CA2045869C - Fusion proteins with immunoglobulin portions, the preparation and use thereof - Google Patents
Fusion proteins with immunoglobulin portions, the preparation and use thereof Download PDFInfo
- Publication number
- CA2045869C CA2045869C CA002045869A CA2045869A CA2045869C CA 2045869 C CA2045869 C CA 2045869C CA 002045869 A CA002045869 A CA 002045869A CA 2045869 A CA2045869 A CA 2045869A CA 2045869 C CA2045869 C CA 2045869C
- Authority
- CA
- Canada
- Prior art keywords
- protein
- recombinant protein
- human
- fusion
- receptor
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Lifetime
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K16/00—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K16/00—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies
- C07K16/18—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P13/00—Drugs for disorders of the urinary system
- A61P13/12—Drugs for disorders of the urinary system of the kidneys
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P37/00—Drugs for immunological or allergic disorders
- A61P37/02—Immunomodulators
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P37/00—Drugs for immunological or allergic disorders
- A61P37/08—Antiallergic agents
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P7/00—Drugs for disorders of the blood or the extracellular fluid
- A61P7/04—Antihaemorrhagics; Procoagulants; Haemostatic agents; Antifibrinolytic agents
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P9/00—Drugs for disorders of the cardiovascular system
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
- C07K14/47—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/475—Growth factors; Growth regulators
- C07K14/505—Erythropoietin [EPO]
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/705—Receptors; Cell surface antigens; Cell surface determinants
- C07K14/715—Receptors; Cell surface antigens; Cell surface determinants for cytokines; for lymphokines; for interferons
- C07K14/7155—Receptors; Cell surface antigens; Cell surface determinants for cytokines; for lymphokines; for interferons for interleukins [IL]
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/745—Blood coagulation or fibrinolysis factors
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/62—DNA sequences coding for fusion proteins
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/14—Hydrolases (3)
- C12N9/48—Hydrolases (3) acting on peptide bonds (3.4)
- C12N9/50—Proteinases, e.g. Endopeptidases (3.4.21-3.4.25)
- C12N9/64—Proteinases, e.g. Endopeptidases (3.4.21-3.4.25) derived from animal tissue
- C12N9/6421—Proteinases, e.g. Endopeptidases (3.4.21-3.4.25) derived from animal tissue from mammals
- C12N9/6424—Serine endopeptidases (3.4.21)
- C12N9/647—Blood coagulation factors not provided for in a preceding group or according to more than one of the proceeding groups
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K38/00—Medicinal preparations containing peptides
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2319/00—Fusion polypeptide
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2319/00—Fusion polypeptide
- C07K2319/30—Non-immunoglobulin-derived peptide or protein having an immunoglobulin constant or Fc region, or a fragment thereof, attached thereto
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2319/00—Fusion polypeptide
- C07K2319/32—Fusion polypeptide fusions with soluble part of a cell surface receptor, "decoy receptors"
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2319/00—Fusion polypeptide
- C07K2319/50—Fusion polypeptide containing protease site
Landscapes
- Health & Medical Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Genetics & Genomics (AREA)
- General Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Medicinal Chemistry (AREA)
- Molecular Biology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Zoology (AREA)
- Biochemistry (AREA)
- Biophysics (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Immunology (AREA)
- Animal Behavior & Ethology (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Public Health (AREA)
- Veterinary Medicine (AREA)
- Pharmacology & Pharmacy (AREA)
- Biomedical Technology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- General Chemical & Material Sciences (AREA)
- Wood Science & Technology (AREA)
- Toxicology (AREA)
- Gastroenterology & Hepatology (AREA)
- Biotechnology (AREA)
- Hematology (AREA)
- General Engineering & Computer Science (AREA)
- Microbiology (AREA)
- Heart & Thoracic Surgery (AREA)
- Cell Biology (AREA)
- Diabetes (AREA)
- Plant Pathology (AREA)
- Pulmonology (AREA)
- Cardiology (AREA)
- Urology & Nephrology (AREA)
- Physics & Mathematics (AREA)
- Peptides Or Proteins (AREA)
- Preparation Of Compounds By Using Micro-Organisms (AREA)
Abstract
The invention relates to genetically engineered soluble fusion proteins composed of human proteins not belonging to the immunoglobulin family, or of parts thereof, and of various portions of the constant region of immunoglobulin molecules. The functional properties of the two fusion partners are surprisingly retained in the fusion protein.
Description
Beh.ringwerke Aktiengesellschaft HOE 90/B 026 - Ma 824 and Dr. LP
The General Hospital Corporation 20458649 Description Fusion proteins with immnunoglobulin portions, the preparation and use thereof The invention relates to genetically engineered soluble fusion proteins composed of human proteins not belonging to the immunoglobulin family, or of parts thereof, and of various portions of the constant region of immunoglobulin molecules. The functional properties of the two fusion partners are, surprisingly, retained in the fusion protein.
EP-A 0 325 262 and EP-A 0 314 317 disclose corresponding fusion proteins composed of various domains of the CD4 membrane protein of human T cells and of human IgGl portions. Some of these fusion proteins bind with the same affinity to the glycoprotein gp120 of human iaununo-deficiency virus as the cell-bound CD4 molecule. The CD4 molecule belongs to the immunoglobulin family and, consequently, has a very similar tertiary structure to that of immunoglobulin molecules. This also applies to the a chain of the T-cell antigen receptor, for which such fusions have also been described (Gascoigne et al., Proc. Natl. Acad. Sci. USA, vol. 84 (1987), 2937-2940).
Hence, on the basis of the very similar domain structure, in this case retention of the biological activity of the two fusion partners in the fusion protein was to be expected.
The human proteins which are, according to the invention, preferably coupled to the amino terminus of the constant region of immunoglobulin do not belong to the immuno-globulin family and are to be assigned to the following classes: (i) membrane-bound proteins whose extracellular domain is wholly or partly incorporated in the fusion.
These are, in particular, thromboplastin and cytokine _ 2 - 2045869 receptors and growth factor receptors, such as the cellular receptors for interleukin-4, interleukin-7, tumor necrosis factor, GM-CSF, G-CSF, erythropoietin;
(ii) non-membrane-bound soluble proteins which are wholly or partly incorporated in the fusion. These are, in particularly, proteins of therapeutic interest such as, for example, erythropoietin and other cytokines and growth factors.
The fusion proteins can be prepared in known pro- and eukaryotic expression systems, but preferably in mammal-ian cells (for example CHO, COS and BHK cells).
The fusion proteins according to the invention are, by reason of their immunoglobulin portion, easy to purify by affinity chromatography and have improved pharmacokinetic properties in vivo.
In many cases, the Fc part in fusion protein is thoroughly advantageous for use in therapy and diagnosis and thus results, for example, in improved pharma-cokinetic properties (EP-A 0232 262). On the other hand, for some uses it would be desirable to be able to delete the Fc part after the fusion protein has been expressed, detected and purified in the advantageous manner described. This is the case when the Fc portion proves to be a hindrance to use in therapy and diagnosis, for example when the fusion protein is to be used as antigen for immunizations.
There are in existence various proteases whose use for this purpose appears conceivable. Papain and pepsin are employed, for example, to generate F(ab) fragments from immunoglobulins (Immunology, ed. Roitt, I. et al., Gower Medical Publishing, London (1989)), but they do not cleave in a particularly specific manner. Blood coagula-tion factor Xa by contrast recognises in a protein the relatively rare tetrapeptide sequence Ile-Glu-Gly-Arg and performs a hydrolytic cleavage of the protein after the arginine residue . Sequences which contain the described tetrapeptide were introduced first by Nagai and Thogersen in a hybrid protein by genetic engineering means (Nagai, R. and Thogersen, H.C., Nature, vol. 309 (1984), 810-812). These authors were able to show that the proteins expressed in E. coli actually are specifi-cally cleaved by factor Xa. However, there is as yet no published example of the possibility of such proteins also being expressed in eukaryotic and, especially, in animal cells and, after their purification, being cleaved by factor Xa. However, expression of the proteins according to the invention in animal cells is preferable because only in a cell system of this type is there expected to be secretion of, for example, normally membrane-bound receptors as fusion partners with retention of their natural structure and thus of their biological activity. Secretion into the cell culture supernatant facilitates the subsequent straightforward purification of the fusion protein.
The invention thus relates to genetically engineered soluble fusion proteins composed of human proteins not belonging to the immunoglobulin family, or of parts thereof, and of various portions of the constant regions of heavy or light chains of immunoglobulins'of various subclasses (IgG, IgM, IgA, IgE). Preferred as immuno-globulin is the constant part of the heavy chain of human IgG, particularly preferably of human IgGl, where fusion takes place at the hinge region. In a particular embodi-ment, the Fc part can be removed in a simple way by a cleavage sequence which is also incorporated and can be cleaved with factor Xa.
Furthermore, the invention relates to processes for the preparation of these fusion proteins by genetic engineer-ing, and to the use thereof for diagnosis and therapy.
The invention will now be described in relation to the drawings, in which:
Figure 1 shows two oligonucleotide probe molecules used in cloning of thromboplastin cDNA;
Figure 2 shows the nucleotide sequence of clone 2b-Apr5 with the thromboplastin amino acid sequence deduced therefrom;
Figure 3 shows two oligonucleotide sequences which are partially homologous with the sequence of the coding strand (A), and with the non-coding strand (B) of thromboplastin cDNA;
Figure 4 shows the restriction map of plasmid pTF1Fc;
Figure 5 shows two oligonucleotide sequences which are partially homologous with the sequence of the coding strand (A), and with the non-coding strand (B) of the IL-4 receptor cDNA cloned in the vector pDC302/T22-8;
Figure 6 shows the restriction map of plasmid pIL4RFc;
Figure 7 shows two oligonucleotide sequences A and B which are partially homologous with the sequence of the coding strand (A), and with the non-coding strand (B) of the EPO cDNA cloned in the vector pCES; and Figure 8 shows the restriction map of plasmid pEPOFc.
Finally, the invention is explained in further examples.
Example 1: Thromboplastin fusion proteins Blood coagulation is a process of central importance in the human body. There is appropriately delicate regula-tion of the coagulation cascade, in which a large number of cellular factors and plasma proteins cooperate. These proteins (and their cofactors) in their entirety are called coagulation factors. The final products of the coagulation cascade are thrombin, which induces the aggregation of blood platelets, and fibrin which stabil-izes the platelet thrombus. Thrombin catalyzes the formation of fibrin from fibrinogen and itself is formed by limited proteolysis of prothrombin. Activated factor X (factor Xa) is responsible for this step and, in the presence of factor Va and calcium ions, binds to platelet membranes and cleaves prothrombin.
Two ways exist for factor X to be activated, the extrin-sic and the intrinsic pathway. In the intrinsic pathway a series of factors is activated by proteolysis in order for each of them to form active proteases. In the extrin-sic pathway, there is increased synthesis of thrombo-plastin (tissue factor) by damaged cells, and it acti-vates factor X, together with factor VIIa and calcium ions. It was formerly assumed that the activity of thromboplastin is confined to this reaction. However, the thromboplastin/VIIa complex also intervenes to activate the intrinsic pathway at the level of factor IX. Thus, a thromboplastin/VIIa complex is one of the most important physiological activators of blood coagulation.
It is therefore conceivable that thromboplastin, apart from its use as diagnostic aid (see below), can also be employed as constituent of therapeutic agents for treat-ing inborn or acquired blood coagulation deficiencies.
Examples of this are chronic hemophilias caused by a deficiency of factors VIII, IX or XI or else acute disturbances of blood coagulation as a consequence of, for example, liver or kidney disease. Use of such a therapeutic agent after surgicial intervention would also be conceivable.
Thromboplastin is an integral membrane protein which does not belong to the immunoglobulin family. Thromboplastin cDNA sequences have been published by a total of four groups (Fisher et al., Thromb. Res., vol. 48 (1987), 89-99; Morrisey et al., Cell, vol. 50 (1987), 129-135;
Scarpati et al., Biochemistry, vol. 26 (1987), 5234-5238;
Spicer et al., Proc. Natl. Acad. Sci. USA, vol. 84 (1987), 5148-5152). Thromboplastin cDNA contains an open reading frame which codes for a polypeptide of 295 amino-acid residues, of which the 32 N-terminal amino acids act as signal peptide. Mature thromboplastin comprises 263 amino-acid residues and has a three-domain structure:
i) amino-terminal extracellular domain (219 amino-acid residues); ii) transmembrane region (23 amino-acid residues); iii) cytoplasmic domain (carboxyl terminus;
21 amino-acid residues). In the extracellular domain there are three potential sites for N-glycosylation (Asn-X-Thr). Thromboplastin is normally glycosylated but glycosylation does not appear essential for the activity of the protein (Paborsky et al., Biochemistry, vol. 29 (1989), 8072-8077).
Thromboplastin is required as additive to plasma samples in diagnostic tests of coagulation. The coagulation status of the tested person can be found by the one-stage prothrombin clotting time determination (for example Quick's test). The thromboplastin required for diagnostic tests is currently obtained from human tissue, and the preparation process is difficult to standardize, the yield is low and considerable amounts of human starting material (placentae) must be supplied. On the other hand, it is to be expected that preparation of native, membrane-bound thromboplastin by genetic engineering will also be difficult owing to complex purification proces-ses. These difficulties can be avoided by the fusion according to the invention to immunoglobulin portions.
The thromboplastin fusion proteins according to the invention are secreted by mammalian cells (for example CHO, BHR, COS cells) into the culture medium, purified by TM
affinity chromatography on protein A-Sepharose and have surprisingly high activity in the one-stage prothrombin clotting time determination.
Cloning of thromboplastin cDNA
The sequence published by Scarpati et al., Biochemistry, vol. 26 (1987), 5234-5238, was used for cloning the thromboplastin cDNA. Two oligonucleotide probe molecules (see Fig. 1) were derived from this. These two probe molecules were used to screen a cDNA bank from human placenta (Grundmann et al., Proc. Natl. Acad. Sci. USA, vol. 83 (1986), 8024-8028).
cDNA clones of various lengths were obtained. One clone, 2b-Apr5, which is used for the subsequent procedure, codes for the same amino-acid sequence as the cDNA
described in Scarpati et al. Fig. 2 depicts the total sequence of the clone 2b-AprS with the thromboplastin amino-acid sequence deduced therefrom.
Construction of a hybrid plasm.id pTF1Fc coding for thromboplastin fusion protein.
The plasmid pCD4E gamma 1(EP 0 325 262 A2; deposited at the ATCC under the number No. 67610) is used for expression of a fusion protein composed of human CD4 receptor and human IgGl. The DNA sequence coding for the extracellular domain of CD4 is deleted from this plasmid using the restriction enzymes HindIiI and BamHI. Only partial cleavage must be carried out with the enzyme HindIII in this case, in order to cut at only one of the two HindIII sites contained in pCD4E gamma 1 (position 2198). The result is an opened vector in which a eukary-otic transcription regulation sequence (promoter) is followed by the open HindIII site. The open BamHI site is located at the start of the coding regions for a penta-peptide linker, followed by the hinge and the CH2 and CH3 domains of human IgGl. The reading frame in the BamHI
recognition sequence GGATCC is such that GAT is trans-lated as aspartic acid. DNA amplification with thermostable DNA polymerase makes it possible to modify a given sequence in such a way that any desired sequences are attached at one or both ends. Two oligonucleotides able to hybridize with sequences in the 5'-untranslated region (A; 5' GATCGATTAAGCTTCGGAACCCGCTCGATCTCGCCGCC 3') or coding region (B: 5' GCATATCTGGATCCCCGTAGAATATTTCTCTGAATTCCCC 3') of thromboplastin cDNA were synthesized. Of these, oligo-nucleotide A is partially homologous with the sequence of the coding strand, and oligonucleotide B is partially homologous with the non-coding strand; cf. Fig. 3.
Thus, amplification results in a DNA fragment (827 bp) which contains (based on the coding strand) at the 5' end before the start of the coding sequence a HindiIl site, and at the 3' end after the codon for the first three amino-acid residues of the transmembrane region a BamHI
site. The reading frame in the BamHI cleavage site is such that ligation with the BamHI site in pCD4E gamma 1 results in a gene fusion with a reading frame continuous from the initiation codon of the thromboplastin cDNA to the stop codon of the heavy chain of IgGl. The desired fragment was obtained and, after treatment with HindilI
and BamHi, ligated into the vector pCD4E gamma 1, as described above, which had been cut with HindIiI
(partially) and BamHI. The resulting plasmid was called pTFlFc (Fig. 4).
Transfection of pTF1Fc into manamalian cells The fusion protein encoded by the plasmid pTFlFc is called pTF1Fc hereinafter. pTF1Fc was transiently expressed in COS cells. For this purpose, COS cells were transfected with pTF1Fc with the aid of DEAE-dextran (EP A 0 325 262). Indirect immunofluorescence investiga-tions revealed that the proportion of transfected cells was about 25 %. 24 h after transfection, the cells were transferred into serum-free medium. This cell supernatant was harvested after a further three days.
Purification of pTF1Fc fusion protein from cell culture supernatants 170 ml of supernatant from transiently transfected COS
cells were collected overnight in a batch process in a column containing 0.8 ml of protein A-Sepharose at 4 C, washed with 10 volumes of washing buffer (50 mM tris buffer pH 8.6, 150 mM NaCl) and eluted in 0.5 ml frac-tions with eluting buffer (93:7 100 mM citric acid:
100 mM sodium citrate). The first 9 fractions were immediately neutralized with 0.1 ml of 2M tris buffer pH 8.6 in each case and then combined, and the resulting protein was transferred by three concentration/dilution cycles in an Amicon microconcentrator (Centricon 30) into TNE buffer (50 mM tris buffer pH 7.4, 50 mM NaCl, 1 mM
EDTA). The pTF1Fc obtained in this way is pure by SDS-PAGE electrophoresis (U.K. L'ammli, Nature 227 (1970) 680-685). In the absence of reducing agents it behaves in the SDS-PAGE like a dimer (about 165 KDa).
Biological activity of purified TF1Fc in the prothrombin clotting time determination TF1Fc fusion protein is active in low concentrations (> 50 ng/ml) in the one-stage prothrombin clotting time determination (Vinazzer, H. Gerinnungsphysiologie und Methoden im Blutgerinnungslabor (1979), Fisher Verlag Stuttgart). The clotting times achieved are comparable with the clotting times obtained with thromboplastin isolated from human placenta.
Example 2: Interleukin-4 receptor fusion proteins Interleukin-4 (IL-4) is synthesized by T cells and was originally called B-cell growth factor because it is able to stimulate B-cell proliferation. It exerts a large number of effects on these cells. One in particular is the stimulation of synthesis of molecules of immuno-globulin subclasses IgGl and IgE in activated B cells (Coffmann et al., Immunol. Rev., vol. 102 (1988) 5). In addition, IL-4 also regulates the proliferation and differentiation of T cells and other hemopoietic cells.
It thus contributes to the regulation of allergic and other immunological reactions. IL-4 binds with high affinity to a specific receptor. The cDNA which codes for the human IL-4 receptor has been isolated (Idzerda et al., J. Exp. Med., vol. 171 (1990) 861-873). It is evident from analysis of the amino-acid sequence deduced from the cDNA sequence that the IL-4 receptor is composed of a total of 825 amino acids, with the 25 N-terminal amino acids acting as signal peptide. Mature human IL-4 receptor is composed of 800 amino acids and, like thromboplastin, has a three-domain structure: i) amino-terminal extracellular domain (207 amino acids);
ii) transmembrane region (24 amino acids) and iii) cytoplasmic domain (569 amino acids). In the extra-cellular domain there are six potential sites for N-glycosylation (Asn-X-Thr/Ser). IL-4 receptor has homologies with human IL-6 receptor, with the p-subunit of human IL-2 receptor, with mouse erythropoietin receptor and with rat prolactin receptor (Idzerda et al., loc. cit.). Thus, like thromboplastin, it is not a member of the immunoglobulin family but is assigned together with the homologous proteins mentioned to the new family of hematopoietin receptors. Members of this family have four cysteine residues and a conserved sequence (Trp-Ser-X-Trp-Ser) in the extracellular domain located near the transmembrane region in common.
On the basis of the described function of the IL-4/IL-4 - 10 - 2`0045869 receptor system, there is a possible therapeutic use of a recombinant form of the IL-4 receptor for suppressing IL-4-mediated immune reactions (for example transplant rejection reaction, autoimmune diseases, allergic reac-tions).
The amount of substance required for therapy makes it necessary to prepare such molecules by genetic engineering. Because of the straightforward purification by affinity chromatography and improved pharmacokinetic properties, according to the invention the synthesis of soluble forms of the IL-4 receptor as immunoglobulin fusion protein is particularly advantageous.
The IL-4 receptor fusion proteins are secreted by mammal-ian cells (for example CHO, BHK, COS cells) into the culture medium, purified by affinity chromatography on protein A-Sepharose and have, surprisingly, identical functional properties to the extracellular domain of the intact membrane-bound IL-4 receptor molecule.
Construction of a hybrid plasmid pIL-4RFc coding for IL-4 receptor fusion protein.
Cutting of the plasmid pCD4E gammal with XhoI and BamHI
results in an opened vector in which the open XhoI site is located downstream from the promoter sequence. The open BamHI site is located at the start of the coding regions for a pentapeptide linker, followed by the hinge and the CH2 and CH3 domains of human IgGl. The reading frame in the BamHI recognition sequence GGATCC is such that GAT is translated as aspartic acid. DNA amplifica-tion with thermostable DNA polymerase makes it possible to modify a given sequence in such a way that any desired sequences can be attached at one or both ends. Two oligonucleotides able to hybridize with sequences in the 5'-untranslated region (A: 5' GATCCAGTACTCGAGAGAGAAGCCGGGCGTGGTGGCTCATGC 3') or coding region (B: 51 CTATGACATGGATCCTGCTCGAAGGGCTCCCTGTAGGAGTTGTG 3') of the IL-4 receptor cDNA which is cloned in the vector pDC302/T22-8 (Idzerda et al., loc. cit.) were synthesized. Of these, oligonucleotide A is partially homologous with the sequence of the coding strand, and oligonucleotide B is partially homologous with the non-coding strand; cf. Fig. 5. Amplification using thermo-stable DNA polymerase results in a DNA fragment (836 bp) which, based on the coding strand, contains at the 5' end before the start of the coding sequence an XhoI site, and at the 3' end before the last codon of the extracellular domain a BamHI site. The reading frame in the BamHI
cleavage site is such that ligation with the BamHI site in pCD4E gamma 1 results in a gene fusion with a reading frame continuous from the initiation codon of the IL-4 receptor cDNA to the stop codon of the heavy chain of IgGl. The desired fragment was obtained and, after treatment with XhoI and BamHI, ligated into the vector pCD4E gamma 1, described above, which had been cut with XhoI/Ba.mIiI. The resulting plasmid was called pIL4RFc (Fig. 6).
Transfection of pIL4RFc into mammalian cells The fusion protein encoded by the plasmid pIL4RFc is called pIL4RFc hereinafter. pIL4RFc was transiently expressed in COS cells. For this purpose, COS cells were transfected with pIL4RFc with the aid of DEAE-dextran (EP A 0 325 262). Indirect immunofluorescence investiga-tions revealed that the proportion of transfected cells was about 25 %. 24 h after transfection, the cells were transferred into serum-free medium. This cell supernatant was harvested after a further three days.
Purification of IL4RFc fusion protein from cell culture supernatants 500 ml of supernatant from transiently transfected COS
cells were collected overnight in a batch process in a column containing 1.6 ml of protein A-Sepharose at 4 C, washed with 10 volumes of washing buffer (50 mM tris buffer pH 8.6, 150 mM NaCl) and eluted in 0.5 ml frac-tions with eluting buffer (93:7 100 mM citric acid:
100 mM sodium citrate). The first 9 fractions were immediately neutralized with 0.1 ml of 2M tris buffer pH 8.6 in each case and then combined, and the resulting protein was transferred by three concentration/dilution cycles in an Amicon microconcentrator (Centricon 30) into TNE buffer (50 mM tris buffer pH 7.4, 50 mM NaCl, 1 mM
EDTA). The IL4RFc obtained in this way is pure by SDS-PAGE electrophoresis (U.K. Lammli, Nature 227 (1970) 680-685). In the absence of reducing agents it behaves in the SDS-PAGE like a dimer (about 150 KDa).
Biological activity of purified IL4RFc IL4RFc proteins binds 125I-radiolabeled IL-4 with the same affinity (Kp=0.5 nM) as membrane-bound intact IL-4 recep-tor. It inhibits the proliferation of IL-4-dependent cell line CTLLHuIL-4RI clone D (Idzerda et al., loc. cit.) in concentrations of 10-1000 ng/ml. In addition, it is outstandingly suitable for developing IL-4 binding assays because it can be bound via its Fc part to microtiter plates previously coated with, for example, rabbit anti-human IgG, and in this form likewise binds its ligands with high affinity.
Example 3: Erythropoieti.ra fusion proteins Mature erythropoietin (EPO) is a glycoprotein which is composed of 166 amino acids and is essential for the development of erythrocytes. It stimulates the maturation and the terminal differentiation of erythroid precursor cells. The cDNA for human EPO has been cloned (EP-A-0 267 678) and codes for the 166 amino acids of mature EPO and a signal peptide of 22 amino acids which is essential for secretion. The cDNA can be used to prepare recombinant functional EPO in genetically manipulated mammalian cells and the EPO can be employed clinically for the therapy of anemic manifestations of various etiologies (for example associated with acute renal failure).
Because of the straightforward purification and the improved pharmacokinetic properties, according to the invention synthesis of EPO as immunoglobulin fusion protein is particularly advantageous.
Construction of a hybrid plasmid pEPOFc coding for erythropoietin fusion protein.
This construction was carried out in analogy to that described in Example 2 (section: "Construction of a hybrid plasmid pIL-4RFc coding for IL-4 receptor fusion protein"). Two oligonucleotides able to hybridize with sequences in the vicinity of the initiation codon (A: 5'GATCGATCTCGAGATGGGGGTGCACGAATGTCCTGCCTGGCTGTGG 3') and of the stop codon (B: 5' CTGGAATCGGATCCCCTGTCCTGCAGGCCTCCCCTGTGTACAGC 3') of the EPO cDNA cloned in the vector pCES (EP-A 0 267 678) were synthesized. Of these, oligonucleotide A is partially homologous with the sequence of the coding strand, and oligonucleotide B is partially homologous with the non-coding strand; cf. Fig. 7. Amplification with thermostable DNA polymerase results in a DNA frag-ment (598 bp) which, based on the coding strand, contains at the 5' end in front of the initiation codon an XhoI
site and in which at the 3' end the codon for the penultimate C-terminal amino acid residue of the EPO
(Asp) is present in a BamHI recognition sequence. The reading frame in the BamHI cleavage site is such that ligation with the BamHI site in pCD4E gamma 1 results in a gene fusion with a reading frame continuous from the initiation codon of EPO cDNA to the stop codon of the heavy chain of IgGl. The desired fragment was obtained and, after treatment with XhoI and BamHI, ligated into ' 14 - 2045869 the vector pCD4E gamrna 1, described above, which had been cut with XhoI/BamHI. The resulting plasmid was called pEPOFc (Fig. 8).
The General Hospital Corporation 20458649 Description Fusion proteins with immnunoglobulin portions, the preparation and use thereof The invention relates to genetically engineered soluble fusion proteins composed of human proteins not belonging to the immunoglobulin family, or of parts thereof, and of various portions of the constant region of immunoglobulin molecules. The functional properties of the two fusion partners are, surprisingly, retained in the fusion protein.
EP-A 0 325 262 and EP-A 0 314 317 disclose corresponding fusion proteins composed of various domains of the CD4 membrane protein of human T cells and of human IgGl portions. Some of these fusion proteins bind with the same affinity to the glycoprotein gp120 of human iaununo-deficiency virus as the cell-bound CD4 molecule. The CD4 molecule belongs to the immunoglobulin family and, consequently, has a very similar tertiary structure to that of immunoglobulin molecules. This also applies to the a chain of the T-cell antigen receptor, for which such fusions have also been described (Gascoigne et al., Proc. Natl. Acad. Sci. USA, vol. 84 (1987), 2937-2940).
Hence, on the basis of the very similar domain structure, in this case retention of the biological activity of the two fusion partners in the fusion protein was to be expected.
The human proteins which are, according to the invention, preferably coupled to the amino terminus of the constant region of immunoglobulin do not belong to the immuno-globulin family and are to be assigned to the following classes: (i) membrane-bound proteins whose extracellular domain is wholly or partly incorporated in the fusion.
These are, in particular, thromboplastin and cytokine _ 2 - 2045869 receptors and growth factor receptors, such as the cellular receptors for interleukin-4, interleukin-7, tumor necrosis factor, GM-CSF, G-CSF, erythropoietin;
(ii) non-membrane-bound soluble proteins which are wholly or partly incorporated in the fusion. These are, in particularly, proteins of therapeutic interest such as, for example, erythropoietin and other cytokines and growth factors.
The fusion proteins can be prepared in known pro- and eukaryotic expression systems, but preferably in mammal-ian cells (for example CHO, COS and BHK cells).
The fusion proteins according to the invention are, by reason of their immunoglobulin portion, easy to purify by affinity chromatography and have improved pharmacokinetic properties in vivo.
In many cases, the Fc part in fusion protein is thoroughly advantageous for use in therapy and diagnosis and thus results, for example, in improved pharma-cokinetic properties (EP-A 0232 262). On the other hand, for some uses it would be desirable to be able to delete the Fc part after the fusion protein has been expressed, detected and purified in the advantageous manner described. This is the case when the Fc portion proves to be a hindrance to use in therapy and diagnosis, for example when the fusion protein is to be used as antigen for immunizations.
There are in existence various proteases whose use for this purpose appears conceivable. Papain and pepsin are employed, for example, to generate F(ab) fragments from immunoglobulins (Immunology, ed. Roitt, I. et al., Gower Medical Publishing, London (1989)), but they do not cleave in a particularly specific manner. Blood coagula-tion factor Xa by contrast recognises in a protein the relatively rare tetrapeptide sequence Ile-Glu-Gly-Arg and performs a hydrolytic cleavage of the protein after the arginine residue . Sequences which contain the described tetrapeptide were introduced first by Nagai and Thogersen in a hybrid protein by genetic engineering means (Nagai, R. and Thogersen, H.C., Nature, vol. 309 (1984), 810-812). These authors were able to show that the proteins expressed in E. coli actually are specifi-cally cleaved by factor Xa. However, there is as yet no published example of the possibility of such proteins also being expressed in eukaryotic and, especially, in animal cells and, after their purification, being cleaved by factor Xa. However, expression of the proteins according to the invention in animal cells is preferable because only in a cell system of this type is there expected to be secretion of, for example, normally membrane-bound receptors as fusion partners with retention of their natural structure and thus of their biological activity. Secretion into the cell culture supernatant facilitates the subsequent straightforward purification of the fusion protein.
The invention thus relates to genetically engineered soluble fusion proteins composed of human proteins not belonging to the immunoglobulin family, or of parts thereof, and of various portions of the constant regions of heavy or light chains of immunoglobulins'of various subclasses (IgG, IgM, IgA, IgE). Preferred as immuno-globulin is the constant part of the heavy chain of human IgG, particularly preferably of human IgGl, where fusion takes place at the hinge region. In a particular embodi-ment, the Fc part can be removed in a simple way by a cleavage sequence which is also incorporated and can be cleaved with factor Xa.
Furthermore, the invention relates to processes for the preparation of these fusion proteins by genetic engineer-ing, and to the use thereof for diagnosis and therapy.
The invention will now be described in relation to the drawings, in which:
Figure 1 shows two oligonucleotide probe molecules used in cloning of thromboplastin cDNA;
Figure 2 shows the nucleotide sequence of clone 2b-Apr5 with the thromboplastin amino acid sequence deduced therefrom;
Figure 3 shows two oligonucleotide sequences which are partially homologous with the sequence of the coding strand (A), and with the non-coding strand (B) of thromboplastin cDNA;
Figure 4 shows the restriction map of plasmid pTF1Fc;
Figure 5 shows two oligonucleotide sequences which are partially homologous with the sequence of the coding strand (A), and with the non-coding strand (B) of the IL-4 receptor cDNA cloned in the vector pDC302/T22-8;
Figure 6 shows the restriction map of plasmid pIL4RFc;
Figure 7 shows two oligonucleotide sequences A and B which are partially homologous with the sequence of the coding strand (A), and with the non-coding strand (B) of the EPO cDNA cloned in the vector pCES; and Figure 8 shows the restriction map of plasmid pEPOFc.
Finally, the invention is explained in further examples.
Example 1: Thromboplastin fusion proteins Blood coagulation is a process of central importance in the human body. There is appropriately delicate regula-tion of the coagulation cascade, in which a large number of cellular factors and plasma proteins cooperate. These proteins (and their cofactors) in their entirety are called coagulation factors. The final products of the coagulation cascade are thrombin, which induces the aggregation of blood platelets, and fibrin which stabil-izes the platelet thrombus. Thrombin catalyzes the formation of fibrin from fibrinogen and itself is formed by limited proteolysis of prothrombin. Activated factor X (factor Xa) is responsible for this step and, in the presence of factor Va and calcium ions, binds to platelet membranes and cleaves prothrombin.
Two ways exist for factor X to be activated, the extrin-sic and the intrinsic pathway. In the intrinsic pathway a series of factors is activated by proteolysis in order for each of them to form active proteases. In the extrin-sic pathway, there is increased synthesis of thrombo-plastin (tissue factor) by damaged cells, and it acti-vates factor X, together with factor VIIa and calcium ions. It was formerly assumed that the activity of thromboplastin is confined to this reaction. However, the thromboplastin/VIIa complex also intervenes to activate the intrinsic pathway at the level of factor IX. Thus, a thromboplastin/VIIa complex is one of the most important physiological activators of blood coagulation.
It is therefore conceivable that thromboplastin, apart from its use as diagnostic aid (see below), can also be employed as constituent of therapeutic agents for treat-ing inborn or acquired blood coagulation deficiencies.
Examples of this are chronic hemophilias caused by a deficiency of factors VIII, IX or XI or else acute disturbances of blood coagulation as a consequence of, for example, liver or kidney disease. Use of such a therapeutic agent after surgicial intervention would also be conceivable.
Thromboplastin is an integral membrane protein which does not belong to the immunoglobulin family. Thromboplastin cDNA sequences have been published by a total of four groups (Fisher et al., Thromb. Res., vol. 48 (1987), 89-99; Morrisey et al., Cell, vol. 50 (1987), 129-135;
Scarpati et al., Biochemistry, vol. 26 (1987), 5234-5238;
Spicer et al., Proc. Natl. Acad. Sci. USA, vol. 84 (1987), 5148-5152). Thromboplastin cDNA contains an open reading frame which codes for a polypeptide of 295 amino-acid residues, of which the 32 N-terminal amino acids act as signal peptide. Mature thromboplastin comprises 263 amino-acid residues and has a three-domain structure:
i) amino-terminal extracellular domain (219 amino-acid residues); ii) transmembrane region (23 amino-acid residues); iii) cytoplasmic domain (carboxyl terminus;
21 amino-acid residues). In the extracellular domain there are three potential sites for N-glycosylation (Asn-X-Thr). Thromboplastin is normally glycosylated but glycosylation does not appear essential for the activity of the protein (Paborsky et al., Biochemistry, vol. 29 (1989), 8072-8077).
Thromboplastin is required as additive to plasma samples in diagnostic tests of coagulation. The coagulation status of the tested person can be found by the one-stage prothrombin clotting time determination (for example Quick's test). The thromboplastin required for diagnostic tests is currently obtained from human tissue, and the preparation process is difficult to standardize, the yield is low and considerable amounts of human starting material (placentae) must be supplied. On the other hand, it is to be expected that preparation of native, membrane-bound thromboplastin by genetic engineering will also be difficult owing to complex purification proces-ses. These difficulties can be avoided by the fusion according to the invention to immunoglobulin portions.
The thromboplastin fusion proteins according to the invention are secreted by mammalian cells (for example CHO, BHR, COS cells) into the culture medium, purified by TM
affinity chromatography on protein A-Sepharose and have surprisingly high activity in the one-stage prothrombin clotting time determination.
Cloning of thromboplastin cDNA
The sequence published by Scarpati et al., Biochemistry, vol. 26 (1987), 5234-5238, was used for cloning the thromboplastin cDNA. Two oligonucleotide probe molecules (see Fig. 1) were derived from this. These two probe molecules were used to screen a cDNA bank from human placenta (Grundmann et al., Proc. Natl. Acad. Sci. USA, vol. 83 (1986), 8024-8028).
cDNA clones of various lengths were obtained. One clone, 2b-Apr5, which is used for the subsequent procedure, codes for the same amino-acid sequence as the cDNA
described in Scarpati et al. Fig. 2 depicts the total sequence of the clone 2b-AprS with the thromboplastin amino-acid sequence deduced therefrom.
Construction of a hybrid plasm.id pTF1Fc coding for thromboplastin fusion protein.
The plasmid pCD4E gamma 1(EP 0 325 262 A2; deposited at the ATCC under the number No. 67610) is used for expression of a fusion protein composed of human CD4 receptor and human IgGl. The DNA sequence coding for the extracellular domain of CD4 is deleted from this plasmid using the restriction enzymes HindIiI and BamHI. Only partial cleavage must be carried out with the enzyme HindIII in this case, in order to cut at only one of the two HindIII sites contained in pCD4E gamma 1 (position 2198). The result is an opened vector in which a eukary-otic transcription regulation sequence (promoter) is followed by the open HindIII site. The open BamHI site is located at the start of the coding regions for a penta-peptide linker, followed by the hinge and the CH2 and CH3 domains of human IgGl. The reading frame in the BamHI
recognition sequence GGATCC is such that GAT is trans-lated as aspartic acid. DNA amplification with thermostable DNA polymerase makes it possible to modify a given sequence in such a way that any desired sequences are attached at one or both ends. Two oligonucleotides able to hybridize with sequences in the 5'-untranslated region (A; 5' GATCGATTAAGCTTCGGAACCCGCTCGATCTCGCCGCC 3') or coding region (B: 5' GCATATCTGGATCCCCGTAGAATATTTCTCTGAATTCCCC 3') of thromboplastin cDNA were synthesized. Of these, oligo-nucleotide A is partially homologous with the sequence of the coding strand, and oligonucleotide B is partially homologous with the non-coding strand; cf. Fig. 3.
Thus, amplification results in a DNA fragment (827 bp) which contains (based on the coding strand) at the 5' end before the start of the coding sequence a HindiIl site, and at the 3' end after the codon for the first three amino-acid residues of the transmembrane region a BamHI
site. The reading frame in the BamHI cleavage site is such that ligation with the BamHI site in pCD4E gamma 1 results in a gene fusion with a reading frame continuous from the initiation codon of the thromboplastin cDNA to the stop codon of the heavy chain of IgGl. The desired fragment was obtained and, after treatment with HindilI
and BamHi, ligated into the vector pCD4E gamma 1, as described above, which had been cut with HindIiI
(partially) and BamHI. The resulting plasmid was called pTFlFc (Fig. 4).
Transfection of pTF1Fc into manamalian cells The fusion protein encoded by the plasmid pTFlFc is called pTF1Fc hereinafter. pTF1Fc was transiently expressed in COS cells. For this purpose, COS cells were transfected with pTF1Fc with the aid of DEAE-dextran (EP A 0 325 262). Indirect immunofluorescence investiga-tions revealed that the proportion of transfected cells was about 25 %. 24 h after transfection, the cells were transferred into serum-free medium. This cell supernatant was harvested after a further three days.
Purification of pTF1Fc fusion protein from cell culture supernatants 170 ml of supernatant from transiently transfected COS
cells were collected overnight in a batch process in a column containing 0.8 ml of protein A-Sepharose at 4 C, washed with 10 volumes of washing buffer (50 mM tris buffer pH 8.6, 150 mM NaCl) and eluted in 0.5 ml frac-tions with eluting buffer (93:7 100 mM citric acid:
100 mM sodium citrate). The first 9 fractions were immediately neutralized with 0.1 ml of 2M tris buffer pH 8.6 in each case and then combined, and the resulting protein was transferred by three concentration/dilution cycles in an Amicon microconcentrator (Centricon 30) into TNE buffer (50 mM tris buffer pH 7.4, 50 mM NaCl, 1 mM
EDTA). The pTF1Fc obtained in this way is pure by SDS-PAGE electrophoresis (U.K. L'ammli, Nature 227 (1970) 680-685). In the absence of reducing agents it behaves in the SDS-PAGE like a dimer (about 165 KDa).
Biological activity of purified TF1Fc in the prothrombin clotting time determination TF1Fc fusion protein is active in low concentrations (> 50 ng/ml) in the one-stage prothrombin clotting time determination (Vinazzer, H. Gerinnungsphysiologie und Methoden im Blutgerinnungslabor (1979), Fisher Verlag Stuttgart). The clotting times achieved are comparable with the clotting times obtained with thromboplastin isolated from human placenta.
Example 2: Interleukin-4 receptor fusion proteins Interleukin-4 (IL-4) is synthesized by T cells and was originally called B-cell growth factor because it is able to stimulate B-cell proliferation. It exerts a large number of effects on these cells. One in particular is the stimulation of synthesis of molecules of immuno-globulin subclasses IgGl and IgE in activated B cells (Coffmann et al., Immunol. Rev., vol. 102 (1988) 5). In addition, IL-4 also regulates the proliferation and differentiation of T cells and other hemopoietic cells.
It thus contributes to the regulation of allergic and other immunological reactions. IL-4 binds with high affinity to a specific receptor. The cDNA which codes for the human IL-4 receptor has been isolated (Idzerda et al., J. Exp. Med., vol. 171 (1990) 861-873). It is evident from analysis of the amino-acid sequence deduced from the cDNA sequence that the IL-4 receptor is composed of a total of 825 amino acids, with the 25 N-terminal amino acids acting as signal peptide. Mature human IL-4 receptor is composed of 800 amino acids and, like thromboplastin, has a three-domain structure: i) amino-terminal extracellular domain (207 amino acids);
ii) transmembrane region (24 amino acids) and iii) cytoplasmic domain (569 amino acids). In the extra-cellular domain there are six potential sites for N-glycosylation (Asn-X-Thr/Ser). IL-4 receptor has homologies with human IL-6 receptor, with the p-subunit of human IL-2 receptor, with mouse erythropoietin receptor and with rat prolactin receptor (Idzerda et al., loc. cit.). Thus, like thromboplastin, it is not a member of the immunoglobulin family but is assigned together with the homologous proteins mentioned to the new family of hematopoietin receptors. Members of this family have four cysteine residues and a conserved sequence (Trp-Ser-X-Trp-Ser) in the extracellular domain located near the transmembrane region in common.
On the basis of the described function of the IL-4/IL-4 - 10 - 2`0045869 receptor system, there is a possible therapeutic use of a recombinant form of the IL-4 receptor for suppressing IL-4-mediated immune reactions (for example transplant rejection reaction, autoimmune diseases, allergic reac-tions).
The amount of substance required for therapy makes it necessary to prepare such molecules by genetic engineering. Because of the straightforward purification by affinity chromatography and improved pharmacokinetic properties, according to the invention the synthesis of soluble forms of the IL-4 receptor as immunoglobulin fusion protein is particularly advantageous.
The IL-4 receptor fusion proteins are secreted by mammal-ian cells (for example CHO, BHK, COS cells) into the culture medium, purified by affinity chromatography on protein A-Sepharose and have, surprisingly, identical functional properties to the extracellular domain of the intact membrane-bound IL-4 receptor molecule.
Construction of a hybrid plasmid pIL-4RFc coding for IL-4 receptor fusion protein.
Cutting of the plasmid pCD4E gammal with XhoI and BamHI
results in an opened vector in which the open XhoI site is located downstream from the promoter sequence. The open BamHI site is located at the start of the coding regions for a pentapeptide linker, followed by the hinge and the CH2 and CH3 domains of human IgGl. The reading frame in the BamHI recognition sequence GGATCC is such that GAT is translated as aspartic acid. DNA amplifica-tion with thermostable DNA polymerase makes it possible to modify a given sequence in such a way that any desired sequences can be attached at one or both ends. Two oligonucleotides able to hybridize with sequences in the 5'-untranslated region (A: 5' GATCCAGTACTCGAGAGAGAAGCCGGGCGTGGTGGCTCATGC 3') or coding region (B: 51 CTATGACATGGATCCTGCTCGAAGGGCTCCCTGTAGGAGTTGTG 3') of the IL-4 receptor cDNA which is cloned in the vector pDC302/T22-8 (Idzerda et al., loc. cit.) were synthesized. Of these, oligonucleotide A is partially homologous with the sequence of the coding strand, and oligonucleotide B is partially homologous with the non-coding strand; cf. Fig. 5. Amplification using thermo-stable DNA polymerase results in a DNA fragment (836 bp) which, based on the coding strand, contains at the 5' end before the start of the coding sequence an XhoI site, and at the 3' end before the last codon of the extracellular domain a BamHI site. The reading frame in the BamHI
cleavage site is such that ligation with the BamHI site in pCD4E gamma 1 results in a gene fusion with a reading frame continuous from the initiation codon of the IL-4 receptor cDNA to the stop codon of the heavy chain of IgGl. The desired fragment was obtained and, after treatment with XhoI and BamHI, ligated into the vector pCD4E gamma 1, described above, which had been cut with XhoI/Ba.mIiI. The resulting plasmid was called pIL4RFc (Fig. 6).
Transfection of pIL4RFc into mammalian cells The fusion protein encoded by the plasmid pIL4RFc is called pIL4RFc hereinafter. pIL4RFc was transiently expressed in COS cells. For this purpose, COS cells were transfected with pIL4RFc with the aid of DEAE-dextran (EP A 0 325 262). Indirect immunofluorescence investiga-tions revealed that the proportion of transfected cells was about 25 %. 24 h after transfection, the cells were transferred into serum-free medium. This cell supernatant was harvested after a further three days.
Purification of IL4RFc fusion protein from cell culture supernatants 500 ml of supernatant from transiently transfected COS
cells were collected overnight in a batch process in a column containing 1.6 ml of protein A-Sepharose at 4 C, washed with 10 volumes of washing buffer (50 mM tris buffer pH 8.6, 150 mM NaCl) and eluted in 0.5 ml frac-tions with eluting buffer (93:7 100 mM citric acid:
100 mM sodium citrate). The first 9 fractions were immediately neutralized with 0.1 ml of 2M tris buffer pH 8.6 in each case and then combined, and the resulting protein was transferred by three concentration/dilution cycles in an Amicon microconcentrator (Centricon 30) into TNE buffer (50 mM tris buffer pH 7.4, 50 mM NaCl, 1 mM
EDTA). The IL4RFc obtained in this way is pure by SDS-PAGE electrophoresis (U.K. Lammli, Nature 227 (1970) 680-685). In the absence of reducing agents it behaves in the SDS-PAGE like a dimer (about 150 KDa).
Biological activity of purified IL4RFc IL4RFc proteins binds 125I-radiolabeled IL-4 with the same affinity (Kp=0.5 nM) as membrane-bound intact IL-4 recep-tor. It inhibits the proliferation of IL-4-dependent cell line CTLLHuIL-4RI clone D (Idzerda et al., loc. cit.) in concentrations of 10-1000 ng/ml. In addition, it is outstandingly suitable for developing IL-4 binding assays because it can be bound via its Fc part to microtiter plates previously coated with, for example, rabbit anti-human IgG, and in this form likewise binds its ligands with high affinity.
Example 3: Erythropoieti.ra fusion proteins Mature erythropoietin (EPO) is a glycoprotein which is composed of 166 amino acids and is essential for the development of erythrocytes. It stimulates the maturation and the terminal differentiation of erythroid precursor cells. The cDNA for human EPO has been cloned (EP-A-0 267 678) and codes for the 166 amino acids of mature EPO and a signal peptide of 22 amino acids which is essential for secretion. The cDNA can be used to prepare recombinant functional EPO in genetically manipulated mammalian cells and the EPO can be employed clinically for the therapy of anemic manifestations of various etiologies (for example associated with acute renal failure).
Because of the straightforward purification and the improved pharmacokinetic properties, according to the invention synthesis of EPO as immunoglobulin fusion protein is particularly advantageous.
Construction of a hybrid plasmid pEPOFc coding for erythropoietin fusion protein.
This construction was carried out in analogy to that described in Example 2 (section: "Construction of a hybrid plasmid pIL-4RFc coding for IL-4 receptor fusion protein"). Two oligonucleotides able to hybridize with sequences in the vicinity of the initiation codon (A: 5'GATCGATCTCGAGATGGGGGTGCACGAATGTCCTGCCTGGCTGTGG 3') and of the stop codon (B: 5' CTGGAATCGGATCCCCTGTCCTGCAGGCCTCCCCTGTGTACAGC 3') of the EPO cDNA cloned in the vector pCES (EP-A 0 267 678) were synthesized. Of these, oligonucleotide A is partially homologous with the sequence of the coding strand, and oligonucleotide B is partially homologous with the non-coding strand; cf. Fig. 7. Amplification with thermostable DNA polymerase results in a DNA frag-ment (598 bp) which, based on the coding strand, contains at the 5' end in front of the initiation codon an XhoI
site and in which at the 3' end the codon for the penultimate C-terminal amino acid residue of the EPO
(Asp) is present in a BamHI recognition sequence. The reading frame in the BamHI cleavage site is such that ligation with the BamHI site in pCD4E gamma 1 results in a gene fusion with a reading frame continuous from the initiation codon of EPO cDNA to the stop codon of the heavy chain of IgGl. The desired fragment was obtained and, after treatment with XhoI and BamHI, ligated into ' 14 - 2045869 the vector pCD4E gamrna 1, described above, which had been cut with XhoI/BamHI. The resulting plasmid was called pEPOFc (Fig. 8).
Claims (13)
1. A recombinant protein encoded by a polynucleotide, which comprises two DNA subsequences, wherein the first subsequence encodes the extracellular domain of a membrane-bound, human tumor necrosis factor (TNF) receptor protein and the second subsequence encodes all of the domains of the constant region of a human immunoglobulin heavy chain other than the first domain of said constant region, wherein the carboxy terminus of the extracellular domain of the membrane-bound, TNF receptor protein is coupled to the amino terminus of the constant region of the human immunoglobulin heavy chain.
2. A recombinant protein of claim 1, wherein said human immunoglobulin heavy chain is selected from the group consisting of IgG, IgM, IgA, and IgE.
3. A recombinant protein of 2, wherein said human immunoglobulin heavy chain is IgG.
4. A recombinant protein of claim 3, wherein IgG is IgG1.
5. A soluble, recombinant fusion protein consisting of a first and a second fusion partner, wherein the first fusion partner is the extracellular domain of a membrane-bound receptor of human tumor necrosis factor and said second fusion partner is the hinge, C H2, and C H3 domains of human IgG1, wherein the carboxy terminus of the extracellular domain of the membrane-bound receptor of human tumor necrosis factor is coupled to the amino terminus of the hinge of the human IgG1.
6. A DNA molecule encoding a recombinant protein as claimed in any one of the claims 1-4.
7. A DNA molecule encoding a soluble fusion protein as claimed in claim 5.
8. A process for preparing a recombinant protein as claimed in any one of claims 1-4, which comprises introducing the DNA
coding for said recombinant protein into a mammalian cell expression system, expressing said protein, and, after expression, purifying the produced protein.
coding for said recombinant protein into a mammalian cell expression system, expressing said protein, and, after expression, purifying the produced protein.
9. The process for preparing a recombinant protein as claimed in claim 8, wherein said produced protein is purified by affinity chromatography via the immunoglobulin portion.
10. A process for preparing a soluble fusion protein as claimed in claim 5, which comprises introducing the DNA coding for said fusion protein into a mammal an cell expression system, expressing said protein, and, after expression, purifying the produced protein.
11. The process for preparing a soluble fusion protein as claimed in claim 10, wherein said produced protein is purified by affinity chromatography via the immunoglobulin portion.
12. A recombinant protein, which is a dimer of the recombinant protein of any one of claims 1-5.
13. A recombinant protein as claimed in claim 12, wherein said dimer is produced in CHO cells.
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| DEP4020607.6 | 1990-06-28 | ||
| DE4020607 | 1990-06-28 |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CA2045869A1 CA2045869A1 (en) | 1991-12-29 |
| CA2045869C true CA2045869C (en) | 2009-01-27 |
Family
ID=6409260
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CA002045869A Expired - Lifetime CA2045869C (en) | 1990-06-28 | 1991-06-27 | Fusion proteins with immunoglobulin portions, the preparation and use thereof |
Country Status (16)
| Country | Link |
|---|---|
| EP (3) | EP1586635A1 (en) |
| JP (2) | JPH05247094A (en) |
| KR (3) | KR100249572B1 (en) |
| AT (2) | ATE309376T1 (en) |
| AU (1) | AU655421B2 (en) |
| CA (1) | CA2045869C (en) |
| CY (2) | CY2151B1 (en) |
| DE (3) | DE59109269D1 (en) |
| DK (2) | DK0835939T3 (en) |
| ES (2) | ES2251009T3 (en) |
| GR (1) | GR3027567T3 (en) |
| IE (1) | IE912256A1 (en) |
| LU (1) | LU90592I2 (en) |
| NL (1) | NL300009I2 (en) |
| PT (1) | PT98113B (en) |
| UY (1) | UY25897A1 (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US8937169B2 (en) | 1996-01-11 | 2015-01-20 | Human Genome Sciences, Inc. | Human G-protein chemokine receptor HSATU68 |
Families Citing this family (147)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO1994025476A1 (en) * | 1993-04-30 | 1994-11-10 | Incyte Pharmaceuticals, Inc. | Recombinant bpi-based and lbp-based proteins, nucleic acid molecules encoding same, methods of producing same, and uses thereof |
| US6541610B1 (en) | 1989-09-05 | 2003-04-01 | Immunex Corporation | Fusion proteins comprising tumor necrosis factor receptor |
| NZ235148A (en) | 1989-09-05 | 1991-12-23 | Immunex Corp | Tumour necrosis factor receptor protein and dna sequences |
| US5395760A (en) * | 1989-09-05 | 1995-03-07 | Immunex Corporation | DNA encoding tumor necrosis factor-α and -β receptors |
| EP1132471A3 (en) * | 1989-09-12 | 2001-11-28 | F. Hoffmann-La Roche Ag | TNF-binding proteins |
| EP0533006A1 (en) * | 1991-09-18 | 1993-03-24 | F.Hoffmann-La Roche & Co. Aktiengesellschaft | Chimaeric interleukin 5-receptor/immunoglobulin polypeptides |
| DE4322330A1 (en) | 1992-08-31 | 1994-03-03 | Behringwerke Ag | Use of the IL-4 receptor for the therapy, prophylaxis and diagnosis of allergic, viral, parasitic and bacterial diseases as well as fungal infections |
| US6274348B1 (en) | 1992-05-19 | 2001-08-14 | Xoma Corporation | Methods for the preparation of positively charged proteins |
| US5643570A (en) * | 1992-05-19 | 1997-07-01 | Xoma Corporation | BPI-immunoglobulin fusion proteins |
| DE4228839A1 (en) | 1992-08-29 | 1994-03-03 | Behringwerke Ag | Methods for the detection and determination of mediators |
| DE4407386B4 (en) * | 1994-03-05 | 2009-01-15 | Dade Behring Marburg Gmbh | Method for reactivation of purified membrane proteins by freezing |
| AU696924B2 (en) * | 1994-04-28 | 1998-09-24 | Dade Behring Inc. | Calibrator for prothrombin time (PT) assays |
| CN1117155C (en) * | 1994-07-29 | 2003-08-06 | 史密丝克莱恩比彻姆有限公司 | Novel compounds |
| US6410008B1 (en) | 1994-12-12 | 2002-06-25 | Beth Israel Hospital Association | Chimeric IL-10 proteins and uses thereof |
| JPH11501506A (en) | 1994-12-12 | 1999-02-09 | ベス イスラエル デアコネス メディカル センター | Chimeric cytokines and their use |
| US6485726B1 (en) | 1995-01-17 | 2002-11-26 | The Brigham And Women's Hospital, Inc. | Receptor specific transepithelial transport of therapeutics |
| DK1323346T3 (en) * | 1995-01-17 | 2006-10-30 | Brigham & Womens Hospital | Receptor-specific transport of immunogens through the epithelium |
| DE19538716A1 (en) * | 1995-10-18 | 1997-04-24 | Behringwerke Ag | Method for quantification of activated coagulation factor VII (FVIIa) |
| US7429646B1 (en) | 1995-06-05 | 2008-09-30 | Human Genome Sciences, Inc. | Antibodies to human tumor necrosis factor receptor-like 2 |
| US7427492B1 (en) | 1995-06-05 | 2008-09-23 | Human Genome Sciences, Inc. | Polynucleotides encoding human tumor necrosis factor receptor-like2 |
| AU6163196A (en) * | 1995-06-07 | 1996-12-30 | Smithkline Beecham Corporation | Method for obtaining receptor agonist antibodies |
| GB9511935D0 (en) * | 1995-06-13 | 1995-08-09 | Smithkline Beecham Plc | Novel compound |
| DE19538715A1 (en) * | 1995-10-18 | 1997-04-30 | Behringwerke Ag | Process for cleaning factor VII and activated factor VII |
| US6936439B2 (en) | 1995-11-22 | 2005-08-30 | Amgen Inc. | OB fusion protein compositions and methods |
| US20030040467A1 (en) | 1998-06-15 | 2003-02-27 | Mary Ann Pelleymounter | Ig/ob fusions and uses thereof. |
| US7964190B2 (en) | 1996-03-22 | 2011-06-21 | Human Genome Sciences, Inc. | Methods and compositions for decreasing T-cell activity |
| US6635743B1 (en) | 1996-03-22 | 2003-10-21 | Human Genome Sciences, Inc. | Apoptosis inducing molecule II and methods of use |
| US5866341A (en) * | 1996-04-03 | 1999-02-02 | Chugai Pharmaceutical Co., Ltd. | Compositions and methods for screening drug libraries |
| EP0961831B1 (en) | 1996-08-16 | 2008-10-29 | Human Genome Sciences, Inc. | Human endokine alpha |
| ATE424410T1 (en) | 1996-08-30 | 2009-03-15 | Human Genome Sciences Inc | INTERLEUKIN-19. |
| PT939804E (en) | 1996-10-25 | 2005-11-30 | Human Genome Sciences Inc | ALPHA NEUTROQUIN |
| ES2615357T3 (en) | 1996-12-06 | 2017-06-06 | Amgen Inc. | Combination therapy using an IL-1 inhibitor to treat IL-1 mediated diseases |
| US6455040B1 (en) | 1997-01-14 | 2002-09-24 | Human Genome Sciences, Inc. | Tumor necrosis factor receptor 5 |
| US6261801B1 (en) | 1997-01-14 | 2001-07-17 | Human Genome Sceineces, Inc. | Nucleic acids encoding tumor necrosis factor receptor 5 |
| US6433147B1 (en) | 1997-01-28 | 2002-08-13 | Human Genome Sciences, Inc. | Death domain containing receptor-4 |
| DK1012274T4 (en) | 1997-01-28 | 2011-07-25 | Human Genome Sciences Inc | Death domain-containing receptor-4 (DR4: death receptor 4), a member of the TNF receptor superfamily and which binds to TRAIL (Apo-2L) |
| US8329179B2 (en) | 1997-01-28 | 2012-12-11 | Human Genome Sciences, Inc. | Death domain containing receptor 4 antibodies and methods |
| US7452538B2 (en) | 1997-01-28 | 2008-11-18 | Human Genome Sciences, Inc. | Death domain containing receptor 4 antibodies and methods |
| US6872568B1 (en) | 1997-03-17 | 2005-03-29 | Human Genome Sciences, Inc. | Death domain containing receptor 5 antibodies |
| PT1015477E (en) | 1997-05-30 | 2010-12-28 | Human Genome Sciences Inc | 32 human secreted proteins |
| AU8182298A (en) * | 1997-07-10 | 1999-02-08 | Beth Israel Deaconess Medical Center | Recombinant erythropoietin / immunoglobulin fusion proteins |
| US6187564B1 (en) | 1997-07-10 | 2001-02-13 | Beth Israel Deaconess Medical Center | DNA encoding erythropoietin multimers having modified 5′ and 3′ sequences and its use to prepare EPO therapeutics |
| US6165476A (en) * | 1997-07-10 | 2000-12-26 | Beth Israel Deaconess Medical Center | Fusion proteins with an immunoglobulin hinge region linker |
| US6242570B1 (en) | 1997-07-10 | 2001-06-05 | Beth Israel Deaconess Medical Center | Production and use of recombinant protein multimers with increased biological activity |
| JP2002017353A (en) * | 1997-12-19 | 2002-01-22 | Japan Tobacco Inc | Method for determining denatured LDL |
| EP1049777B1 (en) * | 1998-01-23 | 2005-08-03 | Immunex Corporation | Acpl dna and polypeptides |
| DE69943022D1 (en) | 1998-03-19 | 2011-01-20 | Human Genome Sciences Rockville | THE COMMON GAMMA CHAIN SIMILAR CYTOKINE RECEPTOR |
| US6472179B2 (en) * | 1998-09-25 | 2002-10-29 | Regeneron Pharmaceuticals, Inc. | Receptor based antagonists and methods of making and using |
| US7083949B2 (en) | 1998-09-25 | 2006-08-01 | Regeneron Pharmaceuticals, Inc. | Receptor based antagonists and methods of making and using |
| US6927044B2 (en) | 1998-09-25 | 2005-08-09 | Regeneron Pharmaceuticals, Inc. | IL-1 receptor based cytokine traps |
| EP1123401A1 (en) | 1998-10-22 | 2001-08-16 | The General Hospital Corporation | BIOACTIVE PEPTIDES AND PEPTIDE DERIVATIVES OF PARATHYROID HORMONE (PTH) AND PARATHYROID HORMONE-RELATED PEPTIDE (PTHrP) |
| US7169567B1 (en) | 1998-12-31 | 2007-01-30 | The General Hospital Corporation | Screening assay utilizing the PTH receptor |
| US6656728B1 (en) | 1999-02-08 | 2003-12-02 | Chiron Corporation | Fibroblast growth factor receptor-immunoglobulin fusion |
| EP1161451A4 (en) | 1999-02-26 | 2006-05-17 | Human Genome Sciences Inc | Human endokine alpha and methods of use |
| MXPA01011264A (en) * | 1999-05-07 | 2002-07-02 | Genentech Inc | Novel chimpanzee erythropoietin (chepo) polypeptides and nucleic acids encoding the same. |
| US6362324B1 (en) | 1999-06-30 | 2002-03-26 | Millennium Pharmaceuticals, Inc. | 17867 a novel human aminopeptidase |
| US6369210B1 (en) | 1999-06-30 | 2002-04-09 | Millennium Pharmaceuticals, Inc. | 22012, human carboxypeptidase |
| WO2001023521A2 (en) | 1999-09-29 | 2001-04-05 | The General Hospital Corporation | Polypeptide derivatives of parathyroid hormone (pth) |
| US6808902B1 (en) | 1999-11-12 | 2004-10-26 | Amgen Inc. | Process for correction of a disulfide misfold in IL-1Ra Fc fusion molecules |
| US6248353B1 (en) | 1999-12-10 | 2001-06-19 | Dade Behring Inc. | Reconstitution of purified membrane proteins into preformed liposomes |
| AU784677B2 (en) * | 2000-03-02 | 2006-05-25 | Abgenix, Inc. | Human monoclonal antibodies against oxidized LDL receptor and pharmaceutical uses thereof |
| AU2001259758A1 (en) | 2000-05-12 | 2001-11-26 | Immunex Corporation | Interleukin-1 inhibitors in the treatment of diseases |
| WO2001092340A2 (en) | 2000-05-26 | 2001-12-06 | Immunex Corporation | Use of interleukin-4 antagonists and compositions thereof |
| EP1349946B1 (en) | 2000-08-25 | 2011-01-26 | BASF Plant Science GmbH | Plant polynucleotides encoding prenyl proteases |
| US6989247B2 (en) | 2000-11-28 | 2006-01-24 | Celltech R & D, Inc. | Compositions and methods for diagnosing or treating psoriasis |
| EP1683865A3 (en) | 2001-02-02 | 2006-10-25 | Eli Lilly & Company | Mammalian proteins and in particular CD200 |
| EP1385864B1 (en) | 2001-04-13 | 2010-06-09 | Human Genome Sciences, Inc. | Anti-VEGF-2 antibodies |
| US7361341B2 (en) | 2001-05-25 | 2008-04-22 | Human Genome Sciences, Inc. | Methods of treating cancer using antibodies that immunospecifically bind to trail receptors |
| ES2437992T3 (en) | 2001-05-25 | 2014-01-15 | Human Genome Sciences, Inc. | Antibodies that bind immunospecifically to TRAIL receptors |
| US7348003B2 (en) | 2001-05-25 | 2008-03-25 | Human Genome Sciences, Inc. | Methods of treating cancer using antibodies that immunospecifically bind to TRAIL receptors |
| NZ530765A (en) | 2001-06-26 | 2006-11-30 | Amgen Fremont Inc | Antibodies that bind OPGL and compositions and methods for the treatment of bone diseases |
| AU2002339843B2 (en) | 2001-07-23 | 2007-12-06 | The General Hospital Corporation | Conformationally constrained parathyroid hormone (PTH) analogs |
| KR100453877B1 (en) | 2001-07-26 | 2004-10-20 | 메덱스젠 주식회사 | METHOD OF MANUFACTURING Ig-FUSION PROTEINS BY CONCATAMERIZATION, TNFR/Fc FUSION PROTEINS MANUFACTURED BY THE METHOD, DNA CODING THE PROTEINS, VECTORS INCLUDING THE DNA, AND CELLS TRANSFORMED BY THE VECTOR |
| AU2003254016A1 (en) | 2002-07-19 | 2004-02-09 | Catholic Healthcare West | Methods and compositions relating to chimeric nicotinic receptor subunits |
| JP5116971B2 (en) | 2002-10-15 | 2013-01-09 | インターセル アーゲー | Nucleic acid encoding an adhesion factor for group B streptococci, an adhesion factor for group B streptococci, and uses thereof |
| AU2004206250B8 (en) | 2003-01-21 | 2009-09-17 | Bristol-Myers Squibb Company | Polynucleotide encoding a novel acyl coenzyme a, monoacylglycerol acyltransferase-3 (MGAT3), and uses thereof |
| EP2287315A1 (en) | 2003-03-04 | 2011-02-23 | Intercell AG | Streptococcus pyogenes antigens |
| AU2003220380A1 (en) | 2003-03-19 | 2004-11-19 | Bristol-Myers Squibb Company | CONFORMATIONALLY CONSTRAINED PARATHYROID HORMONES WITH Alpha-HELIX STABILIZERS |
| EP2336357A1 (en) | 2003-04-15 | 2011-06-22 | Intercell AG | S. pneumoniae antigens |
| TWI353991B (en) | 2003-05-06 | 2011-12-11 | Syntonix Pharmaceuticals Inc | Immunoglobulin chimeric monomer-dimer hybrids |
| AU2012203896B2 (en) * | 2003-05-06 | 2014-09-25 | Bioverativ Therapeutics Inc. | Clotting Factor-Fc Chimeric Proteins to Treat Hemophilia |
| EP3002012A1 (en) * | 2003-05-06 | 2016-04-06 | Biogen Hemophilia Inc. | Clotting factor-fc chimeric proteins to treat hemophilia |
| CA2522986A1 (en) | 2003-05-07 | 2004-11-18 | Intercell Ag | Streptococcus agalactiae antigens i + ii |
| AU2004242842B2 (en) | 2003-05-30 | 2011-11-03 | Intercell Ag | Enterococcus antigens |
| JP4871128B2 (en) | 2003-07-17 | 2012-02-08 | ザ ジェネラル ホスピタル コーポレイション | A conformationally constrained parathyroid hormone (PTH) analog |
| US8110665B2 (en) | 2003-11-13 | 2012-02-07 | Hanmi Holdings Co., Ltd. | Pharmaceutical composition comprising an immunoglobulin FC region as a carrier |
| US8029789B2 (en) | 2003-11-13 | 2011-10-04 | Hanmi Holdings Co., Ltd. | Method for the mass production of immunoglobulin constant region |
| CN102660564B (en) | 2004-04-22 | 2013-05-08 | 泰勒克里斯生物治疗学公司 | Recombinantly modified plasmin |
| EP1598428A1 (en) | 2004-05-18 | 2005-11-23 | Georg Dewald | Methods and kits to detect Hereditary angioedema type III |
| ATE540973T1 (en) | 2004-07-22 | 2012-01-15 | Five Prime Therapeutics Inc | COMPOSITIONS AND METHODS FOR USING MGD-CDF FOR DISEASE TREATMENT |
| ES2368930T3 (en) | 2004-09-06 | 2011-11-23 | Bayer Pharma Aktiengesellschaft | PIRAZOLOPIRIMIDINAS AS INHIBITORS OF PROTEIN CINASE B (AKT). |
| CN101072793B (en) * | 2004-12-09 | 2012-06-20 | 默克专利有限公司 | Il-7 variants with reduced immunogenicity |
| CA2603863A1 (en) | 2005-04-07 | 2006-10-19 | The Cleveland Clinic Foundation | Gammaretrovirus associated with cancer |
| KR100754667B1 (en) | 2005-04-08 | 2007-09-03 | 한미약품 주식회사 | Immunoglobulin Fc Fragments Modified with Non-Peptide Polymers and Pharmaceutical Compositions Comprising the Same |
| CA2619771C (en) | 2005-08-16 | 2012-05-22 | Hanmi Pharmaceutical Co., Ltd. | A method for the mass production of immunoglobulin fc region deleted initial methionine residues |
| AU2006287315B2 (en) | 2005-09-09 | 2013-02-21 | The Johns Hopkins University | Manipulation of regulatory T cell and DC function by targeting neuritin gene using antibodies, agonists and antagonists |
| AU2006344395B2 (en) | 2005-10-13 | 2013-05-02 | Human Genome Sciences, Inc. | Methods and compositions for use in treatment of patients with autoantibody positive diseases |
| CA2628238A1 (en) | 2005-11-07 | 2007-05-18 | The Scripps Research Institute | Compositions and methods for controlling tissue factor signaling specificity |
| EP1785434A1 (en) | 2005-11-11 | 2007-05-16 | Ludwig-Maximilians-Universität München | Targeting and tracing of antigens in living cells |
| EP2671954B1 (en) | 2006-01-20 | 2018-05-16 | Cell Signaling Technology, Inc. | Translocation and mutant ROS kinase in human non-small cell lung carcinoma |
| US7625564B2 (en) | 2006-01-27 | 2009-12-01 | Novagen Holding Corporation | Recombinant human EPO-Fc fusion proteins with prolonged half-life and enhanced erythropoietic activity in vivo |
| AU2007240316A1 (en) | 2006-04-20 | 2007-11-01 | Becton, Dickinson And Company | Thermostable proteins and methods of making and using thereof |
| US7572618B2 (en) | 2006-06-30 | 2009-08-11 | Bristol-Myers Squibb Company | Polynucleotides encoding novel PCSK9 variants |
| WO2008019062A2 (en) | 2006-08-04 | 2008-02-14 | The General Hospital Corporation | Polypeptide derivatives of parathyroid hormone (pth) |
| WO2008031133A2 (en) | 2006-09-15 | 2008-03-20 | Intercell Ag | Borrelia antigens |
| US7767206B2 (en) | 2006-10-02 | 2010-08-03 | Amgen Inc. | Neutralizing determinants of IL-17 Receptor A and antibodies that bind thereto |
| KR100888022B1 (en) | 2006-12-21 | 2009-03-09 | 재단법인 목암생명공학연구소 | Fusion protein between immunoglobulin Fc and human apolipoprotein (a) kringle fragment L8 8Fc |
| WO2008122039A2 (en) | 2007-04-02 | 2008-10-09 | The Government Of The United States Of America, As Represented By The Secretary, Department Of Health And Human Services | Selenocysteine mediated hybrid antibody molecules |
| AU2008248755A1 (en) | 2007-05-02 | 2008-11-13 | Intercell Ag | Klebsiella antigens |
| JP2010530229A (en) | 2007-06-18 | 2010-09-09 | インターセル アーゲー | Chlamydia antigens |
| BRPI0814465B1 (en) | 2007-07-26 | 2021-11-23 | Novagen Holding Corporation | FUSION PROTEIN, DIMER, METHOD FOR PRODUCING A FUSION PROTEIN, CELL LINEAGE, USES OF A FUSION PROTEIN AND A PHARMACEUTICAL COMPOSITION AND PHARMACEUTICAL COMPOSITION |
| MX346714B (en) | 2007-08-01 | 2017-03-24 | The General Hospital Corp * | Screening methods using g-protein coupled receptors and related compositions. |
| EP2987859B1 (en) | 2007-09-27 | 2018-08-08 | Japan Tobacco Inc. | Factor involved in latent infection with herpesvirus, and use thereof |
| ES2576650T3 (en) | 2007-10-18 | 2016-07-08 | Cell Signaling Technology, Inc. | Translocation and ROS mutant kinase in human non-small cell lung carcinoma |
| SI2242769T1 (en) | 2008-01-11 | 2017-02-28 | Adheron Therapeutics, Inc. | Anti-cadherin-11 ec1 domain antibodies for treating inflammatory joint disorders |
| EP2274437B1 (en) | 2008-04-10 | 2015-12-23 | Cell Signaling Technology, Inc. | Compositions and methods for detecting egfr mutations in cancer |
| CN102057044B (en) | 2008-06-04 | 2013-05-01 | 泰勒克里斯生物治疗学公司 | Composition, method and kit for preparing plasmin |
| CA2731546C (en) | 2008-07-23 | 2013-11-19 | Hanmi Holdings Co., Ltd. | A polypeptide complex comprising non-peptidyl polymer having three functional ends |
| AU2010213578B2 (en) | 2009-02-12 | 2015-01-29 | Cell Signaling Technology, Inc. | Mutant ROS expression in human cancer |
| US8617574B2 (en) | 2009-02-13 | 2013-12-31 | Valneva Austria Gmbh | Nontypable Haemophilus influenzae antigens |
| JP5789521B2 (en) | 2009-03-03 | 2015-10-07 | グリフオルス・セラピユーテイクス・インコーポレーテツドGrifols Therapeutics,Inc. | Compositions, methods and kits for producing plasminogen; and plasmin produced therefrom |
| TW201117824A (en) | 2009-10-12 | 2011-06-01 | Amgen Inc | Use of IL-17 receptor a antigen binding proteins |
| BR112012017150B1 (en) | 2010-01-15 | 2022-03-03 | Kirin-Amgen Inc | Pharmaceutical formulation, pharmaceutical container, and kit |
| WO2011090971A2 (en) | 2010-01-19 | 2011-07-28 | The Trustees Of Columbia University In The City Of New York | Osteocalcin as a treatment for male reproductive disorders |
| KR20130107203A (en) | 2010-05-04 | 2013-10-01 | 더 브리검 앤드 우먼즈 하스피털, 인크. | Detection and treatment of fibrosis |
| CN103002906B (en) | 2010-05-13 | 2017-12-29 | 总医院有限公司 | Parathyroid hormone analogs and their applications |
| CN103153331B (en) | 2010-07-15 | 2017-03-22 | 亚德赫伦医疗公司 | Humanized antibodies targeting the EC1 domain of cadherin-11 and related compositions and methods |
| US20140234330A1 (en) | 2011-07-22 | 2014-08-21 | Amgen Inc. | Il-17 receptor a is required for il-17c biology |
| US20150064163A1 (en) | 2011-09-02 | 2015-03-05 | Lifenet Health | BMP Peptides & Methods of Use |
| MX369626B (en) | 2012-05-24 | 2019-11-13 | Mountgate Group Ltd | Compositions and methods related to prevention and treatment of rabies infection. |
| EP2685260A1 (en) | 2012-07-09 | 2014-01-15 | Ludwig-Maximilians-Universität München | Direct and quantitative detection of targets in living cells |
| KR101609840B1 (en) * | 2012-07-12 | 2016-04-07 | 한국생명공학연구원 | Adsorbent columns using antibody Fcbinding peptide |
| CN104902914B (en) | 2012-09-11 | 2019-01-01 | 科荣生生物科学公司 | Correctly folded etanercept in high purity and excellent yield |
| KR102073748B1 (en) | 2013-01-31 | 2020-02-05 | 한미약품 주식회사 | Recombinant yeast transformant and process for preparing immunoglobulin Fc fragment employing the same |
| WO2014152497A2 (en) | 2013-03-15 | 2014-09-25 | The Trustees Of Columbia University In The City Of New York | Osteocalcin as a treatment for cognitive disorders |
| AR096891A1 (en) | 2013-07-12 | 2016-02-03 | Hanmi Pharm Ind Co Ltd | CONJUGATE OF BIOMOLOGICALLY ACTIVE POLYPEPTIDE MONOMER AND CONJUGATE OF FRAGMENTO FC OF IMMUNOGLOBULINA, THAT SHOWS CLEARING THROUGH REDUCED RECEPTOR, AND THE METHOD FOR PREPARING THE SAME |
| SG11201607881SA (en) | 2014-03-31 | 2016-10-28 | Kirin Amgen Inc | Methods of treating nail and scalp psoriasis |
| EP3191186B1 (en) | 2014-09-10 | 2021-01-27 | Georgetown University | Compositions and methods of using interleukin-4 induced gene 1 (il4i1) |
| JP7175608B2 (en) | 2014-11-19 | 2022-11-21 | ザ トラスティーズ オブ コロンビア ユニバーシティ イン ザ シティ オブ ニューヨーク | Osteocalcin as a treatment for age-related frailty |
| US20180079796A1 (en) | 2015-03-13 | 2018-03-22 | Samsung Bioepis Co., Ltd. | Anti-tnf-alpha polypeptide composition and use thereof |
| EP3706795A4 (en) | 2017-11-09 | 2021-10-13 | Pinteon Therapeutics Inc. | Methods and compositions for the generation and use of humanized conformation-specific phosphorylated tau antibodies |
| WO2019178218A1 (en) | 2018-03-14 | 2019-09-19 | Memorial Sloan Kettering Cancer Center | Anti-polysialic acid antibodies and uses thereof |
| US12129298B2 (en) | 2018-06-21 | 2024-10-29 | Daiichi Sankyo Company, Limited | Compositions including CD3 antigen binding fragments and uses thereof |
| WO2020053808A1 (en) | 2018-09-12 | 2020-03-19 | Georg Dewald | Method of diagnosing vasoregulatory disorders |
| US12509515B2 (en) | 2019-03-11 | 2025-12-30 | Memorial Sloan Kettering Cancer Center | CD22 antibodies and methods of using the same |
| KR20230146521A (en) | 2021-01-13 | 2023-10-19 | 메모리얼 슬로안 케터링 캔서 센터 | Antibody-pyrrolobenzodiazepine derivative conjugate |
| TW202245844A (en) | 2021-01-13 | 2022-12-01 | 紀念斯隆凱特琳癌症中心 | Anti-dll3 antibody-drug conjugate |
Family Cites Families (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP0269455A3 (en) * | 1986-11-28 | 1989-09-06 | Takeda Chemical Industries, Ltd. | Highly purified fused protein comprising human ige fc fragment and production thereof |
| PT89484B (en) * | 1988-01-22 | 1994-03-31 | Gen Hospital Corp | GENE CLONED CODES OF FUSAO PROTEINS IG-CD4 AND ITS UTILIZATION |
| JPH05500611A (en) * | 1989-08-23 | 1993-02-12 | ザ・ジェネラル・ホスピタル・コーポレーション | Non-human primate CD4 polypeptides, glycosylatable human CD4 molecules, fragments thereof, fusion proteins thereof, gene sequences and uses thereof |
| US5395760A (en) * | 1989-09-05 | 1995-03-07 | Immunex Corporation | DNA encoding tumor necrosis factor-α and -β receptors |
| EP1132471A3 (en) * | 1989-09-12 | 2001-11-28 | F. Hoffmann-La Roche Ag | TNF-binding proteins |
| DE69133036T2 (en) * | 1990-11-09 | 2003-02-06 | Stephen D. Gillies | CYTOKINE IMMUNOCONJUGATE |
| EP0533006A1 (en) * | 1991-09-18 | 1993-03-24 | F.Hoffmann-La Roche & Co. Aktiengesellschaft | Chimaeric interleukin 5-receptor/immunoglobulin polypeptides |
-
1991
- 1991-06-22 DE DE59109269T patent/DE59109269D1/en not_active Expired - Lifetime
- 1991-06-22 EP EP05011561A patent/EP1586635A1/en not_active Withdrawn
- 1991-06-22 AT AT97120664T patent/ATE309376T1/en not_active IP Right Cessation
- 1991-06-22 ES ES97120664T patent/ES2251009T3/en not_active Expired - Lifetime
- 1991-06-22 DE DE59109032T patent/DE59109032D1/en not_active Expired - Lifetime
- 1991-06-22 ES ES91110307T patent/ES2120949T4/en not_active Expired - Lifetime
- 1991-06-22 DK DK97120664T patent/DK0835939T3/en active
- 1991-06-22 EP EP97120664A patent/EP0835939B8/en not_active Expired - Lifetime
- 1991-06-22 DE DE2000175010 patent/DE10075010I2/en active Active
- 1991-06-22 EP EP91110307A patent/EP0464533B1/en not_active Expired - Lifetime
- 1991-06-22 DK DK91110307T patent/DK0464533T3/en active
- 1991-06-22 AT AT91110307T patent/ATE169030T1/en active
- 1991-06-27 IE IE225691A patent/IE912256A1/en not_active IP Right Cessation
- 1991-06-27 PT PT98113A patent/PT98113B/en not_active IP Right Cessation
- 1991-06-27 AU AU79357/91A patent/AU655421B2/en not_active Expired
- 1991-06-27 CA CA002045869A patent/CA2045869C/en not_active Expired - Lifetime
- 1991-06-28 KR KR1019910010844A patent/KR100249572B1/en not_active Expired - Lifetime
- 1991-06-28 JP JP3183772A patent/JPH05247094A/en active Pending
-
1998
- 1998-08-04 GR GR980401751T patent/GR3027567T3/en unknown
-
1999
- 1999-02-12 CY CY9900007A patent/CY2151B1/en unknown
- 1999-03-19 KR KR1019990009326A patent/KR100280070B1/en not_active Expired - Lifetime
- 1999-03-19 KR KR1019990009324A patent/KR100280069B1/en not_active Expired - Lifetime
-
2000
- 2000-01-13 UY UY25897A patent/UY25897A1/en not_active Application Discontinuation
- 2000-05-31 LU LU90592C patent/LU90592I2/en unknown
- 2000-06-09 NL NL300009C patent/NL300009I2/en unknown
-
2001
- 2001-10-17 JP JP2001319607A patent/JP3768427B2/en not_active Expired - Lifetime
-
2014
- 2014-06-18 CY CY2000009C patent/CY2000009I1/en unknown
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US8937169B2 (en) | 1996-01-11 | 2015-01-20 | Human Genome Sciences, Inc. | Human G-protein chemokine receptor HSATU68 |
Also Published As
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CA2045869C (en) | Fusion proteins with immunoglobulin portions, the preparation and use thereof | |
| US7253264B1 (en) | Immunoglobulin fusion proteins, their production and use | |
| US5098833A (en) | DNA sequence encoding a functional domain of a lymphocyte homing receptor | |
| CA2190371C (en) | Receptor for oncostatin m | |
| US5840844A (en) | Soluble lymphocyte homing receptors | |
| US6433142B1 (en) | Megakaryocyte stimulating factors | |
| JPS63503357A (en) | Novel coagulation active protein | |
| IL85411A (en) | Methods and deoxyribonucleic acids for the preparation of tissue factor proteins | |
| US20030064480A1 (en) | Fusion proteins with immunoglobulin portions, the preparation and use thereof | |
| Andrews et al. | Conservation of tissue factor primary sequence among three mammalian species | |
| EP0804580B1 (en) | Calcium binding recombinant antibody against protein c | |
| WO1993016709A1 (en) | Therapeutic domains of von willebrand factor | |
| US7247453B1 (en) | Calcium binding recombinant antibody against protein C | |
| IE84574B1 (en) | Fusion proteins with parts of immunoglobulins, their production and use | |
| CA2247998C (en) | Fragments of cr1 and their use | |
| HK1083353A (en) | Fusion proteins with parts of immunoglobulins, their production and use | |
| HK1010216B (en) | Fusion proteins with parts of immunoglobulins, their production and use | |
| EP0347262A1 (en) | Cloning and expression of human tissue factor | |
| HK1012015B (en) | Fusionproteins with parts of immunoglobulins, their production and use | |
| JPWO1996003434A1 (en) | Megakaryocyte differentiation and growth factor |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| EEER | Examination request | ||
| MKEX | Expiry |