottom) represent the two di~Perent.members of the primer pair; 5' and 3' represent the orientation of the ... ........... ,.: .. .-, . . . . - .............. ........... ..... .....

.. ... ... . . . .. . .. . . . . .... ... . . .

wo9~/o94s7 PCTIUS90/0086~
20 4~

primer pair and ~ represents a covalent phosphodiester bond between the target DNA and the 3' ends of the :
primer pair. The actual amplification step of the ~-methods of this invention is initiated by adding an 5 excess quantity of only one member o~ the primer pair.
Those of skill in the art will recognize that only one of the above four molecules may actually be amplified (either (~) or (3) depending on whether the "top" or "bottom" primer pair mem~er is used for initiation of lO amplification). This is of little consequence, however, since the amount of target DNA increases exponentially during each amplification step.
After the ligation has been completed, the unbonded member of the primer pair i5 melted o~ and 15 replaced by an identical sequence that i9 covalently bonded to the tar~et DNAs. ~his is pr~ferabl~ achicved by rai~ing khe temperature o~ the solution aontalniny the linkered target DNA to a point at which th~
unbonded pair member melts o~ and then per~orming a 3' 20 extension reaction. The temperature of the solution should not, however, be raised high enough to cause a melting of the strands of the target DNAs. It is ?
therefore desirable to heat the solution to a temperature above the melting temperature (T~) of the 25 primer pair, but below the T~ of the target DNA. It will also be understood by those of skill..in the art that the ionic strength of the solution may also affect the ~. Although the T~ of the target DNA will be undeterminable in practice, the-T~ of most DNA sequences :~
30 of ~ignificant length (i.e., greater than about 400 base pairs) is given by the following formula:
T~ - 69.3 + 0.41 ~mole ~ G+C) . ;
Accordingly,..the T~ of~most target DNAs will be at least 75C. It is there~ore pre~erable to use a primer pair ;r .";' '~ ' ' ,'`'`` .',' ' ' '.. " .. ' ' `' . ' '"' " ' : , " '`' ' '" ' ' . .;.` ' '~" .. ' ` ' ' ' ' "

WO 90/09457 PCT/US9~ O866 2~g'~

that has a melting temperature below about 70C and to eff~ct the melting of the primer pair by heating to about 72C. The melting reaction is essentially complate after about 5 minutes.
once the unbonded pair member is melted off, the resulting 5' overhangs are repaired by standard 3' extension means. This involves contacting the sample with a mixture of ~our deoxynucleotide triphosphates (dATP, dCTP, dTTP and dGTP) and a DNA polymerase, preferably a thermostable polymerase, such as Taq. The extension reaction is preferably performed at about 72C. The 3' extension reaction is preferably carried out in the presence of an excess amount of the one of the members o~ the primer pair that will be used to initiate PCR. Although the added primer pair member does not participate in the 3' extension reaation, it is prQ~arably included at thi~ ~tep in preparation ~or the subsequent polymerase chaln rQaction step.
Alternatively, the primer pair member may be added following the 3' extension reaction. The amount o~
primer pair member added at this i~tep is at least 10-~old greater and pré~erab}y at least 20-~old greater than the amount of primer pair added in the ligation reaction. This will AllowAsubsequent amplificatîon of the linkered target DNA in the polymerase chain reaction steps that follow.
In a more preferrsd embodiment, the melting off and 3' extension steps are performed simultaneously and in the presence of an excess amount of one of the primer pair members. This is achieved by adding the primer pair member, the DNA polymerase and the ~our deoxynucleQtide triphosphates prior to or during the melting off step.
PCR is initiated ~ollowiny completion o~ the extension reaction by adding an ef~eotive amount o~ a :, . ' ' ' ' . , .

W090/09457 P~T/US90/00i866 ,. .',.. 20~6gl~
. - 15 -primer pair member, an effective amount of a DNA
polymerase and an effective amount of the four different nucleotide triphosphates According to a preferred embodiment, the PCR reaction utilizes the primer pair member, deoxynucleotide triphosphates and DNA polymera3e already present in the samples f`rom the 3' extension step. First, the sample is heated to a temperature above the T~ o~ the target DNA. Preferably, the sample is heated to about 93C to insure complete lo melting of the linkered target DNA strands. .
Additionally, the duration of this heating should preferably be kept to a minimum effective time, most pre~erabl~ about 2 minutes. The sample is then cooled, pre~erably to about 40~C, to allow hybridization o~ the excess added primer pair member to its comple~entary.
sequence present on the linkered target DNA.
Pre~erably, this step will ali~o be complete in about 2 minutes. The sample i~ then rehaated to a temperature which promotes primer extension, resulting in an e~ective doubling o~ the amount of properly primed target DNAs. The temperature at which primer extension is performed must be lower than the T~ o~ the target DNAs and, when Ta~ polymerase is employed, is preferably about 72C. The duration of the primer 25 extension step will vary depending on the length of the -~
target DNA. The duration of the primer extension step is approximated at ahout 1 minute per kilobase length of target DNA. In most situations, khe primer:
extension reaction is completed in about 4 to about 6 30. minutes. The melting, annealing and primer extension steps are then repeated as many times as is necessary to.produce a desired amount of. target DNA. These steps ...or their equivalents,.which result -in the~amplification ... .
..of target DNA, are colleatively re~erred to.as 'IPCR

WOso/ns4s7 PCT/US~0/00866 means". The amount of target DNA produced may be estimated by the formula:
Xo2n where XO equals the amount of ampli~iable target DNA
sequence initially present and n equals the number of PCR cycles performed.
The techniques for initlally obtaining the target DN~ will vary depending upon the nature of the original sample. For example, if the target DNA is a lo collection of cDNAs synthesized from a small tissue sample or a single cell, the first step is the isolation of mRNA ~rom that sample. This technique is well known in the art. As used herein the term "small tissue sample" re~ers ~o an amount o~ a biologlcal sample which does not aontain enough mRNA to produce clonable qUantitiQ~ of cDNA. Small tissue samples are exempli~ied by biopsy ~amples.
After the mRNA has been isolated, first- and second-strand cDNA synthesi~ is per~ormed, preferably employing a cDNA synthesis kit (e.g., BRL cDNA
Synthesis System, Bethe~da Research Laboratories, Bethesda, Maryland~. The sequence-independent gene amplification methods of this invention may then be used to produce clonable amounts of the resultant cDNA
~olecules. Restriction enzyme site-conkaining linkers or polynucleotidç-linkersi may then be ligated onto the ends of the cDNAsi following the amplification reaction.
PrePerably, the oligonucleotide primer pair will itself contain an internal restriction site, located either in the middle or at the 5' end, obviating the need for additional linkers. :
In an alternate embodiment o~ the present invention, the original sample to be amplified consists of nucleic a¢id sequiences-obtained from a suspected infectious agent which is present in an intractable '' " ~, ~ .' ~ ' ` ` '' ' W0 ~/Og457 PCr/US90/00866 .
- 17 - 204~919 titer in the infected host. In the case of suspected enveloped virus, a biological sample containing the presumptive causative agent is obtained, homogenized if necessary, and treated with a nuclease, preferably micrococcal nuclease, to digest the host's nucleic acid sieguences. The nuclease is then inactivated by a~y of a number of well known procedures including, but not limited to, heating, addition of metal chelaters, such as EGTA, and extraction with organic solvents, such as lo phenol. The causative agent's nucleic acid sequences are then isolated.
Isolation of nucleic acid sequences from the causative agent initially involves destruction of the viral envelope. Thiis may be achleved with a variety of reagents including organic solvents, pre~erably phenol, lipases, and protaasQs. The nucleic acids may then be isolate7d by stiandard techni~ues~ Most pre7fcrably, inactivation o~ the nuclease and disisolution o~ the viral envelope are achieved in a single step by phenol extraction. The isolated nucleic acid sequences remain in the agueous phase which may be used directly in the methods of this invention or following precipitation and concentration. It should be obvious that precipitation of the small amount of nucleic acid sequences may be facilitated by the addition of a carrier molecule. Most preferably, the carrier molecule is a mixture of short, random sequence oligonucleotides. -It is well known that viral nucleic acid sequences may be in the form of single-stranded or double-stranded DNA or RNA. Additionally, the nucleic 7 acid seguences may be circular or linear.-;lIn order to amplify the nucleic acid sequences from an infectious agent without first identifying their structure it is preferable that dou~le-stranded cDNA be synthesized . '.'. ' . " ' ' . I'; ", "'. . ' . ' ' ' ' . ' ` ' I , :. '. " ` . ' . . ' ' ' ' ~'.' " ` ' '` ' ' ' '. . . ' W090/09qS7 PCT/US90/00866 2~6919 ; i - 18 -from the isolated nuclQic acid sequences. Because cDNA
synthesis requires single-stranded nucleic acid sequences as templates, the isolat2d nucleic acid sequences should initially be denatured. Boiling the isolated nucleic acid sample i5 most preferable because it will denature both linearizad and nicked, circular double-stranded nucleic acids, while having no deleterious e~fect on single-stranded nucleic acids.
If the viral nucleic acid exists as a covalently closed double-stranded DNA circle, the boiling step is likely to introduce random nicks into each strand at low frequency. T~iese nicked molecules will then denature.
There~ore, this treatment insures the production o~
siingle-stranded nucleic acids no maitter what the nature of the starting material. c~NA isynthesis may then be achieved ~rom the reii3ulting s~ngle-stranded nuc:lelc acids by methodi3 whiah are known to those o~'skill in the art. The double-stranded cDNA is an appropriate target DNA for the methodis vf this invention. It should also be underistood that isolated nucleic acids that are known to exist as linear double-stranded DNA
molecules may be amplified directly by the methods of this invention without the need for synthesizing linear double-stranded cDNA.
Still another e~bodiment of the preæent invention relates to amplif'ying DNA inserts contained -within an isolated recombinant clone. This aspect of the invention is especially useful when the target DNA
is cloned into a vector, such as a bacteriophage, which ca~not be replicated readily into large quantities.
This method surprisi~gly allows those of skill in thie art to produce usefu~ quantities of`these DNA`inserts ;~ without the need for subcloning into-a more siuiitable vector. ;~ ; ; `
.:

Wo90/0~4s7 PCT/USgO/00866 19- 2~919 I~ this embodiment of the invention, the vector containing the DNA~insert desired to be amplified is isolated from the host which harbors it.
Such methods are well known and are commonly used in the art. The vector is then cleaved with a restriction enzyme which will release the inserted tar~et DNA from the vector. The released target DNA and the remaining vector may then be ampli~ied in solution together and subsequently separated on the basis of size (invariably lo the vector will be substantially larger than the target DNA).
In order that this invention may be more fully understood, the ~ollowing examples are set forth.
It should be understood that these examples are ~or illustrative purposes only and are not to be construed as llmiting this invention in any mannar.
~ .
Synthesis Of An Oligonucleotide Primer Pair And PreParation Of Tarae,t DNA
We ~irst synthesized the following oligonucleotide primer pair by automated oligonucleotide synthesis:
PCR 01 5'GTTATTGCGGCCGCTTATTG 3' ' PCR 02 3'CAATAACGCCGGCGAATAAC 5'.
The individual oligonucleotide primer pair `
~embers, PCR Ol,and PCR 02, were synthesized separately ' o~ an automated Applied Biosystems 380A DNA ;
synthesizer. Following synthesis, I deprotected the ~
,oligonucleotides by adding 4 ml of concentrated '~i ammonium hydroxide to the vial containing the , ... .. .. . .
oligonucleotide.,,I incubated the vial for 8,hours at '~ ' .. . .. ~ . . .. , . .. .. -600C with constant stirring.,,I then allowed the vial .. . .. . ..
to cool and transferred the conkents to two 2.5 ml Eppendor~ tubes. ~he solution in the Eppendorf tubes , ,. ~, ! ~ " ",, , , ' ~ , ` i . .

WO~o/094s7 PCT/US90/~66 2~ ~g ~ -- 20 -was then eYaporated to dryness in a Speed-Vac Concentrator (Savant, HicXsville, NY).
I further purified the individual oligonucleotide primer pair members by electrophoresis in a 10 well, 1.5 mm thick, 20% polyacrylamide gel containing 7 M urea. I dissolved the contents o~ one Eppendor~ tube in 40 ~1 o~ 7 M urea and loaded 10 ~1 oP
the mixture into each of ~our wells in the gel. The samples were then electrophoresed for approximately lo 2 hours at 500 volts. I then removed the gel from the glass plates and wrapped it in plastic wrap. The electrophoresed oligonucleotide was visualiz~d under ultraviolet li~ht using a fluorescent TLC plate as a backyround (Whatman, Maidstone, Kent, England). Bands containing the oligonucleotide were exci~cd ~rom the gel and placed into an Eppendor~ centri~uge tub~.
The oligonucleotide was then elut~d ~rom the gel slice by adding ~usk enough 10 mM triethylammonium bicarbonate, pH 7.6, to cover the excised gel slice and incubating at 50C for 3 hours. The eluted material was then loaded onto a 1 ml disposable C18 column (J. T. Baker, Phillipsburg, NJ). The column had been previously washed with 10 ml of HPLC grade acetonitrile followed by 10 ml of M20. After loading the sample onto the column and collecting the eluate the column was ~ashed with 10 ml of H20. The oligonucleotide was then eluted with 4 x 1 ~1 of 20~ acetonitrile in H20.
The DNA eluted in the first two 20% acetonitrile fractionsi as determined spectrophotometrically at 260 nm. The fractions containing the oligonucleotide were:concentrated to dryness in a Speed-Vac ` Concentrator. The oligonucleotide was-then dissolved in 1 ml of H20. The ~inai concentràtion of oligonucleotide was determined by measuring the absorbance at 260 nm. The oligonucleotide solution was I ,.
.. I .

WO90/0~4~7 PCT/US90/00866 - 21 - 20~'319 ~, stored at -20C until used. The ~inal yield of both PCR 01 and PCR 02 was 1.4 OD260 units (64 ~ig).
~he target DNAs used to test the method of this invention were ~ II fragments of the plasmid RSD
~PCT patent application W0 88/00831). Specifically, we digested 10 ~ig of RSD DNA in Z00 ~1 of appropriate restriction bu~er with ~0 units of ~ncII (New England Biolabs, Beverley, MA). The digestion was performed at 37C for 2 hours. The digestion yielded five fragments of 4042, 306Z, 2304, 1855 and 1108 base pairs. The test fragments were then diluted 1:500 into H2O.

Sçquen~e IndePende~t Tarqet ~NA ~mPli~ia~tion We ligated 10 picomoles o~ unpho~phorylated linker palr PC~ 01/PC~ 02 to 1 ng o~ te~t ~raigment.
Speci~ically, we added 10 ~1 o~ diluted test ~ragments which were produced according to Example 1 to 100 ~1 o~ `
lX T4 DNA ligase bu~fer (50 mM Tris-HCl, pH 7.8, 10 mM
MgS04, 20 mM DTT, 1 mM ATP) aontaining 40 unlts of T4 ligase and 10 picomoles each o~ PCR 01 and PCR 02. The ligation mixture was allowed to incubate for 16 hours ..
at 15C. .:~ .
Following ligation, we added 1 ~1 of the !:
ligation mix to 100 ~1 of lX PCR buffer (50 mM KCl, 10 mM Tris-HCl, pH 8.4, 1.5 mM MgC12, 100 ~g/ml gelatin) -.. :.
containing 20 nmoles of dXTPs,.20 pmole.of PCR.01 and 1 - ..
unit of Ta~ polymerase. The solution was then overlayed with 100 ~1 of sterile mineral oil and .
incubated at 72C for five minutes. .This inc~bation 30 A. allowed the simultaneous~melting..off of the unligated member of the primer.pair.~and.repair o~..the resultant 20 base overhang by a.3' extension xeaction.
We initiated the polymerase chain reaction by denaturing the linkered target DNA ~or 2 minutes at . .

:';.;. '' ., . , ' . ,, ',. ', , , : . . ., .. ,`' .,, ,.. , ' '' : :: ,' : ' .
': :'' : ' ' ' ,,,, . . . : . , wo~o/09457 2 ~ ~ 6 ~ 1 g PCT/US90/0~866 930C. This was followed by a cooling to 400c for 2 minutes, which allowied the ~xcess added PCR ol to hybridize to its csmplementary sequence contain2d in the linkered target DNA se~uence. Primer extencion was carried out ~y raising the temperature to 720C for 6 minutes. We repeated this 10 minute cycle 59 times.
The entire cycle was per~ormèd automatically using a DNA Thermal Cycler ~Perkin-Elmer/Cetus) To show that either member of the primer pair may be e~fectively utilized to amplify a target DNA we performed the identical procedure described above except we substituted 20 pmoles of PCR 02 for PCR 01 in the lX PCR bu~er.
We anal~zed 10 ~1 of each reaction b~
electrophoresis on a TAE/ethldium bromide/1~ agarose minigel. Th~ ~ample~ werQ elec~rophoresed at 100 volt5 untll the dye ~ront neared the bottom o~ the gel.
Figure 1 displays the results of this analysis.
~igure 1, lane 1 depicts O.S ~g o~ unampiified test fragments. Figure 1, lanes 2 and 3 depict the l/lOth o~ the product of amplifying 10 picograms o~ test fragments for 60 cycles using PCR 01 or PCR 02, respectively, as primers.
It should be noted that only the three smallest test fragment were effectively ampli~ied. I
b~lieve that this inefficiency can be attributed to single-stranded nicks that were present in the starting test ~ragments. The occurrence of such nicks is random and therefore the larger the fragment, the greater the chance of it containing a nick. When these nicks are prèsent in a target DNA molecule one end of that -~ - molecule will be unlinkered after the first cycle of denaturatlon. Such a structure cannot be primed at the unlinkered end and henc9, is unamplifiablè.
. .......................... . . .
`:~

W~s0/0945~ PCT/US90/00866 2~46919 Amplification Of Unknown Sequences Insulin-dependent diabetes mellitus (IDDM) is a disease whose cause is unXnown. The suspected causative agent may be a virus present at an intractable titer ~G. T. Horn et al., Proc. Natl, Acad.
Scl. USA, 8i5, pp. 6012-16 (1~88)]. The methods of this invention are applied to a blood sample of a patient developing IDDM to detect and analyze the nucleic acids of this suspected virus.
A sample of blood is collected from a patient recently diagnosed as having IDDM. The blood is collected with a large bore needle into antic~agulant-free Vacutainers ~Becton-Dickinson, Ruther~ord, NJ).
Cells and ~ibrin clots are removed by centri~uglng at 2,000 rpm ~or 20 minutes at 4C. Onc ml o~ the serum is treated with 10 ~g v~ microcoacal nuclea~e ~Pharmacia, Piscataway, New ~erOEey) ~or 1 hour at 37C ~.
to digest any free nucleic acid that may be contained ;
in the serum. Nucleic acids from the suspected enveloped virus are liberated into solution by adding ~' S ~1 of lM DTT and lO00 units of RNasin ~Promega, Madison, Wisconsin) and then extracting twice with phenol.
The aqueous phase is collected and 1 ~l of synthe~ic primer, pd(N)6, (at a concentration of 50 OD26~ units/ml, Pharmacia) is added., The synthetic ~ '' primer, pd(N)6, is used to randomly prime ~irst strand cDNA synthesis as well as serving as a carrier during subsequent,precipitation o~,the rare viral nucleic - ---acids.~ The nucleic n acids are then ethanol, - - precipitated, dried,and redissolved,in,30,~1 of H~O. ' ,The sample,,is then denatured by;bo~l~n~ ~or 3 minutes.
. . .

'., ` ' ' ' .' .' . .' ` ' ~ ', . `' '. , ` ' ' , ,` ` ` .` ~ ' ' . ' ` ` ` ` ` ' ' ' ' .; ` ` ' ' ' . ` ' ' ' ` ` ' ` . . ' ' , i '. . ' ' ` ' `. ` . ' . .

WO90/D94~7 PCl/US90/00866 ~o4~9 ~ 9 ~enaturation is prevented by quickly chilling the boiled sample on ice.
Double-stranded cDNA is then synthesized from the denatured nucleic acids using a cDNA kit (Bethesda Research Laboratories, Bethesda, Maryland) following the manufacturer's instructions. The resulting cDNA is isopropanol precipitated, redissolYed and then ethanol precipitated. The ethanol prec~pitate is dissolved in 20 ~1 of lX T4 DNA ligase buffer containing 2 picomoles each of PCR 01 and PCR 02 and 8 units of T4 ligase.
Ligation is achieved by incubating the sample overnight at 15~C.
To amplify the linkered target cDNA, 10 ~1 of the ligation mixture is added to 100 ~l of lX PCR
bu~er containing 20 nmoles o~ dXTPs, 20 pmoles oP PCR
01 and l unit o~ ~3~ polymera~e. The sample ii5 overlay~d with lO0 ~l of st~rile min~ral oil and h~atcd to 72C ~or 5 minute~ to melt o~ th~ unligat~d prim~r pair member and repalr thQ overhang. The linkered target cDN~ then amplified in a 60 cycle program, each cycle consisting o~ denaturing at 93c for 2 minute~, primer annealing at 40C ~or 2 minutes and polymerase extension at 72C for 6 minutes.
once amplified the linkered cDNAs are digested wi-th NotI, which cleaves in the middle of the PCR 01/PCR 02 primer pair, and ligated into a NotI-digested expression vector. Individual clones are plat~d and screensd with antisera obtained from a patient su~fering ~rom IDDM.
While WQ have hereinbe~ore represented a - number o~ embodi~ents of this invention, it ii5 apparent that our~basic construction can be~altered to provide other embodiments which utilize the processes of this invention.- Therefore, it will be appreciated that the scope o~ this invention ig to be defined by thQ claims . ! ~ i . . . . . ' . ~ .

~.''' '' ''' ,'', .,''' "' ''''' ' ' `'" ""',, . ' ' ' "~"' .

WO90/094s7 PCT/US9~00866 - ~5 - . ~0~6919 appended hereto rather than the specific embodiments which have bePn presented hereinbefore by way of example.

, .
.

: ~ .. i, . _ . .

Claims (17)

I claim:

1. An oligonucleotide primer pair for amplifying a double-stranded target DNA sequence, consisting of:
a first single-stranded DNA
oligonucleotide primer pair member comprising a DNA
sequence of between about 12 nucleic acids and about 40 nucleic acids and displaying no significant self-complementarity; and a second single-stranded DNA
oligonucleotide primer pair member comprising a DNA
sequence substantially equal in length and substantially complementary to said first single-stranded DNA member; said primer pair being characterized in that said first primer pair member and said second primer pair member are not phosphorylated and the TM of said oligonucleotide pair is less than about 70°C.

2. The oligonucleotide primer pair according to claim 1, wherein said first primer pair member and said second primer pair member both consist of 20 nucleic acids.

3. The oligonucleotide primer pair according to claim 2, said primer pair being selected from the group consisting of NANB 15/NANB 16, NANB
19/NANB 20 and PCR 01/PCR 02.

4. The oligonucleotide primer pair according to claim 1, wherein said primer pair is further characterized by the presence of a restriction endonuclease site.

5. The oligonucleotide according to claim 4, wherein said primer pair is PCR 01/PCR 02.

6. A method for amplifying a double-stranded target DNA sequence in a sample, comprising the step of ligating onto said target DNA the oligonucleotide primer pair according to any of claims 1 to 5.

7. The method according to claim 6, comprising the subsequent steps of:
(a) heating said target DNA to a temperature between the TM of said oligonucleotide primer pair and the TM of said target DNA to melt off the unbonded oligonucleotide primer pair member so as to create 5' overhangs; and (b) repairing said 5' overhangs by 3' extension means.

8. The method according to claim 7, wherein said 3' extension means are performed in the presence of an effective amount of a first oligonucleotide primer pair member, an effective amount of a thermostable DNA polymerase, and an effective amount of four different nucleotide triphosphates.

9. The method according to claim 7, wherein an effective amount of a first oligonucleotide primer pair member, an effective amount of a thermostable DNA
polymerase, and an effective amount of four different nucleotide triphosphates are added to said sample prior to or during said heating of said target DNA.

10. The method according to claim 7 comprising the subsequent step of amplifying said target DNA by PCR means.

11. The method according to claim lo wherein said PCR means comprise the steps of:
(a) heating said sample containing said target DNA to a temperature above the TM of said target DNA so as to separate the strands;
(b) cooling said sample to a temperature effective to promote hybridization of said first oligonucleotide primer pair member to a complementary DNA sequence present in said separated target DNA strands produced in step (a);
(c) maintaining said sample at an effective temperature and for an effective amount of time to promote the activity of said thermostable DNA
polymerase and to synthesize an extension product of said first oligonucleotide primer pair member which is complementary to said separated strand produced in step (a); and (d) repeating steps (a), (b) and (c) for an effective number of times.

12. The method according to claim 6, wherein said target DNA is double-stranded cDNA.

13. The method according to claim 12, wherein said double-stranded cDNA is synthesized from messenger RNA present in a small tissue sample or in a single cell.

14. The method according to claim 12, wherein said double-stranded cDNA is synthesized from the isolated nucleic acid sequences of an infectious agent present in a biological sample.

15. The method according to claim 14, comprising the initial steps of:
(a) digesting host nucleic acid sequences contained in said biological sample;
(b) inactivating the reagent used to perform said digestion;
(c) isolating said nucleic acid sequences of said infectious agent; and (d) denaturing said nucleic acid sequences of said infectious agent under conditions which create an effective template for cDNA synthesis.

16. The method according to claim 15, wherein said biological sample is obtained from a patient suffering from a disease selected Prom the group consisting of insulin-dependent diabetes mellitus, Kawasaki disease, multiple sclerosis, rheumatoid arthritis and juvenile rheumatoid arthritis.

17. The method according to claim 16, wherein said disease is insulin-dependent diabetes mellitus.