CA2006813C - Purified ciliary neurotrophic factor - Google Patents

Abstract

The present invention relates to neurotrophic factors, ciliary neurotrophic factor (CNTF) in particular, as well as methods of purifying CNTF and producing recombinant CNTF. A purified single protein species ciliary neurotrophic factor (CNTF), particularly sciatic nerve ciliary neurotrophic factor (SN-CNTF), having a specific activity increase to greater than 25,000-fold from crude form is produced by recombinant DNA methods including, but not limited to, the steps of acid treatment, chromatofocusing, SDS-PAGE gel and reverse phase-HPLC.
Said purification is useful in that it provides probes that facilitate the screening of cDNA and genomic libraries in order to clone genes encoding CNTF. The present invention also provides nucleic acid and corresponding amino acid sequences for CNTF.

Description

The present invention relates to neurotrophic factors and ciliary neurotrophic. factor (CNTF) in particular, as well as methods of purifying CNTF and producing recombinant CNTF.

Severe mental and physical disabilities result from the death of nerve or glial cells in the nervous system. The death of nerve or glial cells can be caused by neurodegenerative diseases such as Alzheimer's and Parkinson's diseases and multiple sclerosis, by ;,the ischemia resulting from stroke, by a traumatic injury, or by the natural aging process.

Neurotrophic factors are a class of molecules that promote '!the survival and functional activity of nerve or glial cells.
;!Evidence exists to suggest that neurotrophic factors will be i;;useful as treatments to prevent nerve or glial cell death or malfunction resulting from the conditions enumerated above.
,!Appel, 1981, Aan. Neurolovv 10:499.

The best characterized of such neurotrophic factors is nerve ',growth factor (NGF). NGF has been demonstrated to be a neurotrophic f'actor for the forebrain cholinergic nerve cells that die during Alzheimer's disease and with increasing age. The loss of these nerve cells is generally considered responsible for many !Iof the cognitive deficits associated with Alzheimer's disease and with advanced age.

Experiments in animals demonstrate that NGF prevents the death of forebrain cholinergic nerve cells after traumatic injury 00C) 8 13 and that NGF can reverse cognitive losses that occur with aging.
!Hefti and Weir.Ler, 1S186, Ann. Neuroloay 20:275; Fischer et al, 1'1987, Nature, 329:65. These results suggest the potential clinical utility in humans of this neurotrophic factor in the treatment of c:ogniti.ve losses resulting from the death of forebrain cholinergic nerve cells through disease, injury or aging.

A complication of the use of neurotrophic factors is their specificity for only those subpopulations of nerve cells which ,possess the correct membrane receptors. Most nerve cells in the body lack NGP receptors and are apparently unresponsive to this neurotrophic f'actor. It is, therefore, of critical importance to discover new neurotrophic factors that can support the survival of ,different type:s of rierve or glial cells than does NGF.

New neurotrophic factors have been searched for by their ,,ability to support the survival in culture of nerve cells that are not responsive to NGF. One widely used screening assay is designed to di.scover factors that promote the survival of ciliary ganglionic motor neurons that innervate skeletal and smooth muscle. These ciliary ganglionic nerve cells belong to the parasympathetic nenrous system and their survival is not supported by NGF.

The presence of factors which promote the survival of ciliary ganglionic nei:ve cells have been reported from a variety of tissues and species.. Many of these ciliary ganglionic neurotrophic activities have the following similar chemical and biological properties: (1) the activity is present in high concentration in sciatic nerves; (2) the neurotrophic activity Isurvives exposure to the ionic detergent sodium dodecyl sulfate !(SDS) and to the reducing agents beta-mercaptoethanol (BME) or dithiothreitol (DTT) during electrophoresis on SDS polyacrylamide ~reducing gels; and (3) on such gels the activity migrates with an ,;apparent molecular weight between 24-28 kd. Collins, 1985, ,Develoomental BioloQy, 109:255-258; Manthorpe et al., 1986, Brain Research, 367:282-286.

ii Based on these similar properties, it has been proposed that the same or closely related molecules, typically referred to as "ciliary neurotrophic factor" or "CNTF", are responsible for the ciliary ganglionic neurotrophic activities. Thus, the term CNTF
is an operational definition referring to agents with the above properties that promiote the survival of ciliary ganglionic nerve cells in culture. Wlithout sufficient data to establish that the proteins responsible for these activities are identical, CNTFs ,will be distinguished by their tissue and species of origin.
',Thus, if the species of origin is rabbit, the nomenclature is rabbit sciatic nervei CNTF (rabbit SN-CNTF).

Sciatic nerve CNTF is apparently found in highest concentration in peripheral nerves, such as the sciatic nerve. It ilis released from cells in the nerve upon injury. SN-CNTF supports the survival and grc-wth of all peripheral nervous system nerve cells tested, includling sensory, sympathetic, and parasympathetic nerve cells. Thus, SN-CNTF has a broader range of responsive ~
~006S13 nerve cells than does NGF. A rat SN-CNTF has recently been shown to regulate the formmation of specific types of glial cells in the central nervous system (Hughes et al., 1988, Nature 335:70).

The most reasonable hypothesis based on the evidence cited ,above is that sciatic nerve CNTF is a component of the response of the nervous system to injury. SN-CNTF released from cells in a damaged nerve would be expected to promote the survival and .regrowth of in.jured nerve cells and regulate the functional activation of glial cells necessary for regeneration. These considerations indicate that SN-CNTF would have therapeutic value in reducing damage to the nervous system caused by disease or injury.

Despite widespread scientific interest in SN-CNTF, the difficulty of purifying substantial amounts from natural sources and the unavailability of human SN-CNTF have hampered attempts to demonstrate it:s value in sustaining the viability of nerve cells during disease or af'.ter injury. Prior attempts to purify a rat SN-CNTF has re:sultecl in an 800-fold enrichment over crude nerve extract in teizas of specific activity. Manthorpe et al., 1986, Brain ResearcYi 367:282-286.

However, an eic~ht hundred-fold increase in specific activity i;was insufficient to produce a single protein species. Therefore, the product showing increased activity obtained from the method described by Manthorpe et al. is insufficient as it includes multiple protein species. It would be desirable to achieve a purification of SN-CNTF such that a single protein species is obtained with the appropriate biological activity. Once a single protein species is obtairied, sequencing data obtained will be more accurate. By "single protein species," as that term is used hereaft:er .Ln this specification and the appended claims, is meant a polypeptide or series of polypeptides with the same amino acid sequence throughout their active sites. In other words, if the operative portion off the amino acid sequence is the same between two or more polypeptides, they are "a single protein speci_es" as defined herein even if there are minor heterogeneities with respect to length or charge.

SUMMARY OF INVENTION

An object of an aspect of the present. invention is to provide an improved method of purifying SN-CNTF.
Another object of an aspect of the present invention is to provide a SN-CNTF purified to an extent greater than ever achieved before, such that a single protein species is obtained.

Yet another object of an aspect of the present invention is to provide probes whi+.h facilitate screening of cDNA and genomic libraries in oa-der to clone the animal and human geries encoding SN-CNTF.

Another object of an aspect of: an aspect of the invention is to provide the nuclelc: acid and corresponding amino acid sequerices for.- animal and human CNTF.

Another object of an aspect of the invention is to provide recombinant expression systems in which the nucleic acid sequence for humarl or animal CNTF can be used to produce human or animal CNTF protein.

These and other objects are achieved by providing a method of purifying SN--CNTF such that specific activity is increased greater thari 25,000-fold frorn crude extract to purified SN-CNTF. The SN-CNZ'F purified greater than 25,000-fold is also provided.

According to other preferred features of certain preferred embodiments of the present .invention, SN-CNTF
probes are provided for screening cDNA and genomic libraries for SN CNTF.

According to other preferred features of certain preferred embodiments of the present inverition, rabbit and human amino acid and nucleic acid CNTF sequences are provided.

According to other preferred features of certain preferred embodiments of the present inverrtion, a recombinant expression system is provided to produce biologically active aninral or humar-i CNTF.

According to other advantageaus features of certain preferred embodiments of the present invention, a process of purifying SN-CNTF is provided which includes the steps of acid treatment, ammonium sulfate fractionation, chromatofocussing, running the preparatior.i on SDS-Page gel and reverse phase-HPLC.

According to other preferred features of certain preferred embodiment.s of the preserrt i.nverItion, additional purificat:ion steps are providecl in which hydrophobic interaction chromatography is used immediately before and after chrorlatofocussing.

According tc> orre aspect of the irivent ion, there is provided a substantially purified protein sciatic nerve ciliary neurotrophic: factor (SN-CNTF)which has a specific activity of more than 25,000 times great than the specific activity of the natural sciatic nerve extract, a molecular weight of 25,000 daltons on SDS--PAGE, an activity greater than 2 x 108 Trophic Units per mg and an amino acid sequence selected from the group of human or rabbit sequence of Figure 12 or a homologue thereof in which substitutions, deletions and additions may be made without affecting biological activity, wherein said factor has activity.

According to another aspect of the irivention, there is provided a substantially purified protein human sciatic nerve ciliary neurotrophic factor (SN-CNTF) which is a protein comprising the amino acid sequence selected from the group of human or rabbit sequence of Figure 12 or a homologue thereof in whicxl substitutions, deletions and additions may be made without affectirig biological activity, wherein said factor is characterized by (a) a molecular weight of about 25,000 daltons on SDS-PAGE;

(b) a specific activity of: greater than 2 x 108 Trophic Units per mg; and (c) resistance of the biological activity to SDS and reducing agents.

According to a further aspect of: the invention, there is provided a substantially purified protein sciatic nerve ciliary neurotrophic factor (SN-CNTF) which is a protein comprising the amino acid sequence selected from the group of human or rabbit sequence of Figure 12 or a homologue thereof in which substitutions, deletions and additions may be made without affecting biological activity, wherein said factor is comprised of a single protein species.

According to another aspect of the invention, there is provided a nucleic acid sequence encoding human ciliary neurotrophic factor (CNTF) selected from the 6a group of human or rabbit sequence of Figure 12 or the complement thereof.

According to a further aspect of the invention, there is provided an amino acid sequence comprising the amino acid sequence of human ciliary neurotrophic factor (CNTF) selected from the group of human or rabbit sequence of Figure :12.

According to another aspect of the irivention, there is provided a recombinarit: animal cell expression system for producing biologically active ciliary neurotrophic factor (CNTF) which is a protein comprisirig the amino acid sequence selected from the group of human or rabbit sequence of Figure :L2 or a homologue thereof in which substitutions, deletions and addit_Lons may be made without affecting biological activity.

According to a further aspect.- of the invention, there is provided a bacterial cell. expression system for producing biologically active ciliary neurotrophic factor (CNTF) which is a protein comprisirig the amino acid sequence selected from the group of_ human or rabbit sequence of Figure 12 or a homologue thereof in which substitutions, deletions and additions may be made without affecting biological activity.

According to ariother aspect of: the ir.rvention, there is provided a recombinant DNA method for the production of active ciliary neurotrophic factor (CNTF) comprising:

(a) culturing eukaryotic or prokaryotic host cells transformed with a vector comprising a DNA sequence having at least 80% homology with the sequence selected irom the group of human or rabbit of Figure 12, to produce a protein having CNTF activity under conditions appropriate to the expression of CNTF;

6b (b) harvesting CNTF; and (c) permitting CNTF to assume an active tertiary structure whereby it possesses CNTF
activity.
According to a further aspect of the invention, there is provided a substantially purified recombinant ciliary neurotrophic factor (CNTF) which is a protein comprising the amino acid sequence selected from the group of human or rabbit sequence of Figure 12 or a homologue thereof in which substitutions, deletions and additions may be made without affecting biological activity.
According to another aspect of the invention, there is provided a nucleic acid sequence encoding sciatic nerve ciliary neurotrophic factor (SN-CNTF) selected from the group of human or rabbit sequence of Figure 12 and nucleic acid sequences which hybridize under stringent conditions or but for the genetic code would hybridize under stringent conditions to the complement of said nucleic acid sequence and encode a polypeptide having CNTF biological activity.
According to a further aspect of the invention, there is provided a SN-CNTF polypeptide having the amino acid sequence selected from the group of human or rabbit sequence of Figure 12.
According to another aspect of the invention, there is provided a polypeptide of any one of claims 27, 28 or 29, wherein the polypeptide has an activity of greater than 2 x 108 TU/mg.
According to an aspect of the present invention, there is provided a substantially purified protein sciatic nerve ciliary neurotrophic factor (SN-CNTF) which has a specific activity of more than 25,000 times greater than the specific activity of the natural sciatic nerve extract, a molecular weight of 25,000 daltons on SDS-PAGE, an activity greater 6c than 2 x 108 Trophic Units per mg and the amino acid sequence of human SN-CNTF shown in Figure 12 or a homologue thereof having at least 80% identity.
According to another aspect of the present invention, there is provided a substantially purified protein human sciatic nerve ciliary neurotrophic factor (SN-CNTF) which is a protein comprising the amino acid sequence of Figure 12 or a homologue thereof having at least 80% identity, wherein said factor is characterized by (a) a molecular weight of about 25,000 daltons on SDS-PAGE;
(b) a specific activity of greater than 2 x 108 Trophic Units per mg; and (c) resistance to SDS and reducing agents.
According to another aspect of the present invention, there is provided substantially purified protein human sciatic nerve ciliary neurotrophic factor (SN-CNTF) which is a protein comprising the amino acid sequence shown in Figure 12 or a homologue thereof having at least 80%
identity and a SN-CNTF biological activity, wherein said factor is comprised of a single protein species.
According to another aspect of the present invention, there is provided a nucleic acid sequence encoding human ciliary neurotrophic factor (CNTF) shown in Figure 12 or the complement thereof.
According to another aspect of the present invention, there is provided an amino acid sequence comprising the amino acid sequence of human ciliary neurotrophic factor (CNTF) shown in Figure 12.
According to another aspect of the present invention, there is provided a recombinant animal cell expression system for producing biologically active human ciliary 6d neurotrophic factor (CNTF) which is a protein comprising the amino acid sequence shown in Figure 12 or a homologue thereof having at least 80% identity.
According to an aspect of the present invention, there is provided a bacterial cell expression system for producing biologically active human ciliary neurotrophic factor (CNTF) which is a protein comprising the amino acid sequence shown in Figure 12 or a homologue thereof having at least 80% identity.
According to another aspect of the present invention, there is provided a recombinant DNA method for the production of active human ciliary neurotrophic factor (CNTF) comprising:
(a) culturing eukaryotic or prokaryotic host cells transformed with a vector comprising a DNA
sequence having at least 80% identity with the human sequence of Figure 12, to produce a protein having CNTF activity under conditions appropriate to the expression of CNTF;
(b) harvesting CNTF; and (c) permitting CNTF to assume an active tertiary structure whereby it possesses CNTF activity.
According to another aspect of the present invention, there is provided a substantially purified recombinant ciliary neurotrophic factor (CNTF) which is a protein comprising the amino acid sequence selected from the group of human or rabbit sequence of Figure 12 or a homologue thereof having at least 80% identity and a CNTF biological activity.
According to another aspect of the present invention, there is provided a nucleic acid sequence encoding human sciatic nerve ciliary neurotrophic factor (SN-CNTF) shown in Figure 12 and nucleic acid sequences which hybridize 6e under stringent conditions or but for the degeneracy of the genetic code would hybridize under stringent conditions to the complement of said nucleic acid sequence and encode a polypeptide having CNTF biological activity.
According to another aspect of the present invention, there is provided a sciatic nerve ciliary neurotrophic factor (SN-CNTF) polypeptide having the amino acid sequence of the human sequence of Figure 12.
It is to be understood that both the foregoing general description and the following detailed description are exemplary and explonatory only, and are not restrictive of the invention, as 6f claimed. The accompanying drawings, which are incorporated in andi constitute a part of' the specification, illustrate various embodiments of the invention and, together with the description, serve to explain the: principles of the invention.

BRIEF DESCRIPTION OF THE DRAWINGS

Figure 1 depicts exemplary results of chromatography on a Mono P column;

Figure 2 depicts an exemplary plot of the distribution of neurotrophic activit:y in the elute from each of the seven strips cut from the SDS-Page gel after electrophoresis;

Figure 3 depicts exemplary results of reverse phase chromatography;

Figure 4 depicts exemplary results of a silver stained reducing SDS-Page gel run on fractions equivalent to those adjacent to and including the peak of neurotrophic activity shown in Figure 3;

Figure 5 depicts a profile of eluted peptides after digestion with endoprotease Asp-N; and Figure 6 depicts a profile of eluted peptides after digestion ;l,with endoprotease Lys-C.

Figure 7 depicts exemplary results of chromatography of the !ammonium sulfate fresction on a phenyl Sepharose HIC column.
Figure 8 depicts exemplary results of chromatography of the Mono-P chromatofocussed fraction on a alkyl-Superose FPLC-HIC
column.

Figure 9 depicts exemplary results of chromatography of the preparative SDS-PAGE: fraction on a C8 reverse-phase HPLC column.
iPanel (A) illustrates the results of the original purification ii i!procedure. Panel (B) illustrates the results of the current puri-~I'fication procedure after addition of the two HIC chromatography steps.

Figure i0 depicts exemplary results of SDS-PAGE and Western blot analysis of the reverse-phase purified SN-CNTF. Lane 1 in each of the two panels contains molecular weight standard proteins ;1(SIGMA SDS-7)., Lane 2 contains purified SN-CNTF. Panel (A) !iillustrates the results.of silver-staining. Panel (B) illustrates the results of Western blot analysis with affinity-purified anti-peptide-A antibody.

Figure 17, depicts the nucleic acid sequence encoding for !rabbit SN-CNTF. Translation of this nucleic acid sequence gives the corresponciing amino acid sequence printed underneath in single -letter code. Sequeiices that are underlined were confirmed by the amino acid sequence obtained from the SN-CNTF protein.

Figure 12 depicts the nucleic acid and corresponding amino acid sequence (three letter code) for the coding sequence for ihuman CNTF. The human sequences are between the lines. Where the rabbit nucleic: acid or amino acid sequences differ from the human, they are written above and below the lines, respectively.

Figure 1:3 depicts the construction of the pCMVXVPL2 expression vector.

2oos81.3 Figure 14 depicts the methods used to construct CNTF-Synl/3 for expression of CN'TF. The drawing is representative and not to Jjscale. See Example 7 for experimental details.
I!
Figure 15 depicts the methods used to construct CNTF-Syn2/3 ,for expression. of CNITF. The drawing is representative and not to scale. See Example 7 for experimental details.

Figure 16 depicts synthetic oligonucleotides 1 through 4 used in construction of C:NTF-Synl/3 and CNTF-Syn2/3.

Figure 17 depicts synthetic oligonucleotides 5 through 10 used in construction of CNTF-Syn2/3.

Figure 18 depicts certain features of the pT5T bacterial expression vector ccintaining a DNA insert suitable for expression of CNTF. The drawing is representative and not to scale. See Example 7 for experimental details.

Figure 19 depicts certain features of the pT3XI-2 bacterial expression vector containing a DNA insert suitable for expression of CNTF. The drawing is representative and not to scale. See Example 7 for experimental details.

Figure 20 depicts a reducing SDS polyacrylamide gel in which liextracts of cells transformed with various expression constructs were electrophoresecl and stained with Coomassie Brilliant Blue.

Fiqure 21. depicts a reducing SDS polyacrylamide gel in which ~extracts of cells transformed with various expression constructs were electrophoreseci and immunoblotted with affinity-purified anti-CNTF peptide A antibody.

Figure 2:2 depicts the bioassay of serial dilutions of supernatants from bacterial cells expressing pT5T:CNTF-Synl/3 or pT3XI-2:CNTF-Syn2/3. The inset depicts the bioassay of extracted slices from a reducing SDS polyacrylamide gel of the ,pT5T:CNTF-Syn:l/3 supernatant in the region of the gel immediately above and below 24 l{D.

DESCRIPTION OF THE PREFERRED EMBODIMENTS
ReferencE: will now be made in detail to the presently preferred embodimen1ts of the invention which, together with the ;;following examples, serve to explain the principles of the invention.

As noted above, the present invention relates to an SN CNTF
!;that is purified at least 25,000-fold from crude extract. This SN-CNTF is a sinc~le protein species as that term is defined herein.
As a single,protein species, the amino acid sequence of the SN-CNTF may be determined and used to design DNA probes for obtaining ,genomic or cDNA clones for use in recombinant production of SN-CNTF.

The amino acid sequence of the single protein species of SN-CNTF has been partially determined. That sequence is:

I - R S D L T A- L T E S -Y - V K H Q G L N K N

P G
I D G V V - MAG

K L W G L K

Additional amino acid sequence has been determined from purified rabbit SN-1CNTF which is given in Example 2. This additional sequence allows some of the amino acid sequence given above to be located within a single large peptide (Example 2).
This single peptide sequence has been used to generate three i,degenerate oligonucleotide probes (#'s 1, 13, and 7 in Example 4) ';that are very useful, for priming the polymerase chain reaction, since their position. relative to each other is known.

The nucleic acid (mRNA equivalent) sequences encoding rabbit and human CNTF' have been determined and are given in Figures 11 jand 12.

A recombinant siystem for transiently expressing biologically active CNTF has been developed and is described in Example 5.

In addition, the present invention relates to an improved method of purifying SN-CNTF. While the present invention is related to SN-CNTF f'rom any source, the description which follows 'will address that isolated from rabbits.

Briefly, one preferred embodiment of the present method includes pulveirizing rabbit sciatic nerve material. The crude extract is thein centrifuged. The supernatant is acidified and the !resulting precipitate is removed by centrifugation. The supernatant is then titrated with NaOH and the resulting precipitate is agair.L removed by centrifugation.

After pH precipitations, saturated ammonium sulfate solution is added to the supe:rnatant and the precipitant is removed by centrifugation. With the further addition of ammonium sulfate to the supernatant, a precipitation of protein fraction containing most of the SN-CNTF activity results.

The above preparation is then loaded onto a Mono P
chromatofocussing F]PLC column. Column fractions are then collected and analyzed for pH and CNTF activity. The fractions indicated by a bar in Fig. 1 with peak SN-CNTF activity is then further treated as will be discussed in detail below.

The focu:3ed fractions from multiple runs over the Mono P
column are electroplnoresed on SDS polyacrylamide slab gel. A
region of the gel corresponding to molecular weights between 22 and 27 kd is cut across the width of the gel into multiple strips.
The individual strips are cut into smaller pieces and proteins are eluted electrophore=tically. Eluted proteins are collected, and "'the fraction with tlhe highest activity is further purified using .reverse-phase HPLC. This process is described in more detail in the Examples which follow.

In addition, the present invention relates to additional steps that cain be inserted into the purification procedure given ;above in order to allow more starting material to be processed conveniently. In a preferred embodiment of these additional steps, hydrophobic interaction chromatography on phenyl-Sepharose .jis inserted between amaaonium sulfate fractionation and i l,chromatofocussing, while hydrophobic interaction chromatography on an FPLC alkyl-Superose column is inserted between !'chromatofocussing and preparative SDS-PAGE (Example 1).

The method provided by the present invention has resulted in SN-CNTF in a purified form with a greater than 25,000-fold increase in specific activity from the crude extract. Further, the final prociuct produced is a single protein species. This represents an increase of greater than 30-fold over the SN-CNTF, +which includes multiLple protein species, reported as purified in Manthoroe et zil. discussed above. Since SN-CNTF is partially inactivated ori reverse phase HPLC, the calculation of at least .25,000-fold purification according to the present invention !represents a minimurn purification, and the actual purification may be even 100,000-folci or greater. This increased purification will facilitate the determination of the amino acid sequence of SN-iCNTF. According to the present invention, sufficient amino acid !sequence has already been obtained to generate oligonucleotide .probes that w9L11 facilitate screening of cDNA and genomic i'libraries in order to clone the animal and human genes coding for SN-CNTF.

The methods provided by the present invention have resulted in the determination of the coding (mRNA equivalent) sequence for rabbit and human CN'.rF.

As will be discussed in greater detail below, these genes will in turn raake possible large-scale production of (1) animal '!SN-CNTF suitable for studies of its ability to treat animal models of nerdous system damage, and (2) human SN-CNTF suitable for inclusion in pharmaceutical formulations useful in treating damage ;'to the human nervous system.

The methods provided by the present invention have resulted in the produc1tion of biologically active animal CNTF in a recombinant expression system.

With these purified proteins, the amino acid sequence of the promin nt peptides can be determined. The proteins are first !treated with endoprotease Asp-N, endoprotease Lys-C, endoprotease i'Glu-C, or chymotrypsin. After digestion, the amino acid sequence of prominent peptides can be determined using an Applied Biosystems gas phase protein sequencer.

Antibodies that react with purified SN-CNTF can be used for screening expression libraries in order to obtain the gene which encodes SN-CNTF. Synthetic peptides can be synthesized which correspond to regions of the sequence of SN-CNTF using an Applied Biosystems automated protein synthesizer. Such peptides can be used to prepare the antibodies. Antibodies to synthetic peptides have been produced and shown to react with purified CNTF by Western blot analysis (Fig. 10).

From the work above, an ultimate goal is to clone and express the human SN-CNTF gene in order to prepare material suitable for use in human pharmaceutical preparations. Once the genomic sequence is known, genes encoding SN-CNTF can then be expressed in animal or bacterial cells. The rabbit and human gene sequences ,encoding CNTF have been determined. A transient expression system iifor producing biologically active CNTF has been developed.

A recombinant DNA method for the manufacture of CNTF is now disclosed. In one embodiment of the invention, the active site functions in a manner biologically equivalent to that of the native CNTF isolated. from human. A natural or synthetic DNA

2{}0GS13 sequence may be used to direct production of the CNTF. This method comprises:

(a) Preparation of a DNA sequence capable of directing a host cell to produce a protein having CNTF
activity;
~
(b) Cloning the DNA sequence into a vector capable of being transferred into and replicated in a host cell, such vector containing operational elements needed to express the DNA sequence;

(c) Transferring the vector containing the synthetic DNA sequence and operational elements into a host cell capable of' expressing the DNA encoding CNTF;

(d) Culturing the host cells under conditions appropriate for amplification of the vector and expression of CNTF;
(e) Harvesting the CNTF; and (f) Permitting the CNTF to assume an active tertiary structure whereby it possesses CNTF
activity.

In one embodiment, a partially or wholly synthetic DNA
sequence used for production of recombinant CNTF may contain ldifferent nucleotides than the native DNA sequence. In a !
preferred embc-diment:, the DNA sequence with different nucleotides will still encode a polypeptide with the same primary structure as CNTF encoded by aninaal or human CNTF genes. In an alternate preferred embodiment, the DNA sequence with different nucleotides will encode a polype:ptide with a primary structure related to natural CNTF and which has at least one of the biological activities of the CNTF described herein.

In one embodiment of the present invention, the native DNA
,isequence encoding CNTF is modified to promote expression in a host ;',organism or cell. Such modifications may include the following:

(a) If the native DNA sequence is genomic DNA, the removal of intervening, non-coding sequences (introns) may be employed when expression in microorganisms is contemplated.
(b) Alte:ring the nucleic acid sequence to include sequences recognized by various restriction enzymes for ease of subsequent steps of ligation, cloning, and mutagenesis.

(c) Altering the nucleic acid sequence to create codons preferrecl by the host organism or cell used to produce the recombinant protein.

(d) Linking the nucleic acid sequences to operational elements necessary to maintain and express the DNA in a host organism or ceal.

In one enabodiment of the present invention, the DNA sequence to be expressed is prepared as discussed above and inserted into !an expression vectoir capable of residing in a host organism or ,cell and directing the expression of CNTF. Such vectors have certain preferred features suited for expression in a particular host organism or cell:

(a) Microorganisms, especially E. coli The vectors contemplated for use in the present invention include any vectors into which a DNA sequence as discussed above can be inserted, along with any preferred or required operational elements, and which vector can then be subsequently =transferred into a host cell and replicated in such I
'cell. Preferred vectors are those whose restriction sites have been well dociunented and which contain the operational elements preferred or required for transcription of the DNA sequence.
However, certain emlbodiments of the present invention are also envisioned which employ currently undiscovered vectors which would contain one or more of the DNA sequences described herein. In particular, it is preferred that all of these vectors have some or all of the following characteristics: (1) possess a minimal number of host-organism sequences; (2) be stably maintained and propagated in the desired host; (3) be capable of being present in a high copy niuaber in the desired host; (4) possess a regulatable promoter positioned so as to promote transcription of the gene of interest; (5) have at least one marker DNA sequence coding for a selectable trait present on a portion of the plasmid separate from that where the DNA sequence will be inserted; and (6) a DNA
sequence capalble of terminating transcription.

In various preferred embodiments, these cloning vectors !!containing and capa:ble of expressing the DNA sequences of the present invention contain various operational elements. These operational elements," as discussed herein, include at least one promoter, at least one Shine-Dalgarno sequence and initiator codon, and at least one terminator codon. Preferably, these "operational elements" may also include one or more of the following: at least one operator, at least one leader sequence for proteins to be exported from intracellular space, at least one gene for a regulator protein, and any other DNA sequences ,,necessary or preferred for appropriate transcription and ! subsequence t:rans la tion of the vector DNA.

Certain of the,se operational elements may be present in each .of the preferred vectors of the present invention. It is contemplated that any additional operational elements which may be required may be added to these vectors using methods known to ,those of ordinary s:kill in the art, particularly in light of the teachings herein.

In practice, it is possible to construct each of these vectors in a way that allows them to be easily isolated, assembled and interchanged. This facilitates assembly of numerous functional geines from combinations of these elements and the coding region of the DNA sequences. Further, many of these elements will be applicable in more than one host. It is additionally contemplated that the vectors, in certain preferred embodiments, will contain DNA sequences capable of functioning as ;regulators ("operators"), and other DNA sequences capable of J;coding for regulator proteins.

(i) Reaulators These regulators, in one embodiment, will serve to prevent expression of the DNA sequence in the presence of certain environmental conditions and, in the presence of other environmental conditions, will allow transcription and subsequent expression of the protein coded for by the DNA sequence. In particular, it is preferred that regulatory segments be inserted into the vector such that expression of the DNA sequence will not occur, or will occur to a greatly reduced extent, in the absence of, for example, isopropylthio-beta-D-galactoside (IPTG). In this situation, the transformed microorganisms containing the DNA
sequence may be grown to at a desired density prior to initiation of the expression of CNTF. In this embodiment, expression of the desired protein is induced by addition of a substance to the microbial environment capable of causing expression of the DNA
sequence after the desired density has been achieved.

(ii) Promoter=s The expression vectors must contain promoters which can be used by the host organism for expression of its own proteins. While the lactose promoter system is commonly used, other microbial promoters have been isolated and characterized, enabling one skilled in the art to use them for expression of the recombinant CNTF.

(iii) Transcription Terminator The transcription terminators contemplated herein serve to stabilize the vector. In particular, those sequences as described by Rosenberg, M. and Court, D., in Ann. Rev. Genet. 13:319-353 (1979), are contemplated. for use in the present invention.

~

(iv) Non-Translatiad Sequence It is noted that, in the preferred embodiment, it may also be desirable to recoristrucit the 3' or 5' end of the coding region to allow incorporation of :3' or 5' non-translated sequences into the gene transcript. Included among these non-translated sequences are those which stabilize the mRNA as they are identified by Schmeissner, U., McKenney, K., Rosenberg, m and Court, D. in J.
Mol. Biol. 176:39-53 (1984).

(v) Ribosomet Binding Sites The microbial. expression of foreign proteins requires certain operational elemer.Lts which include, but are not limited to, ribosome binding sites. A ribosome binding site is a sequence which a ribosome recognizes and binds to in the initiation of protein synthesis as set: forth in Gold, L., et al., Ann. Rev.
Microbic. 35:557-580; or Marquis, D.M., et al., Gene 42:175-183 (1986). A preferred ribosome binding site is GAGGCGCAAAAA(ATG).
(vi) Leader SecLuence and Translational Coupler Additionally, it is preferred that DNA coding for an appropriate secretory leader (signal) sequence be present at the 5' end of the DNA sequence as set forth by Watson, M.E. in Nucleic Acids Res. 12:5145-5163, if the protein is to be excreted from the cytoplasm. The DNA for the leader sequence must be in a position which allows the production of a fusion protein in which the leader sequence is ~

(I Z00GN13 immediately acijacent to and covalently joined to CNTF, i.e., therei must be no-transcription or translation termination signals between the two DNA coding sequences. The presence of the leader sequence is desired in part for one or more of the following !reasons. First, the presence of the leader sequence may facilitate host processing of CNTF. In particular, the leader sequence may ciirect cleavage of the initial translation product by a leader peptiLdase to remove the leader sequence and leave a polypeptide wiLth the amino acid sequence which has potential protein activiLty. Second, the presence of the leader sequence may !facilitate purification of CNTF through directing the protein out i:of the cell cytoplasm. In some species of host microorganisms, ,the presence of an appropriate leader sequence will allow ;!transport of the coinpleted protein into the periplasmic space, as in the case oi' some E. coli. In the case of certain E. coli, 'Saccharomvices and strains of Bacillus and Pseudomonas, the i!appropriate leader sequence will allow transport of the protein through the cell membrane and into the extracellular medium. In this situatiozi, the protein may be purified from extracellular !protein. Thirdly, in the case of some of the proteins prepared by the present iiivention, the presence of the leader sequence may be necessary to :Locate the completed protein in an environment where ,iit may fold to assume its active structure, which structure possesses the appropriate protein activity.

In one preferred embodiment of the present invention, an additional DNA sequence is located immediately preceding the DNA

sequence which cocies for CNTF. The additional DNA sequence is capable of functioning as a translational coupler, i.e., it is a DNA sequence that encodes an RNA which serves to position ribosomes immediately adjacent to the ribosome binding site of the Inhibitor RNA with which it is contiguous. In one embodiment of the present invention, the translat:ional coupler may be derived using the DNA
sequence TAACGAGGCGCAAAAAATGAAAAAGACAGCTATCGCGATCTTGGAGGATGATTAAATG and methods currently known to those of ordinary skill in the art related to translational couplers.

(vii) Translation Terminator The translation terminators contemplated herein serve to stop the translation of MRNA. They may be either natural, as described by Kohli, J., Mol. Gen. Genet. 182:430-439; or synthesized, as described by Pettersson, R.F. Gene 24:15-27 (1983).

(viii) Selectable Marker Additionally, it is~ preferred that the cloning vector contain a selectable marker, such as a drug resistance marker or other marker which causes expression of a selectable trait by the host microorganism. In one embodiment of the present invention, the gene for ampicillin resistance is included in the vector while, in other plasmids, the gene for tetracycline resistance or the gene for chloramphenicol resistance is included.

Such a drug resistance or other selectable marker is intended in part to facilitate in the selection of transformants.
Additionally, the presence of such a selectable marker in the ~

cloning vector may be of use in keeping contaminating microorganisms from mulitiplying in the culture medium. In this emboq iment, a pure culture of the transformed host microorganisms would be obtained by cu:Lturing the microorganisms under conditions which require the induced phenotype for survival.

The operatiorial elements as discussed herein are routinely selected by those of ordinary skill in the art in light of prior literature and the teachings contained herein. General examples of these operational elements are set forth in B. Lewin, Genes, Wiley & Sons, New York (1983).. Various examples of suitable operational elements may be found ori the vectors discussed above and may be elucidated through review of the publications discussing the basic characteristics of' the aforementioned vectors.

Upon synthesis and isolation of all necessary and desired component parts of the above-discussed vector, the vector is assembled by methods gerierally known to those of ordinary skill in the art. Assembly of such vectors is believed to be within the duties and tasks perfornied by those with ordinary skill in the art as such, is capable of being performed without undue experimentation. For example, similar DNA sequences have been ligated into appropriate cloning vectors, as set forth by Maniatis et al. in Molecular Cloning, Cold Spring Harbor Laboratories (1984).

~

In consti:uction of the cloning vectors of the present invention,-it shoulci additionally be noted that multiple copies of!
the DNA sequerice anci its attendant operational elements may be 1inserted into each vector. In such an embodiment, the host !organism woulci produce greater amounts per vector of the desired ,CNTF. The number of' multiple copies of the DNA sequence which may .be inserted irito the vector is limited only by the ability of the resultant vector, due to its size, to be transferred into and replicated anci transcribed in an appropriate host cell.

(b) Other Microorganisms Vectors suitable for use in microorganisms other than E. coli are also contemplated for this invention. Such vectors are described in Table JL. In addition, certain preferred vectors are discussed below.

- ---- -- - - ---------- ---- --- ----- --- ------- ---- ---- ---_ _ - - _ -------- -- _ -_ _ - - - --TABLE l TRANS('R 11' -TRANS- MRNA TIONAL RS
REGULATED CRIPTION STABIL- START SITE & BIND11u:
HOST PROMOTERS INOUC6R TERMINATOR IZATION LEADER PEPTIDE MARKER ~ITE

E. coli Lacl, Tac2 IPTG rrn86 ompAe blall awpicillinl4 i.a~ a pi, increased r rnC' l aw~ a oxpA" t et ra-Trpatemperature intio phoS cyclinel4,15 IAA addi- trp chloram-t i on or tryptophan depletion Bac, i 1 lus 'aipha 17 E. col i~~n B.asy net~~ra1 Kanr 24 e.amy n.~tor.,l 9 awylase rrn BT.T protease Cawr 25 prot-ease ~
=sub- 18 B.aay ailDha- B.aay a~~l-.~
tilisq~ asylase aaylase' =p ~3 B.subt.
spac-126 IPTG subtilisin23 Pseudo- Trp2/ IAA addition, phos- sulto - Trp (E. c=otil nonas (E. coli) or tryptophan pholipase 98 awide~~
Lac depletion exotoxin A strep-(E. coli) IPTG towycin30 'rac It__ col i 1 _ Yeast Ga1 131, Glucose Cyc I lnvertase36 Ura 337 1U2 depletion Una Acid phIt- Leu 238 and phatase AJ!!4 133, yalactose Alpha Alpha His 3 11 Glucose Factor Factor Tap 1 i'lic, 5 dep l e t ion Sac 2 1'hosphat e cleNlrt ion 1.i Backman, K., Ptashne, M. and Gilbert, W. Proc. Natl. Acad.
Sci. USA 21, 4174-4178 (1976).

2.) de Boer, H.A., Comstock, L.J., and Vasser, M. Proc. Natl.
Acad. Sci. USA 12, 21-25 (1983).

3.I Shimatake, H. and Rosenberg, M. Nature 292, 128-132 (1981).
4.j Derom, C., Gheysen, D. and Fiers, W. Gene 17, 45-54 (1982).
,;

5.; Hallewell, R.A. and Emtage, S. Gene 9, 27-47 (1980).

6.~; Brosius, J., Dull, T.J., Sleeter, D.D. and Noller, H.F. J.
i Mol. Biol. 148 107-127 (1981).

7.i'I Normanly, J., Ogden, R.C., Horvath, S.J. and Abelson, J.
Nature 321, 213-219 (1986).

8.I Belasco, J.G., Nilsson, G., von Gabain, A. and Cohen, S.N.
Cell 4i, 245-251 (1986).

9.1', Schmeissner, U., McKenney, K., Rosenberg M. and Court, D.
J. Mol. Biol. 176, 39-53 (1984).

10.jI Mott, J.E., Galloway, J.L. and Platt, T. EMBO J. j, 1887-1891 (1985).

11.! Koshland, D. and Botstein, D. Cell 2a, 749-760 (1980).

12.1; Movva, N.R., Rakamura, K. and Inouye, M. J. Mol. Biol.
143, 317-328 (1980).

13.;! Surin, B.P., Jans, D.A., Fimmel, A.L., Shaw, D.C., Cox, G.B. and Rosenberg, H. J. Bacteriol. 157, 772-778 (1984).

14.11 Sutcliffe, J.G. Proc. Natl. Acad. Sci. USA 3737-3741 (1978).

15.' Peden, R.W.C. Gene ,22,, 277-280 (1983).

16.i, Alton, N.R. and Vapnek, D. Nature 282, 864-869 (1979).

17.I Yang, M., Ga.lizzi, A., and Henner, D. Nuc. Acids Res.
11(2), 237-248 (1983).

18. Wong, S.-L., Pricet, C.W., Goldfarb, D.S., and Doi, R.H.
,I Proc. Natl. Acad. Sci. USA 81, 1184-1188 (1984).

19.1,'Wang, P.-Z., and Doi, R.H. J. Biol. Chem. 251, 8619-8625, (1984).

20. Lin, C.-K., Quinn, L.A. Rodriquez, R.L. J. Cell Biochem.
Suppl. (981, p. 198 (1985).

21. Vasantha, N., Thonipson, L.D., Rhodes, C., Banner, C., Nagle, J.-, and Fil.pula, D. J. Bact. 159(3), 811-819 (1984).

22. Palva, I., Sarvas, M., Lehtovaara, P., Sibazkov, M., and Kaariainen, L. Proc. Natl. Acad. Sci. USA 79, 5582-5586 (1982).

23., Wong. S.-L., Pricee, C.W., Goldfarb, D.S., and Doi, R.H.
Proc. Natl. Acad. Sci. USA 81, 1184-1188 (1984).

24.1 Sullivan, M.A., Yasbin, R.E., and Young, F.E. Gene 29, 21-46 (1984).

25.1: Vasantha, N., Thompson, L.D., Rhodes, C., Banner, C. Nagle, J., and FilcLla, D. J. Bact. 159(3), 811-819 (1984).

26.~ Yansura, D.G. and Henner, D.J. PNAS ~, 439-443 (1984).

27.1 Gray, G.L., McReown, K.A., Jones, A.J.S., Seeburg, P.H. and Heyneker, H,L. Biotechnology, 161-165 (1984).

28.I Lory, S., and Tai, P.C. Gene 22, 95-101 (1983).

29.1) Liu, P.V. J. Infect. Dis. 190 (suppl), 594-599 (1974).

30.Wood, D.G., Hollinger, M.F., nd Tindol, M.B. J. Bact. 45, 1448-1451 (1981).

31. ~ St. John, T.P. anci Davis, R.W. J. Mol. Biol. =, 285-315 (1981).

32. Hopper, J.E,., and Rowe, L.B. J. Biol. Chem. 2U, 7566-7569 (1978).

33. Denis, C.L., Ferguson, J. and Young, E.T. J. Biol. Chem.
258, 1165-1171 (1983).

34. Lutsdorf, L. and Megnet, R. Archs. Biochem. Biophys. 126, 933-944 (1968).

35. Meyhack, B.,, Bajwa, N., Rudolph, H. and Hinnen, A. EMBO. J.
., 675-680 1(1982).

36.1, Watson, M.E. Nucleic Acid Research 12, 5145-5164 (1984).
!i 37.~ Gerband, C. and Giserineau, M. Curr. Genet. ;, 219-228 1 (1980).

3t, Hinnen, A., Hicks, J.B. and Fink, G.R. P:roc. Natl. Acad.
Sci. USA 79, 1929-1933 (1978).

3q, Jabbar, M.A., Sivasubramanian, N. and Nayak, D.P. Proc.
Natl. Acad. Sci. 'USA 82, 2019-2023 (1985).

---------- --(i) Pseudomonas Vectors Several vector plasmids which autonomously replicate in a broad range of Gram negative bacteria are preferred for use as cloning vehicles in hosts of the genus Pseudomonas. Certain of lithese are described by Tait, R.C., Close, T.J., Lundquist, R.C., Hagiya, M., Rodriguez, R.L., and Kado, C.I. In Biotechnology, May, 1983, pp. 269-275; Panopoulos, N.J. in Genetic Engineering in the Plant Sciences, Praeger Publishers, New York, New York, pp. 163-185 (1981); and Sakagucki, K. in Current Topic in Microbiology and Immunology 96:31-45 (1982).

One particularly preferred construction would employ the plasmid RSF1010 and derivatives thereof as described by Bagdasarian, M., Bagdasarian, M.M., Coleman, S., and Timmis, K.N.
in Plasmids of Medical, Environmental and Commercial Importance, Timmis, K.N. and Puhler, A. eds., Elsevier/North Holland Biomedical Press (1979). The advar,itages of RSF1010 are that it is relatively a small, high copy number plasmid which is readily transformed into and stably maintained in both E. coli and Pseudomonas species. In this system, it would be preferred to use the Tac expression system as described for Escherichia, since it appears that the E. coli trp promoter is readily recognized by Pseudomonas RNA polymerase as set forth by Sakagucki, K. in Current Topics in Microbiology and Immunology 96:31-45 (1982) and Gray, G.L., McKeown, K.A., Jones, A.J.S., Seeburg, P.H., and Heyneker, H.L. in Biotechnology, Feb.
1984, pp. 161-165. Transcriptional activity may be further maximized by requiring the exchange of the promoter with, e.g., an E. coli or P. aeruainosa trp promoter. Additionally, the laci gene of E. coli would also be included in the plasmid to effect regulation.

Translation may be coupled to translation initiation for any of the Pseudomonas proteins, as well as to initiation sites for any of the highly expressed proteins of the type chosen to cause intracellular expressiori of the inhibitor.

In those cases where restriction minus strains of a host Pseudomonas species are not available, transformation efficiency with plasmid constructs isolated from E. coli are poor. Therefore, passage of the Pseudomorias cloning vector through an r- m+ strain of another species prior= to transformation of the desired host, as set forth in Bagdasariari, M., et al., Plasmids of Medical, Environmental and Commercial Importance, pp. 411-422, Timmis and Puhler eds., Elsevier/North Holland Biomedical Press (1979), is desired.

(ii) Bacillus Vectors Furthermore, a pref'erred expression system in hosts of the genus Bacillus involves using plasmid pUB110 as the cloning vehicle. As in other host vector system, it is possible in Bacillus to express the CNTF of the present invention as either an intracellular or a secreted protein. The present embodiments include both systems. Shuttle vectors that replicate in both Bacillus and E. coli are available for constructing and testing various genes as described by Dubnau, D., Gryczan, T., Contentel S., and Shivakumar, A.G. in Genetic Engineerinq, Vol. 2, Setlow and ~

Hollander eds., Plenum Press, New York, New York, pp. 115-131 (1980). For the expression and secretion of the CNTF from B.
subtilis, the sigrial sequence of alpha-amylase is preferably coupled to the coding region for the protein. For synthesis of intracellular CNTF the portable DNA sequence will be translationally coupled to the ribosome binding site of the alpha-amylase leader secluence..

Transcriptiork of either of these constructs is preferably directed by the al.pha-arnylase promoter or a derivative thereof.
This derivative contains the RNA polymerase recognition sequence of the native alpha-a.mylasE: promoter but incorporates the lac operator region as well. Similar hybrid promoters constructed from the penicillinase gene: promoter and the lac operator have been shown to function in Bacillus hosts in a regulatable fashion as set forth by Yansura, D.G. and Henner in Genetics and Biotechnology of Bacilli, Ganesan, A.T. and Hoch, J.A., eds., Academic Press, pp. 249-263 (1984). The lacI gene of E. coli would also be included in the plasmid to effect regulation.

(iii) Clostridium Vectors One preferred construction for expression in Clostridium is in plasmid pJU12, described by Squires, C.H. et al., in J.
Bacteriol. 159:465-471 (1984) transformed into C. perfringens by the method of Heefner, D. . L. et al., as described in J.
Bacteriol. 159:460-464;(1984). Transcription is directed by the promoter of the tetracycline resistance gene. Translation is coupled to the Shine-Dalgarno sequences of this same tet' gene in a ~

manner strictly arialogous to the procedures outlined above for vectors suitable f'or use in other hosts.

(iv) Yeast Vectors Maintenance of foreign DNA introduced into yeast can be effected in several ways as described by Botstein, D. and Davis, R.W., in The Molecular Bioloav of the Yeast Saccharomyces, Cold Spring Harbor Laboratory, Strathern, Jones and Broach, eds., pp.
607-636 (1982). One preferred expression system for use with host organisms of the genus Saccharomyces harbors the CNTF gene on the 2 micron plasmid. The advantages of the 2 micron circle include relatively high capy number and stability when introduced into cir' strains. These vectors preferably incorporate the replication origin and at least one antibiotic resistance marker from pBR322 to allow replication and selection in E. coli. In addition, the plasmid will preferably have the two micron sequence and the yeast LEU2 gene to serve the same purposes in LEU2 defective mutants of yeast.

If it is contemplated that the recombinant CNTF will ultimately be expressed in yeast, it is preferred that the cloning vector first be transferred into Escherichia coli, where the vector would be allowed to replicate and from which the vector would be obtained and purified af'ter amplification. The vector would then be transferred into the yeast for ultimate expression of CNTF.

~

(c) Mammalian Cells The cDNA or crenomic: DNA encoding CNTF will serve as the gene for expression of CNTF :Ln mammalian cells. It should have a sequence that will be efficient at binding ribsomes such as that described by Kozak:, in Nucleic Acids Research 15:8125-8132 (1987).
The DNA fragment carrying the DNA sequence encoding CNTF can be inserted into an expression vector which has a transcriptional promoter and a transcriptional enhancer as described by Guarente, L. in Cell 52:303-=305 (1988) and Kadonaga, J.T. et al., in Cell 51:1079-1090 (1987). The promoter may be regulatable as in the PMSG (Pharmacia Ca.t. No.. 27450601) if constitutive expression of the inhibitor is harmfu]L to cell growth. The vector should have a complete polyadeny'latiori signal as described by Ausubel, F.M. et al. in Current Prcitocol:; in Molecular Biology, Wiley (1987), so that the mRNA transcribed from this vector is processed properly.
Finally, the vector will have the replication origin and at least one antibiotic resistance marker from pBR322 to allow replication and selection in E. coli.

In order to select: a stable cell line that produces CNTF, the expression vector can carry the gene for a selectable marker such as a drug resistance mar=ker or carry a complementary gene for a deficient cell line, such as a dihydrofolate reductase (dhfr) gene for transforming a dhfr- cell line as described by Ausubel et al., supra. Alternatively, a separate plasmid carrying the selectable marker can be cotransfor=med along with the expression vector.

Host CellsLTr-ansformation The vector thus obtained is transferred into an appropriate host cell. These host cells may be microorganisms or mammalian cells.

(a) Microorcfanisms It is believed that any microorganism having the ability to take up exogenous DNA and express those genes and attendant operational elemerits may be chosen. After a host organism has been chosen, the vector= is transferred into the host organism using methods generally known to those of ordinary skill in the art.
Examples of such methods may be found in Advanced Bacterial Genetics by R. W. Davis et al., Cold Spring Harbor Press, Cold Spring Harbor, New York, (1980). It is preferred, in one that the transformation occur at low temperatures, as temperature regulation is contemplated as a means of regulating gene expression through the use of operational elements as set forth above. In another embodiment, if osmolar regulators have been inserted into the vector, regulation. of the salt ~

concentrations duriing the transformation would be required to insure appropriate control of the foreign genes.

It is preferred that the host microorganism be a facultative ,!anaerobe or an aerolbe. Particular hosts which may be preferable for use in this metlhod include yeasts and bacteria. Specific ,yeasts include those of the genus Saccharomyces, and especially Saccharomvices cerevisiae. Specific bacteria include those of the ,genera Bacillus, Escherichia, and Pseudomonas, especially Bacillus subtilis and Escherichia coli. Additional host cells are listed in Table I, suDra .

(b) Mamnalian Cells The vector can be introduced into mammalian cells in culture by several techniques such as calcium phosphate:DNA coprecipita-~tion, electroporation, or protoplast fusion. The preferred method ,is coprecipitation with calcium phosphate as described by Ausubel et al., suDra.

Many stalble cell types exist that are transforanable and capable of transcrilbing processing, and translating the DNA
sequence and producing CNTF protein. However, cell types may be variable with regard to glycosylation of proteins and post-itranalational modification of amino acid residues, if any. Thus, the ideal cell types are those that produce a recombinant CNTF
~) ! identical to -the natural molecule.

The host cells are cultured under conditions appropriate for the expression of C:NTF. These conditions are generally specific for the host cell, and are readily determined by one of ordinary skill in the art in light of the published literature regarding the growth conditions for such cells and the teachings contained therein. For example, 13ergey's Manual of Determinative Bacteriology, 8th Ed., Williams & Wilkins Company, Baltimore, Maryland, contains information on conditions for culturing bacteria. Similar information on culturing yeast and mammalian cells may be obtained from Pollack, R. Mammalian Cell Culture, Cold Spring Habor Laboratories (1975).

Any conditioris necessary for the regulation of the expression of the DNA sequence, dependent upon any operational elements, inserted into or present in the vector, would be in effect at the transformation and. culturing stages. In one embodiment, cells are grown to a high density in the presence of appropriate regulatory conditions which inhibit: the expression of the DNA sequence. When optimal cell density is approached, the environmental conditions are altered to those appropriate for expression of the DNA
sequence. It is thus contemplated that the production of CNTF will occur in a time span subsequent to the growth of the host cells to near optimal density, and that the resultant will be harvested at some time after the regulatory conditions necessary for its expression were induced.

In one embodiment of the present invention, recombinant CNTF
will be purified after expression in a host cell or organism. In a preferred embodiment, recombinant CNTF will be purified after expression in microorganisms, particularly E. coli. In a preferred embodiment of the present invention, CNTF is present in its biologically active state upon recovery from the bacteria cultures.
In an alternate preferred embodiment, CNTF may be allowed to re-fold to assume its active structure at a particular step in the purification process.

For purificat:ion of the recombinant protein, some combination the following steps is preferably used: anion exchange chromatography (Mcrno-Q , Mono-S , and/or DEAE-Sepharose ), gel permeation chromatography (Superose ), chromatofocussing (Mono-P ), land hydrophobic interaction chromatography (octyl- and/or pnenyl-Sepharose ).

It is to be understood that application of the teachings of the present invent.ion to a specific problem or environment will be within the capabilities of one having ordinary skill in the art in light of the teachings contained herein.

The following examples are provided to illustrate certain preferred embodiments of' the present invention, and are not restrictive of the inverition, as claimed.

Example Protein Preparation Materials Adult rabbit sciatic nerves were obtained from Pel-Freez Biologicals, Rogers, Arkansas. Ammonium sulfate (ultrapure) was ~.

purchased from Schwartz/Mann Biotech, Cleveland, Ohio.
Phenylmethylsulfonyl fluoride (PMSF), epsilon-amionocaproic acid, Ibenzamidine, pepstatin, dithiothreitol (DTT), poly-L ornithine ~(P3655), and 3-[4,5-dimethylthiazol-2 yl]-2,5-diphenyl-tetra-,zolium bromide (MTT) were obtained from Sigma Chemical Co., St.
Louis, Missouri. Mono P chromatofocussing FPLC columns were obtained from Pharmacia, Inc., Piscataway, New Jersey. C8 reverse phase HPLC columns were obtained from Synchrom, Inc., Lafayette, Indiana. Acetonitrile was purchased from J.T. Baker Chemical Co., iPhillipsburg, New Jersey. Trifluoroacetic acid was obtained from ,,Pierce Chemicals, Rockford, Illinois. Endoproteases Asp-N and ';Lys-C were obtained from Boehringer Mannheim Biochemicals, :,Indianapolis, Indiana. Fetal calf serum was purchased from Hyclone Laboratories, Logan, Utah. Culture media and salt solutions were obtained from Irvine Scientific, Santa Ana, ,California. Culture dishes were obtained from Costar, Cambridge, '',Massachusetts. Utility grade pathogen-free fertile chick embryo eggs were obt,ained from Spafas, Roanoke, Illinois.
B. A sav for SN-CNTF

Cultures of primary chick embryo ciliary ganglia were prepared as p:reviously described (Collins, 1978, Develop. Biol.
65:50; Manthorpe et al., 1986, Develop. Brain Res. 25:191).

!,Briefly, ciliary ganglia were removed from fertile, pathogen free chicken eggs that had been incubated for 9-10 days at 38 C in a humidified atinosphere. The ganglia were chemically dissociated by exposure first to Hanks' Balanced Salt Solution without divalent , :.

cations, containing 10mM HEPES buffer pH 7.2 for 10 min at 37 C, and then by exposure to a solution of 0.125% bactotrypsin 1:250 (Difco, Detroit, M:Lchigan) in Hanks' Balanced Salt Solution modified as above for 12 min at 37 C. Trypsinization was stopped by addition of fetal calf serum to a final concentration of 10%.

After this treatment, ganglia were transferred to a solution H consisting of Dulbecco's high glucose Modified Eagle Medium without bicarbonate containing 10% fetal calf serum and 10mM
HEPES, pH 7.2 and were mechanically dissociated by trituration ;lapproximately 10 tiLmes through a glass Pasteur pipet whose openincj ~Ihad been fire polished and constricted to a diameter such that it took 2 seconcis to fill the pipet.

The dissociated ganglia were then plated in culture medium (Dulbecco's Modified Eagle Medium supplemented with 10% fetal calf serum, 4 mM glutamiLne, 60 mg/L penicillin-G, 25 mM HEPES, pH 7.2) in 100 mm dituneter tissue culture dishes (40 dissociated ganglia i.per dish) for three hours. This preplating was done in order to separate the nonneuronal cells, which adhere to the dish, from the nerve cells, which do not adhere. After three hours, the nonadherent nerve cells were collected by centrifugation, i resuspended in culture medium, and plated in 50 ul per well onto half area 96 well microtiter tissue culture plates at a density of 11500 nerve cells per well. The microtiter wells had been previously exposed to a 1 mg/mi solution of poly-L-ornithine in 10mM sodium borate, pH 8.4 overnight at 4 C, washed in distilled water and air driect.

Ten ul of a setrial dilution of the sample to be assayed for neurotrophic activity was added to each well and the dishes were incubated for 20 hciurs at 37 C in a humidified atmosphere ~~containing 7.5% CO22. After 18 hours, 15 ul per well of a 1.5 mg/
ml solution of the tetrazolium dye MTT in Dulbecco's high glucose Modified Eagle Medium without bicarbonate containing 10mM HEPES, ~ pH 7.2, was added and the cultures placed back in the 37 C
incubator for 4 hours. Then, 75 ul of a solution of 6.7 ml of 12M.
HC1 per liter of isopropanol was added and the contents of each well triturated 30 times to break open the cells and suspend the dye. The absorbance at 570nm was determined relative to a 690nm reference for each well using an automatic microtiter plate reader (Dynatech, Chantilly, Virginia). The absorbance of wells which had not received any neurotrophic agent (negative controls) was subtracted from the absorbance of sample-containing wells. The resulting absorbance is proportional to the number of living cells in each well, defined as those nerve cells capable of reducing the dye. The number of trophic units of neurotrophic activity was defined as the reciprocal of the dilution that gave 50% of maximal survival of nerve cells. The concentration of trophic activity in trophic units per ml was obtained by dividing the total trophic units by the assay volume (60 ul). Specific activity was ,;determined by dividing the number of trophic units by the amount of protein present in the sample.

C. Pur ication of SN-CNTF

At the end of each of the following steps, the preparation was either processed immediately or stored at -70 C for up to one week until used.

Step 1. CrudeExtract Preparation One Hundred grams (wet weight) of rabbit sciatic nerve (about 300 nerves) was thawed and pulverized using a Polytron rotary ~!homogenizer (Kinematica, Switzerland) for 1 minute in 10 volumes I,(wt/vol) of w=ater containing 10mM EDTA, 1 mM epsilon aminocaproic acid, 1 mM benzamidine and, 0.1 mM PMSF, and centrifuged at I:140,000xg for 30 minutes at 4 C. The supernatant was filtered i;through glass wool to remove floating lipid.

! Step. 2. Acid Treatment and Ammonium Sulfate Fractionation The centrifugation steps referred to below were performed at !I
i;17,000xg for 20 minutes and all operations were performed at 4 C, unless otherwise stated. The crude extract was centrifuged. The i supernatant was acidified to pH 3.6 with 5N HC1 and the resulting precipitate was rexioved by centrifugation. The supernatant was titrated to pH 6.3 with 1N NaOH and the resulting precipitate was again removed, by ceintrifugation. To the above supernatant was added saturated ammonium sulfate solution to achieve 30%
saturation and the precipitate was removed by centrifugation.
Further addition of ammoniuun sulfate to the supernatant to achieve !!60$ saturation resulted in the precipitation of a protein fraction containing most of the SN CNTF activity. The precipitate was dissolved in 20 mM sodium phosphate buffer, pH 6.7, containing 1 2006813 mM EDTA, 0.1mM PMSF and 0.1 uM pepstatin, to give a protein concentration of 8-13 mg/ml.
Step 3. Chromatofocussina The above preparation was dialyzed overnight against a 500 fold larger v-olume of 10mM sodium phosphate, pH 6.7 with one change of buffer, and centrifuged at 140,000xg for 30 minutes. The supernatant was passed through 0.22 um pore-diameter nylon filter and loaded in 3 injections of 2 ml each onto a Mono P
,chromatofocussing F:PLC column (bed volume 4 ml) equilibrated in 25 mM bis-Tris-HC1 buf:fer, pH 5.8. The column was washed with the ~.
same buffer until tlhe absorbance at 280nm of the effluent returned to baseline. The sample was then chromatographed with polybuffer, ,,pH 4.0 (1-10 (iilution of PB74 from Pharmacia).

Column fractions were collected and analyzed for pH and CNTF
activity. Figure 1 shows the results of chromatography on Mono P.
The profile of eluted proteins is plotted as the optical density !j ( 0. D. ) at 280iua. Sisperimposed are plots of the pH and SN-CNTF
activity measured in each fraction. The fractions indicated by the bar with peak SN-CNTF activity (around pH 5) were pooled and treated with solid iimmonium sulfate to achieve 95% saturation and the pellet was colliacted by centrifugation, resuspended in Isaturated ammonium sulfate solution and centrifuged again to remove the polybuffer. The precipitate was dissolved in sufficient 10mM sodium phosphate buffer, pH 6.7 to give a final protein concentration of 3-5 mg/ml (referred to as the "focussed Zoos813 fraction"). Typically, 1 liter of the original crude extract was processed in 8 separate runs on the Mono P column.

Step. 4. Preparative Sodium Dodecyl Sulfate (SDS) Gel Electrophoresis The focussed fractions from multiple runs over the Mono P
column were combined and dialyzed against a 100-fold larger volume ,of 10mM sodium phosphate buffer, pH 6.7 for 8 hours with one !change of buffer, then run on a 15% reducing SDS polyacrylamide slab gel according to the method of Laemmli, 1970. Each resolving, 1!
j.gel measured 0.3 cmi in thickness, 14 cm in height, and 11.5 cm in width. 5.5 m.g of protein was loaded onto each gel.
J,Electrophoresis was performed at 15 C and 40 mA/gel until the 20 !kd prestained molecular weight standard just reached the bottom of the resolving gel.

To reveal the curvature of individual protein bands across the width of the slab gel, the gel was overlayed with a sheet of 'nitrocellulose (0.45 um pore size in roll form obtained from Millipore Corporation, Bedford, Massachusetts) prewetted with water, 2 sheets of prewetted and 2 sheets of dry chromatography paper (3 MM Chr obtained from Whatman, Hillsboro, Oregon), a glass plate and a 500 ml glass bottle for weight. After 30-45 minutes, the outline of the gel was traced onto the nitrocellulose paper using a water-insoluble marker. The paper was washed 3 times with mm Tris-HC1 buff'er, pH 8.0 containing 0.15 M NaCl and 0.3% NP-40 detergent, and then stained for 15-30 minutes with a 1:1000 dilution of Kohinuor Rapidograph Ink (available at stationary supply stores) in the above buffer.

The original gel was placed onto a glass plate and aligned with its outline on the stained nitrocellulose paper underneath .
;,the glass. The region of the gel corresponding to molecular weights between 22-27 kd was located with reference to prestained molecular weight standards (BRL, Bethesda, MD) run in narrow lanes ~~at both ends of each gel. This region was cut across the width of i'the gel into seven 2.5 mm parallel strips using the banding ,!curvature revealed by the stained nitrocellulose paper. Each individual gel strip was cut into smaller pieces (2.5x2mm) and !!proteins were eluted electropohoretically for 6 hours in a 1:1 dilution of the Laemmli running buffer using an electrophoretic concentrator (ISCO, Lincoln, Nebraska). Eluted proteins were I!collected in a volume of 0.2 ml. Figure 2 plots the distribution of neurotrophic activity in the elute from each of the 7 strips !i(labelled a-g in order of decreasing molecular weight). The fraction with the highest activity (strip d) was further purified using reverse-phase HPLC.

Step 5. Revex,se Phase--HPLC

Dithiothreitol (DTT) and 10% trifluroacetic acid (TFA) were added to the gel eluate to achieve final concentrations of 2% and 10.38, respectively. The sample was filtered through a 0.22 um nylon filter, loaded onto a C8 reverse phase HPLC column and eluted with an H20/0.1$ TFA:acetonitrile/0.1% TFA gradient.
Fractions were collected into siliconzied tubes containing 5 ul of 0.4% Tween 20 detergent. Aliquots from each fraction were assayed for neurotrophic activity. Figure 3 shows the results of reverse phase chromatography. Protein concentration is indicated by absorbance at 215 nm and the distribution of neurotrophic activity is superimposed. Fractions with the peak SN-CNTF activity (fractions 37-40, Fig. :3) were pooled for sequencing as described in Example 2. In a separate preparation, fractions adjacent to and including the peak: CNTF activity, equivalent to fractions 36-44 in Fig. 3, were also analyzed on silver-stained reducing SDS-PAGE
(Fig. 4).

Two additional chromatographic steps have also been performed.
These steps confirmed the purity of the CNTF prepared above.

The two additional chromatographic steps both use the prin-ciple of hydrophobic interaction chromatography (HIC). The first HIC step is a conventional column chromatographic procedure inserted after step 2: pH and ammonium sulfate fractionation. The dissolved material aftex= ammonium sulfate precipitation was further diluted with lOmM sodium phosphate buffer, pH 6.7 (Buffer B) until the ionic strength (measured with a conductance meter) was equal to that of Buffer B contairiing 0.3M ammonium sulfate and 5%
isopropanol (Buffer A). Isopropanol was then added to the sample to a final concentratior.i of 5% and the mixture applied to a column of phenyl Sepharose CL4B (Pharmacia, Inc., Piscataway, New Jersey) equilibrated with Buffer A. No more than 3 mg of sample protein was applied per ml of column bed-volume. Typically, 1 liter of crude sciatic nerve extract yielded 50m1. of the redissolved ammonium sulfate pellet, which was then diluted to 70-100m1 as above and applied to a:110ml phenyl Sepharose column. The column was eluted stepwise starting with 3 bed-volumes of Buffer A, followed by 3 bed-volumes of Buffer B, followed by 2 bed-volumes of Buffer B containirig 50% ethylene glycol (Buffer C), then washed with 5 bed-volumes of water. Eighteen ml fractions of the eluted material were collected.

Figure 7 shows the results of one such chromatography run. The profile of eluted proteiLns was continuously monitored by O.D. 280 (solid line). Superimposed on the O.D. tracing is the profile of eluted SN-CNTF bioactivity in each fraction (line connecting x's), as measured in the: ciliary ganglion survival assay described in the original patent application. SN-CNTP bioactivity emerged from the column during elut.ion with Buffer C. The column fractions containing the bulk of the bioactivity (indicated by the bar in Figure 7) were pooled and concentrated by pressure dialysis using an Amicon YM-10 membrane (Amicon Division, W.R. Grace & Co., Danvers, MA) to approximately 1/10 of the original volume, which typically resulted in a final protein concentration of 2.5-3.Omg/ml. The concentrate was dialyzed for a total of 6hr against 3 changes of 55-fold larger volume of B. The dialyzed material was passed through a 0.2 m pore diameter Acrodisc filter (Gelman Sciences, Inc., Ann Arbor, MI) and loaded in multiple injections of 2m1 each onto a Mono-P chromatofocussing column as described in the original patent application.

Without this HIC column step, 1 liter of crude sciatic nerve A

extract required 8 separate runs on the Mono-P chromatofocussing column, as described in the initial patent application, because of the limited protein loading capacity of the column. With the ad-edition of the HIC: colurnn step, 1 liter of crude extract could be processed in a single chromatofocussing run.

The second HI:C step was inserted after the original step 3:
chromatofocussed on Mono-P. To every iml of the chromatofocussed material (at 3-5mg/ml of protein) was added 2ml of 50mM phosphate buffer, pH 6.7, containing 1.5M ammonium sulfate (Buffer D). The mixture was then passed through a 0.2 m pore diameter Acrodisc filter and loaded in multiple injections of 2m1 each onto a Alkyl-Superose HR10/10 FPLC column (Pharmacia) equilibrated with Buffer D. The column was washed with Buffer D until the absorbance of the affluent at O.D. 280 returned to baseline. The column was then eluted with a 60m1 linear gradient running from Buffer D into Buffer E (50mm phosphate buffer, pH 6.7) and 1 ml fractions were collected.

Figure 8 illustrates the results of one such FPLC-HIC column run. The continuous line represents the profile of eluted protein measured by O.D. 280. superimposed is a plot of the SN-CNTF

bioactivity in each gradient fraction. The fractions containing bioactivity (indicated by the bar in Figure 8) were pooled and concentrated in a Centricon-10 concentrator (Amicon) to 0.5m1.

2oos81..3 The sample was dilutecl by adding 2 ml of Buffer B to the upper reservoir and reconceritration by centrifugation to a final volume of 0.5m1. Dilution arid reconcentration was repeated 2 additional times and the final concentrated sample was run on a reducing i+SDS-15$ polyacrylamide preparative slab gel as described above, except that prior dialysis was not necessary.

Figure 9 compares the final purification step on reverse ;iphase HPLC in the initial purification procedure (upper panel) ,!and in the purification procedure after addition of the two HIC
isteps (lower par.Lel). Each panel shows the profile of eluted pro-;teins (solid line is O.D.' 280 and the superimposed SN-CNTF
bioactivity (line connecting x's). It is apparent from the Figure that there is much less contaminating protein present in the sample put onto reverse phase HPLC in the new purification procedure. It is important to note that the specific activity of CNTF produced by the riew procedure is identical within experi-mental error with the specific activity of CNTF produced by the previous procedure (Table 1), indicating that the CNTF prepared by ithe original procedure described above was purified to homogeneity. The advantage of the new purification procedure is that 8 liters of starting material can now be processed as conveniently as 1 liter using the original procedure.

EXamDle 2 Secruencinc of the PurjLfied Neurotrovhic Factor Fractions with the peak SN-CNTF activity (#37-40, Fig. 3) were pooled and conceritrated to 50 ul on a vacuum evaporator centrifuge. The concentrated sample contained 0.14% Tween 20. It was diluted with 1.% ammonium bicarbonate to a final volume of 350 ul and treated with endoprotease Asp-N or endoprotease Lys-C
overnight at 37 C. The mixture was concentrated to approximately 50-100 ul on a vacuum evaporator centrifuge and loaded via a 1 ml sample loop onto a. narrow tore Aguapore RP-300 C8 reverse phase HPLC column (Brownlee Labs), 2.1x220mm, eluted with an H20/0.1% 2 TFA: acetonitrile/0.1% TFA gradient. Peptide containing fractions collected manually into Eppendorf tubes based on the at 215nm.
Figure 5 shows the profile of eluted peptides after digestion with endoprotease Asp-N as determined by absorbance at 215mmn. Figure 6 shows the profile of eluted after digestion with endoprotease Lys-C
followed by and carboxymethylation. The amino acid sequence of the prominent peptides was determined using an Applied Biosystems gas phase protein sequencer.

Additional am.ino acid sequence has been obtained with the cleavage enzymes chymotY=ypsin and endoprotease Glu-C (Boehringer Mannheim Biochemicals, l:ndianapolis, IN). This additional protein ilsequence has allowed some of the amino acid sequences reported above to be pieced together into larger peptides from overlapping stretches of amino acids. The new amino acid sequences and those joined together with previous sequences are given below:
H-S-A-L-T-P-H-=R-R-E

~

V-P-M-A D-Q-Q-V-H-F-T-P-A-B-G

J
i.D-G-L-F-B-R-R-L=FI-G-L-K-V-L-Q-E-L-S-H-W-T-V
.
D-L-R-V-I

Examnle 3 Preparation of Antibodies to the Neurotronhic Factor Antibodies that react with purified rabbit SN-CNTF will be !useful for screening expression libraries in order to obtain the ,gene which encodes rabbit SN-CNTF. In addition, antibodies that neutralize its biological activity will be used in intact animals ;~in order to,determine the biological role of this neurotrophic factor.

In order to prepare such antibodies, synthetic peptides will be synthesized which correspond to regions of the sequence of SN-CNTF using an Applied Biosystems automated protein synthesizer.
Such synthetic peptides will be covalently linked to the carrier õprotein keyhole limpet hemocyanin. The conjugated peptide will be ;iinjected into guinea pigs in complete Freund's adjuvant, with booster shots applied at 3 and 6 weeks in incomplete adjuvant.
Serum samples will be taken from each guinea pig and used in a Western blot against purified SN-CNTF in order to determine if antibody in the serum reacts with the purified protein. Sera positive in the Western assay will be further tested for ability to neutralize the neurotrophic activity in the bioassay used for purification. Sera positive in either the Western or neutralization assay will be further purified as follows: (1) the sera will be absorbed with the carrier protein keyhole limpet hemocyanin in order to remove antibodies directed against that !;protein, then the sera will be retested in the above assays; (2) the IgG antibody fraction will be purified from the serum by ,standard procedures and retested in the above assays. Both these steps will provide a polyclonal antibody that is pure enough to be used to screen expression libraries in order to clone the messenger RNA and gene for SN-CNTF.

Antibodies were g=enerated in rabbits to a synthetic peptide A" corresponding to a, portion of the amino acid sequence of rab-ibit SN-CNTF given in Example 2(E-S-Y-V-R-H-Q-G-L-N-R-N). Methods ,iare given in detail beilow in this Example. Affinity-purified antibodies against synthetic peptide A (anti-peptide-A antibodies) were prepared by passing immunized rabbit antiserum over an affinity column containing covalently-linked synthetic peptide A
+and then eluting boundl antibodies. The unfractionated immune i~antiserum gave a, titer of ca. 105 in an ELIZA assay using peptide A coated wells; it was used at a 1:50 final dilution for Western blot analysis. The af'finity-purified anti-peptide-A antibody, prepared as described below, was used in Western blot analysis at a final concentration of 80 Ag/ml.

Both the anti-peptide-A antiserum and affinity-purified antibodies were ciemonstrated to interact with purified rabbit SN-CNTF by Western blott analysis of reducing SDS-polyacrylamide-I-gel electroPhoresis (SDS-PAGE) of purified CNTF. Pre-immune ~iserum from the siune rabbit did not interact with SN-CNTF under these conditions. Alicluots of the peak fraction of CNTF from the final reverse-phase HPLC purification step (fraction #46, Fig. 9, panel B) were run in two separate lanes on reducing SDS-PAGE.
Adjacent to each lane of purified CNTF was a lane containing i;molecular weight marker proteins. The gel was cut into two panels '~each of which contained one lane of purified CNTF and an adjacent .lane of marker proteins. One of the pieces was silver-stained to localize proteinis (Bio.-Rad Laboratories, Richmond, CA) and the other was examined by iWestern blot analysis (Towbin et al., 1979, ~Proc. Natl. Acad. Sci.t U.S.A. 76:4350) for proteins that reacted , with the affinity-purified anti-peptide-A antibodies.

The left-haind panel of lanes in Figure 10 demonstrates that the peak fraction of reverse-phase purified CNTF contains two closely-spaced protein bands that run at approximately 25,000 daltons and are separated from each other by approximately 500 I!daltons on reducing SDS-PAGE. When silver-stained gels are over-loaded with purified CNTF, it is often not possible to resolve the i.two bands as in Fig. 4.

The right hand panel of lanes in Figure 1.0 demonstrates that both of these bands are recognized and stained by affinity-purified anti-peptide-A antibodies. This recognition is specific Z00E;813 since the unrelated marker proteins in the left-most lane of the right-hand pair are not recognized by the anti-peptide-A anti-ibodies, although they are present in high concentration as demon-,strated in the ].eft_hand silver-stained lanes (Fig. 10). The pre-Iimmune serum from this same rabbit also does not recognize the two ,bands of purified CNTF. These results indicate that there are at least two different forms of CNTF which differ by ca. 500 daltons .
!in molecular weight on reducing SDS-PAGE.

To prepare anti-peptide-A antibodies, synthetic peptide A was conjugated to Keyhole Limpet Hemocyanin (KLH) to enhance its antigenicity. For conjugation, 1 mg of peptide A and 1 mg of KLH

.:(Calbiochem, La Jolla, CA) in 50% glycerol were dissolved in 0.5 'm1 of PBS (20 mM sodiiaa phosphate buffer, pH 7.4, containing 0.15 M NaCl). 10% glutaraldehyde was added dropwise with mixing to a 11final concentration o:f 1%, and the reaction was allowed to stand !at room temperature overnight with mixing, then diluted to 5 ml ~,with PBS. The conjugation mixture was emulsified 1:2 with complete Freund's adjuvant and injected subcutaneously into multiple dorsal sites in two New Zealand white rabbits at ca. 100 g peptide A per rabbit. Three weeks later, each rabbit received ~
;;a booster dose of 50 g of conjugated peptide A in incomplete 1Freund's adjuvant. Thereafter, similar booster injections were ,, administered at 2-week intervals until the antiserum gave a titer of at least 100,000 in an ELIZA assay (Tainer et al., 1984, Nature ,312:127) using peptide A-coated wells. Sera were prepared from ;~:006813 blood collected from the ear vein 5 weeks after the initial injection and biweekly thereafter. Sera were stored at -70 C.
To prepare a peptide affinity column, peptide A was covalently attached to a chromatography column matrix as follows:
To 8 mg of peptide A dissolved in 0.4 ml of PBS containing 4 M
,;guanidine hydrochloride was added 4.5 ml of 0.1 M NaHCO31 pH 8.0, ,and 0.5 M NaCl. One gram of freeze-dried activated CH Sepharose 4B (Pharmacia) was washed and swelled in 200 ml of 1 mM HC1 and immediately transferred to the solution of peptide A. The mixture was rocked overnight at 4 C. The gel was then sedimented in a clinical centrifuge and the supernatant saved for determining the ,:amount of peptide A that became coupled to the matrix. Fifteen ml ,of 0.1 M TRIS buffer, pH 8.0, was added to the gel pellet and !incubated at room. temperature for 2 hr to block unreacted coupling Igroups on the gel matrix. The gel was then packed into a column 11(3 ml bed) and washed three times with the following buffer sequence: (1) 10 bed volumes of 0.1 M acetate buffer, pH 4.0, containing 0.5 M NaCl; (2) 0.1 M TRIS buffer, pH 8.0, containing 0.5 M NaCl. Finally, the column was equilibrated with PBS con-itaining 0.02% sodium azide. The difference in the concentration of free amino groups was determined in the original peptide A
Isolution and in the supernatant after conjugation, using fluores-!camine (Chen et a.l., 1978, Arch. Biochem. Bionhvs, 189:241;

Nowicki, 1979, Anal. Letters 12:1019). This analysis showed that 92-95% of the peptide was lost from solution and had become conju-gated to the Sepharose gel matrix.

Prior to affinity purification of the anti-peptide A anti-8 ml of immunized rabbit serum was dialyzed overnight body, against 2 liters of PBS. The peptide A-Sepharose column was washed sequentially with 10 bed-volumes of each of the following:
!10.1 M glycine-HC1, pH 2.5; PBS; 0.1 M triethylamine, pH 11.5; then PBS. The dialyzed serum was passed through the column three times to insure complete binding of anti-peptide-A antibodies. The column was washed with 20 bed-volumes of PBS, then eluted sequen-!tially with 4 bed-volumes each of the following: 0.1 M
glycine-HC1, pH 2.5; PBS; 0.1 M triethylamine, pH 11.5; then PBS.
One ml fractions were collected. The eluates from the glycine and triethylamine washes were neutralized immediately with 1 M TRIS, pH 9 and 7, respectively, and aliquots assayed for anti-peptide A

!antibody with an ELIZA assay using peptide A-coated wells. The highest titer fractions (typically within 3 bed-volumes of the start of glycine and triethylamine elution) were pooled and ;')dialyzed against PBS. After removing particulate matter by brief centrifugation, the af'finity-purified anti-peptide A antibody supernatant was stored at -70 C.

Example 4 !Cloninc the Gene for SN-CNTF
I~.
The ultimate goal. of the work to be described is to clone and !'express the human SN-CNTF gene in order to prepare material suitable for usES in human pharmaceutical preparations. Since the peptide sequences obtained are for rabbit SN-CNTF and the rabbit and human sequences may not be identical, it is prudent to first obtain clones of the rabbit gene via hybridization with synthetic ioligonucleotides based on the protein sequence and to employ the rabbit clones as hybriciization probes in screens for the human !gene.

;i Both the genomic and messenger RNA (mRNA) sequences encoding rabbit and human SN-CN'rF will be obtained. The mRNA sequence will !be useful for expressing the protein, whereas the genomic sequence will be essential for understanding the structure and regulation of the gene for SN-CNTF. In order to obtain these sequences, both irabbit a'nd human genomic libraries and rabbit and human cDNA
libraries made from mRNA isolated from sciatic nerves will be screened. In the process of obtaining the gene corresponding to the sequence of rabbit or human SN-CNTF, it is also possible to screen for structurally closely related genes that may represent !,'additional members of this family of neurotrophic factors.
A. SN-C'Sen To isolate the rabbit genomic sequences encoding SN-CNTF, a i';rabbit genomic library (Clontech) will be plated on the E.coli nm538 bacterial strain and approximately 1,000,000 recombinant ;,clones will be screened. Regions of the protein sequence of jlrabbit SN-CNTF that can be represented by the fewest codons will , be reverse-translated and corresponding degenerate oligonucleotide ,probes will be synthes3ized. The rabbit oligonucleotides will be labeled by kinasing according to the standard protocol of Maniatis et al. (1982, Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Laboratory). The DNA kinase is obtained from US

ZUOf S13 Biochemical Corp. and the gamma labeled ATP is obtained from ICN.
Oligonucleotides will be labeled to a specific activity of at least 1,000,000 cpm per picomole.

Upon plating of the genomic library, approximately 1 million !,plaques will be transferred onto duplicate nitrocellulose filters.
The filters will then be processed according to the methods of Maniatis et al. (1982, ibid.) and hybridized overnight with radioactively-labeled oligonucleotide probe. The hybridization i'cocktail will include 6X SSCP, 2X Denhardt's, 0.05% sodium pyroophosphate, 1mM EDTA, 0.1% SDS, 100 ug yeast tRNA (Sigma), pH
õ8Ø The temperature of hybridization will be several degrees ''below the calculated Tm of the oligonucleotide. Clones that hybridize with several probes based on different regions of the protein sequence will be plaque purified and the regions of !hybridization will be sequenced by dideoxy termination method (Sanger et al., 1977, Proc. Natl. Acad. Sci. 74:5463) using HSequenase (US Biochemicals Corp.) in order to identify those jclones that encode the SN-CNTF protein sequence.

B. SN-CNTF m Seauences Total cellular RNA will be obtained from rabbit and human sciatic nerves. The tissue will be homogenized in a guanidinium thiocyanate/beta-mercaptoethanol solution and the RNA will be ;:purified by sedimentation through cesium chloride gradients (Glison et. al., 1974, Biochemistry 13:2633). Polyadenylated RNA
will be selected by chromatography on oligo(dT)cellulose (Avid and Leder, 1972, Proc. Nat.l. Acad. Sci. 69:408). Quantitative RNA blot OZoos813 hybridization analysis will be performed with "antisense"
oligonucleotide probes to estimate the prevalence of SN-CNTF
sequences in each RNA preparation and to thereby estimate the nuinber of independent clones one would need to screen to have at least a 99% probability of obtaining CNTF clones. Sufficient .doublestranded complimentary DNA will be synthesized as described by Gubler and Hoffman, 1983, Gene 25:263, and inserted into the ,,lambda gem2 vector (Promega Biotech) according to Palazzolo and Meyerowitz, 1987, Gene 52:197.

Rabbit SN-C',NTF encoding clones will be identified by hybridization of recombinant phage plaques as described above. The identities of the clones will be verified by determination of 1;nucleotide sequences in order to determine correspondence with the entire known protein sequence. Screens of the human sciatic nerve cDNA library will be conducted with randomly primed rabbit SN-CNTF

!;cDNA probes (Feinberg and Vogelstein, 1983, Anal. Biochem. 132:6), which is a more reliable procedure for detecting cross-species hybridization than the use of the smaller oligonucleotides used to screen the rabbit cDNA libraries.

The Polymerase Chain Reaction (PCR) (Saiki et al., 1988, Sci-I'ence M:487) was used to amplify DNA fragments corresponding to rabbit CNTF amin.o acidl sequences. Such DNA fragments were ampli-jlfied from human and rabbit genomic DNA and rabbit sciatic nerve and sympathetic ganglion cDNA. The amplified DNA fragments were subcloned and sequenced using standard techniques (Maniatis et al., 1982, Molecular Cloning: A laboratory manual, Cold Spring Harbor, New York)i.

The DNA fracFnnents obtained by PCR were also used as probes to Iscreen a rabbit aciatic: nerve cDNA library and a human genomic DNA
library. A positive rabbit cDNA clone and positive human genomic clones were purified azid partially sequenced. The sequence of the open reading frame corresponding to the coding (mRNA equivalent) !;sequence for rabbit or human CNTF confirmed the sequence of the ,.
DNA fragments of the coding region obtained using PCR. The , resulting coding sequerices for rabbit and human CNTF are given in Figures 11 and 12, respectively.

Portions of the amino acid sequence obtained from rabbit SN-CNTF were reverse translated into the degenerate oligonucleo-tides #'s 1, 13, 7, and 12 and their complements #'s 3, 14, 8, and ';17. The amino acid sequence (on top) and the location and number-~ ing of the correspondirig sense and anti-sense degenerate ;,oligonucleotides (undei-neath) is given below:

Y-V-R-H-Q-G-=L-N-K--N-I-N-L-D-S-V-D-G-V-P-M-A
( 5 ~ ) ***,tl****,t* *,r*ir13****,r ****rr7**,t** ( 3 ~ ) j ( 3 f) ****3****** ****14***** *****8*,r*** ( 5 1) K-L-W-G-L-R-=V-L-Q-=E-L-S

(5- ) **,t*12*****~ 3~ ) ;~(3~) *,t**17**,r**~5~) The nucleotide sequence of the sense version of each of the degenerate oligonucleot:ides is given below (where N corresponds to any nucleotide):

1#1 5'- TA(T/C) GTN AA (A/G) CA(T/C) CA(A/G) GG -3' #13 5'- AA(T/C) AA(A/(3) AA(T/C) AT(A/T/C) AA (T/C) (C/T)T -3' #7 5'- GA(T/C) GGN GTN CCN ATG GC -3' #12A 5'- AA(A/G) TT(A/G) TGG GGN TT(A/G) AA -3' 1#12B 5'- AA(A/G) TT(A/(',) TGG GGN CTN AA -3' #12C 5'- AA(A/G) CTN TGG GGN TT(A/G) AA -3' , #12D 5'- AA(A/G) CTN TGG GGN CTN AA -3' I! Separate Po:Lymerase Chain Reactions were performed using Heither human or irabbit genomic DNA as template and oligonucleo-';
!'tides #'s 1 and 8 or #'s 1 and 17 as primers, in order to amplify the correspondin<3 regions of the human and rabbit CNTF genes.
Southern blots of the reaction products (probed with radiolabeled ~!oligonucleotide #13) revealed the existence of labeled bands ca.
66 base pairs (#'s 1 and 8) and ca. 366 base pairs (#'s 1 and 17) in size.

The same PCR reacitions described above were run using cDNA
prepared either from rabbit sciatic nerve or rabbit sympathetic ganglion mRNA. RNA was prepared from rabbit sciatic nerves or sympathetic ganglia anci passed over an oligo-dT column to select ';for messenger RNik (mRNA), as described above. Complementary DNA
(cDNA) was prepared wi-th reverse transcriptase using the mRNA as ,!template and oli(~o-dT as primer. When PCR was performed using ,either cDNA as template and either oligonucleotides #'s 1 and 8 or #'s 1 and 17 as primers, fragments were amplified which had the same sequence as those amplified from the rabbit genomic DNA
(Figure 11). This indicates that there are no intervening sequences (introns) in the protein coding region of the CNTF gene between oltgonucleotides #'s 1 and 17.

fi An additional strategy was used to obtain more of the coding h (messenger RNA e(juivalent) sequence for rabbit CNTF:
Double-stranded cDNA was prepared using rabbit sciatic nerve mRNA
as template and an oligo-dt/Not I linker adapter as primer.

;,Subsequently, an EcoRI,/XmnI-linker adapter (5'- AATTCGAACCCCTTCG
.'-3') was added to the 15' -end of the double-stranded cDNA by blunt-end ligation (Maniatis et al., ibid.). The Polymerase Chain !Reaction was performed using this cDNA as a template and oligonucleotides #8 and EcoRI/XmnI-linker-adapter as primers. A
Southern blot of the reaction products (probed with radiolabeled oligonucleotide #13) revealed the existence of a labeled band approximately 200 base pairs in size.

To obtain cDNA clones for rabbit CNTF, a cDNA library was !'prepared from rabbit sciatic nerve poly(A)+ mRNA by the methods described above, except for the use of a lambda gtlO vector (Stratigene) in place of lambda gem2. Approximately 4x106 plaques :of this library were screened using a probe prepared by randomly 1abeling an M13 subclone of a PCR fragment obtained from rabbit !1sympathic ganglion cDNA as template and oligos #8 and Eco RI/Xmn I

liker adapter as primers (see above). The single primary positive 1was plaque purified through a tertiary screen. Upon digestion with Eco RI, the DNA from this clone yielded three fragments in addition to the lambda arms: ca. 2.0, 1.5, and 0.6 kb in length.
By Southern blot analyisis the 1.5 kb fragment was shown to hybridize to other CNTF-specific oligonucloetides and PCR
fragments referred to above. The DNA sequence of this 1.5 kb cDNAj fragement established that it contained the ntire coding sequence-~
ifor rabbit CNTF (Fig. 11).

;! To obtain genomic DNA clones for human CNTF, approximately Ax106 plaques of a human genomic DNA library in vector lambda !
1,EMBL3 were screened using a probe prepared by randomly labeling an !M13 subclone of a PCR fragment obtained from human genomic DNA as template and oligos #1 and #17 as primers (see above). Six of the i!primary positives were plaque purified by subsequent screening and ~found to hybridize to additional CNTF-specific oligonucleotides and PCR fragments. A 0.6 kb Bam HI restriction fragment from one ;,of the clones hybridizing to oligo #13 was subcloned into Bam HI-;;cut M13mp19 and sequenced.

The DNA sequences of the fragments obtained by PCR from !lrabbit material from the rabbit,~cDNA clone were combined based on regions of overlapping sequence to give the cloning (mRNA
equivalent) sequence f'or rabbit SN-CNTF presented in Fig. 11. The 'DNA sequences of the f'ragments obtained by PCR from human genomic ,DNA and from human genomic clones were combined based on regions of overlapping sequence to give the coding sequence for human SN-CNTF presented in F'ig. 12. The rabbit and human nucleic acid :sequences for CNTF are ca. 89% identical (Fig. 12),. indicating that the rabbit and human sequences are from homologous genes encoding CNTF. As shciwn in Figure 11, parts of the nucleic acid sequence for rabbit CNTF are confirmed by the amino acid sequences obtained from purified SN-CNTF and reported in earlier examples.
The Polymerase Chai_n Reaction was performed using the tem-plates and primers, described above. The program for the reactions was as follows: denaturation cycle, 1 min- at 95 C; annealina cycle, 1.5 min. at. 40 C; and extension cycle, 4 min. at 72 C. The reaction was performed f'or 30 cycles. The reaction products were electrophoresed th.rough 2% agarose gels and transferred onto Zeta-Bind membranes (BioRad, Richmond, CA) for Southern blotting. In order to identify the amplified portions of the CNTF coding the Southern blots were probed with a radiolabeled oligonucleotide #13, known from the CNTF protein sequence to lie between the oligonucleotides used to prime the reaction. The labeled bands obtained after Southern blotting were cut from the original gels and prepared for cloning by repairing the ends with Klenow fragment of the DNA polymerase (New England Biolabs, MA) in the presence of all four dNTPs and kinasing the DNA by with T4 polynucleotide kinase (US Biochemical C'orp., Cleveland, OH) and ATP. The appropriate DNA pieces wrere then subcloned into M13mp10 Smal-cut vector (dephosphorylatedl; commercially available from Amersham Corp., Arlington Heights, IL). The recombinant phages containing the fragment of interest. were identified by Benton & Davis (1977, Science 196:180) screening procedure using radiolabeled oligonucleotide #13 as a probe. These recombinant clones were grown up to obtain sufficient quantities of single-stranded DNA for sequencing and 4.

were then sequenced by the dideoxy chain termination method (Sanger, et al., ibid.) The hybridization conditions when long, randomly-labeled DNA
probes were used were !5X SSCP, 2X Denhardt's, 2mM EDTA, 0.05%
sodium pyrophosphate, 0.1$ sodium dodecyl sulfate (SDS), 250 g/

:,~ml of herring sperm DNA (non-specific competitor), pH 8Ø
;IHybridization wa1s carried out at 65 C and blots or filters were :washed at 65 C iin 0.1X SSCP and 0.1% SDS. The hybridization ~~conditions for slhorter, oligonucleotide probes were 6X SSCP, 2X
',,'Denhardt's, 2 mM EDTA, 0.05% sodium pyrophosphate, 0.1% SDS, 100 ' g/ml yeast tRNA (non-specific competitor), pH 8Ø The temperature of hybridization and the conditions for washing blots and filters were individually adjusted for the GC content of each oligonucleotide (Maniatis et al., ibid.).

Example 5 ExDression of Genes Encodinc SN-CNTF in Animal Cells Animal-cell expression of SN-CNTF requires the following steps:

a. Construction of an expression vector;
b. Choice of a host cell line;

c. Introduction. of the expression vector into host cells;
and d. Manipu.lation of recombinant host cells to increase expression levels of SN-CNTF.

(a) SN-CNZ'F expression vectors designed for use in animal cells can be of several types including strong constitutive expression constructs, inducible gene constructs, as well as thosel designed for expression in particular cell types. In all cases, promoters and other gene regulatory regions such as enhancers (inducible or not) and polyadenylation signals are placed in the appropriate location in relation to the CDNA sequences in plasmid-based vectors. Two exaniples of such constructs follow: (1) A
construct using a stronc[ constitutive promoter region should be made using the simian virus 40 (SV40) gene control signals in an arrangement such as that: found in the plasmid pSV2CAT as described by Gorman et al. in Mol. Cel. Biol. 2:1044-1051, 1982. This plasma should be manipulated iri such a way as to substitute the SN-CNTF
CDNA for the chlorampheriicol acetyltransferase (CAT) coding sequences using standard molecular biological techniques (Maniatis et al., su ra .(2) An inducible gene construct should be made utilizing the plasmid PN[K which contains the mouse metallothionein (MT-1) promoter region (Brinster et al., Cell 27:228-231, 1981).
This plasmid can be used as a starting material and should be manipulated to yield a rrietal-inducible gene construct.

(b) A number of' animal cell lines should be used to express SN-CNTF using the vectors described above to produce active protein. Two potential cell lines that have been well characterized for their ability to promote foreign gene expression are mouse Ltk- and Chinese hamster ovary (CHO) dhfr cells, although expression of SN-CNTF is not limited to these cell lines.

Animal cell lines that can be used for expression in addition;

to those mentioned above include the monkey kidney cell COS-7, which is useful for transient expression, and the human embryonic ,kidney cell 293.

(c) Vector DNA should be introduced into these cell lines ~using any of a niuaber of gene-transfer techniques. The method employed here involves the calcium phosphate-DNA precipitation technique described by S.L. Graham and A.S. van der Eb (Virology 52:456-467, 1973) in which the expression vector for SN-CNTF is !co-precipitated with a second expression vector encoding a selectable marker. In the case of Ltk- cell transfection, the i'iselectable marker is a thymidine kinase gene and the selection is ~as described by 'Wigler et al. in Cell 16:L777-785, 1979 and in the ,!
j case of CHO dhfr cells, the selectable marker is dihydrofolate l!reductase (DHFR) whose selection is as described by Ringold et al.
in J. Mol. Appl. Genet. 1:165-175, 1981.

(d) Cells that express the SN-CNTF gene constructs should then be grown under conditions that will increase the levels of ,,production of SN'-CNTF. Cells carrying the metallothionein !promoter constructs can now be grown in the presence of heavy metals such as c,admium which will lead to a 5 fold increased utilization of the MT-=i promoter (Mayo et al., Cell ?.: 99-108 ) subsequently leading to a comparable increase in SN-CNTF protein ,;levels. Cells containing SN-CNTF expression vectors (either SV40-or MT-i-based) along with a DHFR expression vector can be taken through the gene ampl:Lfication protocol described by Ringold et al. in J. Mol. Apl. Genet. 1:165:175, 1981, using methotrexate, a competitive antagonist of DHFR. This leads to more copies of the DHFR genes preseint in the cells and, concomitantly, increased copies of the SN.-CNTF genes*which, in turn, can lead to more SN-I,CNTF protein beiing produced by the cells.

An additional exp:ression vector, pCMVXVPL2, was utilized to i;express the coding sequence for rabbit CNTF transiently in COS-7 cells. This plasmid vector contains the cytomegalovirus (CMV) immediate early promoter and enhancer as described by Boshart et al. (Cell 41:521-530, 1985). This plasmid can be constructed as shown in Figure 13. The polyadenylation signal is provided by simian virus 40 (SV40) sequences (map coordinates 2589-2452; see i!Reddy et al., Science ,2Q0:494-502, 1978). The SV40 origin of 1replication is included in this plasmid to facilitate its use in COS cells for transient expression assays.

Rabbit SN-CNTF was transiently expressed in COS-7 cells as i!follows: The 1.5 kb Eco RI restriction fragment of a rabbit ,Isciatic nerve cDNA clone containing the entire coding region for rabbit SN-CNTF (Example 4) was subcloned into the Eco RI-cut I!expression vector pCMVXVPL2. A single clone was selected which gave restriction fragments, after digestion with Sac I and Bam HI, that were of the size predicted for insertion of the 1.5 kb fragment into the vector in the correct orientation for CNTF
expression. Plasmid DNA from this construct was prepared by the method of alkaline lysis followed by CsCl density centrifugation (Maniatis et al., ibidl.). This DNA was transfected into COS-7 cells by the method of Sompayrac and Danna.(Proc. Natl. Acad.
Sci., U.S.A. 78:7575-7578, 1981). As a control, equivalent COS
cell cultures were transfected with plasmid vector DNA with no insert.

Forty-eight, hours after transfection, the overlying medium and cell pellets were harvested. Cell pellets were extracted by brief sonication. on ice in 20 mM sodium phosphate, pH 6.7 containing 1 mM EDTA, 0.1mM PMSF, and 0.1 pM pepstatin. Serial Iidilutions of both the cell extract and the overlying medium from each culture were assayed for activity in the ciliary ganglion survival assay.

The cell extracts from cultures transfected with vector containing the CNTF cDNA fragment had a titer of ca. 15,000 TU/ml.
in the bioassay and approximately 50 ng/ml of CNTF as determined by Western blot analysis. Neither the cell extracts from cultures !itransfected with vector alone nor the overlying medium from any cultures displayed any detectable bioactivity or CNTF protein by !Western blot ana-lysis.. This result clearly demonstrates that the !,CNTF cDNA we have cloried encodes a protein with the anticipated bioactivity of authentic SN-CNTF.
Examnle 6 Purification of SN-CNTF from Recombinant Animal Cells fl Since SN-CNTF is expected to be synthesized by cells like the natural materia]., it iLs anticipated that the methods described above for purification of the natural protein will allow similar purification anci characterization of the recombinant protein.

It will be apparent to those skilled in the art that various modifications and, variations can be made in the processes and products of the present invention. Thus, it is intended that the present invention cover the modifications and variations of this ainvention provided they come within the scope of the appended claims and their equivalents. Also, the term SN-CNTP is intended to encompass all origins of species, unless the term is immediately preceded by a specific origin of species.

ExamT>le 7 ,Production of rec:ombinant human CNTF

As one embodiment of the present invention, a system for producing recombinant human CNTF was established in the bacterium ,Escherichia coli. Two alternative methods for constructing the !'DNA to be expressed and two different expression vectors were used. All of the:se variant expression systems produce soluble !CNTF protein in high yield that is biologically active in the bacterial cell extract. The methods for establishing these production systems are described below. Please note in what follows that the position of a feature given in brackets (e.g., l[233]) refers to the ntunber of bases at which the feature begins ~'downstream of the A[1] in the initial ATG codon in the human coding sequence for CNTF (Fig. 12).

1. Preparation of DNA for the Expression of CNTF

Stratecrv 1 i:or coiistructina the 5' End Fig. 14): The human genomic DNA clone for CNTF in phage lambda EMBL3 from Example 4 was digested with the restriction enzymes Sal I and Hind III and a 4.3-kb fragment wras gel. purified that contained the CNTF coding sequences iipstream of the Hind III site [233]. This 4.3-kb fragment also contains a single, approximately 1.3-kb intron 1[114-115] in the coding sequence. To allow expression in ;!bacterial cells, the ir.Ltron was removed by site-directed I;mutagenesis in vi.tro using a synthetic oligonucleotide as described by J.A. McClary, F. Whitney, J. Geisselsoder (1989) !~Biotechniaues 7: 282-289.

A. IrLtron deletion by site-directed mutagenesis using DtiaQemici vector and genetic selection Site-directed mutagenesis was carried out to delete the ca.

1.3-kb intron in the 4.,3-kb Sal I/Hind III DNA fragment subcloned into a phagemid vector, Bluescript SK M13(-) (Stratagene). This "vector was choseri since it can accept the large size (ca. 4.3 kb) of the SalI/Hind][II insert. Phagemid vectors are plasmid vectors containing the bacteriophage fl intergenic region that allows rescue as single--stranded DNA. In addition, phagemid vectors have a number of advantages over the single-stranded M13 bacteriophage vectors. Since the phagemids are less than half the size of M13 ,vectors, which prefer inserts with sizes less than ca. 2.3 kb, larger inserts can be isubcloned more easily into phagemids and chances of spontaneous deletions are reduced. Another advantage of phagemids is ithat the inserts can be sequenced directly from double-stranded supercoiled DNA, thereby simplifying their characterization.

Mutagenesis was carried out using the Muta-Gene In Vitro Mutagenesis kit from BioRad. The host cell for template preparation for mutagenesis is the E. coli strain CJ236 (Genotype:' dut, ung, thi, rel Al, pCJ105 [capr]). CJ236 carries a F'-factor selectable by chloramphenicol, thus allowing for rescue of ,single-stranded phagemid DNA using an appropriate helper phage, ;,R408 used in the present work. The rescued single-stranded !phagemid DNA is partially substituted with uracil, due to the dut ;
'(dUTPase) and ung (uracil N-glycosylase) mutations in CJ236.
Template DNA, substituted with uracil and used for mutagenesis, is selectively destroyed when transformed into host cells that icontain wild-type ung loci, such as DH5a in this case, thus ;allowing preferential replication of the newly synthesized mutated DNA.

To perform mutagenesis, the gel-purified 4.3-kb SalI/HindIII
I!fragment was ligated into SalI/HindIII digested and gel purified lBluescript SR M13(-). The ligated DNA was introduced into CJ236 ~,made competent by Hanahan's method as described in J. Mol. Biol.
1166:557 (1983). Transformants were selected on plates containing 1150 g/ml ampicillin (to select for the phagemid) and 30 g/ml chloramphenicol (to select for retention of the F'-factor).
Transformants were checked for the presence of the correct insert !by restriction e:nzyme analysis of transformant DNAs. A
''transformant ca=-rying the correct insert (pSHM-D19) was used in genesis experiment.
subsequent mutac Z

Single-stranded template from pSHM-D19 was rescued using phage R408 as he:lper pllage. CJ236 containing pSHM-D19 was grown in Luria broth containing ampicillin (50 g/ml) and chloramphenicol ~(30 g/ml) to an A600 of ca. 0.3. Cells were infected with R408 helper phage at a multiplicity of infection of 20, then shaken at 37 C for between 8-14 hours. Single-stranded template was extracted from rescued phagemids.

Site-directed intron deletion mutagenesis was performed using a 71-base oligonucleotide (Oligonucleotide 1 in Figure 16).
Oligonucleotide 1 has bases 1-30 complementary to the coding strand immediately downstream (3') and bases 31-71 complementary to the coding strand iimmediately upstream (5') of the intron to be !deleted from the CNTF genomic DNA. For use in mutagenesis reactions, the oligonucleotide was phosphorylated using T4 poly-nucleotide kinase. Mutagenesis reactions using the BioRad Muta-Gene kit was performed according to manufacturer's specifications, except that DNA from mutagenesis reactions was used to transform E. coli strain D:H5a. Deletion mutants were characterized by , restriction enzyme mapping of the DNAs and DNA sequencing of double-stranded DNAs from mutants with the appropriate restriction maps. pMCN-2a was a correctly-deleted intron-less mutant in the Bluescript phage:mid.

B. Reconstruction of the 5' end of the CNTF gene for exDression The 5' end of the CNTF coding sequence was reconstructed in order to make certain changes which do not alter the amino acid 22,00E;813 sequence coded for but. which are likely to increase the efficiency of expression in. bacterria. The partially overlapping, complementary ol.igonuc:leotides 2 and 3 (Fig. 16) were synthesized, gel purified, and annealed together. Oligonucleotide 2 codes for the amino acids preser.it in human CNTF upstream of the Nhe I site [66]. The coding sequence of oligonucleotide 2 contains several bases that diffe:r from those present in the human gene (compare Figs. 12 and 16). These changes were made either to alter the human codon usacfe to t:hat used preferentially by E. coli (according to deBoer and Kastelein in From Gene to Protein: Steps Dictating the Maximal Level of Gene Expression (1986) Davis and Reznikoff, eds. pp. 225-283, Butterworths, NY) or to generate a Bgl II site (Fig. 16), put into the sequence for ease of subsequent genetic manipulations. Oligonucleotide 2 also codes for a translational coupler toward the 5' end (Fig. 16) to promote effective translation. Annealed oligonucleotides 2 and 3 have a Bam HI overhang at the 5' end and a Nhe I overhang at the 3' end for ease of sub,sequent ligation and cloning (Figs. 14 & 16). A
restriction enzyme search of the DNA sequence of the human CNTF
gene showed a unique Nhe I recognition sequence [66] (Fig. 12).
Therefore, oligonucleotides 2 & 3 were designed with a Nhe I
overhang to allow them to be joined to the remaining 3' fragment of the gene after digestion with Nhe I.

C. Joining of Oliaonucleotides 2 & 3 to the intron-deleted codina secxuences Oligonucleotides :t and 3, containing the rebuilt amino-terminus of the CNTF gene, were annealed together and ligated to Nhe I cut pMCN-2a. Ligated DNA was then digested with Bam HI and Hind III to release the DNA fragment referred to as CNTF-Synl which contains DNA sequences suitable for expression in E.coli and 1encoding human C1qTF upstream of the Hind III site [233].

i) Strateav 2 for constructinv the 5' End (Fig. 15): An alternative strategy was carried out in which the intron was not removed by site-directed mutagenesis but rather an entirely synthetic DNA sequence was prepared coding for CNTF upstream of the Hind III site [233], but without the intron. To form this synthetic DNA construct, oligonucleotides 5 through 10 in Fig. 17 :were synthesized. The following oligonucleotides were designed to hform partially overlapping, double-stranded pairs: 5&6, 7&8, 9&10.

Each double-strainded pair contains single-stranded overhangs designed to allow ligation together in the order 5&6-7&8-9&10.
The oligonucleotides were gel purified, annealed, and ligated together into a single 261 base pair double-stranded DNA

oligonucleotide, referred to as CNTF-Syn2. This synthetic DNA
also contained: (1) altered codons to fit E. coli codon usage preferences (compare Figs. 12 and 17); (2) the 5' translational coupler used above (Fig. 16 and 17); and (3) a 5' Bam HI overhang and a 3' Hind III overhang to facilitate ligation and cloning (Fig. 17).

Preoaration of the 3' End of the Expression Construct (Figs.
14 or 15): The human genomic DNA CNTF clone in phage lambda EMBL3 from Example 4 was cut with the restriction enzyme Hind III and a 2.1-kb fragment was ge.l purified containing the CNTF coding sequences downstream of the Hind III site [233]. This 2.1-kb fragment was cloned into Hind III-cut plasmid pEMBL8 (Dente et {lal., 1983, Nucleic Acids Res. 11:1645). A Spe I site [613] was inserted into the 2.1-kb insert DNA by oligonucleotide directed mutagenesis 13 base pairs downstream of the stop codon ending the !~CNTF sequence using the synthetic Oligonucleotide 4 (Fig. 16).
!The mutated plas.mid was cut with Hind III and Spe I to release the downstream coding fragment which was gel purified and is referred to as CNTF-Syn3 (containing the coding sequences for human CNTF
downstream of the Hind III site [233]).

Preoaration, of the Complete Expression Construct CNTF-Synl was ligated to CNTF-Syn3 to produce CNTF-Synl/3 (Fig. 14) and CNfTF-Syn2 was ligated to CNTF-Syn3 to produce CNTF-Syn2/3 (Fig. 15) in order to construct two alternative DNA
fragments each of which codes for human CNTF and has suitable modifications of the DNA sequence to promote efficient expression ~in E. col . These DNA fragments were then expressed in E. coli after being subcloned into: (A) a bacterial expression vector, ipT5T, based on the T7 phage promoter; or (B) a bacterial expression vector, pT3XI-2, based on a hybrid lactose and !!tryptophan operon proinoter ('Tac').

2. Exvression of CNTF usina an expression vector based on the "T7 cromoter" system (Please refer to Fig. 17 for features of the vector):

2oaCS13 A. Descript:Lon of T T

The T7 promoter based expression vector pTST is essentially the same as pJU1003 described by Squires, et. al., J. Biol. Chem.
(1988) 263:16297.-16302, except that there is a short stretch of iDNA between the unique Bgl II site 5' to the T7 promoter and the Cla I site in the tetracycline resistance gene. The sequence of this DNA is:

ATCCATGATA AGCTG'TCAAA CATGAGAATT GAGCTCCCCG GAGATCCTTA GCGAAAGCTA
~! Cla I

1 AGGATTTTTT TTAQ&TCT
Bgl II

B. Construction of the complete expression vector The gel-purified vector was linearized with Bam HI and Spe I
~restriction enzymes. CNTF-Synl/3 was mixed with the linearized vector and ligated to form the expression construct pT5T:CNTF-Synl/3. (See Fig. 14 for the general outline of vector ;construction).
C. Exvression o recombinant human CNTF in E. coli.
pT5T:CNTF-Synl/3 was transformed into the E. coli strain BL21(DE3) for expression. This strain described in Studier and Moffat J. Mol. Bliol. (1986) 189:113-130, contains the T7 RNA
i;polymerase gene under control of the IPTG inducible lac promoter on a nonexcisabl.e lyscrgenic lambda bacteriophage. Of 10 transformants screened, two clones were found to be expressing an IPTG-inducible protein migrating at a molecular weight in the range appropriat:e of CNTF (ca. 24 kD). These two clones have been designated as pT5T:CN7"F-Synl/3-5a and 5c. DNA sequencing of 2oosSs3 pT5T:CNTF-Synl/3,-5a and 5c confirmed that the sequences of the recombinants were correct.

High level expression of recombinant CNTF was achieved by growing the cells in Luria broth with 15 g/ml tetracycline up to ,a cell density corresponding to an A600 of 0.5-0.8. Cells were grown for 1.5-4 hours either without IPTG ("uninduced") or IPTG
was added to a final concentration of 1.0 mM ("induced"). IPTG

I(isopropylfl-D-th.iogalatopyranoside) is an inducer of the lac operon whose presence should result in indirect activation of the expression vector's T7 polymerase and increased levels of expression of CNTF.

D. Analysis of egpressed orotein by SDS volvacrvlamide gel electrophoresis followed by staining with Coomassie stain or immunoblottincr Cells were harvested by brief centrifugation and dissolved directly in SDS-polyacrylamide gel sample buffer (0.025%
bromphenol blue, 10% glycerol, 1% p-mercaptoethanol, 2% SDS, 0.0625M Tris-HC1, pH 6.8) and boiled for 2 min (Fig. 20 and Fig.

1!21). In cells transformed with pTST:CNTF-Syn1,3-5a and induced with IPTG for 2 hours (lane 5, Fig. 20) there is a band darkly stained with Coomassie stain running at the position expected of iCNTF (ca. 24kD). If the cells are grown without IPTG (lane 4, Fig.
20) there is much less of this band, as expected for a protein whose expression, is under control of the lac operon. Cells transformed with. pT5T vector without a CNTF insert do not show this band either induced (lane 3, Fig. 20) or uninduced (lane 2, Fig. 20). Lane 1 contains molecular weight standards.

An identical SDS-polyacrylamide gel was transferred to nitrocellulose and immunoblotted with affinity-purified antibodies!
to CNTF peptide A(E-S-Y-V-R-H-Q-G-L-N-R-N). In cells transformed with pT5T:CNTF-Syn1,3-5a and induced with IPTG for 2 hours (lane 115, Fig. 21) there is a dense band recognized by the !laffinity-purified antibodies to CNTF peptide A and running at the position expected of CNTF (ca. 24kD). If the cells are grown without IPTG (lane 4, Fig. 21) there is much less of this band.

1Cells transformed with, pT5T vector without a CNTF insert do not ishow this band either induced (lane 3, Fig. 20) or uninduced (lane 2, Fig. 20). Lan.e 1 contains molecular weight standards.

In addition, cells transformed with pTST:CNTF-Syn1,3-5a and ',induced with IPT'G for 2 hours were broken open by passage three !times through a French pressure cell. An aliquot of the crude cell Ilysate was separated into supernatant and pellet fractions by centrifugation at 20,000 rpm in JA-20 rotor (Beckman) for 15 min.
Aliquots of the crude lysate, supernatant, and pellet fractions, representing the! same amount of starting cell suspension, were 14lso run on the same EMS polyacrylamide gel, transferred to nitrocellulose and immunoblotted with affinity-purified anti-peptide A antibodies. The lysate supernatant (lane 8, Fig.
21) contained muich more immunoreactive CNTF than did the lysate i pellet (lane 9, Fig. 21). The supernatant CNTF level was !,comparable to that in the unfractionated lysate (lane 7, Fig. 21).
E. Bioactivitv of expressed CNTF

2oa6N13 Cella harveated by brief centrifugation were resuspended in 20mM Tria-HC1, pFi 8.2 at 1/35 the original volume of cell suspension, broken opeii by passage through a French pressure cell three times, and the crude cell lysate separated into supernatant ,and pellet fract:Lons by centrifugation at 20,000 rpm in JA-20 ,!rotor (Beckman) for 15 min. Serial dilutions of the cell supernatant fracition were assayed for their ability to promote the survival of ciliary ganglion nerve cells (as described in Example The supernatant showed significant bioactivity out to a !'dilution of 1:1,000,0010 (Fig. 22). The specific activity of recombinant human CNTF was estimated to be approximately 275 TU/

i!ng, based on bioactivity and on the amount of CNTF protein estimated from immunoblots. This specific activity is about twice i,the specific activity of the purified rabbit CNTF protein, iindicating that the recombinant CNTF is biologically active in the j-bacterial cell extract. Lysates of cells transformed with pT5T
'!without a CNTF insert exhibited no detectable bioactivity.
;.
The supernatant was also electrophoresed on a 15%
'polyacrylamide reducing SDS gel and sliced into imm wide slices that were extracted overnight in cell culture medium at 4 C with rocking and bioassayed. as described in Example 1. The inset to Figure 22 illustrates that there is a peak of bioactivity at I',fractions corresponding to 24 kD as expected for CNTF.
F. Amino acid secuence of expressed CNTF

The region around 24 kD was cut out of an SDS polyacrylamide gel similar to that run for Fig. 20 but without Coomassie 2oosSs3 staining. This material was sequenced by Edman degradation in an Applied Biosystems Protein Sequencer (as described in Example 2).
The following am3no acid sequence was obtained:

Jthe AFTEHS. The question mark corresponds to a C in human sequence (Fig. 12) which cannot be detected by this ,method. This sequence corresponds to that expected from human CNTF

12) and provides additional evidence that CNTF is being ,I;properly expressed. It also indicates that the amino-terminal methionine is removed during expression, leaving the alanine as the amino-ternainal amino acid in the expressed protein.

The above results demonstrate that immunologically cross-reactive CNTF has been expressed at high levels in a ibiologically active form, most of which is soluble after lysis of the bacterial cells.

3. Exvression of CNTF usina an expression vector based on a hybrid lactose and trvctophan operon vromoter ('Tac') system See Fia. 19 for f eatures of the vector ):

A. Descriotion of oT3BI-2 (modification of flRR223-3) The startizig plasmid for this construction was plasmid pRR223-3 purcha:sed from Pharmacia. Plasmid pKK223-3 carries a partial gene for tetracycline resistance. This non-functional gene was replaced by a complete tetracycline resistance gene carried on plasinid pBR322. Plasmid pKK223-3 was digested completely with Sph I and partially with Bam HI. A 4.4 kilobase pair fragment was gel purified and combined with a synthetic adaptor with the sequence:

5' GATCTAGAATTGTC.ATGTTTGACAGCTTATC;AT 3' 3' ATCTTAACAGTAC'.AAACTGTCGAATAGTAGC 5' and a 539 base pair fragment of DNA from a Cla I, Sph I digest of the tetracycline resistance gene of pBR322 (PL Biochemicals, 27-::4891-01). The resulting plasmid was designated pCJ1.

Next a Xho I linker purchased from New England Biolabs was inserted into plasmid pCJl's Pvu II site to form plasmid pCJX-1.
This insertion disrupts the rov gene which controls plasmid copy number. An Eco RI fragment containing the lac 1 gene was purified ifrom plasmid pMC9 [Calos, et al., Proc. Natl. Acad. Sci. USA

(1983), 80:3015-3019] then inserted into the Xho I site with Xho I
11to Eco RI adapters having the sequence:

5' TCGAGT'CTAGA 31 3' CAGATCTTTAA 5' The polylinker seiquence between the Eco RI and Pst I sites in plasmid pRR223-3 was next replaced with a polylinker sequence i!shown here:

5' AATTCCC:GGG TACCAGATCT GAGCTCACTA GTCTGCA 3' 3' GGGCCC ATGGTCTAGA CTCGAGTGAT CAG 5' The plasmid vector so obtained is designated pCJXI-1.

Finally, the tetracycline resistance gene was replaced with a similar gene which had the recognition sites for restriction ,enzymes Hind II]:, Bam HI, and Sal I destroyed by bisulfite mutagenesis. The following procedure was used to mutate the tetracycline resistance gene of pBR322. Plasmid pBR322 was cut with Hind III, then mutagenized with sodium bisulfite [Shortle and _ _ ___.~.._._~.~...__~.~....-...,., Nathans, Proc. Natl. Acad. Sci. USA (1978) 5:2170-2174]. The mutagenized DNA was ligated to form circular DNA, then cut with Hind III to linearize any plasmid that escaped mutagenesis. E.
coli JM109 [Yanisch-Perron,-et al., Gene (1985) 33:103-119] was transformed with the plasmid, then plated on selective media.
~Plasmids were isolated. from tetracycline resistance colonies and checked for loss of the Hind III site in the tetracycline resistance gene. The successfully mutated plasmid was designated pTl. A similar procedure was followed to mutagenize the Bam HI
site in pTl, yielding plasmid pT2. Plasmid pT2 in turn was mutagenized to remove the=Sal I site, forming plasmid pT3. A Cla I!I/Bsm I fragment, of pT3 carrying the mutated tetracycline resistance gene was isolated and used to replace the homologous Jifragment of pCJXI-1 tci form pT3XI-2. The mutated tetracycline resistance gene still encodes a functional protein.

B. Formation of oT3XI-2-410TC3FGFsvn (orevarinc the tac rp omot.er vector for CNTF) Initially a"gene" for basic Fibroblast Growth Factor (bFGF) was synthesized. This "gene" codes for the same sequence as that reported for FGF' by Sommer et al.(1987 Biochem. Bioyhvs.
Res.Commun. 141:67) but uses the codons that are found preferentially in highly expressed genes in E. coli. The structure of this gene is such that the coding portion is preceded bquplaraaediabAoeka~see Squires, et al., 1988, ibid.) to ensure efficient initiation of translation.

The FGF synthetic gene was first inserted into M13mp18 between the Eco RI and Hind III sites and sequenced. The structure of this gene is:

AATTCAGGA TCCGATCGTG GAGGATGATT AA_ATgzGGTAC CATGGCTGCT GGCTCCATCA
GTCCT AGGCT'AGCAC CTCCTACTAA TTTACCCATG GTACCGACGA CCGAGGTAGT
EcoRI BamHI RBS FGFstart Translational Coupler 3 CTACCCTGCC GGC'.ACTGCCG GAAGACGGTG GCTCCGGTGC TTTCCCGCCG GGCCACTTCA
,GATGGGACGG CCGTGACGGC CTTCTGCCAC CGAGGCCACG AAAGGGCGGC CCGGTGAAGT
AAGACCCGAA ACGTCTGTAC TGTAAAAACG GTGGCTTCTT CCTGCGTATC CACCCGGATG
;,TTCTGGGCTT TGCAGACATG ACATTTTTGC CACCGAAGAA GGACGCATAG GTGGGCCTAC
GTCGTGTCGA CGGCGTACGT GAAAAAAGCG ACCCGCACA TCAAACTGCA GCTGCAGGCTG
CAGCACAGCT TGCCGCATGC ACTTTTTTCC TGGGCGTGT AGTTTGACGT CGACGTCCGAC
AAGAACGTG GTGTTGTATC TATCAAAGGC GTTTGCGCAA ACCGTTACCT GGCTATGAAAG
TTCTTGCAC CACAACATAG ATAGTTTCCG CAAACGCGTT TGGCAATGGA CCGATACTTTC
AAGACGGTC GTCTGC:TGGC.TAGCAAATGT GTAACTGACG AATGTTTCTT CTTCGAACGTC
TTCTGCCAG C.AGACGACCG ATCGTTTACA CATTGACTGC TTACAAAGAA GAAGCTTGCAG
;TGGAAAGC.A ACAACTACAA CACCTACCGT TCTCGTAAAT ACACTTCTTG GTACGTTGCTC
ACCTTTCGT TGTTGATGTT GTGGATGGCA AGAGCATTTA TGTGAAGAAC CATGCAACGAG
TGAAACGTA CCGGCCAGTA CAAACTGGGT TCCAAAACTG GCCCGGGTCA GAAAGCAATCC
ACTTTGCAT GGCCGGTC,AT GTTTGACCCA AGGTTTTGAC CGGGCCCAGT CTTTCGTTAGG
TGTTCCTGC CGATGAGCGC TAAATCT~,~ ACTAGTA
ACAAGGACG GCTACTCGCG ATTTAGAATT TGATCATTCGA
FGFstop HindIII
Relevant features of =the gene are highlighted.

It was thein isolated by digestion with Bam HI and Hind III
and inserted into Bam HI/Hind III-cut pJU1003 (Squires, et al., 1988, ibid.) yielding pJU1003-synFGF. This plasmid was cut with 'Xba I and Hind III and the Xba I/Hind III fragment carrying the FGF gene was isolated. This fragment was ligated into pT3XI-2 cut with Eco RI and Hind III, using an Eco RI-Xba I linker:

5' pAAT T'CC ACA ACG GTT TCC CT 3' 2oo6S13 ~~.

3' GC; TGT TGC CAA AGG GAG ATCp 5' The new plasmid is designated pT3XI-2-010TC3FGFsyn.

C. Insertina CNT-F expression constructs into the Tac promoter vector pT3%I-2-010TC3FGFsyn was cut with Bam HI and Spe I, which resulted in the linearization of the 7.4 kb expression vector and .~~the release of the ca. 0.5-kb FGF DNA fragment. In separate 1 reactions, CNTF-aynl/3 and CNTF-Syn2/3 were ligated into the gel :purified Bam HI/Spe I-cut vector DNA fragment, resulting in the iplasmids pT3%I-2:CNTF-Syn1/3 and pT3XI-2:CNTF-Syn2/3.

D. Expression in B. coli.

pT3%I-2:CNTF-Synl/3 was transformed into a phage-resistant E.
coli K-strain, TM107. Fourteen transformants were grown up and analyzed for CNTF expression by SDS polyacrylamide gel 1'electrophoresis and staining with Coomassie Brilliant Blue. Four transformants exhibited a darkly-stained band at the approximate position of CNTF. High level expression of recombinant CNTF was achieved by growing the cells in Luria broth with 1_5 ;&g/ml tetracycline up to a cell density corresponding to an A600 of 0.8.
IPTG was added to a final concentration of 1.0 mM and the cells i.were allowed to grow for two hours. These four transformants all i!exhibited about the same density of CNTF on both Coomassie-stained and inmtunoblotteid ge18. The apparent level of CNTF expression in these transformants, based on these gels, was about one-fourth that exhibited by pT57.':CNTF-Synl/3-5a grown as previously -described. Restriction mapping of the DNAs of these four transformants confirmed that they all carried the human CNTF gene.' PT3XI-2:CNTF-Syn2/3 was transformed into the F~. coli stain 1,TG1 for expression. Transformants were selected by plating on Lb ;iagar containing 15 g/ml tetracycline. Four transformants, pT3XI-;,2:CNTF-Syn2/3-A, -B, -C, -D, were selected, grown up, and !confirmed by restriction enzyme mapping. One transformant, pT3XI-', i;2:CNTF-Syn2/3-A, was selected for further study. This transformant was grown, overnight in 500ml 2XYT broth plus l0 g/ml tetracycline and 1mM IPTG. The cells were harvested by centrifugation as above and extracted in 10mM phosphate buffer, pH
16.7, containing 1mM EDTA, O.1M PMSF, and 0.1mcM pepstatin by sonication on ice for 15 sec using a microtip at power setting #3.
After 15 min centrifugation in a Microfuge, the supernatant was collected and assayed for bioactivity in the ciliary ganglion lsurvival assay (Example 1). There was substantial bioactivity in the supernatant (Fig. 22) which contained 1.5mg/ml protein.

The resulte presented here indicate that two different DNA
constructs in t-oro diff'erent expression vectors allowed the expression of biologically active CNTF, which also migrated appropriately on reducing SDS polyacrylamide gels, was recognized i by affinity-purified antibodies to CNTF, and had an appropriate . ,amino-ter.mi.nal tuaino acid sequence.

4. Purification of recombinant CNTF

A small inoculum of pT5T:CNTF-Synl/3-5a is grown overnight at 37 C with shakizig in Luria broth containing l01&g/ml of a~3 tetracycline. Seven ml of this cell suspension is added per 50m1 of Luria broth in large flasks and grown at 37 C with shaking until the A6. reaches approximately 0.5. Then, 0.5mM final IPTG is added to induce expression of CNTF and growth cc-tinued until the A6.
reaches approximately 1.2 which typically takes 4-6 hrs. The cells are harvested by centrif'ugation JA-20 rotor at 7,000 rpm for 5 min at 4 C and washed once more by centrifugation in 50mm phosphate buffer, pH 8.0 (Buffer P-) at 4 C. The supernatant is removed and the cell pellet is frozen at -20 C as a paste.

The cell paste is suspended in Buffer B [Buffer A containing mM EGTA (Ethylene Glycol.-bis(-aminoethylEther) N,N,N',N'Tetraacetic Acid) and 1mM EDTA (Ethylenediaminetetraacetic Acid)] at 0.5gm paste per ml buffer at 4 C and passed three time through a French pressure cell to break open the bacteria. Polyethyleneimine (PEI) is added to a final concentration of 0.25% and shaken for 30 min at 4 C. The precipitate is; removed by centrifugation for 15 min at top speed in a Microfuge. This step typically reduces the contents of nucleic acid, as measured by the ratio of A260 /A280 from approximately 25% to lesis than 5%.

The sample is then applied to a column of Q-Sepharose (Pharmacia) equilibrated with Buffer B. CNTF is such a major component of the French pressed cell lysate that it can be followed during chromatography by Coomassie Brilliant Blue stained SDS-polyacrylamide gels of column fractions. CNTF is a major, Coomassie-stained band at approximately 24kD. Using this assay, CNTF washes through the Q-Sepharose column in Buffer B.

~.

ZOOGt313 The wash through fractions containing the bulk of CNTF

protein are pooled, dialyzed against Buffer C(51nM phosphate buffer, pH 8.0, containing 1mM EGTA and 1mM EDTA), and applied to I!a Q-Sepharose column equilibrated with Buffer C. The column is 1washed in Buffer C until the A280 returns to baseline, indicating ,that non-adhering proteins have washed through the column. In Buffer C, CNTF binds to the Q-Sepharose column and is then eluted with a 0-O.1M NaCl gradient in Buffer C. CNTF emerges from the ,icolumn at approximately 40mM NaCl and is greater than 90% pure as judged on Coomassie stained SDS-polyacrylamide gels of the peak i CNTF fractions.
~;.

Claims (33)

1. A substantially purified protein sciatic nerve ciliary neurotrophic factor (SN-CNTF) which has a specific activity of more than 25,000 times greater than the specific activity of the natural sciatic nerve extract, a molecular weight of 25,000 daltons on SDS-PAGE, an activity greater than 2 × 10 8 Trophic Units per mg and the amino acid sequence of human SN-CNTF shown in Figure 12 or a homologue thereof having at least 80% identity.

2. A substantially purified protein human sciatic nerve ciliary neurotrophic factor (SN-CNTF) which is a protein comprising the amino acid sequence of Figure 12 or a homologue thereof having at least 80% identity, wherein said factor is characterized by (a) a molecular weight of about 25,000 daltons on SDS-PAGE;
(b) a specific activity of greater than 2 × 10 8 Trophic Units per mg; and (c) resistance to SDS and reducing agents.

3. A substantially purified protein human sciatic nerve ciliary neurotrophic factor (SN-CNTF) which is a protein comprising the amino acid sequence shown in Figure 12 or a homologue thereof having at least 80% identity and a SN-CNTF biological activity, wherein said factor is comprised of a single protein species.

4. A nucleic acid sequence encoding human ciliary neurotrophic factor (CNTF) shown in Figure 12 or the complement thereof.

5. An amino acid sequence comprising the amino acid sequence of human ciliary neurotrophic factor (CNTF) shown in Figure 12.

6. A recombinant animal cell expression system for producing biologically active human ciliary neurotrophic factor (CNTF) which is a protein comprising the amino acid sequence shown in Figure 12 or a homologue thereof having at least 80% identity.

7. A bacterial cell expression system for producing biologically active human ciliary neurotrophic factor (CNTF) which is a protein comprising the amino acid sequence shown in Figure 12 or a homologue thereof having at least 80% identity.

8. The sciatic nerve ciliary neurotrophic factor (SNCNTF) of claim 3 wherein said CNTF is produced by recombinant DNA
methods.

9. A recombinant DNA method for the production of active human ciliary neurotrophic factor (CNTF) comprising:
(a) culturing eukaryotic or prokaryotic host cells transformed with a vector comprising a DNA
sequence having at least 80% identity with the human sequence of Figure 12, to produce a protein having CNTF activity under conditions appropriate to the expression of CNTF;
(b) harvesting CNTF; and (c) permitting CNTF to assume an active tertiary structure whereby it possesses CNTF activity.

10. The method of claim 9 wherein said DNA sequence comprises the nucleic acids of the human sequence of Figure 12.

11. The method of claim 9 wherein said host cells are mammalian cells.

12. The method of claim 11 wherein said mammalian cells are Chinese hamster ovary cells.

13. A substantially purified recombinant ciliary neurotrophic factor (CNTF) which is a protein comprising the amino acid sequence selected from the group of human or rabbit sequence of Figure 12 or a homologue thereof having at least 80% identity and a CNTF biological activity.

14. A nucleic acid sequence encoding human sciatic nerve ciliary neurotrophic factor (SN-CNTF) shown in Figure 12 and nucleic acid sequences which hybridize under stringent conditions or but for the degeneracy of the genetic code would hybridize under stringent conditions to the complement of said nucleic acid sequence and encode a polypeptide having CNTF biological activity.

15. A vector comprising the nucleic acid sequence of claim 14.

16. A host cell comprising the vector of claim 15.

17. The host cell of claim 16, wherein said host cell is a microorganism.

18. The host cell of claim 17, wherein said microorganism is E. coli.

19. The host cell of claim 16, wherein said host cell is an animal cell.

20. The host cell of claim 19, wherein said animal cell is a mammalian cell.

21. The host cell of claim 20, wherein said animal cell is a Chinese hamster ovary cell.

22. A recombinant polypeptide having the biological activity of SN-CNTF encoded by the nucleic acid sequence of claim 14.

23. The polypeptide of claim 22, wherein the polypeptide has an amino acid sequence of the human sequence of Figure 12.

24. A sciatic nerve ciliary neurotrophic factor (SN-CNTF) polypeptide having the amino acid sequence of the human sequence of Figure 12.

25. The polypeptide of any one of claims 22, 23 or 24, wherein the polypeptide has an activity of greater than 2 ×
8 TU/mg.

26. The polypeptide of any one of claims 22, 23, or 24, wherein the polypeptide exhibits resistance to SDS and reducing agents.

27. A polyclonal antibody directed to the polypeptide of any one of claims 22, 23 or 24.

28. A method of purifying the polypeptide of claim 25 from sciatic nerve extract comprising:
(a) subjecting the nerve extract preparation to acid treatment and ammonium sulfate fractionation;
(b) chromatofocusing the preparation subjected to acid treatment and ammonium sulfate fractionation;

(C) running the preparation on SDS-PAGE;
(d) performing reverse phase-HPLC; and (e) eluting and collecting fractions having SN-CNTF
biological activity.

29. The method of claim 28, which includes, prior to said steps of running the preparation on SDS-PAGE gel, additional purification steps comprising:

(a) hydrophobic interaction chromatography between ammonium sulfate fractionation and chromatofocusing; and (b) FPLC hydrophobic interaction chromatography between chromatofocusing and preparative SDS-PAGE.

30. A recombinant DNA method for the production of a polypeptide comprising:
(a) culturing host cells according to claim 16 under conditions appropriate to amplification of the vector and expression of said polypeptide;
(b) harvesting said polypeptide; and (c) permitting said polypeptide to assume an active tertiary structure whereby it possesses CNTF
activity.

31. A pharmaceutical composition comprising a therapeutically effective amount of the polypeptide according to any of claims 22, 23 or 24 in admixture with one or more pharmaceutically acceptable non-toxic excipients.

32. The polypeptide of any of claims 22, 23 or 24 for use in pharmaceutical formulations.

33. The use of the polypeptide of any of claims 22, 23 or 24 for the preparation of a medicament for treating damage to the nervous system caused by disease or injury.