CA2003415A1 - Rapid screening mutagenesis and teratogenesis assay - Google Patents
Rapid screening mutagenesis and teratogenesis assayInfo
- Publication number
- CA2003415A1 CA2003415A1 CA 2003415 CA2003415A CA2003415A1 CA 2003415 A1 CA2003415 A1 CA 2003415A1 CA 2003415 CA2003415 CA 2003415 CA 2003415 A CA2003415 A CA 2003415A CA 2003415 A1 CA2003415 A1 CA 2003415A1
- Authority
- CA
- Canada
- Prior art keywords
- reporter gene
- gene
- expression
- animal
- reporter
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Abandoned
Links
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
RAPID SCREENING MUTAGENESIS AND TERATOGENESIS ASSAY
Abstract of the Invention A rapid, sensitive, and quantitative method and assay system using transgenic animal cells and adult or embryonic transgenic animals to rapidly screen compounds for mutagenic or teratogenic activity. Each cell from a cell culture, a differentiated tissue from an animal or an animal embryo contains a target gene and a reporter gene, both including an animal promoter/enhancer, a coding sequence and a transcription termination signal, so that they are capable of expression in animal cells. The product of the target gene is capable of regulating expression of the reporter gene through interaction with a regulatory sequence in the reporter gene. In the preferred embodiment, the target gene lacI (lac repressor) is coupled to the reporter gene lacZ encoding beta-galactosidase, which is easily detectable by cytochemical or histochemical procedures. When the animal cell is exposed to a compound causing a mutation either altering expression of the target gene or altering the operator of the reporter gene, the reporter gene is expressed.
Abstract of the Invention A rapid, sensitive, and quantitative method and assay system using transgenic animal cells and adult or embryonic transgenic animals to rapidly screen compounds for mutagenic or teratogenic activity. Each cell from a cell culture, a differentiated tissue from an animal or an animal embryo contains a target gene and a reporter gene, both including an animal promoter/enhancer, a coding sequence and a transcription termination signal, so that they are capable of expression in animal cells. The product of the target gene is capable of regulating expression of the reporter gene through interaction with a regulatory sequence in the reporter gene. In the preferred embodiment, the target gene lacI (lac repressor) is coupled to the reporter gene lacZ encoding beta-galactosidase, which is easily detectable by cytochemical or histochemical procedures. When the animal cell is exposed to a compound causing a mutation either altering expression of the target gene or altering the operator of the reporter gene, the reporter gene is expressed.
Description
34~
~PID 8CR~N~G ~TA~B8I~ A~D T~RATO~BN~ A~AY
~ac~grou~ o~ gh~ .o~
This application generally relat~s to genetic engine~ring and specifically involves ~he use of engineered animal c~lls containing an expres~ible target gene coupled to an expressible reporter gene to assay for mutagen~.
Toxicity testing is required for many new drug and agents released into the environment or work place. Compounds mu~t generally be screened ~or damage ~o the embryo (teratogene~is activity) and for damage to the differentiated animal (carcinogenesis or mutagenesi a tivity).
Classically, compounds have been as~ayPd for mutagenic activity u~ing short te~m t~sts employing bacterial cell systems (STT) or ani~al studi~. Most animal studies are conducted using th~ protocol for~rodents developed by the National Cancer Institute in the early 1970~, reported ~y Sontag, et al., in U.S.
~ ~ h Educ. Welfare Publ. UNIH! Carcinoq. Tech. Rep. Serv.
1,76 (1976). However, the correlation between the results - obtained in the two systems is poor and hard to mea~ure o bjeatively. For example, as r:ported by Tennant, et al., in ~ 9çlg~g~ 236, 933-941 (1987), there is only approximately 60%
: 20 concordance b~tween;four widely used STTs and rod~nt , , : " : , :
, 21~3~
carcinogenicity results. The four ~ests that were compared were the g3LD~nÇIl~ ~utagenesis, SAL, (described in Haworth, et al., Environ. Mutaqen. 5 suppl. 1)3 (19~3) and Mortelmans, et al.
To~icol._Appl. Pharmacol. 75, 137 (~984), etc.; chromosome aberration~ in Chinese hamster ovary cells, ABS; sister chromatid exchanges in Chinese hamster ovary cells, SCE, (both described in Galloway, et al. Environ. Mutagen. 7, 1 (1985), and Galloway, et al. nyl o~. Mutaqen ~1987); and mouse lymphoma cell, MOLY, (described in Myhr, et al., Evaluation of Short-Term Tests for Ca~c ~ the Inte~nat ~ emical Sa~ety's C~ borative Study on_in vitro Assays, vol. 5 of P~oqre~s_in MutatiQn R~search Series, pp. 55-568, J. Ashby, et al. Editors (Elsevier, Amsterdam, 1985)) assays.
A recent variation of the SAL, or Ames, in vitro assay was reported ~y Oda, et al., in Mutation Research 147, 219-229 (1985~. Oda, et al. ! intro~uced a fused umuC'-'lacZ gene into Salmo~ella typhimurium. The umu operon in Escherichia coli is responsible for chemical and radiation mutagenesis and is inducible by DNA-damaging agents. Induction of umu by the compound being tested is determined by production of beta~
galactosida~e activity resulting from expr~ssion of lacZ. A
similar modification to the SOS chromotest to detect DNA~damaging agents, d~scribed by Quillardet, et al., Proc. Natl. Acad. Sci.
~Y~L 79, 5971-5975 (1982), uses one of the SOS genes, ~f~, fused to lacZ on the chromosome of E~ coli.
~PID 8CR~N~G ~TA~B8I~ A~D T~RATO~BN~ A~AY
~ac~grou~ o~ gh~ .o~
This application generally relat~s to genetic engine~ring and specifically involves ~he use of engineered animal c~lls containing an expres~ible target gene coupled to an expressible reporter gene to assay for mutagen~.
Toxicity testing is required for many new drug and agents released into the environment or work place. Compounds mu~t generally be screened ~or damage ~o the embryo (teratogene~is activity) and for damage to the differentiated animal (carcinogenesis or mutagenesi a tivity).
Classically, compounds have been as~ayPd for mutagenic activity u~ing short te~m t~sts employing bacterial cell systems (STT) or ani~al studi~. Most animal studies are conducted using th~ protocol for~rodents developed by the National Cancer Institute in the early 1970~, reported ~y Sontag, et al., in U.S.
~ ~ h Educ. Welfare Publ. UNIH! Carcinoq. Tech. Rep. Serv.
1,76 (1976). However, the correlation between the results - obtained in the two systems is poor and hard to mea~ure o bjeatively. For example, as r:ported by Tennant, et al., in ~ 9çlg~g~ 236, 933-941 (1987), there is only approximately 60%
: 20 concordance b~tween;four widely used STTs and rod~nt , , : " : , :
, 21~3~
carcinogenicity results. The four ~ests that were compared were the g3LD~nÇIl~ ~utagenesis, SAL, (described in Haworth, et al., Environ. Mutaqen. 5 suppl. 1)3 (19~3) and Mortelmans, et al.
To~icol._Appl. Pharmacol. 75, 137 (~984), etc.; chromosome aberration~ in Chinese hamster ovary cells, ABS; sister chromatid exchanges in Chinese hamster ovary cells, SCE, (both described in Galloway, et al. Environ. Mutagen. 7, 1 (1985), and Galloway, et al. nyl o~. Mutaqen ~1987); and mouse lymphoma cell, MOLY, (described in Myhr, et al., Evaluation of Short-Term Tests for Ca~c ~ the Inte~nat ~ emical Sa~ety's C~ borative Study on_in vitro Assays, vol. 5 of P~oqre~s_in MutatiQn R~search Series, pp. 55-568, J. Ashby, et al. Editors (Elsevier, Amsterdam, 1985)) assays.
A recent variation of the SAL, or Ames, in vitro assay was reported ~y Oda, et al., in Mutation Research 147, 219-229 (1985~. Oda, et al. ! intro~uced a fused umuC'-'lacZ gene into Salmo~ella typhimurium. The umu operon in Escherichia coli is responsible for chemical and radiation mutagenesis and is inducible by DNA-damaging agents. Induction of umu by the compound being tested is determined by production of beta~
galactosida~e activity resulting from expr~ssion of lacZ. A
similar modification to the SOS chromotest to detect DNA~damaging agents, d~scribed by Quillardet, et al., Proc. Natl. Acad. Sci.
~Y~L 79, 5971-5975 (1982), uses one of the SOS genes, ~f~, fused to lacZ on the chromosome of E~ coli.
2~3~3L5 There are disadvantag~s associatefl with the rodent ass~yæ which are distinct from those identified with the in vitro assays. The most significant problem is the length of time required to demonstrate that a compound is car~inogenic, since S the determination is made based ~n tumor growth following exposure to thP compound being tested. In genexal, animal studies ~u~t extend over a period of at l~ast 12 to 18 months before a compound can be determined not to be carcinogenic.
Another problem i5 that it is impossible to distinguish between genotoxic compounds (those inducing mutations within the DNA
which leads to tumor growth) and those which alter some other non-DNA factor which leads to tumor growth. Still another pro~lem with the rodent assay is that it is qualitative, not quantitative, makin~ it possible only to determine the minimum do~age which induces tumor growth in the species being tested under the assay conditions.
T4 date, very few in vitro assays screen compounds for non-genotoxic carcinogenic activity. One in vitro assay i~
described by Penman and Fey in U.S. Patent No. 4,569,916. This method is based on induction of ~orphological changes in a cell line upon exposur~ to a compound to be tested.
Compounds have traditionally been screened for teratogene~is activity, or inhibition o~ cell differentiation, by expo ing an e~bryo to the compound to be tested, then examining :25 sample~ from different areas o~ duvulopment for aberrations or : -3-2~1~)3~5 inhibition of growth. Detailed descriptions of systems in use are r~ported by Flint in ~rl~5s~g~ 5~ o~b~ edited by Merker, et al., p. 325 (Wa~ter de Gruyter & Co., Berlin 1980) and Flint, ~t al~, JO_Cell_Sci. 61, 2~7 (~983); Concepts in Toxicology, Vol. 3 In Vitro Embryotoxicity aod ~er~tn~ v Tests edi~ed by Homburger, et al., (Xaryer, Basel ~9~5); Toxic.
~Dl _~h~=g9~ 76, 383 and J. Appl. T~ex cQl 4, 109 ~1984). As reported, assay~ for cytotoxicity and for cell differentiation are made in vitro, with confirming studies in vivo. When in vitro studies are conducted, at a minimum, cells from the midbrain and forelimb areas must be exposed to the compound and examined for detrimental effects. Another in vitro teratogenicity assay is reported by Keller in Molecular Toxicoloqy 1, 261-276 (1987) using vaccinia virus growth in primate cell cultures, stated to be equally predictive of human teratogenesis a~ the ln_~Y~ rodent assay.
None of the methods presently in use for screening for carcinogenesis or ~eratogenesis activity in v tro correlate very well with in vivo results, or, where results can be correlated, the tests are time consuming, cannot be quantitated easily and are limited in sensitivity.
It is therefore an object of the present invention to provide a simple, quantifiable, more sensitive assay for mutag~ns, carcinogens, and teratogens.
2~3~1S
It is another object o~ the present invention to provide an accurate measure of mutagenesis or teratogenesis activity th~t can be accurately correlated with in vivo observations.
~u~mary of tho ~e~t~s~l A ~ethod and a~says using engineered animal cells, animal embryos or differentiated animals, carrying in each cell a target gene and a coupled reporter gene. Both the target gene and the reporter gene have been engineered by splicing to each coding sequence an anlmal promoter/enhancer and a transcription termination signal so that both genes can be expressed in animal cells. The target and reporter genas are introduced into a cultured animal cell or embryonic cell by DNA transfection or DNA
microinj~Gtion, respectively. In the a~sence of mutation, the product of the target gene prevents expre~sion of the r~porter gene through interaction with a regulatory sequence in the reporter gene. When a mutation in the target gene occurs which results in production of inactive repressor or othar reyulatory pro~eins, the reporter gene is no longer repressed and the reporter protein is expressed.
~ he reporter genes encode biologically active proteins or antigens whose functions and presence can be easily monitored and quantitated using standard biochemical techniques. The 2~3~5 target ~enes consist of those which encode regulatory proteins that can be linXed to the cont.rol of reporter gene expression.
These can be repressors or o~her regulatory molecules~ The inactivation of a repressor ~ene by a mutagenic event causes the transcription and translation of a defective repressox protein that is unable to repress expression of the r porter geneO The same effect is pruduced by alteration o~ the operator region of the reporter gene in a manner that prevents binding of the repressor protein. Expression of the reporter gene can then be monitored by assaying for defined functions of the gene product.
The reporter gene preferred at this time is the operator-containing ~. coli lacZ gene which encodes beta-galactosîdase. The target gene is the E. coli lacI gene which encodes the lac repressor. In the assay, the engineered animal cells axe expo ed to the mutagen. Prior to muta~enesis, expression of the heta-galactosidase gene is repressed by binding .of the lac repressor protein to the lac operator. When a mutation eve~t alters either the lacI gene, such that a defective lac repressor is produced, or alters the lac operator, the repressor can no longer bind to~the op~rator. The beta-galactosidase gene is then expreæsed. The cells positive for beta-gal ctosidase are stai~ed blue following addition of the substrate for beta-galactosidase, 5-bromo-4-chloro-3-indolyl-beta-D-gal~ctopyranoside, "X-gal".
Another problem i5 that it is impossible to distinguish between genotoxic compounds (those inducing mutations within the DNA
which leads to tumor growth) and those which alter some other non-DNA factor which leads to tumor growth. Still another pro~lem with the rodent assay is that it is qualitative, not quantitative, makin~ it possible only to determine the minimum do~age which induces tumor growth in the species being tested under the assay conditions.
T4 date, very few in vitro assays screen compounds for non-genotoxic carcinogenic activity. One in vitro assay i~
described by Penman and Fey in U.S. Patent No. 4,569,916. This method is based on induction of ~orphological changes in a cell line upon exposur~ to a compound to be tested.
Compounds have traditionally been screened for teratogene~is activity, or inhibition o~ cell differentiation, by expo ing an e~bryo to the compound to be tested, then examining :25 sample~ from different areas o~ duvulopment for aberrations or : -3-2~1~)3~5 inhibition of growth. Detailed descriptions of systems in use are r~ported by Flint in ~rl~5s~g~ 5~ o~b~ edited by Merker, et al., p. 325 (Wa~ter de Gruyter & Co., Berlin 1980) and Flint, ~t al~, JO_Cell_Sci. 61, 2~7 (~983); Concepts in Toxicology, Vol. 3 In Vitro Embryotoxicity aod ~er~tn~ v Tests edi~ed by Homburger, et al., (Xaryer, Basel ~9~5); Toxic.
~Dl _~h~=g9~ 76, 383 and J. Appl. T~ex cQl 4, 109 ~1984). As reported, assay~ for cytotoxicity and for cell differentiation are made in vitro, with confirming studies in vivo. When in vitro studies are conducted, at a minimum, cells from the midbrain and forelimb areas must be exposed to the compound and examined for detrimental effects. Another in vitro teratogenicity assay is reported by Keller in Molecular Toxicoloqy 1, 261-276 (1987) using vaccinia virus growth in primate cell cultures, stated to be equally predictive of human teratogenesis a~ the ln_~Y~ rodent assay.
None of the methods presently in use for screening for carcinogenesis or ~eratogenesis activity in v tro correlate very well with in vivo results, or, where results can be correlated, the tests are time consuming, cannot be quantitated easily and are limited in sensitivity.
It is therefore an object of the present invention to provide a simple, quantifiable, more sensitive assay for mutag~ns, carcinogens, and teratogens.
2~3~1S
It is another object o~ the present invention to provide an accurate measure of mutagenesis or teratogenesis activity th~t can be accurately correlated with in vivo observations.
~u~mary of tho ~e~t~s~l A ~ethod and a~says using engineered animal cells, animal embryos or differentiated animals, carrying in each cell a target gene and a coupled reporter gene. Both the target gene and the reporter gene have been engineered by splicing to each coding sequence an anlmal promoter/enhancer and a transcription termination signal so that both genes can be expressed in animal cells. The target and reporter genas are introduced into a cultured animal cell or embryonic cell by DNA transfection or DNA
microinj~Gtion, respectively. In the a~sence of mutation, the product of the target gene prevents expre~sion of the r~porter gene through interaction with a regulatory sequence in the reporter gene. When a mutation in the target gene occurs which results in production of inactive repressor or othar reyulatory pro~eins, the reporter gene is no longer repressed and the reporter protein is expressed.
~ he reporter genes encode biologically active proteins or antigens whose functions and presence can be easily monitored and quantitated using standard biochemical techniques. The 2~3~5 target ~enes consist of those which encode regulatory proteins that can be linXed to the cont.rol of reporter gene expression.
These can be repressors or o~her regulatory molecules~ The inactivation of a repressor ~ene by a mutagenic event causes the transcription and translation of a defective repressox protein that is unable to repress expression of the r porter geneO The same effect is pruduced by alteration o~ the operator region of the reporter gene in a manner that prevents binding of the repressor protein. Expression of the reporter gene can then be monitored by assaying for defined functions of the gene product.
The reporter gene preferred at this time is the operator-containing ~. coli lacZ gene which encodes beta-galactosîdase. The target gene is the E. coli lacI gene which encodes the lac repressor. In the assay, the engineered animal cells axe expo ed to the mutagen. Prior to muta~enesis, expression of the heta-galactosidase gene is repressed by binding .of the lac repressor protein to the lac operator. When a mutation eve~t alters either the lacI gene, such that a defective lac repressor is produced, or alters the lac operator, the repressor can no longer bind to~the op~rator. The beta-galactosidase gene is then expreæsed. The cells positive for beta-gal ctosidase are stai~ed blue following addition of the substrate for beta-galactosidase, 5-bromo-4-chloro-3-indolyl-beta-D-gal~ctopyranoside, "X-gal".
3~
Detection of expression o~ the reporter gene is sensitive and quantitative, providing enhanced resolution of the effects o~ the compound being tested. There are a number of embodiments of the assay system based on se:lection of the reporter genes, the target genes, the promoters/enhancers and operator sequences, and the assay conditions. Three examples are provided, a transgenic animal cell system for in v~itro analysis o~ mutagen~, a transgenic animal system for in vivo analysis of mutagens, and a transgenic animal embryo system for in vivo analysis of teratogens.
~rle~ Doscriptlon o~ the Draw~ngs Figure 1 is a schematic construction of an expression vector pXZI containing the complete coding sequence of the la~
repressor flanked by the RSV-LTR promoter along with the SV40 polyadenylation site, which forms the functional transcription unit of the target gene, and the complete coding sequence of the beta-galactosidase enzyme ~lanked by the SV40 promoter along : with the SV40 polyadenylation site which forms the functi~nal transcription unit of the repor~er gene.
: Z0 ~ Figur- ~2 i a schematic of the transfection of human embryonic kidney c~lls 2g3 with pXZI and pSV2NE0 and isolation of cell lines positive for IPTG~induction.
~gDO~ S
Figure 3(a) and 3(b) are photographs of XZI (293) cells carrying lacI and lacO-lacZ genes; Figure 3(a) is a photograph of control cells that remained colorless with X gal substrate in the absence of IPTG, demonstrating lacZ repression by lacI repressor;
and Figure 3(b) is a photograph of cells stained blue with X-gal substrate in the presence of 15 mM IPTG, demonstrating lacZ
expression.
Figure 4(a) and 4(b) are photographs of XZI2-9 cells;
Figure 4(a) is a photograph of control cells not exposed to NMU
and Figure 4(b) is a photograph of cells which have been exposed to 150 ~g NMU/ml cells in culture.
Figure 5 is a schematic of a method for treating XZI
cell lines with NMU and detecting more blue colored cells following X-gal supplementation than the control, indicating that those cells have undergcne a mutagenic event.
Figure 6 is a schematic of a method for generating transgenic mice carrying the functional target gene and reporter gene and developing in v1vo mutayenesis assays.
Figure 7 is a schematic of a method for breeding and producing transgenic mice for use in in vivo assays.
: D~t~iled:De30rip~ion o th~ Inv~ntion As described below, a method hls been developed which s uses a set of two genes, a target ~ene and a reporter gene, incorporated into animals or animal cells to screen for compounds having mutagenic, carcinogenic or teratogenic activity. Exposure of the animals or animal cells to compounds having any of these 5 activities causes mutations resulting in alterations in expression o~ the reporter gene. ~oth the target gene and the reporter gene constructs contain an animal promoter/enhancer, the protein coding sequence and the SV40 polyadenylation sequence.
This method has several advantages over the prior art methods of screening for compounds having mutagenic or teratogenic activity. The most significant advantage is the ease in detection and decrease in number of false positives. Although the mutation o genes encoding reporter proteins has previously been used to assay for mutagenic activity, the mutational event resulted in the protein not being expressed. Detecting a single cell, or even a few cells, not expressing a protein, while surrounded by cells which express tha protein, is difficult, tedious,~and subject to a high percentage of error. In contrast, in the present method, the mutakional event ultimately results in the expression~of a reporter molecule which would otherwise not be expressed, and which is readily detected.
As used herein, unless specifically stated otherwise, "animal cells" will be used to inc~ude cells in cell cultures, embryos, and differentiated animals. As also used herein, _g_ 2[)~3~5 "mutagen" will be used to include toxins, carcinogens, teratogens, and other agents which alter DNA or RNA sequence or expression, unless stated otherwise.
~he selection of reporter genes i's based on the ~ollowing criteria: ~i) the reporter gene product cannot be detrimental or lethal to the transformed cells, (ii) the gene product should provide a simple and sensitive detection system Por its quantitation, and ~iii) non-transformed cells should have a low constitutive background of gene products or activities that will be assayed. Reporter genes which encode enzymes, antigens or other biologically actlve proteins ~hich can be monitored easily by biochemical techniques are preferred. These include beta-galactosidase ~Norton, P.A. and Coffin, J.M. Mol. Cell.
Biol. S, 281-290 (1985), peroxidase and luciferase (de ~et, J.R.
et al. Mol. Cell. Biol. 7, 725-737 (1987). In the preferred embodi~ent, there is only one copy of the reporter gene in each animal cell. Howevsr, more than one copy may be utilized to increase the amount of reporter gene product. Although not usually required or desirable, it i5 also possible to include more than one type of reporter gene in the same animal cell.
~ he ~arget gene is selected from the group of sequence which encode regulatory molecules that bind o a sequenca controlling reporter gene expression. These can be repressors or other regulatory molecules, including anti-sense RNA. In the most preferred embodiment, the lacI repressor gene is used as a .
, 2~03~
mutagenesis target. The inactivation of thle repressor gene by a mutagenic event causes the transcription and translation of a defective repressor protein that is no longer able to repress expression of the reporter gene, the lacZ gene encoding beta-galacto idase. Altera~ion of the operator r~gion for thereporter gene in a manner that prevents binding of the repressor protein produces the same effect. Derepression of the reporter gene can then be monitored by assaying for defined functions of the gene product.
The bacterial lac operator repressor system is preferred because it is one of the most basic and thoroughly studied examples o.~ a protein-nucleic acid interaction that regulates transcription of a gene, as described by Coulondre and Miller, Mol. Biol. 117, 577 (1977~ and Miller, Ann. Rev. Genet.
17, 215 (1983). This bacterial regulatory system has been transfected into mammalian cells and expression detected by addition of an inducer, isopropyl beta-D-thiogalactoside (IPTG), as reported by Hu and Davidson, Cell 48, 555 (1987), and Brown, et al., Cell 49, 603 ~1987). An important difference between previous uses of the lac operator-repressor system and the present method is that mutation rather than induction is used to derepress the reporter ~enes to express protein whose function is solely to serve as an indicator. Another difference is that, in the pre~erred embodiment, a single copy o~ functional target gene per cell is introduced into the genome.
.
-11~
2~3~15 For the repressor protein to control the expression of a reporter gene, the operator sequence has to be built into the reporter gene at the location between the transcription initiation site and the initiation codon ATG. Either an original lac operator sequence (5'-GGAATTGTGAGCGGATA~CAATCC-3'), or a mutant lac operator, for example, a sequence which binds repressor eight times tighter (5'-ATTGT~AGC~;CTCACAAT-3'), can be used in vector construction.
The lacI gene has a GTG initiation codon instead of ATG
which is found in animal cells. The GTG codon can be converted to ATG by ~n vitro site specific mutagenasis, using the method of Hu and Davidson, Ce11 48, 555 (1987). This modified lacI gene is then inserted into an appropriate expression vector which contains an eukaryotic promoter and the SV40 polyadenylation site.
Several promoters are good candidat~s for the : construction of expression vectors. For the method of the present invention, two types of promoters are generally used.
The ~irst type consists of ubiquitous promoters such as the histone gene, ribosomal protein gene, and beta-actin gene. The second type consists of tissue specific promoters which include SV40 early promoter, Rous sarcoma virus (RSV) long terminal repeat (LTR) and cytomegalovirus (CMV) early gene promoter, etc.
: All of these promoters are known to drive gene expression in 25: animal cells.
:.
39L~S
To con~truct cells for use as an in YL~E~ mutagenesis model, strong viral promoters such as RSV-LTR are used to drive both the lacI and lacZ genes in animal cell~. For an in vivo mutagenesis model to have broad application, most major organs of transgenic mice should express the mutagenesis target gene and reporter gene. Ubiquitous promoters and enh.ancers are preferred for use in construction o~ transgenic animal systems so that, irrespective of the peculiarities of the substances tested, the ef~ect of the test compound on tissues of diverse organs and metabolic properties which contain the ~arget gene can be detected. A preferred promoter for use as an ubiquitous promoter to drive the lacI gene is the histone 3.2 gene promoter.
This is a transcriptionally very active, single copy gene in mice which is expressed at high levels and accounts for 30 to 40% of th~ histone H3 mRNAs isolated from a variety of mouse tissues.
In those mammalian cells and animal tissues wh~re the histone 2 gene promoter does not result in optimum expression, other viral or c llular promoters can be selected to drive : approprlate expression of the lacI gene. Examples of good candidate to be engineered into DNA constructs are the human ribosomal protein S14 gene, mouse ribosomal protein Sl6 gene, rat cytoplasmic beta-actin gene and human beta-actin gene. These genes have be~n cloned, their nucleotide sequences determined and they are available for~use.
:: :
3~5 In the preferred embodiment, the reporter gene for use with the lacI regulatory gene is the gene encoding beta-galactosidase, derived from the bacterial l,acZ gene. Expression ; of be~a~galactosidase is readily detected using histochemical procedures. In another embodiment, the gene encoding 5V40 large tumor (T) antigen is used as a reporter gene in place of the beta galactosidase gene, using an immunoperoxida~3e technique to detect the cells expressing the SV40 T antigen. A strategy similar to that employed for producing tha lacZ reporter system is used to make the construct containing the complete sequence coding for SV40 T antigen for insertion into an appropriate expression vector. The complete transcription unit of SV40 T antigen is : then physically linked to the functional transcription unit of lacI gene and trans~erred into appropriate cells to test for gene expression.
The theories and standard procedures for molecular cloning are described in Molecular Cloninq, edited by T.
~aniatis, et al. Cold Spring Harbor, Laboratoryl Cold Spring Harbor, N.Y.), Lab Procedures in Molecular_Bioloqy, edited by Ausubel, et al., (Greene Publishing Division of John Wiley, NY
1987), and are generally known to those skilled in the art.
Procedure~ include preparation of DNA and RNA, preparation of cloning vectors, ligation, transformation of competent cells, selection and screening by ln situ filter hybridizatlon, as described by David, et al., Advanced Bacterial Genetics (Cold -~4-2~3~S
Spring Harbor Laboratory, Cold Spring Harbox, MY). In addition, techniques for separation of DNA by ~el electrophoresis, mapping of r~stxiction enz~me cleavage sites, and modification of DNA
fragments by modifying enzymes are used. Most restriction enzymes, vectors, and reagents can be obtained from commercial companies. Common vectors and ~ li stralns are used, or example, pBR322, pUC series, lambda-WES, M13mp, DH5, LE392, JM109 and HB101.
Chain termination methods are used for nucleotide sequence determination to con~irm the DNA constructs at the splicing sites, as reported by Sanger, et al. Proc. ~atl. Acad.
Sci. USA 74, 5463 (1977). Many commercial suppliers provide both reagent kits and detailed protocols. Since most nucleotide sequences are known for the vectors, promoters and genes to be used, oligonucleotides o~ defined sequences are used as primers in s~quencing experiments. These are typically 15 to 20 nucleotides long and very convenient for sequencing specific regions of interest, using the techni~ues of ~essing, et al.
Nucleic Acids Res. 9, 309 (1981). Either single-stranded or double-stranded DNA can be sequenced with this technique.
011ogonucleotides to be used in DNA sequencing and as Iinkers are synthesized by an automated DNA synthesizer. This service can be obtained ~rom commercial sources, such as Genetic Designs, Inc., Houston, Texas. The oligonucleotide~ greater than 2C~6:33~L5 30 nucleotides are then sub3ected to polyacrylamide gel electrophoresis to ensure purity.
DNAs are transfected into cells by one of several standard published procedures to form stable transformants, including, for ex~mple, calcium phosphate precipitation, DEAE-Dextran, electroporation, and protoplast fusion. These m4thods are descri~ed in detail as ollows:
Calcium phosphate precipitation: DNAs are coprecipitated with calcium phosphate, according to ~he method of Graham and van der Eb in Virolo~y 52, 456 (1973), before transfer into cells. 40-50 ~g of DN~ with salmon ~perm or calf thymus DNA
as a carrier is used for 0.5 x 106 cells plated on a lO0 mm dish.
DNA is mixed with 0.5 ml of 2X Hepes solution (280 mM NaCl, 50 mM
Hepes and 1.5 mM Na2HP04, pH 7.0) to which an ~qual volume o~ Zx CaC12 (250 m~ CaClz and 10 mM Hepes, pH 7.0) is added. The solution with a white granular precipitate appearing after 30-40 . minutes is distributed dropwise evenly on the cells and a}lowed to sit for 4-16 hours at 37C. The medium is removed and the cells are shocked with 15% glycerol in PBS for 3 minutes. After : 20 removing the glycerol, the cells are fed with DMEM containing 10 : fetal bovine serum and left in the incubator.
Protein samples are prepared for Western blot analysis by lysing cells ~nd separating the proteins by SDS-PAGE. The proteins are transferred to nitrocellulose by electroblotting as described by Ausubel, et al., Current~Protocols in Mo.lecular .
20~)3~31L5 Biolo~y (John Wiley and Sons, 1987). After blocking the ~ilter with instant non~at dry milk (1 g in 100 ml PBS), primary antibody is added to the filter and incubated for 1 h at room temperature. The filter is washed thorough:Ly with phosphate buffered saline (PBS) and incubated with horseradish peroxidase -antibody conjugate for 1 h at room tempera~ure. The fil~er is again washed thoroughly with PBS and the antigen bands are identified by adding diaminobenzidine.
Enzyme assays, protein purifica~ion, and other classical biochemical methods are employed. DNA and RNA are analyzed by Southern blotting and Northern blotting techniques.
Typically, the samples to be analyzed are size fractionated by gel electrophoresis. The samples, DNA or RNA, in the:gels are then transferred to nitrocellulose or nylon membranes by blotting techniques. The blots, which are replicas of sample patterns in the gels, are hybridized w1th probes in Southern and Northern an~lysis. Specific bands of interest can then be visualized by detection systems such as autoradiography.
DNA can also be transferred using the DEAE-Dextran method of Kimura, et al. Virolo~y 49, 394 ~1972) and Sompayrac, et al., Proc,_ Natl. Acad. Sci. USA 78, 7575 (1981); the electropor~tion ~ethod of Potter, ProQ. Natl. Acad. Sci. U$A 81, 7161 (1984), and the protoplast fusion method of Sandri-Goddin, et al. ~leç. Cell Biol. 1, 743 [1981).
2~ 3 In the pre~erred embodiment of the assay, the engîneered animal cells are exposed to the compound to be tested.
Prior to mutagenesis, expression of the reporter gene is repressed by binding of the lac repressor to the operator of the reporter gene. When a mutation evant alterls the lacI gene such that a defective lac repressor is produced, or alters the operator, the repressor can no longer bind to the operator. The reporter gene is then turned on and directs the synthesis o~ the reporter protein.
The DNA constructs to be introduced into the genomes of animals are engineered using essentially the same methodology.
These transgenic animals are used for in vivo mutagenesis tests.
The preferred embodiment is a transgenic mouse or rat model thal carries the lac repressor gene as the mutagenesis target coupled to an operator-containing reporter gene which can be turned on and expression of the reporter gene monitored, when the lac repressor gene is inactivated by mutagenesis~ Both the target gene and reporter gene are of bacterial origin, but capable of being expressed in animal cells following insertion into animal gene expression vectors. This transgenic model allows simple and eas~ quantitation o~ mutagenesis events in vivo and therefore prcvides a more accurate risk assessment for toxic substances such as mutagens, carcinogen~ and teratog~ns than conventional rodent assays~ The system is also more sensitive and rapid than standard rodent assays since mutations or alterations in the ., ~,, ~ , , .
~'' ' ~ ' ' ' 2~3~1S
target gene can be detected at the DNA and cellular levels by histochemical techniques before tumor development.
The present invention is further described with respect to ~he following non limiting examples.
~ pl~ 1: n vltro a~ l c~ ut~g~nl~si~ A~ay.
: (a) Construction o~ system.
vector DNAs were generated based on plasmid co~ponents dascribed in the literature or commercially available, as shown : schematically in Figure 1. pRSVI was obtained from Dr. Norman Davidson o~ Californials Institute of Technology, Pasadena, California. This plasmid, as described by Hu, M.C., and Davidson, N., in Cell, 48,555 (1987), contains ~ lacI
repressor coding region linked to Rouse sarcoma virus (RSV) promoter and SV40 poly A. pCH110 was described by Hall, C.V., et al., J. Mol. Appl. Gen., 2,101 (1983), and provided by Dr. FranX
Lee of DNAX, Palo Al o, California. The beta-galactosidase ~lacZ) gene is fused to SV40 early promoter and SV40 polyadenyla~ion site in this plasmid.
Figure ~ outlines the insertion of an operator sequence and construction of a combination vector (pXZI). pCH110 was restricted with Sfil and ~dIII and ligated to synthetic complementary oligomerso 5' CGAG CCTCTG AGCTATTCCA GA 3' 3' CGAGCTC GGAGAC TCGATAAGGT CTTCGA 5' 3~S
This procedure yielded plasmid derivative pCHllOXH, having an ~l site 18 nucleotides downstream from the TATTTA
sequence in the SV40 early promoter, described by Reddy, V.B. et al., in Science, 200,494 (1978). lac operator DNAs can potentially be inserted at the Xhol, as well as the HindIII (42 nucleotides downstream of the TATTTA sequence), sites.
As a Pirst step, pCHllOXH wa~ cut with Xhol and ligated to the oligomer shown below con~aining an eighteen nucleotide palindromic lac operator~
5' TCGAATTGTGAGCGCTCACAAT 3' The resulting plasmid pCHllOXH22 was cleaved with BamHl and used to insert RSV lacI as a Bam~l fragment derived from pRSVI. The combination plasmid construct pXZI containing both the lacI and lacO-lacZ genes was used to transfect 293 cells, as diagrammed in Figure 2. ATCC CRL-l573 thuman embryonic kidney cells 293) are available from the American Type Culture Collection, Rockville, MD. Other cells such as ATCC CCL-T.l (LLC-MX2~, that could be used, are also available ~rom the ATCC.
The construct is co-~rans~ected into the cells with a neo gene as the selection marker using known procedures, such as : calcium phosphate precipitation method described above. The cell colonies resistant to the an ibiotic G418 are detected by growth ' : -20-' " " - ~ ;
. . . . ''; ' ' ' ..
.; , ' :' ., ' , .
3~5 in ths selection medium, cloned ~nd analyzed for the presence oP
functional lac repressor and beta-galactosidase genes, as shown schematically in Figure 2.
(b) Analysis and Characterization of System.
Transfected cells containing non-functional lac repres~or gene and functional beta-galactosidase gene stain blue follow~ng addition of the substrate for beta-galactosidasP, 5-bromo~4-chloro-3-indolyl-beta-D-galactopyranoside ~X~gal~, to cultures in the absence of inducer IPTG~ The desired colonies, containing both functional lac repressor and beta-galactosidase g~nes, should stain blue following addition of IPTG and X-gal, remaining unstained if only X-gal is added. Successful expression o~ the lacI gene can also be demonstrated by ~est~rn blot analysis of lac repressor protein according to Sams, et al., J. Biol. Chem. 260, 1185 (1985) and by a filter-binding assay for repressor-operator DNA complexes according to Lin and Riggs, J.
Mol. biol. 72, 671 (1972).
pXZIand pSV2neo DNAs were transfected into human embryonic kidney (293) cells using the calcium phosphate precipitation method. Following trypsinization 24 hours post transfection, the cells were plated at }:10 dilution, and fed with medium containing G418 ~350 ~g/m1). 10 days later, 96 colonies were isolated with cloning rings and tes~ed with X-gal for blu~ stain.
211~3~L5 The 293 derived cells were rinsed with PBS (150 mM
NaCl, 15 ~M ~odium phosphate, pH 7.3) and then fixed for 5 minutes at 4C in 2% formaldehyd~ and 0.2~ glutaldehyde made with PBS. Following fixing and removal of fixing medium, the cells were washed with PBS and ouerlaid with a histochemical reaction mixtl~re containing 1 mg X-gal/ml, 5 mM potassium ferxicyanide, 5 : mM potassium ferrocyanide, and 2 m~ MgC12 in PBS. The X-gal was : dissolved in dimethyl sulfoxide a~ 100 mg/ml conCentratiQn and diluted into the reaction mixture. The cells were incubated at 37C for 18-24 hours before they were examined for blue color.
55 colonies, which did not appear blue, were fed with medium containing 15 mm of IPTG (isopropyl beta-D-thiogalactoside). Seven colonies (designated XZI l-~, XZI 1-12, XZI 1-13, XZI 2-9, XZI 2-13, XZI 3-4, and XZI 4-3) were selected which showed blue color in the presence of IPTG and remained colorless in the absence of IPTG.
Figure 3 demonstrates IPTG induction in one of the clones, showing that the lacI-lacO-lacZ system is functioning as expected and could be used for th~ in vitro mutagenesis assay.
Figure 3(a~ is a photograph of the control cells, which remained colorless with X-gal substrate in the absence of the inducer ~IPTG. Figur- 3(b) ia a photograph of the induced cells, stained blue with X~gal substrate in the presence of 15 mM IPTG, demonstrating lacZ expression.
, .
--2~)~3~LS
Following success~ul expression o~E both lac repressor and beta-galactosidase genes in cultured ce:lls, each of the colonies can be analyzed for the copy number of the introduced genes. Single copies of lacI gene per cell (diploid genome) are screened for by Southern blotting analysis of the genomic DNA.
Cells with single copy are greatly preferrec~ to cells containing more than one copy of functional lacI yene since these will re~uire more than one mutational event ~o inactivate every copy o~ functional repressor gene and thereby to cause the depression of .he reporter gene. Since the mutational event is detected by expression of the reporter gene t the number of copies of reporter gene is not as crucial, with more than one copy facilitating detection in some cases. The probability of obtaining single copy sequence is increased by using low concentrations of target DNA and sufficient carri~r DNA to transfect recipient cells.
(c) Screening Compounds for Nutagenic Activity.
Nitrosomethylurea ~NMU~ can be employed as a model mutagen since it has been shown by Dubridge, et al., Mol! Cell.
Biol. 7, 379 (1987) to readily induce mutations in the lacI gene in vitro. The cultured cells are treated with NMU for a speclfied period of time, and ~he cells screened for expression of th~ reporter gene. The frequency of mutations is quantified by scoring the number of beta-galactosidase positive cells among the total cells.
:
' 2 [30341 S
Similarly, the background frequency of mutations can be obtained by counting the number of beta~galactosidase positive cells present in cultures that are no~ exposed to the mutagen.
A11 seven cell lines were plated :in duplicate at 30%
confluence in 100 mm dishes. NMU was disso:Lved in PBS at 10 mg/ml concentrations and added directly to one of the two dishes of each cell line ~o a final concentration of 150 mg/ml. The dishes were left at 37C Por 6 days while feeding with medium at three day intervals. If the cells became confluent they were subdivided to maintain semi-confluency and growth. X~gal hiætochemical reaction mixture was added a~ter six days and the cells were visualized for blue colored-cells under a light microscope.
XZI 2-9 was found to yield 30 times~more blue cells than the untreated control cells, as shown in Figure ~, indicatillg the inactivation of lacI by NMU followed by derepres ion of lac~. The other cells did not show an increase in blue cells over-the untreated control cells, indicating that no mutation had occured that resulted in derepression of the beka-galactosidase gene.
Figure 5 is a schema:tic of the process used to test compounds ~or mutagenesis. Cells which are capable of expressing beta-galactosidase in the presence of inducer are exposed to mutagen. After a period of days, cells are provided with X-gal substrate. The number of cells showing blue staining (corrected : :
.
., . , ' .
Z~34~L5 for background levels~ is indicative of the mutagenic activity of the compound.
B~a~pl~ 2~ ~r~nsge~io ~ l Nutag~ a~ ~say.
The ~irst steps in producing transgenic animals for an in vivo assay are to prepare and detect activation of the beta galactosidase reporter gene induced by mutation in lac~ in mouse fibroblast cultures that have been successPully transfected with the coupled lacI - lacZ gene construct and subsequently exposed to a test mutagen, using the methodology described in Example 1.
; 10 Controls consist of non-transfected cells and cells bearing the coupled genes that ha~e no~ been exposed to the mutagen. The ln ~i~Q system is followed by the production of founder C57BL/6J
transgenic mice bearing the coupled lacI - lacZ gene construct and, subs~uently, production of transgenic offspring that contains the gene construct. Sexually mature, transgene-positivè
transgenic o~fspring serve as control and mutagenesis-test subjects.
(a) Preparation of DNA.
A DNA construct is prep~red as described in Example 1 for use in making transgenic mice, as shown schematically in Figure 6. The construct has two functlonal transcription units physically linked to each:other~ each containing a promoter/enhancer, a coding sequence and SV40 polyadenylation site. One is used to drive lac repressor gene expression; the 2~3~
other i~ used to drive the expressi~n o~ the beta-galactosidase gene. The mouse histone-3.2 promoter can be used in the construct for ubiquitous expression of both lac repressor and beta-galactosidase genes.
S The DNA fragment containing both the target ~ene, such as ~he lac repressor transcription unit, and the reporter gene, such as the beta-galactosidase transcription unit, or the S~40 T
antigen unit, are excised from the vector by restriction enzyme digestion and isolated by gel electrophoresis and affinity column purification for microinjection, as follows. The fragments are separated on an agarose gel and the de~ired band recovered by electroelution. The DNA is extracted with phenol/chloroform, concentrated by ethanol precipitation, and further purifled by binding and elution from Elutip-d columns. The DNA is then recovered by ethanol precipitation, dissolved in sterile lO mM
Tris pH 8, 1 mM EDTA and quan ified by Hoechst dye fl~orescence assay or spectrophotometry at 260 nm.
(b) Introduction of DNA into Embryos.
: The theories and experimental procedures of transgenic mouse construction are described in "Manipulating the Mouse Embryo" by Brigid Hogan, Frank Costantini and Elizabeth Lacy (Cold æpring Harbor Laboratory, Cold Spring Harbor, N.Y.) Mouse zygote~ are collected from six week old C57B/6J females tJackson : Laboratory, Bar Harbor, Maine) that have been superovulated with 5 IU of Pre~nant ~are's Serum Gonadotropin followed 48 h later by ~' .
-2~-2~3~5 51 U Human ~horionic Gonadotropin. Primed females are placed with C57BL/6J males and checked for vaginal plug5 the following morning. Pseudopregnant female~, used a~ recipients~ are CD-1 females (Charles River Laboratories, Wilminc;ton, Massachusetts~
select~d for estrus and placed with proven sterile vasectomized CD-1 males. Zygotes are collected in BMOC-2 medium modified to contain 5.1 g/l NaCl and 5 mg/ml bovine serum albumin. Cumulus cells are removed by treatment with hyaluronidase (Sigma Type IV, 300 IUtml PBS with 1% PVP 40T, Sigma) diluted to 60 IU/ml in culture medium. Zygotes are washed twice in a 2 ml culture medium to remove debris. Approximately ~ pl of DNA solution i9 injected lnto the male pronucleus with approximately 50% surviving in~ection. Injected zygQtes are incubated in 5% COz in air at 37C until transferred to the oviduct of recipient f~males under tribromoethanol anaesthesia.
Integration o~ the gene construct can occur as a single copy or multiple copies that are generally in a head-to-tail ta~dem array, as reported by Palmiter, Cell 29, 701 (1982).
Methodology for gene injection into the mouse embryo ha~ been described by Brinster, et al., Proc. Natl. Acad. Sci. USA 82, ~ 4438 (1985). Some of the more important factors for increasing : the integration frequency are: the concentration of DNA injected : may be a limiting factor in the efficiency of integration - a concentration of 1-2 ng/~l of DNA, or approximately 100-1,000 copies of the DNA fragment, appears ~o be optimum; a linear DNA
~27-~3~L5 molecule is more efficient if it is cut with endonucleases t~at r~sult in non-blunt ends; an~ nuclear rather than cytoplasmic injection is required for high efficiency rates. Several other ~actors do not appear to effec~ the integration rate. Both female and male pronuclear injections can accommodate the injected DNA and result in comparabl~ integration efficiencies.
Pronuclear injections are not essential for integration to occur as injection of DNA into the nucleus of the two-cell embryo will also result in transgenic animals.
It has been suggested that the strain of mouse used could affect the efficiency of integration. For example, the C57 x SJL hybrid egg has been demonstrated to be more efficient than the inbred C57 strain. Comparable efficiencies have been achieved with inbred CD-l mice (Charles River) as with the 15 ~hybrids. Inbrad C57BL/6J mice (Jackson Laboratories) can be used to eliminate segregation of potential background modifier genes.
Inbred C57BT/6J black female mice are hormonally induced for s~perovulation by the administration of follicle stimulating hormone and luteinizing hor~one. They are then mated with inbred male mice.
Fertilized one-cell embryos are flushed from the oviducts and treated with hyaluronidase to remove the cumulus ophoru6 cells from the embryos. The target DNA is then microinjected into the pronucleus of the one-cell embryo. About 100 copies of the lacI-lacZ DNA construct are injected into each ,~
~3~L3L5 embryo, which are then transerred to the oviducts of pseudopregnant foster mothers to complete the gestation period.
The embryos are allowed to differentiate and develop into entire animals.
~c) Selection and analysis of transgenic mice for in vivo mutagenesis models:
Transgenic mice carrying single copies of coupled functional lacI-lacZ gene construrt are æcreened and selected by the following procedures. A section of tail and/or one lobe of liver is used as a source ~or the isolation of genomic DNA. The copy numbers and structures of the transgenes are analyzed by Southern blotting with DNA from lac repressor or the reporter gene used as probes, as well as to ascertain whether any rearrangement or modiflcation has occurred in the transgenes during the genesis of transgenic mice. Only the mice carxying ; single copies of the complete lacI-lacZ gene construct are : sub~ected to further analysis.
: Appropriate tissues are collected at autopsy from transgenic mice to assay for gene Pxpression. RNA and protein are extracted from these tissues and used in Northern blot, Western blot and rapressor function sssays to detect expression of lac repressor gene in tissues of transgenic mice. Since the : reporter gene:~should be r-pressed by the active lacI gene, :~ expres~ion of the reporter gene in tissues is not expected unless there is~no ~unctional lac repressor present or the inducer IPTG
' ' ., :
2,~1134~LS
i~ added. There~ore, the use of the same promoter and enhancer in the construction of both the repres or and the reporter gene is an important strate~y to avoid "uncoupling" of the two genPs.
The presence of function~l lacI and lacZ genes in the tissues of transgenic mice can also be assayed with he procedures described in "Example l, se~tion (b)" using cells dissociated from tail tissues.
Only the transgenic lines with one copy per cell of functional target gene are selected for further breeding to establish a homozygous transgenic line, as shown schematically in Fiyure 7. The F1 are bred with each other and the expected l/4 homozygous transgenic in the F2 are identified by the intensity of the signal in Southern analysis. Homozygosity are confirmed by breediny tests and Southern analysi~ of the o~fspring. The homozygous offspring containing two copies of the transgene is bred to non-transgenic mates to produce heterozygous test animals for the mutagenesis assay.
(d) Analysis of transgenic animals exposed to compound to be tested.
Quantitative data can be obtained as to the localization~and distribution of positive cells in the major organ of both control and mutagen-treated mice. Tissues from the following organs are selected for morphometric analysis.
Brains, (tis~ues collected from the cerebellum, midbrain and forebrain~, liver, spleen, kidney, left ventricle o~ the heart, 3~5 lung, gonad, uterus, pancreas, fund~s o~ the stomach, duodenum, ileum, colon and sternal bone marrow. Following fixation, tissue blocks are trimmed and the histochemical reac~ion for beta-galactosidase performed on 8 micron cryostat: or 30 micron vibratome cuts to assure random sampling. Consecutive sections separated by 40 micron intervals are collected from each block.
Positive cells are enumerated by digitizing morphome~ry using a biological image analyzer system and the Bio-quant II computer program (R&M Biometrics of Nashville, Tenn.). The hardware for this system consists of an image projecting camera mounted on a standard Zeiss binocular microscope, an Apple II microcomputer and a digitizing tablet. Using this system, the specimen is projected onto the computer screen and the operator selects and outlines the a~ea that will be analyzed. Blood vessels and empty spaces, present as lumens of hollow organs, are outlined on th2 screen and the system is then instructed to subtract these areas from those that will be analyzed. Intense blue-stained cells are counted by using the digitizer and the numbers of pQsitiVe cells per unit area o~ the tissue specimen under study is automatically computed. In this manner, the number of positive cells per unit area of a particular organ from an untreated or treated animal can be enumerated and resulting data statistically compared. A
ma]or added benefit of this system is that specific aell types that may be particularly susceptible to a given mutagen can be identified and quantified.
`~ .
21D~)3~
Histochemical analysis is psrformed on tissues from treated and untreated male and female transgenic mice with the same p~digree. Morphometric techniques can be used to producs quantitative data concerning the number of beta-galactoslAase positive cell~ per organ and per animal sampled to provide information on the compound being tested, as well as the efficacy of the test procedure and the frequency o~ spontaneous background mutation in the transgenic animals. The expression of lacZ gene in cells is assayed by beta-galactosidase staining as follows:
Tissues are immersed in cold 4% paraformaldehyde to which 50 mM of Na3P04 is added. This mixture is adjusted to pH
7.4. The immersed tissue is then fixed overnight in this mixture at 4C. The activity of the enzyme is not impaired by this fixation. The tissues are subsequently rinsed in phosphate buffered saline (P~S) and 30 ~m ections are cut on a vibratome or 8 ~ sections are cut on a cryostat. The resultant sections : are then incubated at 37C, 5% CO2 in 1 mg/ml X-gal, 5 mM K+
ferricyanide, 5 mM K+ ferrocyanide, 2 ~M ~g C12, 0.02~ NP-40, 0.01% cholate in PBS at pH 7.3~ The alkaline pH of this solution and the addition o~ Mg~' is critical to avoid background staining of native galactosidase activity in lysosomes. The cells in a test ti~sue positive ~or beta galactosidase will stain blue. The blue i~ visible within one hour and increases in intenaity over the next 12 hours. This phenomenon can be visualized in either the ~ree-floa~lng vibratome sections or cryostat sections affixed .
, ' " . .
~3~
to gelatin coated glass slides. When the desired color intensity is achieved, vibratome sections are mounted onto slides in 0.1%
KCrSO4 and 1% gelatin and dried on a slide warmed at 37C for 1/2 hour. Sections are subsequently dehydrated and cleared in xylene for 2-3 minutes. Counter staining is per~ormed using methyl green aftar which coverslips are placed over the sections.
Paraffin sec ions o~ tissue whole-mounts can also be done since post-embedding in this material does not result in the loss of the blue positive staining. Paraf~in embedded sections can therefore be stored and kept indefinitely as a permanent record for each test procedure.
If the SV40 large T antigen, or other antigen, is used as the reporter gene, a cytochemical-immunoperoxidase method, such as that described by Hanahan, Nature 315, 115 (1985~;
Ornitz~ et al., ~ 238,188 (1987); or Behringer, Proc. Natl.
Acad Sci. USA 85, 2648 ~1988), is used to detect expression of reporter proteins.
: E~pl~ 3: Tr~ge~ic a~ ryo~ to a3~ay for t~ratogen~.
Embryos of the transgenic animals carrying a target gene and a coupled reporter gene are used to screen for teratogens. ~his transgenic embryo model allows simple and rapid quantitation of mutagenesis events in a system which is simiIar to the living human embryo and should provide a more accurate asses ment of the risk of a compound being teratogenic than currently used methods.
2003~
Transgenic animals, such as mice and pigs carrying the lacI g~ne coupled to the lacZ gene, generated by the procedures described in de~ail in Examples 1 and 2, are used to generate transgenic offspring as test animals. Embryos isolated at different stages from pregnant female transgenic animals with successful gene expression are exposed to the agent to be tested, ` and analyzed for expression of the reporter gene.
For example, a 10-mm transgenic pig embryo which has bçen developing for a gestation period of 20 21 days and contains the rudiments of almost all adult structures is exposed to a potential teratogen. The mutation events caused by teratogenic subætances will inactivate the target gene and turn on the reporter gene in certain cells/tissues of the embryo. These cells/tissues can be d-tected using histochemical analysis as described above or by Allen, N.D., et al., in l'Transgenes as probes ~or active chromosomal domains in mouse development", Nature 333, 852-855 (1988~ when the reporter protein is beta galactosidase, or as otherwise appropriate for the reporter protein.
Modifications and variations of the methods and assay systems, transgenic animals and animal cells carrying target genes coupled to reporter genes ~or testing for mutagens and teratogens, will be apparent to those skilled in the art from the foregolng detailed description of the invention. Such variations 3~5 and modif ications are intended to come within the scope of the appended claims.
' -35-:
: . .
Detection of expression o~ the reporter gene is sensitive and quantitative, providing enhanced resolution of the effects o~ the compound being tested. There are a number of embodiments of the assay system based on se:lection of the reporter genes, the target genes, the promoters/enhancers and operator sequences, and the assay conditions. Three examples are provided, a transgenic animal cell system for in v~itro analysis o~ mutagen~, a transgenic animal system for in vivo analysis of mutagens, and a transgenic animal embryo system for in vivo analysis of teratogens.
~rle~ Doscriptlon o~ the Draw~ngs Figure 1 is a schematic construction of an expression vector pXZI containing the complete coding sequence of the la~
repressor flanked by the RSV-LTR promoter along with the SV40 polyadenylation site, which forms the functional transcription unit of the target gene, and the complete coding sequence of the beta-galactosidase enzyme ~lanked by the SV40 promoter along : with the SV40 polyadenylation site which forms the functi~nal transcription unit of the repor~er gene.
: Z0 ~ Figur- ~2 i a schematic of the transfection of human embryonic kidney c~lls 2g3 with pXZI and pSV2NE0 and isolation of cell lines positive for IPTG~induction.
~gDO~ S
Figure 3(a) and 3(b) are photographs of XZI (293) cells carrying lacI and lacO-lacZ genes; Figure 3(a) is a photograph of control cells that remained colorless with X gal substrate in the absence of IPTG, demonstrating lacZ repression by lacI repressor;
and Figure 3(b) is a photograph of cells stained blue with X-gal substrate in the presence of 15 mM IPTG, demonstrating lacZ
expression.
Figure 4(a) and 4(b) are photographs of XZI2-9 cells;
Figure 4(a) is a photograph of control cells not exposed to NMU
and Figure 4(b) is a photograph of cells which have been exposed to 150 ~g NMU/ml cells in culture.
Figure 5 is a schematic of a method for treating XZI
cell lines with NMU and detecting more blue colored cells following X-gal supplementation than the control, indicating that those cells have undergcne a mutagenic event.
Figure 6 is a schematic of a method for generating transgenic mice carrying the functional target gene and reporter gene and developing in v1vo mutayenesis assays.
Figure 7 is a schematic of a method for breeding and producing transgenic mice for use in in vivo assays.
: D~t~iled:De30rip~ion o th~ Inv~ntion As described below, a method hls been developed which s uses a set of two genes, a target ~ene and a reporter gene, incorporated into animals or animal cells to screen for compounds having mutagenic, carcinogenic or teratogenic activity. Exposure of the animals or animal cells to compounds having any of these 5 activities causes mutations resulting in alterations in expression o~ the reporter gene. ~oth the target gene and the reporter gene constructs contain an animal promoter/enhancer, the protein coding sequence and the SV40 polyadenylation sequence.
This method has several advantages over the prior art methods of screening for compounds having mutagenic or teratogenic activity. The most significant advantage is the ease in detection and decrease in number of false positives. Although the mutation o genes encoding reporter proteins has previously been used to assay for mutagenic activity, the mutational event resulted in the protein not being expressed. Detecting a single cell, or even a few cells, not expressing a protein, while surrounded by cells which express tha protein, is difficult, tedious,~and subject to a high percentage of error. In contrast, in the present method, the mutakional event ultimately results in the expression~of a reporter molecule which would otherwise not be expressed, and which is readily detected.
As used herein, unless specifically stated otherwise, "animal cells" will be used to inc~ude cells in cell cultures, embryos, and differentiated animals. As also used herein, _g_ 2[)~3~5 "mutagen" will be used to include toxins, carcinogens, teratogens, and other agents which alter DNA or RNA sequence or expression, unless stated otherwise.
~he selection of reporter genes i's based on the ~ollowing criteria: ~i) the reporter gene product cannot be detrimental or lethal to the transformed cells, (ii) the gene product should provide a simple and sensitive detection system Por its quantitation, and ~iii) non-transformed cells should have a low constitutive background of gene products or activities that will be assayed. Reporter genes which encode enzymes, antigens or other biologically actlve proteins ~hich can be monitored easily by biochemical techniques are preferred. These include beta-galactosidase ~Norton, P.A. and Coffin, J.M. Mol. Cell.
Biol. S, 281-290 (1985), peroxidase and luciferase (de ~et, J.R.
et al. Mol. Cell. Biol. 7, 725-737 (1987). In the preferred embodi~ent, there is only one copy of the reporter gene in each animal cell. Howevsr, more than one copy may be utilized to increase the amount of reporter gene product. Although not usually required or desirable, it i5 also possible to include more than one type of reporter gene in the same animal cell.
~ he ~arget gene is selected from the group of sequence which encode regulatory molecules that bind o a sequenca controlling reporter gene expression. These can be repressors or other regulatory molecules, including anti-sense RNA. In the most preferred embodiment, the lacI repressor gene is used as a .
, 2~03~
mutagenesis target. The inactivation of thle repressor gene by a mutagenic event causes the transcription and translation of a defective repressor protein that is no longer able to repress expression of the reporter gene, the lacZ gene encoding beta-galacto idase. Altera~ion of the operator r~gion for thereporter gene in a manner that prevents binding of the repressor protein produces the same effect. Derepression of the reporter gene can then be monitored by assaying for defined functions of the gene product.
The bacterial lac operator repressor system is preferred because it is one of the most basic and thoroughly studied examples o.~ a protein-nucleic acid interaction that regulates transcription of a gene, as described by Coulondre and Miller, Mol. Biol. 117, 577 (1977~ and Miller, Ann. Rev. Genet.
17, 215 (1983). This bacterial regulatory system has been transfected into mammalian cells and expression detected by addition of an inducer, isopropyl beta-D-thiogalactoside (IPTG), as reported by Hu and Davidson, Cell 48, 555 (1987), and Brown, et al., Cell 49, 603 ~1987). An important difference between previous uses of the lac operator-repressor system and the present method is that mutation rather than induction is used to derepress the reporter ~enes to express protein whose function is solely to serve as an indicator. Another difference is that, in the pre~erred embodiment, a single copy o~ functional target gene per cell is introduced into the genome.
.
-11~
2~3~15 For the repressor protein to control the expression of a reporter gene, the operator sequence has to be built into the reporter gene at the location between the transcription initiation site and the initiation codon ATG. Either an original lac operator sequence (5'-GGAATTGTGAGCGGATA~CAATCC-3'), or a mutant lac operator, for example, a sequence which binds repressor eight times tighter (5'-ATTGT~AGC~;CTCACAAT-3'), can be used in vector construction.
The lacI gene has a GTG initiation codon instead of ATG
which is found in animal cells. The GTG codon can be converted to ATG by ~n vitro site specific mutagenasis, using the method of Hu and Davidson, Ce11 48, 555 (1987). This modified lacI gene is then inserted into an appropriate expression vector which contains an eukaryotic promoter and the SV40 polyadenylation site.
Several promoters are good candidat~s for the : construction of expression vectors. For the method of the present invention, two types of promoters are generally used.
The ~irst type consists of ubiquitous promoters such as the histone gene, ribosomal protein gene, and beta-actin gene. The second type consists of tissue specific promoters which include SV40 early promoter, Rous sarcoma virus (RSV) long terminal repeat (LTR) and cytomegalovirus (CMV) early gene promoter, etc.
: All of these promoters are known to drive gene expression in 25: animal cells.
:.
39L~S
To con~truct cells for use as an in YL~E~ mutagenesis model, strong viral promoters such as RSV-LTR are used to drive both the lacI and lacZ genes in animal cell~. For an in vivo mutagenesis model to have broad application, most major organs of transgenic mice should express the mutagenesis target gene and reporter gene. Ubiquitous promoters and enh.ancers are preferred for use in construction o~ transgenic animal systems so that, irrespective of the peculiarities of the substances tested, the ef~ect of the test compound on tissues of diverse organs and metabolic properties which contain the ~arget gene can be detected. A preferred promoter for use as an ubiquitous promoter to drive the lacI gene is the histone 3.2 gene promoter.
This is a transcriptionally very active, single copy gene in mice which is expressed at high levels and accounts for 30 to 40% of th~ histone H3 mRNAs isolated from a variety of mouse tissues.
In those mammalian cells and animal tissues wh~re the histone 2 gene promoter does not result in optimum expression, other viral or c llular promoters can be selected to drive : approprlate expression of the lacI gene. Examples of good candidate to be engineered into DNA constructs are the human ribosomal protein S14 gene, mouse ribosomal protein Sl6 gene, rat cytoplasmic beta-actin gene and human beta-actin gene. These genes have be~n cloned, their nucleotide sequences determined and they are available for~use.
:: :
3~5 In the preferred embodiment, the reporter gene for use with the lacI regulatory gene is the gene encoding beta-galactosidase, derived from the bacterial l,acZ gene. Expression ; of be~a~galactosidase is readily detected using histochemical procedures. In another embodiment, the gene encoding 5V40 large tumor (T) antigen is used as a reporter gene in place of the beta galactosidase gene, using an immunoperoxida~3e technique to detect the cells expressing the SV40 T antigen. A strategy similar to that employed for producing tha lacZ reporter system is used to make the construct containing the complete sequence coding for SV40 T antigen for insertion into an appropriate expression vector. The complete transcription unit of SV40 T antigen is : then physically linked to the functional transcription unit of lacI gene and trans~erred into appropriate cells to test for gene expression.
The theories and standard procedures for molecular cloning are described in Molecular Cloninq, edited by T.
~aniatis, et al. Cold Spring Harbor, Laboratoryl Cold Spring Harbor, N.Y.), Lab Procedures in Molecular_Bioloqy, edited by Ausubel, et al., (Greene Publishing Division of John Wiley, NY
1987), and are generally known to those skilled in the art.
Procedure~ include preparation of DNA and RNA, preparation of cloning vectors, ligation, transformation of competent cells, selection and screening by ln situ filter hybridizatlon, as described by David, et al., Advanced Bacterial Genetics (Cold -~4-2~3~S
Spring Harbor Laboratory, Cold Spring Harbox, MY). In addition, techniques for separation of DNA by ~el electrophoresis, mapping of r~stxiction enz~me cleavage sites, and modification of DNA
fragments by modifying enzymes are used. Most restriction enzymes, vectors, and reagents can be obtained from commercial companies. Common vectors and ~ li stralns are used, or example, pBR322, pUC series, lambda-WES, M13mp, DH5, LE392, JM109 and HB101.
Chain termination methods are used for nucleotide sequence determination to con~irm the DNA constructs at the splicing sites, as reported by Sanger, et al. Proc. ~atl. Acad.
Sci. USA 74, 5463 (1977). Many commercial suppliers provide both reagent kits and detailed protocols. Since most nucleotide sequences are known for the vectors, promoters and genes to be used, oligonucleotides o~ defined sequences are used as primers in s~quencing experiments. These are typically 15 to 20 nucleotides long and very convenient for sequencing specific regions of interest, using the techni~ues of ~essing, et al.
Nucleic Acids Res. 9, 309 (1981). Either single-stranded or double-stranded DNA can be sequenced with this technique.
011ogonucleotides to be used in DNA sequencing and as Iinkers are synthesized by an automated DNA synthesizer. This service can be obtained ~rom commercial sources, such as Genetic Designs, Inc., Houston, Texas. The oligonucleotide~ greater than 2C~6:33~L5 30 nucleotides are then sub3ected to polyacrylamide gel electrophoresis to ensure purity.
DNAs are transfected into cells by one of several standard published procedures to form stable transformants, including, for ex~mple, calcium phosphate precipitation, DEAE-Dextran, electroporation, and protoplast fusion. These m4thods are descri~ed in detail as ollows:
Calcium phosphate precipitation: DNAs are coprecipitated with calcium phosphate, according to ~he method of Graham and van der Eb in Virolo~y 52, 456 (1973), before transfer into cells. 40-50 ~g of DN~ with salmon ~perm or calf thymus DNA
as a carrier is used for 0.5 x 106 cells plated on a lO0 mm dish.
DNA is mixed with 0.5 ml of 2X Hepes solution (280 mM NaCl, 50 mM
Hepes and 1.5 mM Na2HP04, pH 7.0) to which an ~qual volume o~ Zx CaC12 (250 m~ CaClz and 10 mM Hepes, pH 7.0) is added. The solution with a white granular precipitate appearing after 30-40 . minutes is distributed dropwise evenly on the cells and a}lowed to sit for 4-16 hours at 37C. The medium is removed and the cells are shocked with 15% glycerol in PBS for 3 minutes. After : 20 removing the glycerol, the cells are fed with DMEM containing 10 : fetal bovine serum and left in the incubator.
Protein samples are prepared for Western blot analysis by lysing cells ~nd separating the proteins by SDS-PAGE. The proteins are transferred to nitrocellulose by electroblotting as described by Ausubel, et al., Current~Protocols in Mo.lecular .
20~)3~31L5 Biolo~y (John Wiley and Sons, 1987). After blocking the ~ilter with instant non~at dry milk (1 g in 100 ml PBS), primary antibody is added to the filter and incubated for 1 h at room temperature. The filter is washed thorough:Ly with phosphate buffered saline (PBS) and incubated with horseradish peroxidase -antibody conjugate for 1 h at room tempera~ure. The fil~er is again washed thoroughly with PBS and the antigen bands are identified by adding diaminobenzidine.
Enzyme assays, protein purifica~ion, and other classical biochemical methods are employed. DNA and RNA are analyzed by Southern blotting and Northern blotting techniques.
Typically, the samples to be analyzed are size fractionated by gel electrophoresis. The samples, DNA or RNA, in the:gels are then transferred to nitrocellulose or nylon membranes by blotting techniques. The blots, which are replicas of sample patterns in the gels, are hybridized w1th probes in Southern and Northern an~lysis. Specific bands of interest can then be visualized by detection systems such as autoradiography.
DNA can also be transferred using the DEAE-Dextran method of Kimura, et al. Virolo~y 49, 394 ~1972) and Sompayrac, et al., Proc,_ Natl. Acad. Sci. USA 78, 7575 (1981); the electropor~tion ~ethod of Potter, ProQ. Natl. Acad. Sci. U$A 81, 7161 (1984), and the protoplast fusion method of Sandri-Goddin, et al. ~leç. Cell Biol. 1, 743 [1981).
2~ 3 In the pre~erred embodiment of the assay, the engîneered animal cells are exposed to the compound to be tested.
Prior to mutagenesis, expression of the reporter gene is repressed by binding of the lac repressor to the operator of the reporter gene. When a mutation evant alterls the lacI gene such that a defective lac repressor is produced, or alters the operator, the repressor can no longer bind to the operator. The reporter gene is then turned on and directs the synthesis o~ the reporter protein.
The DNA constructs to be introduced into the genomes of animals are engineered using essentially the same methodology.
These transgenic animals are used for in vivo mutagenesis tests.
The preferred embodiment is a transgenic mouse or rat model thal carries the lac repressor gene as the mutagenesis target coupled to an operator-containing reporter gene which can be turned on and expression of the reporter gene monitored, when the lac repressor gene is inactivated by mutagenesis~ Both the target gene and reporter gene are of bacterial origin, but capable of being expressed in animal cells following insertion into animal gene expression vectors. This transgenic model allows simple and eas~ quantitation o~ mutagenesis events in vivo and therefore prcvides a more accurate risk assessment for toxic substances such as mutagens, carcinogen~ and teratog~ns than conventional rodent assays~ The system is also more sensitive and rapid than standard rodent assays since mutations or alterations in the ., ~,, ~ , , .
~'' ' ~ ' ' ' 2~3~1S
target gene can be detected at the DNA and cellular levels by histochemical techniques before tumor development.
The present invention is further described with respect to ~he following non limiting examples.
~ pl~ 1: n vltro a~ l c~ ut~g~nl~si~ A~ay.
: (a) Construction o~ system.
vector DNAs were generated based on plasmid co~ponents dascribed in the literature or commercially available, as shown : schematically in Figure 1. pRSVI was obtained from Dr. Norman Davidson o~ Californials Institute of Technology, Pasadena, California. This plasmid, as described by Hu, M.C., and Davidson, N., in Cell, 48,555 (1987), contains ~ lacI
repressor coding region linked to Rouse sarcoma virus (RSV) promoter and SV40 poly A. pCH110 was described by Hall, C.V., et al., J. Mol. Appl. Gen., 2,101 (1983), and provided by Dr. FranX
Lee of DNAX, Palo Al o, California. The beta-galactosidase ~lacZ) gene is fused to SV40 early promoter and SV40 polyadenyla~ion site in this plasmid.
Figure ~ outlines the insertion of an operator sequence and construction of a combination vector (pXZI). pCH110 was restricted with Sfil and ~dIII and ligated to synthetic complementary oligomerso 5' CGAG CCTCTG AGCTATTCCA GA 3' 3' CGAGCTC GGAGAC TCGATAAGGT CTTCGA 5' 3~S
This procedure yielded plasmid derivative pCHllOXH, having an ~l site 18 nucleotides downstream from the TATTTA
sequence in the SV40 early promoter, described by Reddy, V.B. et al., in Science, 200,494 (1978). lac operator DNAs can potentially be inserted at the Xhol, as well as the HindIII (42 nucleotides downstream of the TATTTA sequence), sites.
As a Pirst step, pCHllOXH wa~ cut with Xhol and ligated to the oligomer shown below con~aining an eighteen nucleotide palindromic lac operator~
5' TCGAATTGTGAGCGCTCACAAT 3' The resulting plasmid pCHllOXH22 was cleaved with BamHl and used to insert RSV lacI as a Bam~l fragment derived from pRSVI. The combination plasmid construct pXZI containing both the lacI and lacO-lacZ genes was used to transfect 293 cells, as diagrammed in Figure 2. ATCC CRL-l573 thuman embryonic kidney cells 293) are available from the American Type Culture Collection, Rockville, MD. Other cells such as ATCC CCL-T.l (LLC-MX2~, that could be used, are also available ~rom the ATCC.
The construct is co-~rans~ected into the cells with a neo gene as the selection marker using known procedures, such as : calcium phosphate precipitation method described above. The cell colonies resistant to the an ibiotic G418 are detected by growth ' : -20-' " " - ~ ;
. . . . ''; ' ' ' ..
.; , ' :' ., ' , .
3~5 in ths selection medium, cloned ~nd analyzed for the presence oP
functional lac repressor and beta-galactosidase genes, as shown schematically in Figure 2.
(b) Analysis and Characterization of System.
Transfected cells containing non-functional lac repres~or gene and functional beta-galactosidase gene stain blue follow~ng addition of the substrate for beta-galactosidasP, 5-bromo~4-chloro-3-indolyl-beta-D-galactopyranoside ~X~gal~, to cultures in the absence of inducer IPTG~ The desired colonies, containing both functional lac repressor and beta-galactosidase g~nes, should stain blue following addition of IPTG and X-gal, remaining unstained if only X-gal is added. Successful expression o~ the lacI gene can also be demonstrated by ~est~rn blot analysis of lac repressor protein according to Sams, et al., J. Biol. Chem. 260, 1185 (1985) and by a filter-binding assay for repressor-operator DNA complexes according to Lin and Riggs, J.
Mol. biol. 72, 671 (1972).
pXZIand pSV2neo DNAs were transfected into human embryonic kidney (293) cells using the calcium phosphate precipitation method. Following trypsinization 24 hours post transfection, the cells were plated at }:10 dilution, and fed with medium containing G418 ~350 ~g/m1). 10 days later, 96 colonies were isolated with cloning rings and tes~ed with X-gal for blu~ stain.
211~3~L5 The 293 derived cells were rinsed with PBS (150 mM
NaCl, 15 ~M ~odium phosphate, pH 7.3) and then fixed for 5 minutes at 4C in 2% formaldehyd~ and 0.2~ glutaldehyde made with PBS. Following fixing and removal of fixing medium, the cells were washed with PBS and ouerlaid with a histochemical reaction mixtl~re containing 1 mg X-gal/ml, 5 mM potassium ferxicyanide, 5 : mM potassium ferrocyanide, and 2 m~ MgC12 in PBS. The X-gal was : dissolved in dimethyl sulfoxide a~ 100 mg/ml conCentratiQn and diluted into the reaction mixture. The cells were incubated at 37C for 18-24 hours before they were examined for blue color.
55 colonies, which did not appear blue, were fed with medium containing 15 mm of IPTG (isopropyl beta-D-thiogalactoside). Seven colonies (designated XZI l-~, XZI 1-12, XZI 1-13, XZI 2-9, XZI 2-13, XZI 3-4, and XZI 4-3) were selected which showed blue color in the presence of IPTG and remained colorless in the absence of IPTG.
Figure 3 demonstrates IPTG induction in one of the clones, showing that the lacI-lacO-lacZ system is functioning as expected and could be used for th~ in vitro mutagenesis assay.
Figure 3(a~ is a photograph of the control cells, which remained colorless with X-gal substrate in the absence of the inducer ~IPTG. Figur- 3(b) ia a photograph of the induced cells, stained blue with X~gal substrate in the presence of 15 mM IPTG, demonstrating lacZ expression.
, .
--2~)~3~LS
Following success~ul expression o~E both lac repressor and beta-galactosidase genes in cultured ce:lls, each of the colonies can be analyzed for the copy number of the introduced genes. Single copies of lacI gene per cell (diploid genome) are screened for by Southern blotting analysis of the genomic DNA.
Cells with single copy are greatly preferrec~ to cells containing more than one copy of functional lacI yene since these will re~uire more than one mutational event ~o inactivate every copy o~ functional repressor gene and thereby to cause the depression of .he reporter gene. Since the mutational event is detected by expression of the reporter gene t the number of copies of reporter gene is not as crucial, with more than one copy facilitating detection in some cases. The probability of obtaining single copy sequence is increased by using low concentrations of target DNA and sufficient carri~r DNA to transfect recipient cells.
(c) Screening Compounds for Nutagenic Activity.
Nitrosomethylurea ~NMU~ can be employed as a model mutagen since it has been shown by Dubridge, et al., Mol! Cell.
Biol. 7, 379 (1987) to readily induce mutations in the lacI gene in vitro. The cultured cells are treated with NMU for a speclfied period of time, and ~he cells screened for expression of th~ reporter gene. The frequency of mutations is quantified by scoring the number of beta-galactosidase positive cells among the total cells.
:
' 2 [30341 S
Similarly, the background frequency of mutations can be obtained by counting the number of beta~galactosidase positive cells present in cultures that are no~ exposed to the mutagen.
A11 seven cell lines were plated :in duplicate at 30%
confluence in 100 mm dishes. NMU was disso:Lved in PBS at 10 mg/ml concentrations and added directly to one of the two dishes of each cell line ~o a final concentration of 150 mg/ml. The dishes were left at 37C Por 6 days while feeding with medium at three day intervals. If the cells became confluent they were subdivided to maintain semi-confluency and growth. X~gal hiætochemical reaction mixture was added a~ter six days and the cells were visualized for blue colored-cells under a light microscope.
XZI 2-9 was found to yield 30 times~more blue cells than the untreated control cells, as shown in Figure ~, indicatillg the inactivation of lacI by NMU followed by derepres ion of lac~. The other cells did not show an increase in blue cells over-the untreated control cells, indicating that no mutation had occured that resulted in derepression of the beka-galactosidase gene.
Figure 5 is a schema:tic of the process used to test compounds ~or mutagenesis. Cells which are capable of expressing beta-galactosidase in the presence of inducer are exposed to mutagen. After a period of days, cells are provided with X-gal substrate. The number of cells showing blue staining (corrected : :
.
., . , ' .
Z~34~L5 for background levels~ is indicative of the mutagenic activity of the compound.
B~a~pl~ 2~ ~r~nsge~io ~ l Nutag~ a~ ~say.
The ~irst steps in producing transgenic animals for an in vivo assay are to prepare and detect activation of the beta galactosidase reporter gene induced by mutation in lac~ in mouse fibroblast cultures that have been successPully transfected with the coupled lacI - lacZ gene construct and subsequently exposed to a test mutagen, using the methodology described in Example 1.
; 10 Controls consist of non-transfected cells and cells bearing the coupled genes that ha~e no~ been exposed to the mutagen. The ln ~i~Q system is followed by the production of founder C57BL/6J
transgenic mice bearing the coupled lacI - lacZ gene construct and, subs~uently, production of transgenic offspring that contains the gene construct. Sexually mature, transgene-positivè
transgenic o~fspring serve as control and mutagenesis-test subjects.
(a) Preparation of DNA.
A DNA construct is prep~red as described in Example 1 for use in making transgenic mice, as shown schematically in Figure 6. The construct has two functlonal transcription units physically linked to each:other~ each containing a promoter/enhancer, a coding sequence and SV40 polyadenylation site. One is used to drive lac repressor gene expression; the 2~3~
other i~ used to drive the expressi~n o~ the beta-galactosidase gene. The mouse histone-3.2 promoter can be used in the construct for ubiquitous expression of both lac repressor and beta-galactosidase genes.
S The DNA fragment containing both the target ~ene, such as ~he lac repressor transcription unit, and the reporter gene, such as the beta-galactosidase transcription unit, or the S~40 T
antigen unit, are excised from the vector by restriction enzyme digestion and isolated by gel electrophoresis and affinity column purification for microinjection, as follows. The fragments are separated on an agarose gel and the de~ired band recovered by electroelution. The DNA is extracted with phenol/chloroform, concentrated by ethanol precipitation, and further purifled by binding and elution from Elutip-d columns. The DNA is then recovered by ethanol precipitation, dissolved in sterile lO mM
Tris pH 8, 1 mM EDTA and quan ified by Hoechst dye fl~orescence assay or spectrophotometry at 260 nm.
(b) Introduction of DNA into Embryos.
: The theories and experimental procedures of transgenic mouse construction are described in "Manipulating the Mouse Embryo" by Brigid Hogan, Frank Costantini and Elizabeth Lacy (Cold æpring Harbor Laboratory, Cold Spring Harbor, N.Y.) Mouse zygote~ are collected from six week old C57B/6J females tJackson : Laboratory, Bar Harbor, Maine) that have been superovulated with 5 IU of Pre~nant ~are's Serum Gonadotropin followed 48 h later by ~' .
-2~-2~3~5 51 U Human ~horionic Gonadotropin. Primed females are placed with C57BL/6J males and checked for vaginal plug5 the following morning. Pseudopregnant female~, used a~ recipients~ are CD-1 females (Charles River Laboratories, Wilminc;ton, Massachusetts~
select~d for estrus and placed with proven sterile vasectomized CD-1 males. Zygotes are collected in BMOC-2 medium modified to contain 5.1 g/l NaCl and 5 mg/ml bovine serum albumin. Cumulus cells are removed by treatment with hyaluronidase (Sigma Type IV, 300 IUtml PBS with 1% PVP 40T, Sigma) diluted to 60 IU/ml in culture medium. Zygotes are washed twice in a 2 ml culture medium to remove debris. Approximately ~ pl of DNA solution i9 injected lnto the male pronucleus with approximately 50% surviving in~ection. Injected zygQtes are incubated in 5% COz in air at 37C until transferred to the oviduct of recipient f~males under tribromoethanol anaesthesia.
Integration o~ the gene construct can occur as a single copy or multiple copies that are generally in a head-to-tail ta~dem array, as reported by Palmiter, Cell 29, 701 (1982).
Methodology for gene injection into the mouse embryo ha~ been described by Brinster, et al., Proc. Natl. Acad. Sci. USA 82, ~ 4438 (1985). Some of the more important factors for increasing : the integration frequency are: the concentration of DNA injected : may be a limiting factor in the efficiency of integration - a concentration of 1-2 ng/~l of DNA, or approximately 100-1,000 copies of the DNA fragment, appears ~o be optimum; a linear DNA
~27-~3~L5 molecule is more efficient if it is cut with endonucleases t~at r~sult in non-blunt ends; an~ nuclear rather than cytoplasmic injection is required for high efficiency rates. Several other ~actors do not appear to effec~ the integration rate. Both female and male pronuclear injections can accommodate the injected DNA and result in comparabl~ integration efficiencies.
Pronuclear injections are not essential for integration to occur as injection of DNA into the nucleus of the two-cell embryo will also result in transgenic animals.
It has been suggested that the strain of mouse used could affect the efficiency of integration. For example, the C57 x SJL hybrid egg has been demonstrated to be more efficient than the inbred C57 strain. Comparable efficiencies have been achieved with inbred CD-l mice (Charles River) as with the 15 ~hybrids. Inbrad C57BL/6J mice (Jackson Laboratories) can be used to eliminate segregation of potential background modifier genes.
Inbred C57BT/6J black female mice are hormonally induced for s~perovulation by the administration of follicle stimulating hormone and luteinizing hor~one. They are then mated with inbred male mice.
Fertilized one-cell embryos are flushed from the oviducts and treated with hyaluronidase to remove the cumulus ophoru6 cells from the embryos. The target DNA is then microinjected into the pronucleus of the one-cell embryo. About 100 copies of the lacI-lacZ DNA construct are injected into each ,~
~3~L3L5 embryo, which are then transerred to the oviducts of pseudopregnant foster mothers to complete the gestation period.
The embryos are allowed to differentiate and develop into entire animals.
~c) Selection and analysis of transgenic mice for in vivo mutagenesis models:
Transgenic mice carrying single copies of coupled functional lacI-lacZ gene construrt are æcreened and selected by the following procedures. A section of tail and/or one lobe of liver is used as a source ~or the isolation of genomic DNA. The copy numbers and structures of the transgenes are analyzed by Southern blotting with DNA from lac repressor or the reporter gene used as probes, as well as to ascertain whether any rearrangement or modiflcation has occurred in the transgenes during the genesis of transgenic mice. Only the mice carxying ; single copies of the complete lacI-lacZ gene construct are : sub~ected to further analysis.
: Appropriate tissues are collected at autopsy from transgenic mice to assay for gene Pxpression. RNA and protein are extracted from these tissues and used in Northern blot, Western blot and rapressor function sssays to detect expression of lac repressor gene in tissues of transgenic mice. Since the : reporter gene:~should be r-pressed by the active lacI gene, :~ expres~ion of the reporter gene in tissues is not expected unless there is~no ~unctional lac repressor present or the inducer IPTG
' ' ., :
2,~1134~LS
i~ added. There~ore, the use of the same promoter and enhancer in the construction of both the repres or and the reporter gene is an important strate~y to avoid "uncoupling" of the two genPs.
The presence of function~l lacI and lacZ genes in the tissues of transgenic mice can also be assayed with he procedures described in "Example l, se~tion (b)" using cells dissociated from tail tissues.
Only the transgenic lines with one copy per cell of functional target gene are selected for further breeding to establish a homozygous transgenic line, as shown schematically in Fiyure 7. The F1 are bred with each other and the expected l/4 homozygous transgenic in the F2 are identified by the intensity of the signal in Southern analysis. Homozygosity are confirmed by breediny tests and Southern analysi~ of the o~fspring. The homozygous offspring containing two copies of the transgene is bred to non-transgenic mates to produce heterozygous test animals for the mutagenesis assay.
(d) Analysis of transgenic animals exposed to compound to be tested.
Quantitative data can be obtained as to the localization~and distribution of positive cells in the major organ of both control and mutagen-treated mice. Tissues from the following organs are selected for morphometric analysis.
Brains, (tis~ues collected from the cerebellum, midbrain and forebrain~, liver, spleen, kidney, left ventricle o~ the heart, 3~5 lung, gonad, uterus, pancreas, fund~s o~ the stomach, duodenum, ileum, colon and sternal bone marrow. Following fixation, tissue blocks are trimmed and the histochemical reac~ion for beta-galactosidase performed on 8 micron cryostat: or 30 micron vibratome cuts to assure random sampling. Consecutive sections separated by 40 micron intervals are collected from each block.
Positive cells are enumerated by digitizing morphome~ry using a biological image analyzer system and the Bio-quant II computer program (R&M Biometrics of Nashville, Tenn.). The hardware for this system consists of an image projecting camera mounted on a standard Zeiss binocular microscope, an Apple II microcomputer and a digitizing tablet. Using this system, the specimen is projected onto the computer screen and the operator selects and outlines the a~ea that will be analyzed. Blood vessels and empty spaces, present as lumens of hollow organs, are outlined on th2 screen and the system is then instructed to subtract these areas from those that will be analyzed. Intense blue-stained cells are counted by using the digitizer and the numbers of pQsitiVe cells per unit area o~ the tissue specimen under study is automatically computed. In this manner, the number of positive cells per unit area of a particular organ from an untreated or treated animal can be enumerated and resulting data statistically compared. A
ma]or added benefit of this system is that specific aell types that may be particularly susceptible to a given mutagen can be identified and quantified.
`~ .
21D~)3~
Histochemical analysis is psrformed on tissues from treated and untreated male and female transgenic mice with the same p~digree. Morphometric techniques can be used to producs quantitative data concerning the number of beta-galactoslAase positive cell~ per organ and per animal sampled to provide information on the compound being tested, as well as the efficacy of the test procedure and the frequency o~ spontaneous background mutation in the transgenic animals. The expression of lacZ gene in cells is assayed by beta-galactosidase staining as follows:
Tissues are immersed in cold 4% paraformaldehyde to which 50 mM of Na3P04 is added. This mixture is adjusted to pH
7.4. The immersed tissue is then fixed overnight in this mixture at 4C. The activity of the enzyme is not impaired by this fixation. The tissues are subsequently rinsed in phosphate buffered saline (P~S) and 30 ~m ections are cut on a vibratome or 8 ~ sections are cut on a cryostat. The resultant sections : are then incubated at 37C, 5% CO2 in 1 mg/ml X-gal, 5 mM K+
ferricyanide, 5 mM K+ ferrocyanide, 2 ~M ~g C12, 0.02~ NP-40, 0.01% cholate in PBS at pH 7.3~ The alkaline pH of this solution and the addition o~ Mg~' is critical to avoid background staining of native galactosidase activity in lysosomes. The cells in a test ti~sue positive ~or beta galactosidase will stain blue. The blue i~ visible within one hour and increases in intenaity over the next 12 hours. This phenomenon can be visualized in either the ~ree-floa~lng vibratome sections or cryostat sections affixed .
, ' " . .
~3~
to gelatin coated glass slides. When the desired color intensity is achieved, vibratome sections are mounted onto slides in 0.1%
KCrSO4 and 1% gelatin and dried on a slide warmed at 37C for 1/2 hour. Sections are subsequently dehydrated and cleared in xylene for 2-3 minutes. Counter staining is per~ormed using methyl green aftar which coverslips are placed over the sections.
Paraffin sec ions o~ tissue whole-mounts can also be done since post-embedding in this material does not result in the loss of the blue positive staining. Paraf~in embedded sections can therefore be stored and kept indefinitely as a permanent record for each test procedure.
If the SV40 large T antigen, or other antigen, is used as the reporter gene, a cytochemical-immunoperoxidase method, such as that described by Hanahan, Nature 315, 115 (1985~;
Ornitz~ et al., ~ 238,188 (1987); or Behringer, Proc. Natl.
Acad Sci. USA 85, 2648 ~1988), is used to detect expression of reporter proteins.
: E~pl~ 3: Tr~ge~ic a~ ryo~ to a3~ay for t~ratogen~.
Embryos of the transgenic animals carrying a target gene and a coupled reporter gene are used to screen for teratogens. ~his transgenic embryo model allows simple and rapid quantitation of mutagenesis events in a system which is simiIar to the living human embryo and should provide a more accurate asses ment of the risk of a compound being teratogenic than currently used methods.
2003~
Transgenic animals, such as mice and pigs carrying the lacI g~ne coupled to the lacZ gene, generated by the procedures described in de~ail in Examples 1 and 2, are used to generate transgenic offspring as test animals. Embryos isolated at different stages from pregnant female transgenic animals with successful gene expression are exposed to the agent to be tested, ` and analyzed for expression of the reporter gene.
For example, a 10-mm transgenic pig embryo which has bçen developing for a gestation period of 20 21 days and contains the rudiments of almost all adult structures is exposed to a potential teratogen. The mutation events caused by teratogenic subætances will inactivate the target gene and turn on the reporter gene in certain cells/tissues of the embryo. These cells/tissues can be d-tected using histochemical analysis as described above or by Allen, N.D., et al., in l'Transgenes as probes ~or active chromosomal domains in mouse development", Nature 333, 852-855 (1988~ when the reporter protein is beta galactosidase, or as otherwise appropriate for the reporter protein.
Modifications and variations of the methods and assay systems, transgenic animals and animal cells carrying target genes coupled to reporter genes ~or testing for mutagens and teratogens, will be apparent to those skilled in the art from the foregolng detailed description of the invention. Such variations 3~5 and modif ications are intended to come within the scope of the appended claims.
' -35-:
: . .
Claims (28)
1. A method for screening for compounds which cause a mutation or alteration in expression of a nucleic acid sequence in a eukaryotic cell comprising:
providing a target gene and a reporter gene in combination with sequences regulating expression of the reporter gene, wherein the product of expression of the target gene is capable of regulating expression of the reporter gene by binding to the regulatory sequences, the protein encoded by the reporter gene is readily detectable, and an alteration of the target gene or the regulatory sequences prevents expression of the reporter gene.
providing a target gene and a reporter gene in combination with sequences regulating expression of the reporter gene, wherein the product of expression of the target gene is capable of regulating expression of the reporter gene by binding to the regulatory sequences, the protein encoded by the reporter gene is readily detectable, and an alteration of the target gene or the regulatory sequences prevents expression of the reporter gene.
2. The method of claim 1 wherein the reporter gene includes an eukaryotic promoter, a regulatory sequence, a sequence encoding a reporter gene product and a transcription termination signal, and the product of expression of the target gene binds to the regulatory sequence of the reporter gene to regulate expression of the sequence encoding the reporter gene product.
3. The method of claim 2 wherein the target gene includes an eukaryotic promoter, a sequence encoding a regulatory molecule and a transcription termination signal.
4. The method of claim 2 wherein the reporter gene product is selected from the group consisting of biochemically detectable proteins and nucleic acid sequences.
5. The method of claim 2 wherein the regulatory sequence is an operator.
6. The method of claim 3 wherein the regulatory target gene product is selected from the group of repressors and nucleic acid sequences capable of binding to the reporter gene or gene product.
7. The method of claim 6 wherein the reporter gene product is beta-galactosidase and the regulatory molecule is a lac repressor protein.
8. The method of claim 1 further comprising inserting the target and reporter genes into an eukaryotic cell.
9. The method of claim 8 wherein the eukaryotic cell is an animal embryo in an early stage of differentiation.
10. The method of claim 8 wherein the eukaryotic cell is in a tissue of a fully differentiated animal.
11. The method of claim 8 further comprising controlling the number of copies of the target and reporter genes inserted into an animal cell.
12. The method of claim 11 wherein the number of copies of the functional target gene is limited to one.
13. The method of claim 8 further comprising exposing the animal cell to a compound and comparing expression of the reporter gene products in the exposed cell with expression of the reporter gene products in a control cell not exposed to the compound.
14. The method of claim 9 further comprising exposing the embryo to a compound, allowing the embryo to undergo cell division for a period of time and comparing expression of the reporter gene products in the embryo with expression of the reporter gene products in an embryo not exposed to the compound.
15. The method of claim 10 further comprising exposing the differentiated animal to a compound, allowing the animal to metabolize the compound and undergo cell division and comparing expression of the reporter gene products in a tissue from the exposed animal with expression of the reporter gene products in the same type of tissue of a control animal not exposed to the compound.
16. The method of claim 8 wherein the reporter gene encodes beta-galactosidase further comprising determining expression of the reporter gene by providing a substrate for beta-galactosidase and staining with a ferricyanide-ferrocyanide solution.
17. The method of claim 8 further comprising determining expression of the reporter gene using enzyme linked immunoglobulins to detect expression of antigens by immunochemical procedures.
18. A system for rapid screening for compounds which cause a mutation or alteration in expression of a nucleic acid sequence in a eukaryotic cell comprising:
a target gene and a reporter gene in combination with sequences regulating expression of the reporter gene, wherein the product of expression of the target gene is capable of regulating expression of the reporter gene by binding to the regulatory sequences, the protein encoded by the reporter gene is readily detectable, and an alteration of the target gene or the regulatory sequences prevents expression of the reporter gene.
a target gene and a reporter gene in combination with sequences regulating expression of the reporter gene, wherein the product of expression of the target gene is capable of regulating expression of the reporter gene by binding to the regulatory sequences, the protein encoded by the reporter gene is readily detectable, and an alteration of the target gene or the regulatory sequences prevents expression of the reporter gene.
19. The system of claim 18 wherein the reporter gene includes an eukaryotic promoter, a regulatory sequence, a sequence encoding a reporter gene product and a transcription termination signal, and the product of expression of the target gene binds to the regulatory sequence of the reporter gene to regulate expression of the sequence encoding the reporter gene product.
20. The system of claim 19 wherein the target gene includes an eukaryotic promoter, a sequence encoding a regulatory molecule and a transcription termination signal.
21. The system of claim 19 wherein the reporter gene product is selected from the group consisting of biochemically detectable proteins and nucleic acid sequences complementary to reporter gene sequence.
22. The system of claim 21 wherein the reporter gene product is selected from the group consisting of beta-galactosidase, luciferase, peroxidase and immunochemically detectable antigens.
23. The system of claim 20 wherein the regulatory gene product is selected from the group of repressors and nucleic acid sequences capable of binding to the reporter gene or gene products.
24. The system of claim 23 wherein the regulatory molecule is a lac repressor protein and the regulatory sequence is the lacZ operator.
25. The system of claim 18 further comprising at least one promoter selected from the group consisting of the histone 3.2 gene, human ribosomal protein 514 gene, mouse ribosomal protein S16 gene, rat beta-actin gene, cytomegalovirus early gene promoter, SV40 early promoter, Rous sarcoma virus long terminal repeat and Moloney leukemia virus long terminal repeat.
26. The system of claim 18 further comprising an eukaryotic cell.
27. The system of claim 26 wherein the eukaryotic cell is in an animal embryo in an early stage of differentiation.
28. The system of claim 26 wherein the animal cell is in a tissue of a fully differentiated animal.
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US27605588A | 1988-11-25 | 1988-11-25 | |
| US07/276,055 | 1988-11-25 |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CA2003415A1 true CA2003415A1 (en) | 1990-05-25 |
Family
ID=23054959
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CA 2003415 Abandoned CA2003415A1 (en) | 1988-11-25 | 1989-11-20 | Rapid screening mutagenesis and teratogenesis assay |
Country Status (2)
| Country | Link |
|---|---|
| JP (1) | JPH0630623B2 (en) |
| CA (1) | CA2003415A1 (en) |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US6824976B1 (en) | 1993-04-02 | 2004-11-30 | Rigel Pharmaceuticals, Inc. | Method for selective inactivation of viral replication |
-
1989
- 1989-04-12 JP JP9276389A patent/JPH0630623B2/en not_active Expired - Lifetime
- 1989-11-20 CA CA 2003415 patent/CA2003415A1/en not_active Abandoned
Also Published As
| Publication number | Publication date |
|---|---|
| JPH0630623B2 (en) | 1994-04-27 |
| JPH02145200A (en) | 1990-06-04 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US6100089A (en) | Rapid screening mutagenesis and teratogenesis assay | |
| US6001588A (en) | Introns and exons of the cystic fibrosis gene and mutations thereof | |
| US7449615B2 (en) | Non-invasive evaluation of physiological response in a transgenic mouse | |
| Gordon et al. | DNA-mediated genetic transformation of mouse embryos and bone marrow—a review | |
| Lozano et al. | Tissue‐specific expression of p53 in transgenic mice is regulated by intron sequences | |
| US6891031B2 (en) | Coordinate cytokine regulatory sequences | |
| JPH06503967A (en) | Tumor-susceptible non-human animals | |
| US20030143597A1 (en) | Methods for making polynucleotide libraries, polynucleotide arrays, and cell libraries for high-throughput genomics analysis | |
| Mortensen et al. | Selection of transfected mammalian cells | |
| CA2003415A1 (en) | Rapid screening mutagenesis and teratogenesis assay | |
| KR102133179B1 (en) | IRX1 Knock-out Transgenic Zebrafish Model and Method for Producing Thereof | |
| WO1993024642A1 (en) | Insertion of heterologous dna outside of known chromosomal genes | |
| Nakamura et al. | Quantitative analysis of luciferase activity of viral and hybrid promoters in bovine preimplantation embryos | |
| EP0467883A1 (en) | Method of physically mapping genetic material | |
| WO1993017123A1 (en) | Mutagenicity testing using reporter genes with modified methylation frequencies | |
| WO1993023533A1 (en) | Anti-neoplastic in vivo drug screen | |
| Burke et al. | Integration of Drosophila heat-shock genes transfected into cultured Drosophila melanogaster cells | |
| Brickell | Molecular analysis of gene structure and function | |
| Cui | Model systems for detecting mutations in animal cells and transgenic mice | |
| Wagner | Accessing novel developmental mechanisms in the mouse by gene trapping | |
| US20040137490A1 (en) | Methods for making polynucleotide libraries, polynucleotide arrays, and cell libraries for high-throughput genomics analysis | |
| Deprimo | Development of transgenic mouse model systems for the in situ detection of genetic alterations | |
| Guise | Application of recombinant DNA techniques in animal improvement | |
| Sharan | Molecular dissection of regions required for postimplantation development of the mouse using radiation-induced deletions | |
| Keller | Characterization of two transgene-induced mutations of the mouse: Sl (tg) and Del (19) TgN8052 |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| FZDE | Dead |