CA2019156A1

CA2019156A1 - Formation of triple helix complexes of double stranded dna using nucleoside oligomers

Info

Publication number: CA2019156A1
Application number: CA002019156A
Authority: CA
Inventors: Paul O.P. Ts'o; Paul S. Miller
Original assignee: Individual
Current assignee: Johns Hopkins University
Priority date: 1989-06-19
Filing date: 1990-06-18
Publication date: 1990-12-19
Also published as: IL94752A; TW221829B; WO1990015884A1; NZ234082A; EP0478708A4; AU7584594A; ZA904689B; AU679111B2; JPH04506152A; EP0478708A1; IL94752A0; AU5846890A; AU651067B2

Abstract

PATENT

ABSTRACT OF THE DISCLOSURE

A specific segment of double stranded DNA may be detected or recognized by formation of a triple helix structure using an Oligomer comprised of nucleosidyl units linked by internucleosidyl phosphorus linkages. Function or expression of double stranded DNA segments may be prevented by triple helix formation. Novel Oligomers comprising modified nucleosidyl units are useful in triple helix formation, and may be optionally derivatized with DNA modifying groups.

Description

2~9~
S P E C I F I C A T I O N

FORMAq!ION OF TRIPI-E ~E:LIX CO~gPI~5XE:8 OF DOURI~E 8~RANDÆD DNA
U8ING NUCI,E08IDE f;~LIGO~BRA

CR088--R13FE:R13~C13 TfD P~EI,ATED APPI,IfCA~ION8 This application is a continuation-in-part of ~.S.
Serial No. 924,234, filed October 28, 1986, the r~isclosure of which is incorporated herein by reference.

BACXGROUNDn~OF THE INVFNTION
Publications and other reference materials referred to herein are incorporated herein by reference and are numerically referenced in the following text and respectively grouped in the appanded Bibliography which immediately precedes the claims.
The present invention is directed to novel methods of detecting and locating specific sequences in double ~tranded DNA
using nucleoside oligomers which are capable of specifit_ally complexing with a selected double stranded DNA structure to give a triple helix structure.
Formation of triple helix structures by homopyrimidine oligodeoxyribonucleotides binding to polypurine tracts in double stranded DNA by Hoogsteen hydrogen bonding has been reported.
(See, e.g. (1) and (2)). The homopyrimidine oligonucleotides were found to recogni~e extended purine sequences in the major groove of double helical DNA via triple helix formation. Speci-ficity was found to be imparted by Hoogsteen base pairing between the homopyrimidine oligonucleotide and the purine strand of the Watson-Crick duplex DNA. Triple helical complexes containing cytosine and thymidine on the Hoogsteen ~or third) strand have R I ~ ~ o Date cf Deposit ~//
Iherebycer;i~ythatthispaperor~eeisbeing deposi~ed wi~htheUnited st~tes PostalSer~ire ~E~f~ress~ailPostofi;e~0Addresse~ser~iceun-der 37 C!.~ I.IC or lil~ d,teil,dicate~d~c~,e~lldis addre~ dtot~eC;, mar~s,~a~iirl~;on D~ 0231.
St~Zcitv~ L ~s r~pe0 ~rined~ameo~-n MailillgP3per.

slg,lature 2~9~ ~
PATENT

been found to be stable in acidic to neutral solutions, respect-ively, but have been found to dissociate on increasiny pH.
Incorporation of modified bases of T, such as 5 bromo-uracil and C, ~uch as 5-methylcytosine, into the Hoogsteen strand has been found to increase stability of the triple helix over a higher pH
range. In order for cytosine (C) to participate in the Hoogsteen-type pairing, a hydrogen must be available on the 3-N
of the pyrimidine ring for hydrogen bonding. Accordingly, in some circumstances, C may be protonated at N-3.
DNA exhibits a wide range of polymorphic conformations, such conformations may be essential for biological processes.
Modulation of signal transduction by sequence-specific protein-DNA binding and molecular interactions such as transcription, translation, and replication, are believed to be dependent upon DNA conformation. (3) It is exciting to consider the possibility of developing therapeutic agents which bind to critical regions of the genome and selectively inhibit the function, replication, and survival of abnormal cells. (4) The design and development of sequence-specific DNA binding molecules has been pursued by various lahoratories and has far-reaching implications for the diagnosis and treatment of diseases involving foreign genetic materials (such as viruses) or alterations in genomic DNA (such as cancer).
Nuclease-r~sistant nonionic oligodeoxynucleotides (ODN) consisting of a methylphosphonate (MP) backbone have been studied in vitro and in vivo as potential anticancer, antiviral and antibacterial agents. ~5) The 5'-3' linked internucleotide bonds of these analogs closely approximate the conformation o~

2 ~ 6 PATENT

nucleic acid phosphodiester bonds. The phosphate backbone is rendered neutral by methyl substitution of one anionic phosphoryl oxygen decreasing inter- and intrastrand repulsion due to the charged phosphate groups. (5) Analogs with MP backbone can penetrate living cells and have been shown to inhibit mRNA
translation in globin synthesis and vesicular s~omatitis viral protein synthesis, and inhibit splicing of pre-mRNA in inhibition of HSV replication. Mechanisms of action for inhibition by the nonionic analogs include formation of stable complexes with complementary RNA and/or DNA.
Nonionic oligonucleoside alkyl- and aryl-phosphonate analogs complementary to a selected single stranded foreign nucleic acid sequence can selectively inhibit the expression or function or expression of that particular nucleic acid without disturbing the function or expression of other nucleic acids present in the cell, by binding to or interfexing with that nucleic acid. ~See, e.g. U.S. Patent No. 4,469,863 and 4,51~,713). The use of complementary nuclease-resistant nonionic oligonucleoside methylphosphonates which are taken up by mammalian cells to inhibit viral protein synthesis in certain contexts, including Herpes simplex virus-l is disclosed in U.S.
Patent No. 4,757,055.
The use of anti-sense oligonucleotides or phosphoro-thioate analogs complementary to a part of viral mRNA to interrupt the transcription and translation of viral mRNA into protein has been proposed. The anti-sense constructs can bind to viral mRNA and were thought to obstruct the cells ribosomes from moving along the mRNA and thereby halting the translation of mRNA

2 Q ~
PATENT

into protein, a process called "translation arrest" or "ribosomal-hybridization arrest." (6) The inhibition of infection of cells by HTLV-III by administration of oligonucleotides complementary to highly conserved regions of the HTLV-III genome necessary for HTLV-III
replication and/or expression is disclosed in U.S. Patent No.
4,806,463. The oligonucleotides were found to affect viral replication and/or gene expression as assayed by reverse transcriptase activity (replication) and production of viral proteins pl5 and p24 ~gene expression).
The ability of some antisense oligodeoxynucleotides containing internucleoside methylphosphonate linkages to inhibit HIV-induced syncytium formation and expression has been studied.
(7) Psoralen-derivatized oligonucleoside methylphosphonates have been reported capable of cross-linking either coding or non-coding single stranded DNA; however, double stranded DN~ was not cr~ss-linked. (28) ~MMARY OF THE INVEN~ON
The present invention is directed to methods of dekecting or recognizing a specific segment of double stranded DNA or double stranded DNA sequence and to methods of preventing expression or function of a specific segment of double stranded DNA ~aving a given sequence. This is achieved without destroying the intactness of the duplex structure or interrupting the base-pairing of the double stranded DNA. The present invention is also directed to novel modified Oligomers which are useful for preventing expression and/or functioning of a selected double 2 ~
PATENT

stranded DNA sequence and which optionally include a DNA modify-iny group. Additionally, the present invention is directed to novel Oligomers which comprise cytosine analogs. The present invention is also directed to formation of a triple helix structure by the interaction of a specific segment o~ double stranded DNA and an Oligomer which is sufficiently complement~ry to the DNA segment to read it and base pair (or hybridize) thereto.
Accordingly, in one aspect, the present invention is directed to methods of detecting or recognizing a specific segment of double stranded DNA which comp-ises contacting said segment of DNA with an Oligomer which is sufficiently comple-mentary to the sequence of purine bases in said segment of double stranded DNA or a portion thereof to hydrogen bond (or hybridize) therewith thereby giving a triple helix structure.
In another aspect, the present invention is directed to methods of preventing or inhibiting expression or function of a specific segment of double stranded DNA having a given sequence which comprises contacting said DNA segment with an Oligomer su~ficiently complementary to said double stranded DNA segment to form hydrogen bonds therewith, thereby giving a triple helix structure.
The present invention is directed to methods wherein the DNA segment comprises a gene in a living cell and wherein formation of the triple helix structure permanently inhibits or inactivates said gene.
In a preferred aspect, said Oligomer is modified to incorporate a DNA modifying group which, after the Oligomer hydrogen bonds or hybridizes with the selected DNA sequence, is 2 ~ 6 PATENT

caused to react chemically with the DNA and irreversibly modify it. Such modifications may include cross-linking Oligomer and DNA by forming a covalent bond thereto, alkylating the DNA, cleaving said DNA at a specific location, or by degrading or destroying the DNA.
In another aspect, the present invention provides novel nonionic alkyl- and aryl-phosphonate Oligomers which are sufficiently complementary to the purine sequence of a specific double stranded DNA segment to hydrogen bond and form a triple helix structure. Preferred are nonionic methylphosphonate Oligomers.
One preferred class of methylphosphonate Oligomers comprises only purine bases.
The present invention also provides Oligomers having nucleosidyl units in which a cytosine analog replaces cytosine and wherein said cytosine analog comprises a heterocycle which has a hydrogen available for hydrogen bonding at the ring position which corresponds to N-3 of cytosine and which is capable of forming two hydrogen bonds with a guanine base at neutral pH.
In another aspect of the present invention, Oligomers which comprise a modified sugar moiety having a lengthening link between the 5'-C and the 5'-OH and/or the 3'-C and 3'-OH are provided. These Oligomers comprising such modi~ied sugar moieties may read purine bases on both strands of a segment of double stranded DNA.

2 ~
PATENT

~A) Definition~
As used herein, the following terms have the following meanings unless expressly stated to the contrary.
The term "Oligomer" refers to nucleosidyl units which are connected by internucleosidyl phosphorus group linkages and includes oligonucleotides, nonionic oligonucleoside alkyl- and aryl-phosphonate analogs, phosphorothioate analogs of oligo-nucleotides, phosphoamidate analogs o~ oligonucleotides, neutral phosphate ester oligonucleotide analogs, and other oligonucleo-tide analogs and modified oligonucleotides.
The term "phosphonate" refers to the group o = P-R
wherein R is an alkyl or aryl group. Suitable alkyl or aryl groups include those which do not sterically hinder the phosphonate linkage or interact with each other. The phosphonate group may exist in eithsr an "R" or an "S" configuration.
Phosphonate groups may be used as internucleosidyl phosphorus group linkages (or links) to connect nucleosidyl units.
The term "phosphodiester" refers to the group O = p Oe.
Phosphodiester ~roups may be used as internucleosidyl phosphorus group linkages (or links) to connect nucleosidyl units.
The term "alkyl or aryl-phosphonate Oligomer" refers to nucleotide Oligomers having internucleosidyl phosphorus group linkages wherein at least one alkyl or aryl phosphonate inter-nucleosidyl linkage replaces a phosphodiester internucleosidyl linkage.
The term "methylphosphonate Oligomer" (or "MP-Oligomer") refers to nucleotide Oligomers (or oligonucleotide analogs! havina internucleosidyl phosphorus group linkages 2~ 5 6 PATENT

wherein at least one methylphosphonate internucleosidyl linkage replaces a phosphodiester internucleosidyl linkage.
The term "Third Strand Oligomer" refers to Oligomers which are capable of reading a segment of double stranded DNA and forming a triple helix structure therewith.
The term "nucleoside" includes a nucleosidyl unit and is used interchangeably therewith and includes not only units having A, G, C, T and U as their bases, but also analogs and modified forms of the bases (such as 8-substituted purines).
The term "complementary" when referring to an Oligomer Third Strand refers to Oligomers having base sequences which hydrogen bond (and base pair or hybridize) with the purine base of a corresponding ~Watson-Crick) base pair of a double stranded DNA to form a triple helix structure.
In the various Oligomer sequences listed herein "p" in, e.g., as in ApA represents a phosphodiester linkage, and ~ i in, e.g., as in C~G represents a methylphosphonate linkage. ~lso, notation such as "T" indicates nucleosidyl groups linked by methyl phosphonate linkages.
The term "purine" or "purine base" includes not only the naturally occurring adenine and guanine bases, but also modifications of those bases such as bases substituted at the 8-position.
The term "read" refers to the ability of a nucleic acid to recognize through hydrogen bond interactions the base sequence of another nucleic acid. Thus, in reading a double stranded DNA
sequence, a Third Strand Oligomer is able to recognize through hydrogen bond ir.te.actions the base pairs, in particular the purine bases, in the duplex of a segment of double stranded DNA.

9 ~ ~ PATENT

The term "triplet" refers to a situation such as that depicted in Figures lA, lB and 2A to 2D wherein a base in the Third Strand has hydrogen bonded (and thus base paired) with a ~Watson-Crick) base pair of a segment of double s~randed DNA.

BRIE:F DEBCRIPTION~ OF ~{B DRAWING8 Fig. lA and lB depict triplets wherein a pyrimidine base in the Third Strand forms a triplet with the duplex DNA
(Watson-Crick) base pair.
Fig. 2A to 2D depict triplets wherein a purine base in the Third Strand forms a triplet with the duplex DNA (Watson-Crick) base pair.
Fig. 3A to 3~ depict the base se~uences of exemplary polypurine sequence triple helix structures wherein the Third Strand "reads" and, thus, base pairs with purine bases on one strand of the double stranded DNA.
Fig. 4A to 4E depict the base sequences of exemplary mixed sequence triple helix structures wherein the Third Strand "reads" and, thus base pairs with purine bases on both strands of the double stranded DNA.
Fig. 5 depicts a nucleosidyl unit having a modified sugar moiety with an alkyleneoxy link for lengthening internucleoside phosphorus linkages and processes for its preparation.
Fig. 6 depicts a nucleosidyl unit having a modified sugar moiety with an alkylene link for lengthening internucleoside phosphorus linkages and processes for its synthesis.

2 ~
PATENT

Fig. 7 depicts CD spectra of triple helix structures, (-) depicts a MP-Oligomer Third Strand, t---) depicts an Oligonucleotide Third Strand.
Figs. 8A and 8B depict cross-linking of (A) single stranded DNA and (B) double stranded DNA using psoralen-derivatized MP-Oligomers.

DETAILED DE~CRIPTION OF THE_INVENTION
The present invention involves the formation of triple helix structures with a selected double stranded DNA sequence by contacting said DNA with an Oligomer which is sufficiently complementary to the purine sequence of the double stranded DNA
to form hydrogen bonds (or hybridize) therewith.

(A) General A~pects In addition to other aspects described herein, this invention includes the following aspects.
(I) A first aspect concerns the reading (or recognition) of the base pairs in the double stranded DNA segment without opening the base pair, through the hydrogen bond formation by the bases in the Third Strand with the extra hydrogen bond sites of purines in the double stranded DNA, such as adenine and guanine. In other words, the reading of the base pair sequence in the DNA

duplex is always done by reading the purine of the base pair, through hydrogen bond formation with the bases in the Third Strand, with the remaining available hydrogen bonding sites of the purines in the D~A. Either purines (such as adenine (A) or guanine (G)) or pyrimidines (th~nQ !T~ or cytosine (C)) in the 2~19156 PATENT

Third Strand can form hydrogen bonds with the purines in the DNA, .e.:
i) Adenine (A) in the base pair of DNA can be read or hydrogen bonded with A or T in ~he third strand.
ii) Guanine (G) in the base pair of DNA can be read or paired with C or G in the third strand.
In a pxeferred aspect of the present invention, the phosphorus-containing backbone of the Third Strand comprises methylphosphonate groups as well as naturally occurring phospho-diester groups.
(II) A second aspect of this invention is ~o read the purine (A or G) in the double stranded DNA totally by the use of purine bases from the Third Strand. In other words, this aspect of the present invention uses only G to read G in the base pairs in the DNA duplex, and similarly to use only ~ to read A in the base pairs in the DNA duplex. The polarity of the strands, either the anti-parallel or parallel direction of the Third Strand in respect to the strand containing the purine to be read in the duplex is important.
The base planes of the purines and pyrimidines are rigid, and the furanose ring only allows a small ripple (about 0.5~ above or below the plane). Thus, th~ conformational state of the nucleoside is defined principally by the rotation of these two more or less rigid planes, i.e. the base and the pentose, relative to each other about the axis of the C'-1 to N-~ or N 1 bond. The sugar-base torsion angle, ~, has been defined as "the angle formed by the trace of the plane of the base with the projection of the C-1' to 0-1l bond of th~ f-lr~nose ring when viewed along the C'-1 to a bond. This angle will b~ taken as 2 ~
PATENT

zero when the furanose-ring oxygen is an~iplanar to C-2 of the pyrimidine or purine ring and positive angles will be taken as those measured in a clockwise direction when viewing C-l' to N."
This angle has also been termed the glycosyl torsion angle.
Using the above definition, it was concluded that there were two ranges of ~CN for the nucleosides, about -30 for the anti conformation and a~out +150 for the syn conformation. The range for each conformation is about +45. (22, 22a) Other researchers have used or proposed slightly different definitions of this angle. (23,24,25,26,27) Information concerning ~CN has been obtained using procedures such as X-ray diffraction, proton magnetic resonance (PMR) and optical rotatory dispersion-circular dichroism (ORD-CD). (22a) In order to accommodate the change of location of the purine base to be read from one strand (termed the "Watson strand") to the opposite strand (termed the "Crick strand"), we have recognized that a particular conformation of the nucleoside, defined by the torsion angle of the glycosyl bond, of the puxine nucleosidyl unit in the Third Strand is required in order that the purine nucleoside in the Third Strand can be used to read the purine in the duplexO In other words, in order to read the purine bases in the DNA~ the conformations of the purine nucleo-sidyl units in the Third Strand are influenced by the polarity (parallel (5' to 3') or anti~parallel (3' to 5') direction) of the strand containing the purine bases to be read in the DNA in relation to the Third Strand. For the purine nucleosidyl units in the Third Strand, reading the purine in the parallel strand in the duplex, the conformation of the purine nuclecs d~ nit in the Third Strand should be in the ~Ya conformation. On the other 2 8 ~
PATENT

hand, the conformation of the purine nucleosidyl unit in the Third Strand in reading the corresponding purine in the anti-parallel strand in the duplex, should exist in anti conformation. Thus, in reading the purine bases in the duplex distributed in both strands, one has the choice of using a Third Strand which has the same polarity as (i.e. is parallel to) either one strand or the opposite strand. As an example, ~9~ ~

PATENT

5' 3' G C (these 2 strands are ¦ ¦ anti parallel to f G each other) T A

A T

3' 5' (Watson stxand) (Crick strand) The sequence of the Third Strand in the triplet with the DNA

duplex having the same polarity of the Watson strand from 5' to 3' would be as follows:

5, Gsyn anti I anti A~yn 3 ~ (the Third Strand parallel to the Watson strand) The sequence of a Third Strand parallel to the Crick strand would be as follows:
Ganti I syn lsyn A~nt i 5' (the Third Strand parallel to the Crick strand) According to one aspect of this invention, in constructing the Third Strand for reading the purines in the base pairs of the duplex, the following guidelines apply:
(i) Starting from the 5' end toward the 3' end, the purine nucleosidyl units (A or G) of the Third Strand need to be in syn confoxmation in reading the purines in the base pair (A or G) of 2 0 ~
PATENT

the parallel ("Watson") strand of the double stranded DNA. In reading the second purine in the second base pair, the same requirement applies if the purine is located in the same strand as the first purine. However, if the second purine is located in the opposite anti-parallel ("Crick") strand (now the opposite strand is anti-parallel to the Third Strand), the purine nucleo-sidyl unit needs to be in anti conformation. In all cases, adenine in the Third Strand is used to read adenine in the duplex and guanine in the Third Strand is used to read guanine in the duplex.
(ii) A third aspect of this invention concerns the length of the linkage of the phosphorus backbone of the Third Strand to allow reading of the purine bases on either strand of the double stranded DNA. In order to be able to "read" (or base pair) with purine bases on either strand, the distance between nucleosidyl units along the phosphorus backbone must be increased. Two examples of types of lengthening link formats for the phosphorus backbone are proposed. One type of link format for the phosphorus backbone would use a universal lengthening link on the individual nucleosidyl units, i.e. all the lengthening links of the Third Strand would be the same. Such a universal link format is particularly suitable for Third Strands comprising only purine bases. Accordingly, the length of the link between the 5' carbon of the "nucleosidyl unit one" to the 3' oxygen of the subsequent "nucleosidyl unit two" may be increased by two atoms (such as -CH2CH2-) or by 3 atoms (such as -O-CH2-CH2-), thereby lengthening the linkage between individual nucleosidyl units by 2 to 6A. In order to allow an appropriate distance between nucleosidyl units, we recommend that separation of ~-he units be increased by a 2 ~ 5 ~
PATENT
1~7/069 number of atoms ranging from 1 to 6. Figure 6 illustrates an example of a nucleosidyl unit comprising this lengthening link format and proposed synthetic routes.
A second lengthening link format for the phosphorus backbone would comprise non-uniform lengthening links. Links having internucleosidyl distances on the order o~ the standard phosphodiester backbone for the Third Strand would be employed when the purines being read were on the same strand, while a lengthened link ( ls-17A in length) which could comprise lengthening links on the 3' carbon of one nucleosidyl unit and on the 5'- carbon of its neighbor, would be employed to read the purine bases located on opposite strands. Such a non-uniform lengthening link format would be particularly suitable for use in Third Strands comprising both pyrimidine (or pyrimidine analog) and purine bases.

(8) Formation o~ ~ripl~ ~lix ~tru~tur~s ~1) Triplet ~or Triple-8tr~ded~_b~s~ pairin~

~) Pyri~ n~ in ?hird ~r~nd ~o~mi~ Tri~let In one aspect of the present invention, triplets are formed wherein a pyrimidine base in the Third Strand forms ~
hydrogen bonds and, thus, base pairs with the purine base of a base pair of the double stranded DNA sequence. Examples o~ such triplets where having a pyrimidine base as the base in the Third Strand are shown in Figures lA and lB.
Fig. lA depicts a triplet having T as the Third Strand base which forms hydrogen bonds and, thus, base pairs with the A

1~

2 ~ 6 PATENT

of the double stranded DNA. In such circumstances, the T of the Third Strand is aligned parallel to the A-containing strand of the double stranded DNA, and anti-parallel to the T-containing strand of the double stranded DNA (w~ich is also anti-parallel to the A-containing strand). Accordingly, the sequence for that triplet is written as follows:

~ A ~
~ .

Fig. lB depicts a triplet ha~ing a protonated cytosine (C+) as the Third Strand base which forms hydrogen bonds and, thus, base pairs with a G of a G-C base pair in the double stranded DNA. In such circumstance, the cytosine base in the Third Strand must be protonated at N3 in order to form hydrogen bonds necessary for a stable triplet. Optionally, a cytosine may be replaced with a cytosine analog having a quaternary nitrogen at a position analogous to N3. In the triplet depicted, the C+
(or its analog) of the Third Strand is aligned parallel to the G-containing strand of the double stranded DNA, and anti-parallel to the C-containing ~trand of the double stranded DNA (which is also anti-parallel to the G-containing strand). Accordingly, such a triplet sequence is written as follows:

~~~ r ~

PATENT

(b) Purin~ in Third 8tr~ Fo~in~ Triplet In another aspect of the present invention, triplets are formed wherein a purine base in the Third Strand forms hydrogen bonds with and, thus, base pairs with the same purine base in one strand of the double stranded DNA. Accordingly~ A
will pair with A and G will pair with ~.
In contrast to the pyrimidine Third Strand triplets, the purine base in the Third Strand is capable of base pairing with the purine base of double stranded DNA such that the strand polarity of the Third Strand containing the purine base may be aligned either parallel or anti-parallel to strand polarity of the strand containing the purine to be read in the double stranded DNA.
For example, Fig. 2A depicts a triplet where the A of the Third Strand is aligned parallel to the A of the double stranded DNA, and anti-parallel to tha T of the double stranded DNA. In such a circumstance, the glycosyl (C-N) torsion an~le of the Third Strand A is in the ~y~ conformation, and the glycosyl torsion angles of the A and T bases of the double stranded DNA
are both in the 3~i conformation. Such a triplet sequence is written as follows:

AA ~

2~ 6 PATENT

Alternatively, Fig. 2B depicts a triplet where the A o~
the Third Strand is aligned anti-parallel to the A of the double strandad DNA and parallel to the T of the double stranded DNA.
In such circumstance, the glycosyl torsion angles of all three bases are in the anti conformation. Such a triplet sequence is written as follows:

VA ~

PATENT

Fig. 2C depicts a triplet wherein the G of the Third Strand is aligned parallel to the G of the double stranded DNA, and anti-parallel to the C of the double stranded DNA. In such circumstance, the glycosyl torsion angle of the Third Strand G is in the svn conformation, and the glycosyl torsion angles of the G-C bases of the double stranded DNA are both in the anti conform~tion. Such a triplet sequence is written as follows:

r~ ' Fig. 2D depicts a triplet wherain the G of the Third Strand is aligned anti-parallel to the G of the double stranded DNA and parallel to the C of the double stranded DNA. In such circumstanca, the glycosyl torsion angles for all three bases ar.e in the an~i conformation. Such a triplet sequenc~ is written as ~ollows:

~r J ~A ~

` 20 2 ~
PATENT

~2) Polypuri~e 8eg~ces Where one strand of a selected double stranded DNA
sequence comprises a polypurine sequence, an Oligomer complement-ary to the polypurine sequence is used and may comprise a complementary sequence of pyrimidines or purines or a mixture thereof. Preferred Oligomers, include nonionic MP-Oligomers which are nuclease resistant and are capable of forming the previously-discussed triplet structures with the double stranded DNA.
Examples of triple stranded helix sequences wherein the Third Strand binds to a polypurine sequence in one strand of a double stranded DNA sequence are schematically depicted in Fig.
3A to 3~. In Figures 3A to 3~, C~ denotes a protonated C.

~3) Nixed Bequenaes Mixed sequences are sequences wherein the purine bases of the selected DNA sequence are located on both strands of the double stranded DNA sequence. Accordingly, the Third Strand Oligomer must be able to hydrogen bond and, thus, base pair with the purine base of each base pair of the double stranded DNA
sequence without regard to which strand of the double stranded DNA the purine base is located on. Accordingly, the Third Strand Oligomer must be able to "read" across the double stranded DNA.
Examples of mixed sequences including an appropriately complementary Third Strand are depicted in Fig. 4A to 4E.

Fig. 4A depicts a mixed sequence having a pyrimidine-rich Third Strand.
Fig. 4B depio~s a mix~d sequence having a purine-rich Third Strand.

2 ~
PATENT

Fig. 4C, 4D and 4E depict mixed sequences having Third Strands containing only purine bases. In Figures 4C to 4E, "S"
denotes syn and "a" denotes anti; no superscript denotes anti.
Where the Third Strand Oligomer must "read" across the double strand from one strand to the opposite strand in order to base pair with the purine base, it may be advantageous to provide a lengthened internucleosidyl phosphorus linkage by incorporation of the previously-described backbone link formats into the phosphorus backbone which connects the sugar moieties of the nucleosidyl units.
For example, an internucleosidyl linkage may be lengthened by the interposition of an appropriate alkylene ~- (CH2) n~) or alkyleneoxy (-tCH2) n~) lengthening link between the 5'-carbon and the 5' hydroxyl of the sugar moiety of a nucleosidyl unit or a similar link betwesn the 3'-carbon and the 3'-hydroxyl. tsee Figures S and 6). Where indicated, such lengthening links may be interposed at both the 3'- and 5'-cark~ns of the sugar moiety.
Where consecutive purines of the selected double stranded DNA sequence occur on the same strand, such lengthening links need not be employed; internucleosidyl phosphorus linkages such as methylphosphonate linkages allow an appropriate base on the Third Strand to read consecutive purine bases on one strand of the selected double stranded DNA sequence.
Accordingly, by employing such lengthening links where indicated, Oligomers which are capable of reading with the purine bases on both strands of a selected double stranded DNA sequence, may be prepared.

~ 2 ~
PATENT

(C) Third 8tra~d Oligomers Preferred are Oligomers having at least a~out 7 nucleosides, which is usually a sufficient number to allow for specific binding to a desired purine sequence of a segment of double stranded DNA. More preferred are Oligomers having from about 8 to about 40 nucleotides; especially preferred are Oligomers having from about 10 to about 25 nucleosides. Due to a combination of ease of synthesis, with specificity for a selected sequence, coupled with minimi2ation of intra-Oligomer, inter-nucleoside interactions such as folding and coiling, it is believed that Oligomers having from about 14 to about 18 nucleosides comprise a particularly preferred group.

~l) Preferred Oli~omers These Oligomers may comprise either ribosyl moieties or deoxyribosyl moieties or modifications thereof. However, due to their easier synthesis and increased stability, Oligomers com-prising deoxyribosyl or modified deoxyribosyl moieties are preferred.
Although nucleotide Oli~omers (i.e., having the phosphodiester internucleoside linkages present in natural nucleotide Oligomers, as well as other oligonucleotide analogs) may be used according to the present invention, preferred oligomers comprise oligonucleoside alkyl and arylphosphonate analogs, phosphorothioate oligonucleoside analogs, phosphoro-amidate analogs and neutral phosphate ester oligonucleotide analogs. However, especially preferred are oligonucleoside alkyl- and aryl-phosphonate analogs in wh ch phosphonate linkages replace one or more of the phosphodiester linkages which connect 2 ~
PATENT

two nucleosidyl units. The preparation of some such oligonucleo-sidyl alkyl and arylphosphonate analogs and their use to inhibit expression of preselected single stranded nucleic acid sequences is disclosed in U.S. Patent Nos. 4,469,863; 4,511,713; 4,757,055;

4,507,433; and 4,591,614, the disclosures of which are incorporated herein by reference. A particularly preferred class of these phosphonate analogs are methylphosphonate Oligomers.
Preferred synthetic methods for methylphosphate Oligomers ("MP-Oligomers") are described in Lee, B.L. et al.
Biochemistry 27:3197-3203 (1988) and Miller, P.S., et al., Biochemistry 25:5092-5097 (1986), the disclosures of which are incorporated herein by reference.
Preferred are oligonucleosidyl alkyl- and aryl-phosphonate analogs wherein at least one of the phosphodiester internucleoside linkages is replaced by a 3' - 5' linked internucleoside methylphosphonyl (~P~ group (or "methylphos-phonate"). The methylphosphonate linkage is isosteric with respect to the phosphate groups of oligonucle~tides. Thus, these methylphosphonate Oligomers ("MP-oligomers") should present minimal steric restrictions to interaction with the selected DNA
sequences. Also suitable are other alkyl or aryl phosphonate linkages wherein such alkyl or aryl groups do not sterically hinder the phosphonate linkage or interact with each other.
These MP-Oligomers should be more resistant to hydrolysis by various nuclease and esterase activities, since the methylphos-phonyl group is not found in naturally occurring nucleic acid molecules. Due to the nonionic nature of the methylphosphonate linkage, these MP-oligomers should be better able 'o cross cell membranes and thus be taken up by cells. It has been found that 2~9~
PATENT

certain MP-Oligomers are more resistant to nuclease hydrolysis, are taken up in intact form by mammalian cells in culture and can exert specific inhibitory effects cn cellular DNA and protein synthesis (See, e.g., U.S. Patent No, 4,469,~63).
Preferred are MP-Oligomers having at least about seven nucleosidyl units, more preferably at least about 8, which i5 usually sufficient to allow for specific recognition of the desired segment of double stranded DNA. More preferred are MP-Oligomers having from about 8 to about 40 nucleosides, especially preferred are those having from about 10 to about 25 nucleosidesO
Due to a combination of ease of preparation, with specificity for a selected sequence and minimization of intra-Oligomer, inter-nucleoside interactions such as folding and coiling, particularly preferred are MP-Oligomers of from about 14 to 18 nucleosides.
Especially preferred are MP-Oligomers where the 5'-internucleosidyl linkage is a phosphodiester linkage and the remainder of the internucleosidyl linkages are methylphosphonyl linkages. Having a phosphodiester linkage on the 5' - end of the MP-Oligomer permits kinase labelling and electrophoresis of the Oligomer and also improves its solubility.
The selected double stranded DNA sequences are sequenced and MP-Oligomers complementary to the purine sequence are prepared by the methods disclosed in the above noted patents and disclosed herein.
These Oligomers are useful in determining the presence or absence of a selected double stranded DNA sequence in a mixture of nucleic acids or in samples including isolated cells, tissue samples or bodily fluids.

20~ 9~
PATENT

The~e Oligomers are useful as hybridization assay probes and may be used in detection assays. When used as probes, these Oligomers may also be used in diagnostic kits.
If desired, labeling groups such as psoralen, chemiluminescent groups, cross-linking agents, intercalating agents such as acridine, or groups capable of cleaving the targeted portion of the viral nucleic acid such as molecular scissors like o-phenanthrolinecopper or ~DTA-iron may be incorporated in the MP-Oligomers.
These Oligomers may be labelled by any of several well known methods. Useful labels include radioisotopes as well as nonradioactive reporting groups. Isotopic labels include 3H, 35S, 32p, 12sI, Cobalt and 14C. Most methods of isotopic labelling involve the use of enzymes and include the known methods of nick translation, end labelling, second strand synthesis, and reverse transcription. When using radio-labelled probes, hybridization can be detected by autoradiography, scintillation counting, or gamma counting. The detection method selected will depend upon the hybridization conditions and the particular radioisotope used for labelling.
Non-isotopic materials can also be used for labelling, and may be introduced by the incorporation of modified nucleo-sides or nucleoside analogs through the use of enzymes or by chemical modification of the Oligomer, for example, by the use of non-nucleotide linker groups. Non-isotopic labels include fluor-escent molecules, chemiluminescent molecules, enzymes, cofactors, enzyme substrates, haptens or other ligands. One preferred labelling method includes incorporation of acridinium esters.

~91~6 PATENT

Such labelled Oligomers are particularly suited as hybridization a~say probes and for use in hybridization assays.
When used to prevent function or expression of a double stranded DNA sequence, these Oligomers may be advantageously derivatized or modified to incorporate a DNA modifying group which may be caused to react with said DNA and irreversibly modify its structure, thereby rendering it non-functional. Our co-pending patent application, U.S. Serial No. 924,~34, filed October 28, 1986, the disclosure of which is incorporated herein by reference, teaches the derivatization of Oligomers which comprise oligonucleoside alkyl and arylphosphonates and the use of such derivatized oligonucleoside alkyl and arylphosphonates to render targeted single stranded nucleic acid sequences non-functional.
A wide variety of DNA modifying groups may be used to derivatize these Oligomers. DNA modifying groups include groups which, after the derivatized Oligomer forms a triple helix stru ture with the double stranded DNA segment, may be caused to form a covalent linkage, cross-link, alkylate, cleave, degrade, or otherwise inactivate or destroy the DNA segment or a target sequence portion thereo~, and thereby irreversibly inhibit the function and/or expression of that DNA segment.
The location of the DNA modifying groups in the Oligomer may be varied and may depend on the particular DNA
modifying group employed and the targeted double stranded DNA
segment. Accordingly, the DN~ modifying group may be positioned at the end of the Oligomer or intermediate the ends. A plurality of DNA modifying groups may be included.

2 ~ 6 PATENT

In one preferred aspect, the DNA mod.fying group is photoreactable (e.g., activated by a particular wavelength, or range of wavelengths of light), so as to cause reaction and, thus/ cross-linking between the Oligomer and the double stranded DNA.
Exemplary of DNA modifying groups which may cause cross-linking are the psoralens, such as an aminomethyltrimathyl psoralen group (AMT). The AMT is advantageously photoreactable, and thus must be activated by exposure to particular wavelength light before cross-linking is effectuated. Other cross-linking groups which may or may not be photoreactable may be used to derivatize these Oligomers.
Alternatively, the DNA modifying groups may comprise an alkylating agent group which, on reaction, separates from the Oligomer and is covalently bonded to the DNA segment to render it inactive. Suitable alkylating agent groups are known in the chemical arts and include groups derived from alkyl halides, haloacetamides, phosphotriesters and the like.
DNA modifying groups which may be caused to cleave the DNA segment include transition metal chelating complexes such as ethylene diamine tetraacetate (EDTA) or a derivative thereof.
Other groups which may be used to effect cleaving include phenan-throline, porphyrin or bleomycin, and the like. When EDTA is used, iron may be advantageously tethered to the Oligomer to help generate the cleaving radicals. Although EDTA is a preferred DNA
cleaving group, other nitrogen containing materials, such as azo compounds or nitreens or other transition metal chelating complexes may be used.

20191~ PATENT
1~7/069 The nucleosidyl units of Third Strand Oligomers which read purine bases on both strands of a double stranded DNA
sequence may comprise a mixture of purine and pyrimidine bases or only purine bases.
Where purine bases on both strands of a double stranded DNl~ sequence are to be read, it is preferred to use Oligomers having only purine bases. It is believed that such purine-only Oligomers are advantageous for several reasons: (a) purines have higher stacking properties than pyrimidines, which would tend to increase stability of the triple helix structure; (b) use of purines only eliminates the need for either protonation of cytosine (so it has an available hydrogen for hydrogen bonding at the N-3 position at neutral pH) or use of a cytosine analog having such an available hydrogen at the position which corresponds to N3 on the pyrimidine ring; and allows use of a universal lengthening link.
The purine bases (and pyrimidine bases as well) are normally in the anti conformation; however, the barrier for a base to roll over to the syn conformation is low. In formation of the third triple helix, the purines on the Third Strand may assume the syn conformation during the hydrogen bonding process.
If desired, it is possible to modify the purine so that it is normally in the syn conformation. For example, the purine may be modified at the 8-position with a substitutent such as methyl, bromo, isopropyl or other bulky group so it will assume the syn configuration under normal condi~ions. Nucleosidyl units comprising su~h substituted purines would thus normally assume the syn conformation. Accordingly, where a purine base in the syn conformation is indicated, the present invention contemplates 2 ~1 915 6 PATENT

the optional incorpora~ion of such 8-substituted purines in place of unsubstituted A or G. Studies with our (Kendrew) models indicate that such substitutions should not affect ~ormation of the triple helix structure.
Use of purine nucleosidyl units in the anti and syn conformations~ as appropriate (following the rules for reading the double stranded DNA described herein) allows reading of the purines on both strands of the duplex and formation of a triple helix structure by the purine-only third strand with the double stranded DNA.
If a Third Strand Oligomer comprising both pyrimides and purines is used to read purines on both strandx of a double stranded DNA, a non-uniform link format is used as described herein to allow the third strand to read across from one strand of the duplex to the other, (2) Pro~er~ PY~n~ Ol~gQm~r~
The present invention provides a novel class of purine Oligomers which comprise nucleosidyl units selected from:

~~ I~-c~ C~B~ ~,J/~ c~

Q ~ R' o~ R

o~P\ R' \ ~o' \

W~ L~iii Bp is a purine base; R is independently selected from alkyl and aryl groups which do not sterically hinder the phosphonate linkage or interact with each other; R' is hydrogen, hydroxy or methoxy; and alk is alkylene of 2 to 6 carbon atoms or alkylene of 2 to 6 carbon atoms.
Preferred ara Oligomers which comprise at least about 7 nucleosidyl units.
Preferred are nucleosidyl units where R is methyl.
Also preferred are nucleosidyl units wherein R' is hydrogen.
Suitable bases Bp include adenine and guanine, either optionally substituted at the 8-position, preferred substitutions include methyl, bromo, isopropyl and the like. Preferred are alk groups having from about 2 to about 3 carbon atoms. Particularly preferred are alk groups having two carbon atoms, and include ethylene.

~3) Oligomer~ Co~pri~in~ Cyto~i~e ~nalog In another aspect of the present invention, novel Oligomers are provided which comprise nucleosidyl units wherein cytosine has been replaced by a cytosine analo~ comprising a heterocycle which has an available hydrogen at the ring position analogous to the 3-N of the cytosine ring and is capable of forming two hydrogen bonds with a guanine base at neutral pH and thus does not re~uire protonation as does cytosine for Hoogstein-type base pairing, or formation of a triplet.
Suitable nucleosidyl units comprise analogs having a six-membered heterocyclic ring which has a hydrogen available for hydrogen bonding at the ring position corresponding to N-3 o~
cytosine and which is capable of forming two hydrogen bonds with a guani ne haS~a at neutral pH and include 2'-deoxy-5,6-dihydro-5-azadeoxycytidine (I), pseudoisocytidine (II), 6-amino-3~ D-2 ~ 6 PATENT

ribofuranosyl)pyrimidine-2,4-dionP (III) and 1-amino-1,2,4-(~-D-deoxyribofuranosyl)triazine-3-[4H]-one (IV), the structures of which are set forth in Table 5.

(D) Praparation o~ NP-Oli~omers ~1) In General As noted previously, the preparation of methylphos-phonate oligomers has been described in U.S. Patent Nos.
4,469,863; 4,507,433; 4,511,713; 4,591,S14 and 4,757,055.
Preferred synthetic methods ~or methylphosphonate Oligomers are described in Lin, S., et al., Biochemistry 28:1054-1061 (1989); Lee, B.L., et al., Biochemistry 27:3197-3203 (1988) and Miller, P.S., et al., 25:5092-5097 (1986), the disclosures of which are incorporated herein by reference. Oligomers comprising nucleosidyl units which comprise modi~ied sugar moieties having lengthening links (see Figures 5 and 6~ may be conveniently prepared by these methods.
Oligomers comprising phosphodiester internucleosidyl phosphorus linkages may be synthesized using any of several conventional methods, including automated solid phase chemical synthesis using cyanoethylphosphoroamidite precursors ~29).
If desired, the previously-described nucleosidyl units comprising cytosine analogs (see Table 5) may be incorporated into the MP-Oligomer by substituting the appropriate cytidine analog (see Table 5) in the reaction mixture.

~91~6 PATENT

~2) Preparation ~P-Oli~omers ~vi~q Lengtheni~ k~ in the Phosphoru~ Backbo~e ~a) 5 ' (~thylen~ -8ub~tituted-8u~ar Inlterm3diatas MP-Oligomers may be prepared using modified nucleosides where either the bond between the 5'-carbon and the 5'-hydroxyl or the 3'-carbon and the 3'-hydroxyl of the sugar moiety has been substituted with a alkyleneoxy group, such as ethyleneoxy group.
Figure 5 shows proposed reaction schemes for preparation of intermediates for modified nucleosides having either a 3'-(ethyleneoxy) or 5~-(ethyleneoxy) link. In Figure 5, B represents a base, Tr and R represent protecting groups, Tr depicting a protecting group such as dimethoxytrityl and R
depicting protecting groups such as t-butyldimethyl silyl or tetrahydropyranyl.
If desired, nucleosidyl units having such lengthening links at both the 3'- and 5'- positions of the sugar moiety may be p~epared.

~b) 5'~ y~ro~y~thyl-8~bstitut~ 8ugar Intermodiata In situations where a double stranded DNA sequence which has purine bases on both strands is to be read, it may be preferred to use ~P-Oligomers having a slightly lengthened internucleoside link on the phosphorus backbone.
Such MP-Oligomers may be prepared using nucleosides in which the sugar (deoxyribosyl or ribosyl) moiety has been modified to replace the 5'-hydroxy with a ~-hydroxyethyl (HO-CH2-CH2-) group synthetic sch~me~ _o. the preparation of such a 5'-~-hydroxyathyl-substituted nucleosides is depicted in Figure 6.

PATENT

Figure 6 depicts a proposed reaction scheme for a 5'-~-hydroxyethyl-substituted sugar analog. In Figure 6, DCC denotes dicyclohexylcarbodiimide, DMSO denotes dimethylsulfoxide. B is a base. Suitable protecting groups, R, includ~ t-butyldimethyl silyl and tetrahydropyranyl.

(c) Prep~r~tion o~ ~2~01iqomers ~aving Lon~then~dinq Int~rnu~lsoside Li~ks in the_Phosphoru~ Backbone MP-Oligomers incorporating the above-described modified nucleosidyl units are prepared as described above, substituting the modified nucleosidyl unit.
In the preparation of Oligomers comprising only purine bases, use of nucleosidyl units having the same lenthening links may be employed. However, in the preparation of Oligomers comprising both pyrimidine (or pyrimidine analog) bases and purine bases, a mixture of nucleosidyl units having no lengthening link and lengthening links are used; nucleosidyl units having lengthening links at both the 3' carbon and the 5'-carbon of the sugar moiety may be advantageous.

~3) Preparation of Dorivatize~ NP-Oligomer3 Derivatized Oligomers may be readily prepared by adding the desired DNA modifying groups to the Oligomer. As noted, the number of nucleosidyl units in the Oligomer and the position of the DNA modifying group(s) in the Oligomer may be varied. The DNA modifying group(s) may be positioned in the Oligomer where it will most effectively modify the target sequence of the DN~.
Accordingly, the positioning of the ~ modifying group may depend, in large measure, on the DNA segment involved and its key 2~191~6 PATENT
187/o~9 target site or sites, although such optimum position can be readily determined by conventional techniques known to those skilled in the art.

(a) Preparation o~ P30ral~n-Deri~atized ~P-Oli~omer~
The derivatization of MP-Oligomers with psoralens, 5uch as 8-methoxypsoralen and 4'-aminomethyltrimethylpsoralen (AMT), is described in Kean, J.M. et al., Biochemistry 27:9113-9121 (1988) and Lee, B.L. et al., Biochemistry 27:3197-3~03 (1988), the disclosures of which are incorporated herein by reference.

~b) Preparation o~ ED~A-D~riv~ti~ed MP-Oli~o~er~
The derivatization of MP-Oligomers with EDTA is described in Lin, S.B., et al., Biochemistry 28:1054-1061 (1989), the disclosures of which are incorporated herein by reference.

~E) Utility According to the present invention, a specific segment of double stranded DNA may be detected or recognized using an MP-Oligomer Third Strand which reads the purine bases of the duplex of the double-stranded DNA according to the triplet base pairing guidelines described herein. The MP-Oligomer Third Strand has a sequence selected such that the base of each nucleosidyl unit will form a triplet with a corresponding base pair oP the duplex DNA to give a triple helix structure. Detectably labeled Oligomers may be used as probes for use in hybridization assays, for example, to detect the presence of a par~icular double-stranded DNA sequence.

2 ~
PATENT

The present in~ention also provides a method of preventing expression or function of a selected sequence in double stranded DNA by use of an MP-Oligomer which reads the DNA
sequence and forms a triple helix structure. Formation of the triple helix may prevent expression andtor function by modes such as preventing opening of the duplex for transcription, preventing of binding of effector molecules (such as proteins), etc.
Derivatized Oligomers may be used to detect or locate and then irreversibly modify at target site in the DNA duplex by cross-linking (psoralens) or cleaving one or both strands (EDTA). By careful selection of a target site for cleavage, the Oligomer may be used as a molecular scissors to specifically excise a selected DNA sequence.
The Oligomers may be derivatized to incorporate a DNA
reacting or modifying group which can be caused to react with the DNA segment or a target sequence thereof to irreversibly modify, degrade or destroy the DNA and ~hus irreversibly inhibit its functions.
Thus, these Oligomers may be used to irreversibly inactivate or inhibit a particular gene or target sequence of the game in a living cell, allowing selective inactivation or inhibition. These Oligomers could then be used to permanently inactivate, turn off or destroy genes which produced defective or undesired products or if activated caused undesirable effects.
Another aspect of the pres~nt invention is directed to a kit for detecting a particular double stranded DNA sequence which comprises a detectably labeled purine MP-Oligomer Third Strand selected to be able sufficiently complementai^y tc the 2 0~ 1 5 6 PATENT

purine sequence to be able to read the sequence and form a triple helix structure.
To assist in understanding the present invention, the following examples are included which describe the results of a series of experiments, including computer simulations. The following examples relating to this invention should not, of course, be construed in specifically limiting the invention and such variations of the invention, now known or later developed, which would be within the purview of one skilled in the art, are considered to fall within the scope of the present invention as hereinafter claimed.

B$aNP~B~

~LaMP~ 1 CO~SPUTER QIMULA~I!I0~8 OF TRIPLZ!: ~BI-I~ 8TRUCTlJR158 The primary purpose of these computer simulations was to determine whether nonionic nucleotide analogs with a methyl-phosphonate ("MP") backbone would bind with greater affinity in comparison with unmodified oligodeoxynucleotides ("ODN") as the Third Strand of the triple-stranded helical DNA through Hoogsteen-type base pairing. Experimental work suggested that ODN binding to duplex DNA and inhibition of transcription could be via triplet formation (8), but no experimental comparison had been made between analogs with MP backbone verses native ODN in formation of the triple-stranded DNA helix. It was previously unknown whether a nonionic analog with MP backbone could be accommodated in the major groove of triple-stranded helical DNA.
Furthermore, the conformation of fully solvated triple-stranded 2 ~
PATENT

helical DNA with native or MP backbone in the third strand had not been determined. Site-specific oligonucleotide binding via double and triple stranded DNA complex formation has recently been shown to suppress transcription of human oncogenes in vitro (8, 9). The goal of this example was to use molecular dynamics simulation to investigate nonionic oligonucleotide analogs with MP backbone in triple-stranded helical complexes, and to gain insiqht into the molecular mechanism(s) involved in this process.

(A) 8imulætion ~ethod~
Triple-stranded poly(dT~ poly(dA~0)-poly(dT10) [T1AT2]
coordinates were obtained from the A-DNA x-ray structure of Arnott and Selsing (10). The same coordinates were used for the starting geometry of poly(dT10)-poly (dA10)-poly(dT10) methylphos-phonate [T1AT~MP]. Geometry optimization and partial atomic charge assignments for the dimethyl ester methylphosphonate frag-ment were calculatad by ab initio quantum mechanical methods with QUES_ (version 1.1) using 3-21G* and STOG* basis sets, respectively (11). The latter basis set was used to maintain uniform charge assiqnments with those previously calculated for nucleic acids in the AMBER database. The final monopole atomic charge assignments for the MP fragment were made to obtain a neutral net charge for each base, furanose, and MP backbone of the third DNA strand. Alternating Rp and Sp methyl substitution of the backbone phosphoryl oxygens of the T2MP strand was done by stereo computer graphics. The substitution of MP diastereomers was made in this manner to approximate experimental yield, since the synthesis cannot be controlled. Molecular mechaniss and molecular dynamics calculations were made with a fully vectorized 2 ~
PATENT

version of AMBER (version 3.1), using an all-atom force field (12, 13). All calculations w~re performed on CRAY X-MP/24 and VAX 8600 computers.
The negative charge of the DNA phosphate backbone was rendered neutral by placement of positive counterions within 4 A
of the phosphorus atoms bisecting the phosph~te oxyyens;
counterions were not placed on the MP-substituted strand. The triple helices and counterions were surrounded by a 10A shell of TIP3P water (14) molecules with periodic boundary conditions.
There are 9,283 and 10,824 atoms in the TlAT2 and TlAT~MP systems, respectively. The box dimensions were 101, 686.8 A3 for T1AT2, and 124,321.1 A3 for T1AT~MP. Initially, the DNA and counterion atoms were fully constrained while the surrounding water mole-cules wers energy minimized using an 8.0 A nonbonded cutoff until convergence (root mean-square [rms] of the gradient <0.1 kcal/mole/A). The DNA, counterions, and water were subsequentl~
energy minimized without geometric constraints for an additional 1500 cycles, followed by 220 cycles of minimization with SHAKE
activated (15). Molecular dynamics using SHAKE at constant temperature and pressure (300K and l bar) was carried out without constraints for 40 psec trajectories for each of the two molecular ensembles.

~B) Re~ult~ of 8i~ulation 8tu~ies The third DNA strand with MP backbone resulted in several changes consistent with enhanced binding of the ODN with the MP backbone in the triple helix. The average hydrogen bond distances and mean atomic fluctuations are consistently smaller in the TlAT~MP triplet (~able 1) The interstrand phosphorus atoms 3g 2 0 1 91 ~ ~ PATENT

distance was 9.6A [+/-O.sl) for A T2 and 8.3A (+/-0.58) for A-T2MP. The reduced interstrand phosphorus atom distance and smaller mean atomic fluctuations between the second and third strands are due to decreased interstrand electrostatic repulsion accompanying MP substitution in the backbone.
Both triple helical DNA systems had strand-specific polymorphic conformational behavior during molecular dynamics.
There are significant conformational changes in the ~uranose relative to the starting geometry in both systems lTable 2). In the T1AT2 helix the furanose ring populations of the T1 and T2 strands remained predominantly in an A-DNA conformation (C3'endo) and the largest proportion of the adenlne sugars adopted a B-DNA
conformation (C2'endo). A notable percentage of the adenine furanose conformations were in an Ol'endo conformation in T~AT2 and TlATzMP~ The sugar puckering pattern of the MP substituted helix had a greater proportion of Ol'endo and C2'endo con~orma-tions in contrast to the unsubstituted helix. Analysis of other conformational parameters support the hybrid conformational nature of these triple helices. The helical twist angle (between Tl and A strands) averaged 39.~ degrees (~\-2.86) for the T~AT2 structure and is more consistent with a 8-DNA conformation (range 36-45). The TlATzMP helical twist angle averages 32.0 degrees (+\-2.19) and is closer to that of A-DNA (range 30-32~7~o The average helical repeat singles (between the Tl and A strands) for the entire structure are for 10. 2 T1ATz and 11. 2 degrees for TlATzMP. The average intrastrand phosphorus atom distances over the 40 psec trajectory are presented in Table 3. In both helices, the intrastrand phosphorus distances of the Tl strands are most consistent with an A-DNA conformation (7.0 A). The 2 0 ~ 91 ~ 6 PATENT

interstrand phosphorus distances of the T2MP strand are more consistent with a B-DNA conformation, in contrast to values more consistent with A-DNA for the T2 strand.
We analyzed the coordination of counterions and water along the backbone of the DNA to determine the chang s accompany-ing MP substitution. The average coordination distance and atomic fluctuations-of the counterions with phosphorus atoms was 3.8A (+\-0.6) for TlAT2 and 4.6A (+\-0.9) for the TlAT~MP helix.
The increase in average coordination distance and atomic motion in T1AT2MP (by 0.8A) is most likely due to the proximity of Rp (axial projecting) methyl groups to the counterions coordinated to the second strand. The average number of water molecules coordinated to the phosphate groups is not significantly altered in the MP substituted helix.
The DNA backbone and the C1'-N (base) dihedral transitions of the two helical systems are shown in Table 4.
Comparisons of the -dihedral of the adenine strands reveals a sliqht change in the average position of the dihedral with MP
substitution, positioning the dihedral closer to trans, but there is a large ovarlap in the transitional motions of both dihedrals during the 40 psec trajectory. There was a significant change (by 27.0 degrees~ in the average Sp-MP diastereomer ~ dihedral angle from baseline. The fluctuation of the ~ dihedral contain-ing the Sp-MP diastereomer was significantly less than the Rp-MP.

2 0191~ 6 PATENT

~C) Intorprat~tion_of 8i~ul~tion Rs3ult~
The results of these molecular dynamics calculations predict that an MP-substituted ODN incorporated as a colinear third strand with Hoogsteen pairing will form a more stable triple helical complex than a native ODN as the third strand, as in the case of poly(dT)poly(dA)poly(dT). The enhanced binding of the MP strand is due to reduced interstrand electrostatic re~ulsion. The MP-substituted helix has reduced hydrogen bond distances, decreased interstrand A-T2 phosphorus distances, and less fluctuation in atomic position relative to the native triple helix. The closer fit and reduced atomic motion during molecular dynamics ars qualitatively consistent with a greater enthalpy of binding and stability o~ the MP-substituted triple helical complex. These findings support the MP-substitution of the third strand facilitates formation of a more cohesive triple helical structure by decreased interstrand phosphate repulsion, and will secondarily have closer approximation of Hoogsteen and Watson-Crick hydrogen bond interactions. One would expect predominant effects on Hoogsteen pairin~, but there is an unexpected enhancement of Watson-Crick hydrogen bonding with MP substitution in these calculations. The latter finding is most likely due to decreased electrostatic repulsion and shielding (by the third strand) between the T1 and T~MP strands.
The conformation of these DNA structures differs from experimental data based on the fiber diagram. The structure of poly(dT)poly(dA)-poly(dT) was determined by x-ray diffraction studies under conditions of 92~ humidity, and is a low resolution ~uc~ure (10). The molecular dynamics simulations are of fully solvated DNA structures under periodic boundary conditions with 2~ 5 6 PATENT

counterions. DNA in solution i5 generally believed to predomi-nate in the B-form; A-DNA conformation predominates under conditions of lower humidity (16). Several triple-stranded ~NA
helical structures have been determined by x-ray diffraction studies and have been uniformly observed in an A-DNA conformation under conditions of low humidity and increased salt concentration (10,17,18). These computer simulations predict that different DNA conformations coexist within the triple helix, that the individual strands of the helices have predominant conformational populations, and that a Hoogsteen-paired, MP-substituted DNA
strand is predicted to predominate in the B-form. The large proportion of 01' endo sugars in both triplexes is of interest since this furanose conformation is 0.6 kcal/mole higher than C2' endo and C3, endo DNA sugar puckers (16). The DNA dodecamer crystal structure (19) has a notable 01' endo population, and a significant proportion of 01' endo sugar puckers were observed in molecular dynamics simulations of dsDNA by Seibel et al. (20) Both helical structures generally follow the classical observa-tions of purine nucleotides adopting C2' endo geometries and pyrimidines adopting C3~ endo geometries.
The large perturbation of the ~ dihedral and variable conformational fluctuation of the Fp and Sp MP diastereoisomers in the triplet are due to nonbonded and hydrophobic interactions.
The Sp-MP groups are in close proximity to thymine methyl groups (in the major groove) on the same DNA strand, and interact by Van der Waals forces, which could locally destabilize the helix by "locking" the thymine to the Sp~MP backbone. There are greater deviations in tha ~ dihedral of the Rp-MP groups, since thase -~ 43 2~ 3 ~
PATENT

groups project out into the solvent water and are positioned farther away from the thymine methyl groups. There is a known relationship between the orientation of the methyl substituent on the phosphorus atom and DNA duplex s~ability, and a proposed mechanism of reduced stability of Sp-MP diastereomers is due to local steric interactions (21). Our calculations suggest that steric interactions contribute very little toward local helix destabilization, and the predominant mechanism is mediated by non-bonded interactions between the methyl groups of the Sp-MP
backbone and thymine on the same strand which locally destabilizes the DNA.

E$AMPL~ 2 DBTECTION OF ~RIPL~ B LI~ FORMATION U8ING
CIRC~AR DIC~ROI8~ 8PEC~RO8COPY
Circular dichroism spectroscopy studies were performed using Triple Helix Structures formed using a combination following nucleoside oligomers.
I: d(CTCTCTCTCTCTCTCT) abbreviated d(CT)8 E2s4 = 9.2 x 104 M1 cm II: d(AGAGAGAGAGAGAGAG) abbreviated d(AG) 8 E254 = 1.45 x 105 Ml cm1 III: d(CpT~C~T~C~T~C~T~C~T~C~T~C~T~C T~) abbreviated d(C~T) 8 E254 = 8.5 x 104 M1 Cml Circular dic~ ism (CD) spectra for the triple helix structures made with (a) 2:1 d(CT)8 ~ d(AG)8 and (b) 1:1:1 d(CT)8 2 ~
PATENT

d(AG)8 ~ d(C~T~)8 were performed using a CD spectropolarimeter in 0.lM phosphate buffer at the indicated pH.
Figure 7 shows the CD spectra for triple helix (a) [2:1 d(CT)8 o d(AG)8 ( _ ] and ~b) [1:1:1 d(CT)8 ~ d(AG)8 ~

d(CT)8( ,) ] -CRO88LIN~ING OF TRIPLE HELIX ~TRUCTUR~S U~ING
P80RALEN~DERIVATIZ D ~IP-OLIGOMER~
Psoralen derivatized dTp(T) 6 oligomers were prepared as described in Lee, B.L., et al., Biochemistry 27:3197-3203 (1988).
The T7 oligomers were allowed to hybridize with DNA
having the following sequence including a 15-mer p~ly A
subsequence:

5' 10 20 30 40 3' d- TAATACGACTCACTATAGGGAGATTTTTTTTTTTTTTTACGAGCT

d- ATTATGCTGAGTGATATCCCTCTAAAAAAA~AAAA~ATGCTCGA
3' 5' MP-oligomers derivatized with 4'-(aminoethyl)amino-methyl-4,5',8-trianethyl-psoralen ["(ae)AMT"], 4'-(aminobutyl)-aminomethyl-4,5',8-trimethylpsoralen ["(ab)AMT"] and 4'-(amino-hexyl)aminomethyl-4,5'-8-trimethylpsoralen ["(ah)AMT"] were allowed to hybridize with (a) single stranded DNA of the above DNA sequences and (b) double stranded DNA of the above sequence at 4C and were irradiated to cause crosslinkiny as described in Lee, et al.
Results are depicted in Figures 8A and 8B. Figure 8A
shows crosslinking of the psoralen derivatized T7 Oligomers with the single stranded (poly A con'~ining) DNA sequence.

2 0 ~
PATENT

Figure 8B shows crosslinking o~ the double stranded DNA
with the double stranded DNA sequence.

2 0 ~ PATENT

T~BLB 1 AVERAGED HYDROGEN BOND DI8TANCE8 ~R~8) . ~AT8QN CRICR WIT~OUT N~ WI~H MP
ADE HN6B - THY 04 2.33 (+/-0.31) 1.98 (+/-0-15) ADE Nl - THY H3 2.10 (+/-0.17) 1.95 (+/-0-13) ~OOG8TEBN
ADE HN6A - THY 04 2.12 (+/-0.22) 2.09 (+/-0.19) ADE N7 - THY H3 1.94 (+/-0.16) 1.92 (+/-0.12) Averaged Watson - Crick and Hoogsteen hydrogen bond distances (in Angstroms) in T~AT2 and T1AT~MP helices. These distances are calculated for the triple helical DNA complexes.
The fluctuation in atomic position (calculated as the root~mean-square [rms]) are in (~).

2 ~

~ Q) ~.
E~ ~

¦ o~o ~ 0~ ~o oO do~ ~ J
- ... ..- E~
O O ~ O O O O
O O
~ o~O o~O o~O o\O o\O o\O ~
Z ~ O ~ ~
O _ ~D ~ O~ ~
F~ U~ h q~
,~, ~ o~ o~ d~ o`~
C~ _ ~ S~
P
O
N ~ O d~ d~ oh d~ o~
P3C~ GO ~r1 1~ N O

Z~ o ~ co r~
O ~, o ~ ~ -~ ~ ~ o ~
C)PZ ~ ~ ~t~ J
+l +l +l +l +l 11 0 ~ la _ W _ U
P3 ~ q~ M
o 3 o u) t~ o ~ ~
4 ~ o ~t o o ,a O
W _ ~ ~ __ _ _ U O O OO O o _ O OO O O S-l tq q-l W _ +l +l +l +l +l +l a~ ~ o --`~ O

~i ~ ~ U
I
I ~ ~ ~o I ~ ~ ~ ~ - ~ ~ 2 , ... ... ~ ., ooo ooo ~ ~

o .~ .,, 2 01~ 6 PATENT

TABhB 3 ~VERAGE INTR~8TRAND P~08P~AT~ ATO~ DI8~C~ ~RM~) STRAND ~I~OU~ ~P WIT~ ~P
Tl 6.5 (+/0.28) 6.2 (+/0-31) A 7.0 (+/0.26) 7.1 (+/0.24) T2 6.3 (+/0.29) 6.8 (+/0.26) Intrastrand phosphate distances of TlAT2 and T1AT~MP helices. The calculated intrastrand phosphate distances (in Angstroms) aver-aged over the 40 psec trajectory are shown for the entire triple helical systems. Standard interstrand phosphorus distances are 6.0A for A-DNA and 7.0A for B-DNA (15).

2~ 9~5 ~ PATENT

TABL~3 ~
Wit~out MP With MP
~ 03' - P - 05' - C5' T1 280~5 (18.5) 288.4 (11.3) A 252.9 (28.7) 233.2 (28.5) T2 285.1 (11.6) 288.5 (11.3) P - 05' - C5' - C4' T1 161.2 (11.5) 168.7 (8.7) A 151.5 (10.7) 159.3 (21.5) T2 140.8 (8.8) POR158.8 (21.9) POS167.8 (8.7 Y 05' ~ Cs~ - C4~ - C3 Tl 70.6 (14.6) 62.6 ( 9.3) A 104.8 (27.9) 112.3 (25.5) T2 67.2 (10.5) 64.0 (10.4) ~ C5' - C4' - C3' - 03' T1 90.3 (12-8) 82.5 (11.1) A 112.5 (16.7) 111.6 (17.2) T2 88.6 (10.4) 104.5 (16.5) ~ C4' - C3' - 03' - P
T1 196.4 (10.1) 199.1 (10-6) A 200.1 (10.9) 198.0 (13.3) T2 197.5 (10.5) 187.9 ( 7-8) C3' - 03' - P - 05' Tl 290.8 (10.6) 290.6 ( 9-6) A 282.9 (12.0) 282.0 (18.5) T2 285.0 (10.5) 280.5 (11.4) PUR 01' - C1~ - N9 - C4 ADE 215.3 (14.7) 212.1 (14.2) PYR
T1 212.3 (11.0) 205.9 (10.0) T2 206.3 (10.7) 213.9 (13.2) Average backbone dihedral angles (rms) for the triple helical DNA
structures during the 40 psec trajectory 2 ~ 6 PATENT

TABL~ 5 CYT~DINB ANA~OG~
Structure Reference tPreparation) ~a I l Goddard, A.~., et al., ~`~ Tetrahedron Letters 29:1767 t l988 ) J Beisler, et al., J. Med. Chem.
20:806 (1977) ~0 \1 /
I
~0 ~2.
Doboszawske, B., et al., J.
org. Chem 53:2777 (1988);
~ ~ Woodcock, T.~., et al., Cancer I O Res. 40:4234 tl980~;
\ Burchenal, J.H., qt al., / Cancer Res. 36:1520 (1976) ~0 t2.

¦ Winkley, M.W., et al., J.
Che~. Soc. (c), p. 791 (1969) ~o a~

~I L
.~: ~ From 1,2,4-triazine-3(4H) o~e ~ (by reaction ~ith ammonium O ~ ~ ~ chloride or by (a) nitro-sating ~ollow~d by (b) ~o- treatment with sodium borohydride)

Claims

1. A method of detecting or recognizing a specific segment of double-stranded DNA without interrupting the base pairing of the duplex which comprises contacting said DNA segment with an Oligomer having at least about seven nucleosidyl units which is sufficiently complementary to said DNA segment or a portion thereof, to form a triple helix structure.

2. A method according to claim 1 wherein said Oligomer comprises a methylphosphonate Oligomer.

3. A method according to claim 2 wherein said Oligomer comprises only purine bases.

4. A method according to claim 3 wherein a guanine or substituted guanine of the Oligomer is used to read guanine in one of the strands of the double standed DNA and adenine or substituted adenine is used to read adenine in one of the strands of the double stranded DNA.

5. A method according to claim 4 wherein a guanine nucleosidyl unit or a substituted guanine nucleosidyl unit of the Oligomer in the syn conformation is used to read guanine in the parallel strand in the double stranded DNA and a guanine nucleosidyl unit or a substituted guanine nucleosidyl unit of the Oligomer in the anti conformation is used to read guanine in the antiparallel strand of the double stranded DNA; and wherein an PATENT

adenine nucleosidyl unit or a substituted adenine nucleosidyl unit of the Oligomer in the syn conformation is used to read adenine in the parallel strand of the double stranded DNA and an adenine nucleosidyl unit or a substituted adenine nucleosidyl unit of the Oligomer in the anti conformation is used to read adenine in the antiparallel strand of the double stranded DNA.

6. A method according to claim 2 wherein said Oligomer comprises modified nucleosidyl units having a modified deoxyribosyl analog moiety of the formula:

wherein B comprises a purine or pyrimidine base and alk is alkylene of 2 to 6 carbon atoms or alkyleneoxy of 2 to 6 carbon atoms.

7. A method according to claim 6 wherein said Oligomer comprises only purine bases.

8. A method according to Claim 2 wherein said Oligomer comprises purine bases and pyrimidine bases.

PATENT

9. A method according to Claim 8 wherein said Oligomer has nuclsosidyl units in which a cytosine analog replaces cytosine and wherein said cytosine analog comprises a 6-membered heterocyclic ring which has a hydrogen available for hydrogen bonding at the ring position which corresponds to N-3 of cytosine and which is capable of forming two hydrogen bonds with a guanine base at neutral pH.

10. A method according to Claim 9 wherein said cytosine analog is 5,6,-dihydro-5-azacytosine, pseudoisocytosine;

6-amino-3-pyrimidine-2,4-dione; or 1-amino 1,2,4-triazine-3[4H]-one.

11. A method according to claim 2,3,8 or 9 wherein said Oligomer comprises a modified sugar moiety selected from the following:

, > and wherein alk is alkylene of 2 to 6 carbon atoms or alkyleneoxy of 2 to 6 carbon atoms, and R' is hydrogen, hydroxy or methoxy.

12. A method of preventing expression or function of a specific segment of double-stranded DNA having a given sequence PATENT

of each of the two strands in the complementary DNA duplex which comprises contacting said DNA segment with an Oligomer having at least about seven nucleosidyl units which is sufficiently complementary to said DNA segment, or a portion thereof, to form a triple helix structure.

13. A method according to Claim 12 wherein said Oligomer comprises only purine bases.

14. A method according to claim 13 wherein a guanine or substituted guanine of the Oligomer is used to read guanine in one of the strands of the DNA duplex and adenine or substituted adenine is used to read adenine in one of the strands of the DNA
duplex.

15. A method according to claim 14 wherein a guanine nucleosidyl unit or a substituted guanine nucleosidyl unit of the Oligomer in the syn conformation is used to read guanine in the parallel strand in the DNA duplex and a guanine nucleosidyl unit or a substituted guanine nucleosidyl unit of the Oligomer in the anti conformation is used to read guanine in the antiparallel strand of the DNA duplex; and wherein an adenine nucleosidyl unit or a substituted adenine nucleosidyl unit of the Oligomer in the syn conformation is used to read adenine in the parallel strand of the DNA duplex and an adenine nucleosidyl unit or a substituted adenine nucleosidyl unit of the Oligomer in the anti conformation is used to read adenine in the antiparallel strand of the DNA duplex.

PATENT

16. A method according to Claim 12 wherein said Oligomer has nucleosidyl units in which a cytosine analog replaces cytosine and wherein said cytosine analog comprises a 6-membered heterocyclic ring which has a hydrogen available for hydrogen bonding at the ring position which corresponds to N-3 of cytosine and which is capable of forming two hydrogen bonds with a guanine base at neutral pH.

17. A method according to claim 16 wherein said cytosine analog is 5,6-dihydro-5-azacytosine, psuedoisocytosine;
6-amino-3-pyrimidine-2,4-dione; or 1-amino-1, 2, 4-triazine-3 [4H] -one

18. A method according to Claim 12 wherein said nucleosidyl units are connected by a phosphodiester group or an alkyl or aryl phosphonate group.

19. A method according to claims 18 wherein said nucleosidyl units comprise a modified sugar moiety selected from the following:

PATENT

wherein alk is alkylene of 2 to 6 carbon atoms or alkyleneoxy of 2 to 6 carbon atoms and R' is hydrogen, hydroxy or methoxy.

20. A method according to claim 12 wherein said Oligomer is modified to include a DNA modifying group which may be caused to react with said DNA and irreversibly modify the structure of said DNA.

21. A method according to Claim 15 wherein said Oligomer includes a DNA modifying group which can be caused to react with said DNA segment or a target sequence therein and irreversibly modify said DNA and thereby irreversibly inhibit the expression or function of said DNA segment.

22. A method according to claim 21 wherein said modification comprises covalently linking of the Oligomer with one strand of the DNA or crosslinking said DNA.

23. A method according to Claim 21 wherein said modification comprises cleaving said DNA.

24. A method according to Claim 21 wherein said DNA
segment comprises a gene in a living cell and formation of said triple helix structure permanently inhibits or inactivates said gene.

25. A triple helix structure which comprises a selected double stranded DNA sequence and an alkyl or aryl phosphonate Oligomer which is sufficiently complementary to read PATENT

the purine sequence of said double stranded DNA and thus form triplets.

26. A structure according to claim 25 wherein a guanine or substituted guanine of the Oligomer is used to read guanine in one of the strands of the double standed DNA and adenine or substituted adenine is used to read adenine in one of the strands of the double stranded DNA.

27. A structure according to claim 26 wherein a guanine nucleosidyl unit or a substituted guanine nucleosidyl unit of the Oligomer in the syn conformation is used to read guanine in the parallel strand in the double stranded DNA and a guanine nucleosidyl unit or a substituted guanine nucleosidyl unit of the Oligomer in the anti conformation is used to read guanine in the antiparallel strand of the double stranded DNA;
and wherein an adenine nucleosidyl unit or a substituted adenine nucleosidyl unit of the Oligomer in the syn conformation is used to read adenine in the parallel strand of the double stranded DNA
and an adenine nucleosidyl unit or a substituted adenine nucleosidyl unit of the Oligomer in the anti conformation is used to read adenine in the antiparallel strand of the double stranded DNA.

28. An Oligomer which comprises at least about seven interconnected nucleosidyl units selected from:

PATENT

, ,and wherein Bp is a purine base; R is independently selected from alkyl and aryl groups which do not sterically hinder the phosphonate linkage or interact with each other; R' is hydrogen, hydroxy or methoxy; and alk is alkylene of 2 to 6 carbon atoms or alkyleneoxy of 2 to 6 carbon atoms.

29. An Oligomer according to claim 28 which comprises a methylphosphonate Oligomer.

30 . An Oligomer capable of reading purine bases in a double stranded DNA sequence which comprises nucleosidyl units in which cytosine is replaced with a heterocyclic cytosine analog having an available hydrogen for hydrogen bonding at the ring position which corresponds to N-3 of the pyrimidine ring and which is capable of forming two hydrogen bonds with a guanine base at neutral pH.

31. An Oligomer according to Claim 30 wherein said nucleosidyl unit is selected from 2'-deoxy-5,6-dihydro-5-aza-deoxycytidine; pseudocytidine; 6-amino-3-(.beta.-D-ribofuranosyl)-pyrimidine-2,4-dione and 1-amino-1,2,4-(.beta.-D-deoxyfuranosyl) triazine-3[4H]-one.

PATENT

32. An Oligomer according to Claim 31 which comprises a methylphosphonate Oligomer.

33. An Oligomer capable of reading purine bases in a segment of double stranded DNA which comprises at least about seven nucleosidyl units connected by internucleosidyl phosphorus linkages wherein at least one nucleosidyl unit is selected from , and wherein B is a base, R' is hydrogen, hydroxy or methoxy, alk is independently alkylene of 2 to 6 carbon atoms or alkyleneoxy of 2 to 6 carbon atoms and alk' is alkyleneoxy of 2 to 6 carbon atoms.

34. An Oligomer according to claim 33 which comprises only purine bases.

35. An Oligomer according to claim 34 wherein a guanine or substituted guanine of the Oligomer is used to read guanine in one of the strands of the double standed DNA and an adenine or substituted adenine is used to read adenine in one of the strands of the double stranded DNA.

36. An Oligomer according to claim 35 wherein a guanine nucleosidyl unit or a substituted guanine nucleosidyl PATENT

unit of the Oligomer in the syn conformation is used to read guanine in the parallel strand in the double stranded DNA and a guanine nucleosidyl unit or a substituted guanine nucleosidyl unit of the Oligomer in the anti conformation is used to read guanine in the antiparallel strand of the double stranded DNA;
and wherein an adenine nucleosidyl unit or a substituted adenine nucleosidyl unit of the Oligomer in the syn conformation is used to read adenine in the parallel strand of the double stranded DNA
and an adenine nucleosidyl unit or a substituted adenine nucleosidyl unit of the Oligomer in the anti conformation is used to read adenine in the antiparallel strand of the double stranded DNA.

37. An Oligomer according to claim 33 wherein said internucleosidyl phosphorus linkages are alkyl or aryl phosphonate internucleosidyl linkages or phosphodiester internucleosidyl linkages.

38. An Oligomer according to claim 37 which comprises only purine bases.

39. An Oligomer according to claim 38 wherein a guanine or substituted guanine of the Oligomer is used to read guanine in one of the strands of the double standed DNA and adenine or substituted adenine is used to read adenine in one of the strands of the double stranded DNA.

40. An Oligomer according to claim 39 wherein a guanine nucleosidyl unit or a substituted guanine nucleosidyl PATENT

unit of the Oligomer in the syn conformation is used to read guanine in the parallel strand in the double stranded DNA and a guanine nucleosidyl unit or a substituted guanine nucleosidyl unit of the Oligomer in the anti conformation is used to read guanine in the antiparallel strand of the double stranded DNA;
and wherein an adenine nucleosidyl unit or a substituted adenine nucleosidyl unit of the Oligomer in the syn conformation is used to read adenine in the parallel strand of the double stranded DNA
and an adenine nucleosidyl unit or a substituted adenine nucleosidyl unit of the Oligomer in the anti conformation is used to read adenine in the antiparallel strand of the double stranded DNA.

41. An Oligomer according to claim 40 comprising nucleosidyl units of the formula:

42. An Oligomer according to claim 41 wherein R' is hydrogen.

43. An Oligomer according to claim 41 wherein alk is ethylene or ethyleneoxy.

44. An Oligomer according to claim 43 wherein alk is ethylene.