CA2005720A1 - .alpha.-plasmin inhibitor analogue and a highly productive plasmid for expression of .alpha.-plasmin inhibitor - Google Patents

Abstract

Abstract An .alpha.2-plasmin inhibitor analog and a highly productive plasmid for expression of .alpha.2-plasmin inhibitor Replacing Leu13 in the natural .alpha.2-plasmin inhibitor amino acid sequence by Phe13 leads to an effective .alpha.2-plasmin inhibitor analogue. It can be prepared by genetic engineering, especially in an expression system using E. coli host cells.

Description

2~s~
~' Hoechst Japan Limited - 1 - HOE 88/5 052 An a2-Plasmin inhibitor analogue and a highly productive plasmid for expression of a2-plasmin inhibitor (1) Field of the Invention The invention relates to a genetechnological process for preparing ~2-plasmin inhibitors using a DNA
coding $or said a2-plasmin inhibitors in which a nucleotide ~eguence is altered so as to produce the ~2-plasmin inhibitor in Escherichia coli in a large amount. The invention is also concerned with an a2-plasmin inhibitor analogue in which the 13th amino acid is replaced by phenylalanine, said analogue-codin~ DNA and a process for preparing the analogue.
The a2-plasmin inhibitor produced according to the invention and its analogue are expected to be effective as an antihemostatic agent or an antimetastatic agent for cancer, or as a therapeutic agent for inflammation in which various plasmin-like proteases participate, or also as a therapeutic agent for hyper-fibrinolysis.
(2) Description of the Prior Art An a2-plasmin inhibitor is a protein composed of 452 amino acids. The amino acid sequence and natural DNA
coding ~or the protein are described in Published European ~ 57~

Patent Application 0257630. .
However, if the natural cDNA as it is coding for ;~
the ~2-plasmin inhibitor is employed in expression under the .~' regulation of the tryptophan promoter or tac promoter .:
commonly used for the expression of exogenous genes~ .:
utilizing E. coli as a host, productivity is very low.
We have attributed the low productivity to the 5' terminal nucleotide sequence of messenger RNA (called "mRNA"
for short hereinbelow) synthesized from transcription :~:
initiation site of the above promoter. The responsible :
portion is the nucleotide sequence from 5' terminal to approximately 50 nucleotide downstream of AUG, the .
translation initiation codon of a2-PI ~called "nucleotide sequence flanking the translation initiation site" for short hereinbelow).
Thus, we have investigated the substitution of the :
nucleotide sequence coding for the amino terminal of a2-plasmin inhibitor. The substitution has then been made by selecting nucleotides that cannot take a stable higher-order structure with the sequence in the neighborhood of the 5' terminal of mRNA. That is, the substitution is directed to :
providing an ~2-plasmin inhibitor-coding cDNA having a novel nucleotide sequence suitable for expression using the ; -~
:: . .
tryptophan promoter and tac promoter, typical promoters most -~
commonly used in the production of recombinant protein utili~ing E. coli as a host, or the trc promoter, a ~`

~ .
, ' ,. ..

2 0 ~ r~
. -- 3 --.;

homologue of tac promoter.
Furthermore, we have prepared DNA coding for an a2-plasmin inhibitor analogue in which the 13th amino ac.id leucine is replaced by phenylalanine and have produced said analogue by means of expression of said DNA.

The invention relates to an a2-plasmin inhibitor analogue in which the 13th amino acid is replaced by . :
phenylalanin~, and a DNA coding for its amino acid sequence.
The invention is also concerned with DNA coding -for the a2-plasmin inhibitor analogue in which (X1 16) in the bel~w-mentioned DNA is .

AAC.CAG.CAG.CAC.GTA.TCC.CCC.CTC.ACA.CTA.
CTC.AAC.TTC.GCC.AAT.CAA.

lS and a DNA coding for a2-pla~min inhibitor in which (Xl 16) is AAC.CAA.CAC.CAG.GTG.TCC.CCA.CTT.ACC.CTC. ~-CTT.AAC.TTG.GCC.AAC.CAG.
tXl_l6)~GAG~CCT~GGT~GGC~CAG~ACT~GCC~CTGoAAG~ :
AGT.CCC~CCA.GGA.GTC.TGC.AGC.AGA.GAC.CCC.ACC.
CCA.GAQ.CAG.ACC.CAC.AGG.CTG.GCC.CGG.GCC.ATG. ~.
~TG.GC~.TTC.ACT.CCC.GAC.CTG.TTC.TCC.CTC.GTC.
GCT.CAA.ACC.TCC.ACC.TGC.CCC.AAC.CTC.ATC.CTC.
TCA.CCC.CTC.ACT.CTG.GCC.CTG.CCG.CTC.TCT.GAC.

CTG.CCA.CTA.GCT.CCT.CAC.AAC.CAC.ACC.TTG.CAC.
ACC.CTC.CAA.CAC.GTC.CTC.CAC.GCA.CCC.TCA.CGC.
CCC.TGC.CTC.CCC.CAT.CTG.CTC.ACC.CGC.CTC.TCC.
CAC.GAC.CTG.GGC.CCC.GGC.GCG.TTC.CCA.CTG.CCT.
GCC.ACG.ATG.TAC.CTG.CAG.AAA.GGA.TTT.CCC.ATC.
AAA.GAA.CAT.TTC.CTG.GAA.CAA.TCC.GAA.CAG.CTA.
TTT.GGG.GCA.AAG.CCC.GTG.AGC.CTG.ACG.GGA.AAG.
CAG.GAA.GAT.GAC.CTG.GCA.AAC.ATC.AAC.CAA.TGG.
GTG.AAG.GAG.GCC.ACG.GAG.GGG.AAG.ATT.CAG.GAA.
lo TTC.CTC.TCT.GGG.CTG.CCC.CAA.CAC.ACC.CTG.TTC.
CTT.CTC.CTC.AAC.GCC.ATC.CAC.TTC.CAC.CGT.TTC.
TGG.ACG.AAC.AAG.TTT.GAC.CCC.ACC.CTT.ACC.CAC.
AGA.CAC.TCC.TTC.CAC.,CTC.CAC.CAC.CAC.TTC.ACG
GTC.CCC.GTC.GAA.ATC.ATC.CAC.CCC.CGC.ACG.TAC.
CCG.CTG.CGC.TGG.TTC.TTG.CTG.GAG.CAG.CCT.GAG.
ATC.CAG.GTG.GCT.CAT.TTC.CCC.TTT.AAG.AAC.AAC
ATG.AGC.TTT.GTG.GTC.CTT.GTA.CCC.ACC.CAC.TTT
GAA.TGG.AAC.GTG.TCC.CAG.GTA.CTG.GCC.AAC.CTG
AGT.TGG.GAC.ACC.CTG.CAC.CCA.CCT.CTG.GTG.TGG.
.. .
GAG.AGG.CCC.ACC.AAG.GTC.CGG.CTG.CCT.AAG.CTG.
TAT.CTG.AAA.CAC.CAA.ATG.GAC.CTG.GTG.GCC.ACC.
CTC.AGC.CAG.CTG.GGC.CTG.CAG.GAG.TTG.TTC.CAG. , ~ `
"~' . ::,~

:... : ` - . . .. . ` ,. ................ . ....... ;. ~ .. ` . . - ` ` `

.,.. ... `.. ` . . `` - . ` ` . . . . . . .: ~.. .. ".~ `.. : - .. , . " . .. , . . ; " ` ., .. : .. - .,`.. :.` ` . ` ...

. :,...

GCC.CCA.GAC.CTG.CGT.GGG.ATC.TCC.GAG.CAG.AGC.
CTG.GTG.~TG.TCC.GGC.GTG.CAG.CAT.CAC.TCC.ACC.
GTG.GAG.CTC.AGC.GAG.CTC.GGC,.GTG.GAG.GCG.GCG.
~CG.GCG.ACC.AGC.ATT.GCC.ATC.TCC.CCC.ATG.TCC.
CTG.TCC.TCC.TTC.AGC.GTG.AAC.CGC.CCC.TTC.CTC.
TTC.TTC.ATC.TTC.GAG.CAC.ACC.ACA.GGC.CTT.CCC.
CTC.TTC.GTG.GGC.AGC.~TG.~GG.AAC.CCC.AAC.CCC.
AGT.GCA.CCG.CCG.GAG.CTC.AAG.GAA.CAG.CAC.GAT.
TCC.CCG.GGC.AAC.AAC.GAC.TTC.CTC.CAG.ACC.CTG.
o AAA.CGC.TTC.CCC.CGC.GGA.GAC.AAC.CTT.TTC.GGC.
CCT.GAC.TTA.AAA.CTT.GTG.CCC.CCC.ATG.GAG.GAG.
GAT.TAC.CCC.CAG,TTT,GGC,AGC.CCC.AAG, :

Furthermore, the invention is concerned with a recombinant DNA fragment containing the above DNA and promoters, an lS expression plasmid containing the same, E. coli cells transformed with the plasmid and a process for preparing an a2-plasmin inhibitor and its analogue using E. coli.
~ The DNA of the invention is conveniently prepared by substituting a portion of the natural DNA for the a2-plasmin inhibitor with a synthetic DNA although it can be prepared by total synthesis.
The APHL fragment which is natural DNA for a2-i7~ :

plasmin inhibitor was prepared, as described in Published ;
European Patent Application 0257630, by connecting the EcoRI
fragment of ~APH34 originating from HepG2 with the EcoRI
fragment from ~APLl obtained from the human liver cDNA
library. The APHL fragment was inserted into the ~coRI site of the plasmid vector pHSG 299 ~Takeshita et al., Gene, 61, pp. 63-74 (1987)~ having a kanamycin resistance gene originating from the transposon Tn 908 (referred to Oka, A.
et al.: J. Mol. Biol. (1981) 148, 217-226) and a polylinker ~;
originating from pUC 19 (commercially available from Takara Shuzo) and then designated p~AP3. E. coli K12/Om214 was transformed with the plasmid paAP3. The E. coli cells transformed with paAP3 containing APHL fragment is deposited ~`
as FEP~ BP-1350 at the Fermentation Research Institute, ~ ;;
lS Agency of Industrial Science and Technology.
The nucleotide sequence of the cDNA-fragment APHL ~
is shown in Table 1 and the restriction map of the same is ~ -shown in Fig. 1.

' ', :..
' :, ' ' ' 2~

T a b 1 e 24*
GAA.TTC.CGG.CTG.GCA.CGG.GAG.AAC

* 25 84*
ATG.GCG.CTG.CTC.TGG.GGG.CTC.CTG.GTG.CTC.AGC.TGG.TCC.TGC.CTG.CAA.G~C.CCC.TGC.TCC
Met-Ala-Leu-Leu-Trp-Gly-Leu-Leu-Val-Leu-Ser-Trp-Ser-Cys-Leu-Gln-Gly-Pro-Cys-Ser * 85 144*
GTG.TTC.TCC.CCT.GTG.AGC.GCC.ATG.GAG.CCC.ITG.GGC.TGG.CAG.CTA.ACT.AGC.GGG.CCG.AAC
Val-Phe-Ser-Pro-Val-Ser-Ala-Met-Glu-Pro-Leu-Gly-Trp-Gln-Leu-Thr-Ser-Gly-Pro-Asn ..
* 145 204*
CAG.GAG.CAG.GTG.TCC.CCA.CIT.ACC.CTC.CTC.AAG.TTG.GSC.AAC.CAG.GAG.CCT.GGT.GGC.CAG
Gln-Glu-Gln-Val-Ser-Pro-Leu-Thr-Leu-Leu-Lys-Leu-Gly-Asn-Gln-Glu-Pro-Gly-Gly-Gln * 205 264*
ACT.GCC.CTG.AAG.AGT.CCC.CCA.GGA.GTC.TGC.AGC.AGA.GAC.CCC.ACC.CCA.GAG.CAG.~CC.CAC
Thr-Ala-Leu-Lys-Ser-Pro-Pro-Gly-Val-Cys-Ser-Arg-Asp-Pro-Thr-Pro-Glu-Gln-Thr-His * 265 324*
AGG.CTG.GCC.CGG.GCC.ATG.ATG.GCC.TTC.ACT.GCC.GAC.Cni.TTC.TCC.CTG.GTG.GCT.CAA.ACG
Arg-Leu-Ala-Arg-Ala-Met-Met-Ala-Phe-Thr-Ala-Asp-Leu-Phe-Ser-Leu-Val-Ala-Gln-Thr * 325 384*
TCC.ACC.TGC.CCC.AAC.CTC.~TC.CTG.TCA.CCC.CTG.AGT.GTG.GCC.CTG.GCG.CTG.TCT.CAC.CTG
Ser-Thr-Cys-Pro-Asn-Leu-Ile-Leu-Ser-Pro-Leu-Ser-Val-Ala-Leu-Ala-Leu-Ser-~is-Leu * 385 444*
GcA.cTA.GGT.GcT.cAG.AAc~cAc.AcG.lTG.cAG.AGG.cTG~cAA~cAG.GTG.cTG.cAc.GcA.GGc.TcA
Ala-Leu-Gly-Ala-Gln-Asn-His-Thr-Leù-Gln-Arg-Leu-Gln-Gln-Val-Leu-His-Ala-Gly-Ser * 445 504*
GG~i.CCC.TGC.CTC QCC.CAT.CTG.CTG.AGC.CGC.CTC.TGC.CAf.GAC.CTG.GGC.CCC.GGC.GCG.TTC
Gly-pro-cys-Leu-pro-His-Leu-Leu-ser-Arg-Leu-cys-Gln-Asp-Leu-Gly-pro-Gly-Ala-phe X6~ 7;~

.
.. . .
~ ..
* 505 564*
CGA.CTG.GCT.GCC.AGG.ATG.TAC.CTG.CAG.AAA.GGA. m . ccc . ATC.AAA.GAA.GAT.TTC.CTG.GAA
Arg-Leu-Ala-Ala-Arg-Met-Tyr-Leu-Gln-Lys-Gly-Phe-Pro-Ile-Lys-GlU-Asp-Phe-Leu-Glu * 565 624*
5 CAA.TCC.GAA.CAG.CTA.TTT.GGG.GCA.AAG.CCC.GTG.AGC.CTG.ACG.GGA.AAG.CAG.GAA.GAT.GAC
Gln-Ser-Glu-Gln-Leu-Phe-Gly-Ala-Lys-Pro-Val-Ser-Leu-Thr-Gly-Lys-Gln-Glu-Asp-Asp * 625 684*CTG.GCA.AAC.ATC.AAC.CAA.TGG.GTG.AAG.GAG.GCC.ACG.GAG.CGG.AAG.ATT.CAG.GAA.TTC.CTC ;;
Leu-Ala-Asn-Ile-Asn-Gln-Trp-Val-Lys-Glu-Ala-Thr-Glu-Gly-Lys-Ile-Gln-Glu-Phe-Leu . .
* 685 TCT.GGG.CTG.CCG.GAA.GAC.ACC.GTG.TTG.CTT.CTC.CTC.AAC.GCC.ATC.CAC.TTC.CAG.GGT.TTC
Ser-Gly-Leu-Pro-Glu-Asp-Thr-Val-Leu-Leu-Leu-Leu-Asn-Ala-Ile-His-Phe-Gln-Gly-Phe 804*
TGG.AGG.AAC.AAG.TTT.GAC.CCG.AGC.CTT.ACC.CAG.AGA.GAC.TCC.TTC.CAC.CTG.GAC.GAG.CAG
Trp-Arg-Asn-Lys-Phe-Asp-Pro-Ser-Leu-Thr-Gln-Arg-Asp-Ser-Phe-His-Leu-Asp-Glu-Gln * 805 864*
TTC.ACG.GTG.CCC.GTG.G~A.ATG.ATG.CAG.GCC.CGC.ACG.TAC.CCG.CTG.CGC.TGG.TTC.TTG.CTG
Phe-Thr-Val-Pro-Val-Glu-Met-~et-Gln-Ala-Arg-Thr-Tyr-Pro-Leu-Arg-Trp-Phe-Leu-Leu ~ 865 924*
GAG.CAG.CCT.GAG.ATC.CAG.GTG.GCT.CAT.TTC.CCC.TIT.AAG.AAC.AAC.ATG.AGC.TTT.GTG.GTC ~
Glu-Gln-pro-Glu-Ile-Gln-val-Ala-His-Phe-Pro-Phe-Lys-Asn-Asn-Met-Ser-Phe-Val-Val - '.
,~
* 925 984*
CTT.GTA.CCC.ACC.CAC. m. GAA.TGG.A~C.GTG.TCC. QG.GTA.CTG.GCC.AAC.CTG.AGT.TGG.GAC -~
Leu-Val-Pro-Thr-His-Phe-Glu-Trp-Asn-Val-Ser-Gln-Val-Leu-Ala-Asn-Leu-Ser-Trp-Asp ':' * g85 1044*
ACC.CTG.CAC.CCA.CCT.CTG.GTG.TGG.GAG.AGG.CCC.ACC.AAG.GTC.CGG.CTG.CCT. M G.CTG.TAT
Thr-Leu-His-Pro-Pro-Leu~Val-Trp-Glu-Arg-Pro-Thr-Lys-Val-Arg-Leu-Pro-Lys-Leu-Tyr :

2~7X(:~
g * 104S 1104*CTG.AAA.CAC.CAA.ATG.GAC.CTG.GTG.GCC.ACC.CTC.AGC.CAG.CTG.GGC.CTG.CAG.GAG.TTG.TTC
Leu-Lys-His-Gln-Met-Asp-Leu-Val-Ala-Thr-Leu-Ser-Gln-Leu-Gly-Leu-Gln-Glu-Leu-Phe * 1105 1164*CAG.GCC.CCA.GAC.CTG.CGT.GGG.ATC.TCC.GAG.CAG.AGC.CTG.GTG.GTG.TCC.GGC.GTG.CAG.CAT
Gln-Ala-Pro-Asp-Leu-Ar~-Gly-Ile-Ser-Glu-Gln-Ser-Leu-Val-Val-Ser-Gly-Val-Gln-His * 1165 1224*CAG.TCC.ACC.CTG.GAG.CTC.AGC.GAG.GTC.GGC.GTG.GAG.GCG.GCG.GCG.GCC.ACC.AGC.ATT.GCC
Gln-Ser-Thr-Leu-Glu-Leu-Ser-Glu-Val-Gly-Val-Glu-Ala-Ala-Ala-Ala-Thr-Ser-Ile-Ala * 1225 1284*
ATG.TCC.CGC.ATG.TCC.CTG.TCC.TCC.TTC.AGC.GTG.AAC.CGC.CCC.TTC.CTC.TTC.TTC.ATC.TTC
Met-Ser-Arg-Met-Ser-Leu-Ser-Ser-Phe-Ser-Val-Asn-Arg-Pro-Phe-Leu-Phe-Phe-Ile-Phe * 1285 1344*CAG.GAC.ACC.ACA.GGC.ClT.CCC.CTC.TTC.GTG.GGC.AGC.GTG.AG&.AAC.CCC. M C.CCC.AGT.GCAGlu-Asp-Thr-Thr-Gly-Leu-Pro-Leu-Phe-Val-Gly-Ser-Val-Arg-Asn-Pro-Asn-Pro-Ser-Ala * 1345 1404*CCG.CGG.GAG.CTC.AAG.GAA.CAG.CAG.GAT.TCC.CCG.GGC.AAC.AAG.GAC.TTC.CTC.CAG.AGC.CTG
Pro-~rg-Glu-Leu-Lys-Glu-Gln-Gln-Asp-Ser-Pro-Gly-Asn-Lys-Asp-Phe-Leu-Gln-Ser-Leu * 1405 1464*AAA.GGC.TTC.CCC.CGC.GEA.GAC.AAG.CTT.TTC.GGC.CCT.GAC.TTA.AAA.CTT.GTG.CCC.CCC.ATG
Lys-Gly-Phe-Pro-Arg-Gly-Asp-Lys-Leu-Phe-Gly-Pro-Asp-Leu-Lys-Leu-Val-Pro-Pro-Met * 1465 1524* , GAG.GAG.GAT.TAC.CCC.CAG~ m .GGC.AGC.CCC.AAG.TGA.GGG.GCC.GTG.GCT.GTG.GCA.TCC.AGA
Glu-Glu-Asp-Tyr-Pro-Gln-Phe-Gly-Ser-Pro-Lys-***-Gly-Ala-Val-Ala-Val-Ala-Ser-Arg * 1525 1584*
GTC.CCT.GCC.TGG.ACC.AGC.CTC.TCC.ACT.CAT.GTG.ACT.CTT.TCC.AAC.CTG.CTT.TGT.GGC.ACT
Val-pro-Ala-Tr~ Thr-ser-Leu-ser-Thr-~is-val-Thr~Leu-ser-Asn-Leu-Leu-cys-Gly-Thr - , ,, 2~ 0 .. . .

* 1585 1644*GGG.GCA.GGG.GCC.GGG.GGC.AGT.CTG.AGA.GAG.GCC.ATT.CTT.TCC.CM.CAC.CTC.TTG.GCG.AGT
Gly-Ala-Gly-Ala-Gly-Gly-Ser-Leu-Arg-Glu-Ala-Ile-Leu-Ser-Gln-His-Leu-Leu-Gly-Ser ','- ""
* 1645 1704*5 TTA.GGG.TGG.GGG.GGG.GCG.CGG.CTG.GGA.GGA.GGG,.CAG.GCA.TCG.GGG.AGC.CGG.GAG.CCT.GAC
Leu-Gly-Trp-Gly-Gly-Ala-Arg-Leu-Gly-Gly-Gly--Gln-Ala-Ser-Gly-Ser-Arg-Glu-Pro-Asp ~ 1705 1764*CCT.C~T.CTT.TCT.TCC.AAA.CAG.GCT.CAG.AGG.GTG.TCC.TGC.ACC.C-GG.GCC.TGG.GCA.CGA.GGGPro-His-Leu-Ser-Ser-Lys-Gln-Ala-Gln-Arg-Val-Ser-Cys-Thr-Gly-Ala-Trp-Ala-Gly-Gly - ;
- :'.
* 1765 1824*
AGG.TGC.TTC.TAG.TTC.TGC.CAG.GAG.ACA.GGT.TAG.CTG.CTC.CCC.ACG.TCA.GCT.GGG.ACA.CCC
Arg-Cys-Phe-***-Phe-Cys-Gln-Glu-Thr-Gly-***-Leu-Leu-Pr~-Thr-Ser-Ala-Gly-Thr-Pro * 1825 1884*CGA.CTT.TTG.TTT.ACC.AGA.GAA.AAA.GGG.AGG.GGG.AGA.GGG.CTG.CCT.TTG.GAC.TTG.TCC.CGG
Arg-Leu-Leu-Phe-Thr-Arg-GIu-Lys-Gly-Arg-Gly-Arg-Gly-Leu-Pro-Leu-Asp-Leu-Ser-Arg ,. ::
* 1885 1944*GAC.ACC.TAG.GCT.AGG.GTG.GGG.AGA.GAC.GGG.CCC.TGG.TGG.TGG.CTC.GGG.AGG.CGA.ACG.TTG
Asp-Thr-***-Ala-Arg-V~l-Gly-Arg-Asp-Gly-Pro-Trp-Trp-Trp-Leu-Gly-Arg-Arg-Thr-Leu * 1945 2004*TCC.TCA.GCC.CCG.CGT.GGA.ACT.CGT.GTC.TGG.CAC.AGC.CTG.GCT.GTG.GCC.TAA.OCT.GCC.GAG
Ser-Ser-Ala-Pro-Arg-Gly-Thr-Arg-Val-Trp-His-Ser-Leu-Ala-Val-Ala-***-Pro-Ala-Glu * 2005 , 2064*AGT.CCA.TCA.GCC.TCC.ATC.CTA.CCC.CCT.GTG.CCT.TGT.CAC.GCC.AGA.CTT.CCC.ACG.GCT.CCT
Ser-Pro-Ser-Ala-Ser-Ile-Leu-Pro-Pro-Val-Pro-Cys-His-Ala-Arg-Leu-Pro-Thr-Pla-Pro * 2065 2124*
CGA.GAT.ccc~AAc.AcT.Gcc.AGc.ATT.Tcc.clT.ccT.Tcc.TcT.ccT.GTc.Tcc.cTc.cTc.TGc.ccG
Arg-Asp-Pro-Asn-Thr-Ala-Ser-Ile-ser-Leu-pro-5er-ser-Pro-Val-ser-Leu-Leu-Cys-Pro S~7~

!

* 2125 2184*
GGA.GcT.cAG~GAA.ccG.AGG.cAG.GGA.AGG.ATc.ccA.TGA.GcT.ccT-TAA.GGc-Tcr .TIT.GTA.AGGGly-Ala-Gln-Glu-Pro-Arg-Gln-Gly-Arg-Ile-Pro-~**-Ala-PrO-***-Gly-Ser-Phe-Val-Arg * 2185 2244*
TTT.TTG.TAG.TGA.TIT.TTA.TGC.CAC.CTG.AAT.AAA.GAA.TGA.ATG.GGC.AAA.AAA.AAA.AAA.AAA
Phe-Leu-***-***-Phe-Leu-Cys-His-Leu-Asn-Lys-Glu-***-Met-Gly-Lys-Lys-Lys-Lys-Lys * 2245 AAA.AAA.GGA.ATT.
Lys-Lys-Gly-Ile Figures in the table mean the number of asterisked bases.

'-'~.,~',.' ~';',,' Z~t72~ '.. :, .

. ~ , ~: .
In the above nucleotide sequence, the nucleotide sequence from 1 to 6 is the EcoRI site originating from the EcoRI linker used in cloning and the nucleotide sequence from 7 to 24 is a non coding region upstream of the 5'-end.
The nucleotide sequence from 25 to 141 is corresponding to the peptide portion contained only in the precursor of a2-plasmin inhibitor (so-called anchor portion). The nucleotide sequence from 142 to 1497 is the subject portion coding for a2-plasmin inhibitor. The TGA from 1498 to 1500 is a stop codon. The nucleotide sequence from 1501 ff. is a non-coding region downstream of the 3'-end, AATAAA from 2212 to 2217 a poly A sequence addition signal and poly A of 2230 ff. a region originating from poly A terminal of poly A
messenger. 2251 to 2256 is the EcoRI site originating from the EcoRI linker used in cloning.
In order to modify the natural DNA, a DNA fragment containing the portion to be modified is synthesized, and replaced by means of appropriate restriction sites.
The plasmid to express the DNA of the invention contains, in addition to a gene coding for a2-plasmin inhibitor, a promoter of a procaryotic organism to direct initiation of the transcription, a terminator of a procaryotic organism to direct termination of the transcription and a gene coding for an appropriate selection marker. As an example of procaryotic host cells is mentioned Eschexichia coli (called E coli for short). As : ~

examples of a promoter in E. coli the trp promoter or tac promoter are preferred. As an example of a terminator in E.
coli the rrnB ribosomal RNA terminator is preferred. As the selection marker Ap , Cm , Km and the like are preferred.
Introduction of the recombinant plasmid into E.
coli cells was accomplished by the transformation in the presence of calcium ions described in detail in the state of the art, for example, "Molecular Cloning" by Maniatis et al.
(published by Cold Spring Harbor Laboratory, 1982). The transformant cells thus obtained produce a2-plasmin inhibitors dur~ng cultivation.
The invention will be described below in more detail with reference to examples.

Example 1 Preparation o a plasmid for expressing an ~2-plasmin ;~
inhibitor analogue in which the 13th amino acid is replaced by phenylalanine The plasmid paAP3 obtained from the culture of E.
coli K12/Om214 (FERM BP-1350) was cleaved with EcoRI and blunt-ended with T4 DNA polymerase followed by cleavage with Hind III at the nucleotide position 1427 in Table 1. The . :, fragment was inserted between the PstI site blunt-ended with T4 DNA polymerase and the Hind III site of pUC18 (ampicillin ;
resistant, available from the gene bank of the Japanese National Institute of Health, Deposit No. VE 007) to give ''"' ~'',~', z~.5~720 paAP5. Separately, a fragment containing the region coding ~ :
for the carboxyl terminal of a2-E)lasmin inhibitor obtained by cleavage with FokI at the nucleotide position of lS07, subsequent blunting the ends with T4 DNA polymerase and then cleavage with Hind III at the nucleotide position of 1427 was inserted between the Hinc II site and the Hind III site of pHSG399 (chloramphenicol resistant, available from the -same gene bank as above, Deposit No. VE 024) to give paAP6. .
Then, paAP5 and p~AP6, both after cleavage with Hind III, were ligated, and a plasmid which was double resistant to ;
ampicillin and chloramphenicol was selected to give paAP7.
The paAP7 contained the entire region coding for a2-plasmin inhibitor (1476 bp of the nucleotide sequence from 25 to .
1500), and a fragment containing the region can be excised by cleavage at AccI site and at XbaI site.
Separately, a cloning vector called pHSG297 was prepared in which the nucleotide sequence between the SacI
site and the SmaI site of pHSG298 (kanamycin resistant, available from the same gene bank as above, Deposit No. VE - :
018) was deleted by cleaving with the enzymes and blunting -~-the ends with T4 ~NA polymerase. Between the AccI site and :
! the XbaI site of the cloning vector cDNA for a2-plasmin inhibitor was inserted between the AccI site and the XbaI
site of paAP7 to give paAP8 (Fig. 2).
On the other hand, pHSG741 (Fig. 3, ampicillin resistant, available from the same bank as above, Deposit Z ~ 5~

No. VE 040) which is an expression vector contains a tryptophan promoter and rrnB terminator for a ribosomal RNA
gene. Between these two regions there were cloning sites NcoI, PstI, EcoRI and Hind III arranged in this order.
First, between the NcoI site and the PstI site of the plasmid the following fragment was inserted which had been synthesized chemically: ;

5' CATGAACCAGGAG~AGGTGTCCCCACTTACC~TCCTCAAGTTGGGCAACC

3' TTGGTCCT~GTCCACAGGGGTGAATGGGAGGAGTTCAACCCGTTGG
0 AGGAGCCTGGTGGCCAGACTGCCCTGAAGAGTCCCCCAGGAGTCTGCA 3' ` `
TCCTCGGACCACCGGTCTGACGGGACTTCTCAGGGGGTCCTCAG 5' . . - ` ~:
The cohesive end CATG appearing at the beginning of the fragment i5 complementary to the cohesive end of the NcoI site appearing immediately after the tryptophan ~
promoter and the SD sequence of pHSG741, and ATG of the same ` ~;
functions as the translation initiation codon for a2-plasmin inhibitor. The second codon and the following portion correspond to the bases 142 ff. and do not contain the codons for the leader sequence of said protein. They code for Asn-Gln-Glu-Gln ff. starting from the N terminal end of said protein. The cohesive end at the end of the fragment `
was complementary to the cohesive end of the PstI site at ~ ;~
the nucleotide position of 236.
Next, between the PstI site and the EcoRI site of ~, the plasmid the remaining cDNA portion for ~2-plasmin ~ :

, .' . ~:`
'''~"''"'''`''';

~ 7 ~

, inhibitor obtained from p~AP8 which is a fragment between PstI site at the nucleotide position of 236 and the EcoRI
site at the nucleotide position of 676 is inserted. Next, between the EcoRI site and the blunt-ended Hind III site of -the plasmid the DNA fragment from the EcoRI site at the nucleotide position of 676 through the blunt-ended XbaI site in the 3' downstream region was inserted. The process resulted in regeneration of the XbaI sites and thus the construction of pAP213 was completed (Fig. 4).
The DNA fragment of the paA213 thus obtained containing the portion coding for the N-terminal of 2-plasmin inhibitor between the HpaI site of tryptophan promoter and the BstXI site in the ~2-plasmin inhibitor-coding region was ~ubs~ituted with the following fragment which had been chemically synthesized:

5' M CTAGTACGCAAGTTCACGTAAAAAGGGTATGACCATGAACCAGGAGCAGGTATCCCCC
3' TTGA~CATGCGTTCAAGTGCATTTTTCCCATACTGGTACTTGGTCCTCGTCCATAGGGGG

CTCACACTACTGAAGTTCGGCAATCAAGAGC 3' GAGTGTGATGACTTCAAGCCGTTAGTT 5' The blunt end of the fragment appearing at the beginning o~ the fragment forms the HpaI site again by linking with the blunt end of the HpaI site in pAP213, of which ATG, the nucleotides from 37 to 39 from the left end function as a ~ranslation initiation codon. The subsequent nucleotide sequence codes for the amino acid sequence from the N-terminal to the 17th excluding the signal peptide of a2-plasmin inhibitor in which the 13th leucine is replaced by phenylalanine (Asn-Gln-Glu-Gln-Val-Ser-Pro-Leu-Thr-Leu-Leu-Lys-Phe-Gly-Asn-Gln-Glu) and the rear cohesive end is complementary to the cohesive end of the BstXI site in the a2-plasmin inhibitor-coding region. The plasmid constituted as above was designated paAP21B (Fig.

4).
Example 2 ~ ;~
Preparation of an expression vector in E. coli containing -~;
the trc promoter .
Expression of the ~2-plasmin inhibitor using the ;;
trc promoter was accomplished by the use of pTrc99A (Amann et al., Gene, 69, pp. 301-315 (1988)).
lS First, between the NcoI site and the XbaI site of pTrc99A the following fragment was inserted which had been ~ ;
chemically synthesized~
S' CATGAACCAAGAGCAGGTGTCCCCACTTACCCTCCTTAAGCTCGAGT 3' 3' TTGGTTCTCGTCCACAGGGGTGAATGGGAGGAATTCGAGCTCAGATC 5' The cohesive end CATG of the fragment appearing at the beginning is complementary to the cohesive end of the NcoI site located immediately after the trc promoter and the SD sequence of pTrc99A, ATG which functions as the ;~
translation initiation codon for the a2-plasmin inhibitor. ;~
The nucleotide sequence following ATG codes for the amino acid sequence from the first to the 12th (Asn-Gln-Glu-Gln-2i~S~72~ ;

:

Val-Ser-Pro~Leu-Thr-Leu-Leu-Lys) from the N-terminal end excluding the signal peptide for a2-plasmin inhibitor, and the codons corresponding to the 11th and 12th amino acids are the AflII site (C TTAAG) followed by the XhoI site; the rear cohesive end is complementary to the cohesive end of the XbaI site. The plasmid constituted as above was designated paAP222.
Separately, between the SphI site of paAP8 and the BstXI site in the a2-plasmin inhibitor-coding region the following fragment was inserted which had been chemically synthesized:

5' CCCTACCTTAAGTTGGGCAACCAGGACC`3 3' GTACGCCATGGAATTCAACCCGTTGGTC 5' The cohesive end GTAC of the fragment appearing at the beginning is complementary to the cohesive end of the SphI site in paAP8 and is followed by the KpnI site and the AflII site. The rear cohesive end is complementary to the cohesive end of the BstXI site in paAP8. The nucleotide sequence from the AflII site to the rear cohesive end codes for the amino acid sequence from the 11th to the 17th (Leu-Lys-Leu-Gly-Asn-Gln-Glu) from the N-terminal excluding the signal peptide for a2-plasmin inhibitor. The plasmid constituted as above was designated paAP2230 Next, the AflII-XbaI fragment which contains the portion coding for the amino acid sequence from the 11th and X6~ 7~
- 19 - ::
.

following positions from the N-terminal excluding the signal peptide for a2-plasmin inhibitor was excised from paAP223 ~:
and inserted between the AflII and XbaI sites in the synthetic DNA cloned into p~AP222 to complete paAP221 ( Fig.
5). ' Example 3 Expression of human a2-plasmin inhibitor analogue in ;~
E. coli by the use of p~AP218 ~ .
E coli W3110 transformed with paAP218 was ~ -~
cultivated in M9 Casamino acids + Trp medium (medium -~
.
prepared from M9 Casamino acids medium to which tryptophan ;
. . .
had been added to a final concentration of 100 ~M) with shaking at 37C for 16 hours. 100 ml of M9 Casamino acids medium was inoculated with l ml of the bacterial culture followed by cultivation for about 3.5 hrs. When OD550 was 0.9, IAA (indoleacrylic acid) was added to a final concentration o 1 mM to activate ~ promoter. Then, 10 ml of 10% Casamino acids and 5 ml of 20~ glucose were added, after 3 hrs. followed by the same amounts of Casamino acids and glucose. After cultivation for additional 3 hrs. the E. ~ -coli cells were collected for examination of the whole ~ -proteins produced in E. coli cells by means of SDS
polyacrylamide gel electrophoresis. E. coli cells ~-txansformed with pHSG741 which is an expression vector alone ~`
and those with p~AP213 which expresses a2-plasmin inhibitor in a small amount were used as control. As shown by -,: '~' ' ' :, i ,", ,'` ;'.',~ ~' r. . ~.. ..

~s~
~ 20 -, polyacrylamide gel electrophoresis a strong band was detected only in the cells transformed with p~AP218. An experiment was carried out as given below in order to investigate in detail the proteins produced when the p~AP218 was employed. E. coli cells collected under the above-described conditions were suspended in lO x TE (lO0 mM Tris-HCl (pH 7.6), 10 mM EDTA) so as to have OD550=lO, lysozyme was added to a final concentration of 50 ~g/ml and the mi~ture was left at room temperature for 30 min; Cells were broken by ultrasonication and subjected to centrifugation at 12000 g for 10 ~in. Precipitate and supernatant were separated, and the supernatant was used as the soluble fraction. The ~recipitate was suspended in a 10 x TE-0.5%
Triton XlO0 solution, and the suspension was left at room temperature for 5 min. After centrifugation at 12000 g at 4C for 5 min., precipitate was recovered and used as the insoluble fraction. The insoluble fraction contains `
inclusion bodies produced by E. coli. The soluble fraction, the insoluble fraction and E. coli cells were treated with sample buffer for SDS electrophoresis (62.5 mM Tris-HCl (pH

6.8), 2% glycerol, 2% SDS, 5% B-mercaptoethanol, 0.001% BPB) at~90C for 5 min. and subjected to SDS polyacrylamide gel electrophoresis. The same procedures were applied to pHSG741 for comparison with the results with p~AP218. There was detected a strong band in the insoluble fraction only in the ce~ls transformed with p~AP218. It was also revealed .. . . . . . ..
.: . . .: . , . : - .
' - ' .- ' - . '. ' ~ ... ~,:
- : : ~ . ~,. . .
: ' . , . ' ~, . . , .: , 2~ 5~7~

- .: ' '.

that the band represents ~2-plasmin inhibitor analogue by staining with anti-u2-plasmin inhibitor antibody in the Western blot method. As described above, it was evident that the E. coli cells transformed with paAP218 express a . ~ ~. .
large amount oE the ~z-plasmin inhibitor analogue inclusion ~ ~
bodies. ~ ;

Brief Description of the Drawin~s ~ ~ ~
Fig. l shows the restriction map of APHL. . ~ `
Fig. 2 is the restriction map for plasmid p~AP8, ` ``-in which (FokI) and (EcoRI) show the sites eliminated by ligation, respectively.
Fig. 3 is the restriction map of plasmid pHSG741.
Fig. 4 is the restriction map of paAP213 and p~AP218 in which (NcoI) shows the site eliminated by ligation.
Fig. 5 is the restriction map of p~AP221.

The coding region for the ~2-plasmin inhibitor is shown in Fig. 1, 2, 4 and 5 as a black bar. Apr means the ampicillin resistance gene, Kmr the kanamycin ~
resistance gene, rrnB the terminator se~uence, trp ~ ; -and trc the promoter regions.
..~''`',,, '"
'''''''''''~'`"' ,: .~ .: - ,, :, : .. , . . - . : ., . : . .- . :: .. . - :. , . ,, .: , ,: .

Claims

THE EMBODIMENTS OF THE INVENTION IN WHICH AN EXCLUSIVE
PROPERTY OR PRIVILEGE IS CLAIMED ARE DEFINED AS FOLLOWS:

(1) An .alpha.2-plasmin inhibitor analogue in which the 13th amino acid is replaced by phenylalanine.

(2) A DNA coding for the .alpha.2-plasmin inhibitor analogue according to claim 1.

(3) The DNA according to claim 2 having the nucleotide sequence:

wherein (X1-16) is (4) A recombinant DNA fragment in which the DNA
according to claim 3 is operatively linked to the tryptophan (trp) promoter.

(5) The DNA according to claim 2 having the nucleotide sequence:
wherein (X1-16) is (6) A recombinant DNA fragment in which the DNA
according to claim 5 is operatively linked to the tac promoter or trc promoter.

(7) A plasmid for the expression of the .alpha.2-plasmin inhibitor containing the recombinant DNA fragment according to one or more of claims 2 to 6.
(8) Host cells transformed with the plasmid according to claim 7.

(9) Escherichia coli cells transformed with the plasmid according to claim 7.

(10) A process for preparing .alpha.2-plasmin inhibitors by means of a transformant according to claim 8 or 9.

11. The .alpha.2-plasmin inhibitor as claimed in claim 1, and substantially as described herein.