CA1341280C - Non-human carbonyl hydrolase mutants, dna sequences and vectors encoding same and hosts transformed with said vectors - Google Patents

Abstract

Novel carbonyl hydrolase mutants derived from the amino acid sequence of naturally-occurring or recombinant non-human carbonyl hydrolases and DNA
sequences encoding the same. The mutant carbonyl hydrolases, in general, are obtained by in vitro modification of a precursor DNA sequence encoding the naturally-occurring or recombinant carbonyl hydrolase to encode the substitution, insertion or deletion of one or more amino acids in the amino acid sequence of a precursor carbonyl hydrolase. Such mutants have one or more properties which are different than the same property of the precursor hydrolase.

Description

NON-HUMAN CARBONYL HYDROLASE MUTANTS, DNA SEQUENCES AND VECTORS ENCODING SAME
AND HOSTS TRANSFORMED WITH SAID VECTORS
The recent development of various in vitro techniques to manipulate the DNA sequences encoding naturally-occuring polypeptides as well as recent developments in the chemical synthesis of relatively short sequences of single and double stranded DNA has resulted in the speculation that such techniques can be used to modify enzymes to improve some functional property in a predictable way. Ulmer, K.M. (1983) Science ~, 666-671. The only working example disclosed therein is the substitution of a single amino acid within the active site of tyrosyl-tRNA
synthetase (Cys35~Ser) which lead to a reduction in enzymatic activity. See Winter, G., et al. (1982) Nature 299, 756-758; and Wilkinson, A.J., et al.
(1983) Biochemistry 22, 3581-3586 (Cys35-~Gly mutation also resulted in decreased activity).
When the same t-RNA synthetase was modified by substituting a different amino acid residue within the active site with two different amino acids, one of the mutants (Thr51--Ala) reportedly demonstrated a predicted moderate increase in kcat/Km whereas a second mutant (Thr51--Pro) demonstrated a massive increase in kcat/Km which could not be explained with certainty. Wilkinson, A.H., et al. (1984) Nature 307, 187-188.
Another reported example of a single substitution of an amino acid residue is the substitution of cysteine for isoleucine at the third residue of T4 lysozyme.
Perry, L.J., et al. (1984) Science 226, 555-557. The resultant mutant lysozyme was mildly oxidized to form a disulfide bond between the new cysteine residue at position 3 and the native cysteine at position 97.
This crosslinked mutant was initially described by the author as being enzymatically identical to, but more thermally stable than, the wild type enzyme. However, in a "Note Added in Proof", the author indicated that the enhanced stability observed was probably due to a chemical modification of cysteine at residue 54 since the mutant lysozyme with a free thiol at Cys54 has a thermal stability identical to the wild type lysozyme.
Similarly, a modified dihydrofolate reductase from E.coli has been reported to be modified by similar methods to introduce a cysteine which could be crosslinked with a naturally-occurring cysteine ire the reductase. Villafranca, D.E., et al. (1983) Science 222, 782-788. The author indicates that this mutant is fully reactive in the reduced state but has significantly diminished activity in the oxidized state. In addition, two other substitutions of specific amino acid residues are reported which resulted in mutants which had diminished or no activity.
EPO Publication No. 0130756 discloses the substitution of specific residues within B. amyloliquefaciens subtilisin with specific amino acids. Thus, Met222 has been substituted with all 19 other amino acids, G1y166 with 9 different amino acids and G1y169 with Ala and Ser, As set forth below, several laboratories have also reported the use of site directed mutagensis to produce the mutation of more than one amino acid residue within a polypeptide.
The amino-terminal region of the signal. peptide of the prolipoprotein of the E. coli outer membrane was stated to be altered by the substitution or deletion of residues 2 and 3 to produce a charge change in that region of the polypeptide. Inoyye, S., et al. (1982) Proc. Nat. Acad. Sci. USA _79, 3438-3441. The same laboratory also reported the substitution and deletion of amino acid redisues 9 and 14 to determine the effects of such substitution on the hydrophobic region of the same signal sequence. Inouye, S., et al.
(1984) J. Biol. Chem. 259, 3729-3733.
Double mutants in the active site of tyrosyl-t-RNA
synthetase have also been reported. Carter, P.J., et al. (1984) Cell 38, 835-840. In this report, the improved affinity of the previously described Thr511Pro mutant for ATP was probed by producing a second mutation in the active site of the enzyme. One of the double mutants, G1y35/Pro5l, reportedly demonstrated an unexpected result in that it bound ATP
in the transition state better than was expected from the two single mutants. Moreover, the author warns, at least for one double mutant, that it is not readily predictable how one substitution alters the effect caused by the other substitution and that care must be taken in interpreting such substitutions.

A mutant is disclosed in U.S. Patent No. 4,532,207, wherein a polyarginine tail was attached to the C-terminal residue of ~-urogastrone by modifying the DNA sequence encoding the polypeptide. As disclosed, the polyarginine tail changed the electrophoretic mobility of the urogastrone-polyaginine hybrid permiting selective purification. The polyarginine was subsequently removed, according to the patentee, by a polyarginine specific exopeptidase to produce the i0 purified urogastrone. Properly construed, this reference discloses hybrid polypeptides which do not constitute mutant polypeptides containing the substitution, insertion or deletion of one or more amino acids of a naturally occurring polypeptide.
Single and double mutants of rat pancreatic trypsin have also been reported. Craik, C.S., et al. (1985) Science 228, 291-297. As reported, glycine residues at positions 216 and 226 were replaced with alanine residues to produce three trypsin mutants (two single mutants and one double mutant). In the case of the single mutants, the authors stated expectation was to observe a differential effect on Km. They instead reported a change in specificity (kcat/Km) which was primarily the result of a decrease in kcat. In contrast, the double mutant reportedly demonstrated a differential increase in Km for lysyl and arginyl substrates as compared to wild type trypsin but had virtually no catalytic activity.
The references discussed above are provided solely for their disclosure prior to the filing date of the instant case, and nothing herein is to be construed as an admission that the inventors are not entitled to antedate such disclosure by virtue of prior invention or priority based on earlier filed applications.

1 341 280_ Based on the above references, however, it is apparent that the modification of the amino acid sequence of wild type enzymes often results in the decrease or destruction of biological activity.
Accordingly, the invention seeks to provide carbonyl hydrolase mutants which have at least one property which is different from the same property of the carbonyl hydrolase precursor from which the amino acid of said mutant is derived.
The invention also seeks to provide mutant DNA sequences encoding such carbonyl hydrolase mutants as well as expression vectors containing such mutant DNA sequences.
Still further, the present invention seeks to provide host cells transformed with such vectors as well as host cells which are capable of expressing such mutants either intracellularly or extracellularly.
Summarv of the Invention The invention includes carbonyl hydrolase mutants, preferably having at least one property which. is substantially different from the same property of the precursor non-human carbonyl hydrolase from which the amino acid sequence of the mutant is derived. These properties include oxidative stability, substrate, specificity catalytic activity, thermal stability, alkaline stability, pH activity profile and resistance to proteolytic degradation. The precursor carbe~nyl hydrolase may be naturally occurring carbonyl hydrolases or recombinant carbonyl hydrolases. The amino acid sequence of the carbonyl hydralase mutant is derived by the substitution, deletion or insertion of one or more amino acids of the precursor carbonyl hydrolase amino acid sequence.
The invention also includes mutant DNA sequences encoding such carbonyl hydrolase mutants. Further the invention includes expression vectors containing such mutant DNA sequences as well as host cells transformed with such vectors which are capable of expressing said carbonyl hydrolase mutants.
The present invention provides a substantially pure subtilisin-related protease derived by the replacement of at least one amino acid residue of a precursor subtilisin-related protease with a different amino acid, said one amino acid residue being selected from the group of equivalent amino acid residues of subtilisin naturally produced by Bacillus amyloliquefaciens consisting of Tyr2l, Thr22, Ser24, Asp36, G1y46, A1a48, Ser49, Met50, Asn77, Ser87, Lys94, Va195, Leu96, I1e107, G1y110, Metl24, Lys170, Tyrl7l, Prol72, Asp197, Met199, Ser204, Lys213, His67, Leu126, Leul35, G1y97, Ser101, G1y102, G1n103, G1y127, Glyl28, Pro129, Tyr214 and G1y215.
The invention further provides a substantially pure subtilisin-related protease having an amino acid sequence derived from the amino acid sequence of a precursor subtilisin-related protease by the substitution of a different amino acid for at least a first and a second amino acid residue of said amino acid sequence of said precursor subtilisin-related protease, said first amino acid residue being selected from the first group of equivalent amino acid residues of subtilisin naturally produced by Bacillus amyloliquefaciens consisting of Tyr2l, Thr22, Ser24, Asp36, G1y46, A1a48, Ser49, Met50, Asn77, Ser87, Lsy94, Va195, Leu96, I1e107, G1y110, Met124, Lys170, Tyrl7l, Pro172, Aspl97, Metl99, Ser204, Lys213, His67, Leul26, Leul35, G1y97, Ser101, G1y102, G1n103, Leu126, J

6a G1y127, G1y128, Pro129, Tyr214, and G1y215 and said second amino acid residue being selected from the group of equivalent amino acid residues of subtilisin naturally produced by Bacillus amyloliquefaciens consisting of Asp32, Ser33, His64, Tyr104, Alal52, Asnl55, G1u156, Glyl66, Glyl69, Phe189, Tyr217, and Met222.
The invention also provides a substantially pure subtilisin-related protease derived by the replacement of at least one amino acid residue of a precursor subtilisin-related protease with a different amino acid, said su.btilisin-related protease being modified in at least substrate specificity as compared to said precursor, said at least one amino acid residue being selected from the group of equivalent amino acid residues of subtilisin naturally produced by Bacillus amyloliquefaciens consisting of His67, I1e107, Leu135, G1y97 through G1n103, Leu126 through Pro129, Lys213 through G1y215, G1y153, Asnl54, G1y157 through Va1165, Tyrl67, Pro168 and Lys170 through Pro172.
The invention additionally provides a substantially pure subtilisin-related protease derived from the amino acid sequence of a precursor subtilisin-related protease by a combination of substitutions of at least two amino acid residues in said precursor equivalent to amino acid residues of subtilisin naturally produced by Bacillus amyloliquefaciens, wherein said combination of substituted equivalent residues is selected from the group consisting of Thr22/Ser87, Ser24/Ser87, A1a45/A1a48, Ser49/Lys94, Ser49/Va195, Met50/Va195, Met50/G1y110, Met50/Met124, Met50/Met222, Metl24/Met222, Glul56/G1y166, G1u156/G1y169, G1y166/Met222, G1y169/Met222, Tyr21/Thr22, Met50/Met124/Met222, Tyr21/Thr22/Ser87, Met50/G1u156/G1y166/Tyr217, Met50/G1u156/Tyr217, Met50/G1u156/G1y169/Tyr217, Met50/I1e107/Lys213, Ser204/Lys213, and I1e107/Lys213.
J

6b The invention further provides a substantially pure subtilisin-related protease derived by the replacement of one or more amino acid residues of a precursor subtilisin-related protease with a different naturally occurring amino acid, said subtilisin-related protease being altered in at least alkaline stability as compared to said precursor, said amino acid residues replaced being selected from the group of equivalent amino acid residues of subtilisin naturally produced by Bacillus amyloliquefaciens consisting of Asp36, I1e107, Lys170, Aspl97, Ser204, Lys213, Ser24, and Met50.
The invention also provides a substantially pure subtilisin-related protease derived by the replacement of one or more amino acid residues of a precursor subtilisin-related protease with a different naturally occurring amino acid, said subtilisin-related protease being modified in. at least thermal stability as compared to said precursor, said amino acid residues replaced being selected from the group of equivalent amino acid residues of subtilisin naturally produced by Bacillus amyloliquefaciens consisting of Asp36, I1e107, Lys170, Ser204, Lys213, Metl99 and Tyr2l.
The invention also provides a substantially pure subtilisin-related protease derived by the replacement of one or more amino acid residues of a precursor subtilisin-related protease with a different naturally occurring amino acid, said subtilisin-related protease being modified in at least oxidative stability as compared to said precursor, said amino acid residues replaced being selected from the group of equivalent amino acid residues of subtilisin naturally produced by Bacillus amyloliquefaciens consisting of Met50 and Metl24.
The invention also provides a substantially pure subtilisin-related protease derived from the amino acid sequence of a precursor subtilisin-related protease by a J

6c combination of substitutions of two or more amino acid residues in said precursor equivalent to amino acid residues of subtilisin naturally produced by Bacillus amyloliquefaciens, wherein said subtilisin-related protease being modified in at least thermal stability as compared to said precursor and wherein said combination of substitutions of two or more amino acid residues is selected from the group consisting of Thr22/Ser87, Ser24/Ser87 and Tyr21/Thr22/Ser87.
The invention also provides a substantially pure subtilisin-related protease derived from the amino acid sequence of a precursor subtilisin-related protease by a combination of substitutions of two or more amino acid residues in said precursor equivalent to amino acid residues of subtilisin naturally produced by Bacillus amyloliquefaciens, said subtilisin-related protease having at least altered oxidative stability and substrate specificity as compared to said precursor, wherein said combination of substitutions of two or more amino acid residues is selected from the group consisting of Glyl66/Met222 and Glyl69/Met222.
The invention also provides a substantially pure subtilisin-related protease derived from the amino acid sequence of a precursor subtilisin-related protease by a combination of substitutions of two or more .amino acid residues in said precursor equivalent to amino acid residues of subtilisin naturally produced by Bacillus amyloliquefaciens, said subtilisin-related protease having at least improved enzyme performance as compared to said precursor, wherein said combination of substitution of two or more amino acid residues comprises Glul56 and G1y166.
The invention also provides a substantially pure subtilisin-related protease derived from the amino acid sequence of a precursor subtilisin-related protease by a J

6d combination of substitutions of two or more amino acid residues in said precursor equivalent to amino acid residues of subtilisin naturally produced by Bacillus amyloliquefaciens, said subtilisin-related protease having at least altered substrate specificity and kinetics as compared to said precursor, wherein said combination of substitutions of two or more amino acid residues is selected from the group consisting of G1u156/G1y169/Tyr217, Glyl56/G1y166/Tyr217 and Glul56/Tyr217.
The invention also provides a substantially pure subtilisin-related protease derived from the amino acid sequence of a precursor subtilisin-related protease by a combination of substitutions of two or more amino acid residues in said precursor equivalent to amino acid residues of subtilisin naturally produced by Bacillus amyloliquefaciens, said subtilisin-related protease having at least modified alkaline or thermal stability as compared to said precursor, wherein said combination of substitution of t:wo or more amino acid residues is selected from the group consisting of I1e107/Lys213, Ser204/Lys213, G1u156/G1y166, Met50/Glul56/G1y169/Tyr217 and Met50/I1e107/Lys2,l3.
The invention also provides a substantially pure subtilisin-related protease derived from the amino acid sequence of a precursor subtilisin-related protease by the deletion of one or more amino acid residues in said precursor equivalent to amino acid residues of subtilisin naturally produced by Bacillus amyloliquefaciens, wherein said one deleted residue is selected from the group consisting of Ser161, Serl62, Serl63 and Thr164.
The invention also provides a substantially pure subtilisin-related protease derived by the replacement of one or more amino acid residues of a precursor subtilisin-related J

6e protease with a different naturally occurring amino acid, said one or more amino acid residues replaced being selected from the group of equivalent amino acid residues of subtilisin naturally produced by Bacillus amyloliquefaciens consisting of Met50, I1e107, Ser204, Lys213, Metl24 + Met222, Met50 + Metl24 + Met222, Thr22 + Ser87, Ser24 + Ser87, Met50 + G1u156 + G1y169 + Tyr217, I1e107 + Lys213, Ser204 + Lys213, and Met50 + I1e107 + Lys213, wherein the amino acid substitution at position Met50 is Phe, the substitution at position I1e107 is Val, the substitution at position Ser204 is Cys, Leu or Arg, the substitution at position Lys213 is Arg, the substitution at position Metl24 is Ile, the substitution at position Met222 is any amino acid, the substitution at position Thr22 is Cys, the substitution at position Ser87 is Cys, the substitution at Ser24 is Cys, the substitution at position G1u156 is Ser, the substitution at position G1y169 is Ala, and the substitution at position Tyr217 is Leu.
Brief Description of the Drawings Figure 1 shows the nucleotide sequence of the coding strand, correlated with the amino acid sequence of B.
amyloliquefaciens subtilisin gene. Promoter (p) ribosome binding site (rbs) and termination (term) regions of the DNA
sequence as well as sequences encoding the presequence (PRE) putative prosequence (PRO) and mature form (MAT) of the hydrolase are also shown.
Figure 2 is a schematic diagram showing the substrate binding cleft of subtilisin together with substrate.
J

- 1~41r80 Figure 3 is a stereo view of the S-1 binding subsite of B.
amyloliquefaciens subtilisin.
Figure 4 is a schematic diagram of the active site of subtilisin Asp32, His64 and Ser221.
Figures 5A and 5B depict the amino acid sequence of sub-tilisin obtained from various sources. The residues directly beneath each residue of B. amyloliquefaciens subtilisin are equivalent residues which (1) can be mutated in a similar manner to that described for B. amyloliquefaciens subtilisin, or (2) can be used as a replacement amino acid residue in B. amyloliquefaciens subtilisin. Figure 5C depicts conserved residues of B. amylolique-faciens subtilisin when compared to other subtilisin sequences.
Figures 6A and 6B depict the inactivation of the mutants Met222L and Met222Q when exposed to various organic oxidants.
Figure 7 depicts the ultraviolet spectrum of Met222F
subtilisin and the difference spectrum generated after inactivation by diperdodecanoic acid (DPDA).
Figure 8 shows the pattern of cyanogen bromide digests of untreated and DPDA oxidized subtilisin Met222F on high resolu-?0 tion SDS-pyridine peptide gels.

_g-Figure 9 depicts a map of the cyanogen bromide fragments of Fig. 8 and their alignment with the sequence of subtilisin Met222F.
Figure 10 depicts the construction of mutations between codons 45 and 50 of _B. am_yloliquefaciens subtilisin.
Figure 11 depicts the construction of mutations between codons 122 and 127 of B. amylolic~uefaciens subtilisin.
Figure 12 depicts the effect of DPDA on the activity of subtilisin mutants at positions 50 and 124 in subtilisin Met222F.
Figure 13 depicts the construction of mutations at codon 166 of H_. amyloliquefaciens subt:ilisin.
Figure 14 depicts the effect of hydrophobicity of the P-1 substrate side-chain on the kinetic parameters of wild-type ~. amYloliquefaciens subtili~sin.
Figure 15 depicts the effect of position 166 side-chain substitutions on P-1 substrate specificity.
Figure 15A shows position 166 mutant subtilisins containing non-branched alkyl and aromatic side-chain substitutions arranged in order of increasing molecular volume. Figure 15B shows a series of mutant '0 enzymes progressing through ~- and ~-branched aliphatic side chain substitutions of increasing molecular volume.
Figure 16 depicts the effect of position 166 '5 side-chain volumn on log kcat/Km for various P-1 substrates.

Figure 17 shows the substrate specificity differences between I1e166 and wild-type (Glyl66) B. amyl~oliquefaciens sub-tilisin against a series of alphatic and aromatic substrates. Each bar represents the difference in log kcat/Km for Ilel66 minus wild-type (G1y166) subtilisin.
Figure 18 depicts the construction ~of mutations at codon 169 of B, amyloliquefaciens subtilisin.
Figure 19 depicts the construction of mutations at codon 104 of B. amyloliquefaciens subtilisin.
Figure 20 depicts the consturction of mutations at codon 152 B. amyloliquefaciens subtilisin.
Figure 21 depicts the construction of single mutations at codon 156 and double mutations at codons 156 and 166 of B.
amyloliquefaciens subtilisin.
Figure 22 depicts the construction of mutations at codon 217 for B. amyloliquefaciens subtilisin.
Figures 23A and 23B depict the. kcat/Km versus pH profile for specific mutations at codon 156 and/or 166 in B. amylolique-faciens subtilisin.
Figure 24 depicts the kcat/Km versus pH profile for mutations at codon 222 in B. amyloliquefaciens subtilisin.
- g _ ~ 341 28 0 -lo-Figure 25 depicts the constructing mutants at codons 94, 95 and 96.
Figures 26 and 27 depict substrate specificity of various wild type and mutant subtilisins for different substrates.
Figures 28 A, B, C and D depict the effect of charge in the P-1 binding sites due to substitutions at codon 156 and 166.
Figures 29 A and B are a stereoview of the P-1 binding site of subtilisin BPN' showing a lysine P-1 substrate bound in the site in two ways. In 29A, Lysine P-1 substrate is built to form a salt bridge with a Glu at codon 156. In 29B, Lysine P-1 substrate is built to form a salt bridge with Glu at codon 166.
Figure 30 demonstrates residual enzyme activity versus temperature curves for purified wild-type (Panel A), C22/C87 (Panel B) and C24/C87 (Panel C).
Figure 31 depicts the strategy for producing point mutations in the subtilisin coding sequence by misin-corporation of a-thioldeoxynucleotide triphosphates.
Figure 32 depicts the autolytic stability of purified wild type and mutant subtilisins 170E, 107V, 2138 and 107V/213R at alkaline pH.
Figure 33 depicts the autolytic stability of purified wild type and mutant subtilisins V50, F50 and F50/V107/R213 at alkaline pH.

Figure 34 depicts the strategy far constructing plasmids containing random cassette mutagenesis over residues 197 through 228.
Figure 35 depicts the oligodeoxynucleotides used for random cassette mutagenesis over residues 197 through 228.
Figure 36 depicts the construction of mutants at codon 204.
Figure 37 depicts the oligodeoxynucleotides used for synthesizing mutants at codon 204.
petailed Description The inventors have discovered that various single and multiple 'fin vitro mutations involving the substitution, deletion or insertion of one or more amino acids within a non-human carbonyl hydrolase amino acid sequence can confer advantageous properties to such mutants when compared to the non-mutated carbonyl hydrolase.
Specifically, ~. amyloliquefaciens subtilisin, an alkaline bacterial protease, has been mutated by modifying the DNA encoding the subtilisin to encode the substitution of one or more amino acids at various amino acid residues within the mature form of the subtilisin molecule. These ~n vitro mutant subtilisins have at least one property which is different when compared to the same property of the precursor subtilisin. These modified properties fall into several categories including: oxidative stability, substrate specificity, thermal stability, alkaline stability, catalytic activity, pH activity 1 3~1 ~~0 profile, resistance to proteolytic degradation, Km, kcat and Km/kcat ratio.
Carbonyl hydrolases are enzymes which hydrolyze O
compounds containing C-X bonds in which X is oxygen or nitrogen. They include naturally-occurring carbonyl hydrolases and recombinant carbonyl hydrolases.
Naturally occurring carbonyl hydrolases principally include hydrolases, e.g. lipases and peptide hydrolases, e.g. subtilisins or metalloproteases.
Peptide hydrolases include «-aminoacylpeptide hydrolase, peptidylamino-acid hydrol,ase, acylamino hydrolase, serine carboxypeptidase, metallocarboxy peptidase, thiol proteinase, carboxylproteinase and metalloproteinase. Serine, metallo, thiol and acid proteases are included, as well as endo and exo proteases.
"Recombinant carbonyl hydrolase" refers to a carbonyl hydrolase in which the DNA sequence encoding the naturally occurring carbonyl hydrolase is modified to produce a mutant DNA sequence which encodes the substitution, insertion or deletion of one or more amino acids in the carbonyl hydrolase amino acid sequence. Suitable modification methods are disclosed herein and in EPO Publication No. 0130756 published January 9, 1985.
Subtilisins are bacterial carbonyl hydrolases which generally act to cleave peptide bonds of proteins or peptides. As used herein, "subtilisin" means a naturally occurring subtilisin or a recombinant subtilisin. A series of naturally occurring subtilisins is known to be produced and often secreted by various bacterial species. Amino acid sequences of the members of this series are not entirely homologous. However, the subtilisins in this series exhibit the same or similar type of proteolytic activity. This class of serine proteases shares a common amino acid sequence defining a catalytic triad which distinguishes them from the chymotrypsin related class of serine proteases. The subtilisins and chymotrypsin related serine proteases both have a catalytic triad comprising aspartate, histidine and serine. In the subtilisin related proteases the relative order of these amino acids, reading from the amino to carboxy terminus is aspartate-histidine serine. In the chymotrypsin related proteases the relative order, however is histidine-aspartate-serine.
Thus, subtilisin herein refers to a serine protease having the catalytic triad of subt:ilisin related proteases.
"Recombinant subtilisin" refers to a subtilisin in which the DNA sequence encoding the subtilisin is modified to produce a mutant DNA sequence which encodes the substitution, deletion or insertion of one or more amino acids in the naturally occurring subtilisin amino acid sequence. Suitable methods to produce such modification include those disclosed herein and in EPO Publication No. 0130756. For example, the subtilisin multiple mutant herein containing the substitution of methionine at amino acid residues 50, 124 and 222 with phenylalanine, isoleucine and glutamine, respectively, can be considered to be derived from the recombinant subtilisin containing the substitution of glutamine at residue 222 (Q222) disclosed in EPO Publication No.
0130756. The multiple mutant thus is produced by the substitution of phenylalanine for methionine at residue 50 and isoleucine for methionine at residue 124 in the Q222 recombinant subtilisin.
"Carbonyl hydrolases" and their genes may be obtained from many procaryotic and eucaryotic organisms.
Suitable examples of procaryotic organisms include gram negative organisms such as ~. coli: or pseudomonas and gram positive bacteria such as micrococcus or bacillus. Examples of eucaryotic organisms from which carbonyl hydrolase and their genes may be obtained include yeast such as S. cerevisiae, fungi such as Aspergillus sp., and non-human mammalian sources such as, for example, Bovine sp. from which the gene encoding the carbonyl hydrolase chymosin can be obtained. As with subtilisins, a series of carbonyl hydrolases can be obtained from various related species which have amino acid sequences which are not entirely homologous between the members of that series but which nevertheless exhibit the same or similar type of biological activity. Thus, non-human carbonyl hydrolase as used herein has a functional definition which refers to carbonyl hydrolases which are associated, directly or indirectly, with procaryotic and non-human eucaryotic sources.
A "carbonyl hydrolase mutant" has an amino acid sequence which is derived from the amino acid sequence of a non-human "precursor carbonyl hydrolase". The precursor carbonyl hydrolases include naturally-occurring carbonyl hydrolases and recombinant carbonyl hydrolases. The amino acid sequence of the carbonyl hydrolase mutant is "derived" from the precursor hydrolase amino acid sequence by the substitution, deletion or insertion of one or more amino acids of the precursor amino acid sequence. Such modification is of the "precursor DNA sequence" wraich encodes the 1341280 _ amino acid sequence of the precursor carbonyl hydrolase rathern than manipulation of the precursor carbonyl hydrolase per se. Suitable methods for such manipulation of the precursor DNA sequence include methods disclosed herein and in EPO Publication No.
0130756.
Specific residues of _B. amylolic~uefaciens subtilisin are identified for substitution, insertion or deletion. These amino acid position numbers refer to those assigned to the ~. amyloliquefaciens subtilisin sequence presented in Fig. 1. The invention, however, is not limited to the mutation of this particular subtilisin but extends to precursor carbonyl hydrolases containing amino acid residues which are ''equivalent" to the particular identified residues in B. amylolisuefaciens subtilisin.
A residue (amino acid) of a precursor carbonyl hydrolase _is equivalent to a residue of B.
amyloliquefaciens subtilisin if it is either homologous (i.e., corresponding in position in either primary or tertiary structure) or analagous to a specific residue or portion of that residue in _B.
amyloliquefaciens subtilisin (i.e., having the same or similar functional capacity to combine, react, or interact chemically).
In order to establish homology to primary structure, the amino acid sequence of a precursor carbonyl hydrolase is directly compacted to the amvloliquefaciens subtilisin primary sequence and particularly to a set of residues known to be invariant in all subtilisins for which sequence is known (Figure 5C). After aligning the conserved residues, allowing for necessary insertions and '!341280 deletions in order to maintain alignment (i.e., avoiding the elimination of conserved residues through arbitrary deletion and insertion), the residues equivalent to particular amino acids in the primary sequence of _B. amyloliguefaciens subtilisin are defined. Alignment of conserved residues preferably should conserve 100% of such residues. However, alignment of greater than 75% or as little as 50% of conserved residues is also adequate to define equivalent residues. Conservation of the catalytic triad, Asp32/His64/Ser221 should be ma~.ntained.
For example, in Figure 5A the amino acid sequence of subtilisin from $. amyloliguefaciens _B. subtilisin var. I168 and $. lichenformis (carlsbergensis) are aligned to provide the maximum amount of homology between amino acid sequences. A comparison of these sequences shows that there are a number of conserved residues contained in each sequence. These residues are identified in Fig. 5C.
These conserved residues thus may be used to define the corresponding equivalent amino acid residues of $.
amylolic~uefaciens subtilisin in other carbonyl hydrolases such as thermitase derived from Thermoactinomyces. These two particular sequences are aligned in Fig. 5B to produce the maximum homology of conserved residues. As can be seen there are a number of insertions and deletions in the thermitase sequence as compared to $. amvloliquefaciens subtilisin. Thus, in thermitase the equivalent amino acid of Tyr217 in $. amyloliguefaciens subtilisin is the particular lysine shown beneath Tyr217.
In Fig. 5A, the equivalent amino acid at position 217 in $. amYloliguefaciens subtilisin is Tyr. Likewise, 1341 ~~0 in ~. subtilis subtilisin position 217 is also occupied by Tyr but in ~. licheniformis position 217 is occupied by Leu.
Thus, these particular residues in thermitase, and subtilisin from $. subtilisin and B_. licheniformis may be substituted by a different amino acid to produce a mutant carbonyl hydrolase since they are equivalent in primary structure to Tyr217 in ~. amyloliquefaciens subtilisin. Equivalent amino acids of course are not limited to those for Tyr217 but extend to any residue which is equivalent to a residue in _H. amylolique-faciens whether such residues are conserved or not.
Equivalent residues homologous at the level of tertiary structure for a precursor carbonyl hydrolase whose tertiary structure has been determined by x-ray crystallography, are defined as those for which the atomic coordinates of 2 or more of the main chain atoms of a particular amino acid residue of the precursor carbonyl hydrolase and _H. amyloliquefaciens subtilisin (N on N, CA on CA, C on C, and 0 on 0) are within 0.13nm and preferably O.lnm after alignment.
Alignment is achieved after the best model has been oriented and positioned to give the maximum overlap of atomic coordinates of non-hydrogen protein atoms of the carbonyl hydrolase in question to the _B.
amyloliquefaciens subtilisin. The best model is the crystallographic model giving the lowest R factor for experimental diffraction data at the highest resolution available.
E~Fo(h)~-~Fc(h)~
R factor E Fo (h) h 1 34~ 280 Equivalent residues which are functionally analogous to a specific residue of ~. amyloliquefaciens subtilisin are defined as those amino acids of the precursor carbonyl hydrolases which may adopt a conformation such that they either alter, modify or contribute to protein structure, substrate binding or catalysis in a manner defined and attributed to a specific residue of the ~. amyloli~cuefaciens subtilisin as described herein. Further, they are those residues of the precursor carbonyl hydrolase (for which a tertiary structure has been obtained by x-ray crystallography), which occupy an analogous position to the extent that although the main chain atoms of the given residue may not satisfy the criteria of equivalence on the basis of occupying a homologous position, the atomic coordinates of at least two of the side chain atoms of the residue lie with 0.13nm of the corresponding side chain atoms of am~loliquefaciens subtilisin. The three dimensional structures would be aligned as outlined above.
Some of the residues identified for substitution, insertion or deletion are conserved residues whereas others are not. In the case of residues which are not conserved, the replacement of one or more amino acids is limited to substitutions which produce a mutant which has an amino acid sequence that does not correspond to one found in nature. In the case of conserved residues, such replacements should not result in a naturally occurring sequence. The carbonyl hydrolase mutants of the present invention include the mature fonas of carbonyl hydrolase mutants as well as the pro- and prepro-forms of such hydrolase mutants.
The prepro-forms are the preferred construction since ?~4?2~0__ this facilitates the expression, secretion and maturation of the carbonyl hydrolase mutants.
"Expression vector" refers to a DNA construct containing a DNA sequence which is operably linked to a suitable control sequence capable of effecting the expression of said DNA in a suitable host. Such control sequences include a promoter to effect transcription, an optional operator sequence to control such transcription, a sequence encoding suitable mRNA ribosome binding sites,, and sequences which control termination of transcription and translation. The vector may be a plasmid, a phage particle, or simply a potential genomic insert. Once transformed into a suitable host, the vector may replicate and function independently of the host genome, or may, in some instances, integrate into the genome itself. In the present specification, "plasmid" and "vector" are sometimes used interchangeably as the plasmid is the most commonly used form of vector at present. However, the invention is intended to include such other forms of expression vectors which serve equivalent functions and which are, or become, known in the art.
The "host cells" used in the present invention generally are procaryotic or eucaryot~ic hosts which preferably have been manipulated by the methods disclosed in EPO Publication No. 01.0756 to render them incapable of secreting enzymatically active endoprotease. A preferred host cell for expressing subtilisin is the Bacillus strain BG2036 which is deficient in enzymatically active neutral protease and alkaline protease (subtilisin). The construction of strain BG2036 is described in detail in. EPO Publicatin No. 0130756 and further described by Yang, M.Y., et al. (1984) J. Bacteriol. ~b_0, 15-21. Other host cells for expressing subtilisin include Bacillus subtilis 1168 (EPO Publication No. 0130756).
Host cells are transformed or transfected with vectors constructed using recombinant DNA techniques. Such transformed host cells are capable of either replicating vectors encoding the carbonyl hydrolase mutants or expressing the desired carbonyl hydrolase mutant. In the case of vectors which encode the pre or prepro form of the carbonyl hydrolase mutant, such mutants, when expressed, are typically secreted from the host cell into the host cell mediuia.
"Operably linked" when describing the relationship between two DNA regions simply means that they are functionally related to each other. For example, a presequence is operably linked to a peptide if it functions as a signal sequence, participating in the secretion of the mature form of the protein most probably involving cleavage of the signal sequence. A
Promoter is operably linked to a coding sequence if it controls the transcription of the sequence; a ribosome binding site is operably linked to a coding sequence if it is positioned so as to permit translation.
The genes encoding the naturally-occurring precursor carbonyl hydrolase may be obtained in accord with the 1341280_.

general methods described herein in FPO Publication No. 0130756.
Once the carbonyl hydrolase gene has been cloned, a number of modifications are undertaken to enhance the use of the gene beyond synthesis of the naturally-occurring precursor carbonyl hydrolase. Such modifications include the production of recombinant carbonyl hydrolases as disclosed in FPO Publication.
No. 0130756 and the production of carbonyl hydrolase mutants described herein.
The carbonyl hydrolase mutants of the present invention may be generated by site specific mutagenesis (Smith, M. (1985) Ann, Rev. Genet. 423;
Zoeller, M.J., et al. (1982) Nucleic Acid Res. 10, 6487-6500), cassette mutagenesis (EPO Publication No.
0130756) or random mutagenesis (Shortle, D., et al.
(1985) Genetics, 11G, 539; Shortle, D., et al. (1986) Proteins: Structure, Function and Genetics, 1, 81;
Shortle, D. (1986) J. Cell. Biochem, 30, 281; Alber, T., et al. (1985) Proc. Natl. Acad. of Sci., 82, 747;
Matsumura, M., et al. (1985) J. Biochem., 260, 15298;
Liao, H., et al. (1986) Proc. Natl. Acad. of Sci., 83 576) of the cloned precursor carbonyl hydrolase.
Cassette mutagenesis and the random mut:agenesis method disclosed herein are preferred.
The mutant carbonyl hydrolases expressed upon transformation of suitable hosts are screened for enzymes exhibiting one or more properties which are substantially different from the properties of the precursor carbonyl hydrolases, e.g., changes in substrate specificity, oxidative stability, thermal stability, alkaline stability, resistance to proteolytic degradation, pH-activity profiles and the like.
A change in substrate specificity is defined as a difference between the kcat/Km ratio of the precursor carbonyl hydrolase and that of the hydrolase mutant.
The kcat/Km ratio is a measure of catalytic efficienty. Carbonyl hydrolase mutants with increased or diminished kcat/Km ratios are described in the examples. Generally, the objective will be to secure a mutant having a greater (numerically large) kcat/Km ratio for a given substrate, thereby enabling the use of the enzyme to more efficiently act on a target substrate. A substantial change in kcat/Km ratio is preferably at least 2-fold increase or decrease.
However, smaller increases or decreases in the ratio (e. g., at least 1.5-fold) are also considered substantial. An increase in kcat/Km ratio for one substrate may be accompanied by a reduction in kcat/Km ratio for another substrate. This is a shift in substrate specificity, and mutants exhibiting such shifts have utility where the precursor hydrolase is undesirable, e.g. to prevent undesired hydrolysis of a particular substrate in an admixture of substrates.
~ and kcat are measured in accord with known procedures, as described in EPO Publication No.
0130756 or as described herein.
Oxidative stability is measured either by known procedures or by the methods described hereinafter. A
substantial change in oxidative stability is evidenced by at least about 50% increase or decrease (preferably decrease) in the rate of loss of enzyme activity when exposed to various oxidizing conditions. Such oxidizing conditions are exposure to the organic 1~41C80 oxidant diperdodecanoic acid (DPDA) under the conditions described in the examples.
Alkaline stability is measured either by known procedures or by the methods described herein. A
substantial change in alkaline stability is evidenced by at least about a 5% or greater increase or decrease (preferably increase) in the half life of the enzymatic activity of a mutant when compared to the precursor carbonyl hydrolase. In the case of subtilisins, alkaline stability was measured as a function of autoproteolytic degradation of subtilisin at alkaline pH, e.g. for example, O.1M sodium phosphate, pH 12 at 25° or 30°C.
Thenaal stability is measured either by known procedures or by the methods described herein. A
substantial change in thermal stability is evidenced bY at least about a 5% or greater increase or decrease (preferably increase) in the half-life of the catalytic activity of a mutant when. exposed to a relatively high temperature and neutral. pH as compared to the precursor carbonyl hydrolase. In the case of s~tilisins, thermal stability is measured by the autoproteolytic degradation of subtilisin at elevated temperatures and neutral pH, e.g., for example 2mM
calcium chloride, 50mM MOPS pH 7.0 at °_i9°C.
The inventors have produced mutant subtilisins containing the substitution of the amino acid residues of ~. am~rloliquefaciens subtilisin shown in Table I.
The wild type amino acid sequence and DNA sequence of ~. am~yloliquefaciens subtilisin is shown in Fig. 1.

134~~~0 TABLE I

Residue Rep lacement Amino Acid Tyr21 A F

Thr22 C

Ser24 C

Asp32 N Q S

Ser33 A T

Asp36 A G

G1y46 V

A1a48 E V R

Ser49 C L

Met50 C F V

Asn77 D

Ser87 C

Lys94 C

Va195 C

Leu96 D

Tyr104 A C D E F G H K L M N P Q R S T V W
I

I1e107 V

G1y110 C R

Metl24 I L

A1a152 G S

Asn155 A D H Q T

G1u156 Q S

G1y166 A C D E F H I L M N P Q R S T V W Y
K

G1y169 A C D E F H I L M N P Q R S T V W Y
K

Lys170 E R

Tyr171 F

Pro172 E Q

Phe189 A C D E G H I L M N P Q R S T V W Y
K

Asp197 R A

Met199 I

Ser204 C R L P

Lys213 R T

Tyr217 A C D E F G H K L M N P Q R S T V W
I

Ser221 A C

Met222 A C D E F G H K L N P Q R S T V W Y
I

The different amino acids substituted are represented in Table I by the following single letter designations:
Amino acid or residue 3-letter 1-letter thereof symbol symbol Alanine Ala A

Glutamate Glu E

Glutamine Gln Q

Aspartate Asp D

Asparagine Asn N

Leucine Leu L

Glycine Gly G

Lysine Lys K

Serine Ser S

Valine Val V

Arginine Arg R

Threonine Thr T

Proline Pro P

Isoleucine Ile I

Methionine Met M

Phenylalanine Phe F

Tyrosine Tyr Y

Cysteine Cys C

Tryptophan Trp W

Histidine His H

Except where otherwise indicated by context, wild-type amino acids are represented by the above three-letter symbols and replaced amino acids by the above single-letter symbols. Thus, if the methionine at residue 50 in $. amvloliguefaciens subtilisin is 134'280 replaced by phenylalanine, this mutation (mutant) may be designated Met50F or F50. Similar designations are used for multiple mutants.
In addition to the amino acids used to replace the residues disclosed in Table I, other replacements of amino acids at these residues are expected to produce mutant subtilisins having useful properties. These residues and replacement amino acid~~ are shown in Table II.

134.1280 TABLE II
Residue Replacement Amino Acids) Tyr-21 L

Thr22 K

Ser24 A

Asp32 Ser33 G

G1y46 A1a48 Ser49 Met50 L K I V

Asn77 D

Ser87 N

Lys94 R Q

Va195 L I

Tyr104 Met124 K A

Al$152 C L I T M

Asn155 G1u156 A T M L !t G1y166 G1y169 Tyr171 K R E Q

pro172 D N

Phe189 Tyr217 Ser221 Met222 Each of the mutant subtilisins in Table I contain the replacement of a single residue of the am~rlolic~uefaciens amino acid secduuence. These particular residues were chosen to probe the influence of such substitutions on various properties of B.
amyloliguefacien subtilisin.
Thus, the inventors have identified Met124 and Met222 as important residues which if substituted with another amino acid produce a mutant subtilisin with enhanced oxidative stability. For Met124, Leu and Ile are preferred replacement amino acids. Preferred amino acids for replacement of Met222 are disclosed in ~PO Publication No. 0130756.
Various other specific residues have also been identified as being important with regard to substrate specificity. These residues include Tyr104, A1a152, G1u156, G1y166, G1y169, Phe189 and Ty:r217 for which mutants containing the various replacement amino acids presented in Table I have already been made, as well as other residues presented below for which mutants have yet to be made.
The identification of these residues, :including those yet to be mutated, is based on the inventors' high resolution crystal structure of ~. amyloli~uefaciens s~tilisin to 1.8 A (see Table III) , their experience with ~n v, itro mutagenesis of subtilisin and the literature on subtilisin. This work and the x-ray crystal structures of subtilisin containing covalently bound peptide inhibitors (Robertus, J.D., et al.
(1972) Hiochemistry ~,~,, 2439-2449), product complexes (Robertus, J.D., et ~,. (1972) B~ochemistrv 11, 4293-4303), and transition state analogs (Matthews, D.A., Wit" al (1975) J. Hiol. Chem. X50, 7120-7126;
Poulos, T.L., ~t ~. (1976) J. Biol. Chem. 251, .~5 1097-1103), has helped in identifying an extended J
peptide binding cleft in subtilisin. This substrate binding cleft together with substrate is schematically ~ 341 ~8 0 -29~
diagramemed in Fig. 2, according to the nomenclature of Schechter, I., et ~. (1967) Biochem Bio. Res.
Commun. ~7, 157. The scissile bond in the substrate is identified by an arrow. The P and P' designations refer to the amino acids which are positioned respectively toward the amino or carboxy terminus relative to the scissle bond. T;he S and S' designations refer to subsites in the substrate binding cleft of subtilisin which interact with the corresponding substrate amino acid residues.

1 34~ 280 Atomic Coordinates for the Apoenzyme Form of $, An~rloliquefaciens Subtilisin to 1.8AResolution i ala r Il.131 s3.Ils -1!.751 I ala Ca 1!.111 11.17. -tl.las I ala c 11.731 se.!s -11.32. I 1la o 11.31 sl.llT tl.lTs I ua C tl.o!! fl.slt -11.13 t clr r 11.11 1!.a 112..1 i Gar ca 17.11! lt.eol -11..31 t GlY c 11.75 T.TOa -t.!!2 t GlY o 11.T1s ~T.1s -11.1!1 t Glr c1 ll.lts l.Tle -12.11!

t GAY cc ls.atl lT.ses -11.17 t Glr co 13.!12 1T.Tz -tz.l3o t GW ofl l3.ot3 11.11 -2.117 : Glr rEt ll.lls 11.17 -t3.sta ! sE1 r 11.!77 lT.tos -1!.st 3 sE1 ca 1T.lse ls.ell 11!.!37 3 st1 c 11.T3s 11.11 -11.1!1 s set o ls.slo s.3s2 -IS.:t!

sE1 c1 11.s11 1s.131 -I.ea! ! sE1 oc 1t.1t ll.tlo -IT.11!

1 vw r 11.!!1 w.wa -Il.Trs a vw ca ls.l.1 11.11 -Il.l3!

4 vas c 11. I2! 11.!31 -11.:10 1 gal 0 11.113 1.171 -I.a 1 vas c1 1!.001 11.12 -to.tz a vu cGI I1.T1 1.sTt -te.Tl1 vm cct Il.o3T lt.zll -11.11 s r1o r ls.t3! t.IOa -17.331 s r1o ca ls.3t. l..ls -Il.o2T s r1o c ls.sel !!.los -1.11!

s rao 0 11.ts !1.213 -17.11 s r1o c! ll.lso 1.0 -IS.tl3 S r10 CG 13.1.1 3.15 -If.ltl f Ie0 CO 11.11 11. 17.111 l1 TTt Y 11.3x3 3l.to -1s.117 1 ttt CI 11.11 3T.o3 -IS.IIs 1 TTt c ts.3s! 3x.!75 -ls.stt 1 Ttt o ls.ttl !s.ll3 -Il.t3s 1 Trt c1 It.tv 37.33 -11.13. 1 Tt1 cc le.otl ls.l.T -IS.ess 1 TTt col 11.131 35..51 -11.36 1 TTI C0t 11.1!1 31.le1 -11.11 1 Ttt CEI I.s3s 3..110 -11.6s3 1 TTt CEt !7.115 33.5!! -I1.3T1 1 TIt C2 11.11 33.11. 15.121 1 Ttt 0h 11.31! 11.131 -ls.!!1 1 Gl1 r 11..11 !7.312 -11.130 1 Gl1 Ca 13.11 11.11 -11.171 t Glt c lz.loo 31.s3s -ls.lTO t Gm o !1.717 ls.ltl -IS.113 a vW r 12.111 3T. il.s.1 a val ca 11.777 lT.s23 -IT.131 s2!

1 vat C 1.313 31.33 -I.T3s vat 0 11.13! !5.111 -1l.lTo ~a~ C 11.T1s 31.!00 -11.57 s ~aL CGI ll.IO1 31.el3 -1!.113 1 vas cct 1.111 I!.l11 -IT.T33 1 sE1 r 13.11 31.311 -ll.TTs ! sE1 Ca l..~l! 3s.31t -1l.flt fE1 C 11.111 31.!20 -1.115 1 sE1 0 11.112 !3.111 11.!01 1 tEltC 11.11! ls.l3t -ll.so5 SEt oG 11.1? 11.7.1 to.3s1 11 6111r 11.1!1 13.17 -IT.112 11GAY Ca 13. l1. 1!.131 -li.Ta to ilk C 11.17 !1.111 -17.77 11GLY 0 lt.tls lo. -17..13 1 Glr C ll.lts 71.15 1s.11e a.1 I Glr LG 11.1!5 11.117 -11.511 11 GlY Co 11.1 !1.111 11.111 11GLY 0E1 ll.ss. 33.11 -11.7!1 to GlY rEt ll.sst lo.!o -lt.tsl II1~E r il.lts lt.sTS 11.17 11 IlE Ca 11.173 31.!01 -le.l2 I1ICE C Io.t01 11.71 -1!.105 11 I~E 0 1.173 11.133 -t.Io ilIlf CI 1.132 31.111 -17.!75 il IlE CGI !.11 !1.117 -11..!

11i~E CGt 1.112 1.155 ls.lll 11 IlE C0I T.sl1 !1.111 -IT.lt3 ItWs r 11.272 3t.1s -to.tTT it lts Ca 11.311 11.11! -11.72 12lts c lo.s1 33.1x -it.stt 1t lts o lo.lTe 3.713 -3.11 12lts c1 ll.tsT lo.lla -tt.:l1 it ms cc i:.tl3 tl.l3e -11.13 12W Co lt.s.3 tl.slT -t2. IS! it lts CE 13.13 17.17 tl.Ila s 1tlts rt 1.17 tT.llo -to.t3s 13 am r lo.le! 31.13 -tl.!!1 13ala Ca l.3ts 3s.1lt 2.131 i3 aW C 11.1 3f.T11 -3.113 13a 0 1.331 ls.lol -t..lel 13 1la c1 .s s1.1ls -:l.sls l1r1o r 11.33 !s.ls -13.1!3 11 r1o ca il.lts ll..3e -ts.lte 11r1o c 11.1!1 ls.ssT -1.317 11 reo 0 11.77 !1..T -tT.lls l1r1o C 13.112 ~l.sle -11.!2 i r1o CG 13.31 11.!11 -13.11!

l1r1o co 11.21 !s.l31 t:.ts1 is a~a r lI.sl1 ll.:) -11.11!

isla ca 11.37! l3.lse -17.37 is 1aa c 11.e1t !3. -tl.lu s isala o 1.11 13.11 t 1.111 is 1la C Il.sst !1.111 -17.12 11ltu r 1.1s !1.131 -11.11! 11 AEU Ca T.tll il.fsl -17.11 11ltu C 1.111 1f.ltf ti.stl l1 lEU a t.)1t 111.11 tl.stl !1lEu C .111 11.13 -1.111 11 1E11CG f.t1 l3.11s -t.stt 11LE11C11 f.11 !3.=3. t1.! 11 lEU Cot 1.!1 11.1!7 -:1.13 iTHIS r 1.11s !1.111 -11.11 1T rls ca 1.111 fl.ISI -t1.s31 1Tr:s t l.sl1 !t.!1 -tl.1lo it HIS a !.lt s1.tt -!.sa itrIS c1 .711 !.Ie -tT.lsl 1T ~ls cc !.Is 11.:11 -1.112 itrli rol .!3 !!.eT -ts.lTt it rIS ut 1.11 !1.lt. -ts.1l l1HIS CEI .111 !1.111 -11.11 it rli rEI 1.111 71.)1 -11.31!

11.ittr 11.111 17.113 -71.11 11 itt Ca 11.11 1. t3! 11.122 1341280_ se 0sfc fe.isl tl.~:s lr.r~r se 0efa eØ1 ~e.f~: 01.0s.

0efce ft.ls~ 0s.111 -l~.ff: re 0t o: ss.s:> tI.lle 0e.e11 11 im Y ~.eeo 0s..ls f~.l.! f1 m c1 e.ee: ~.w st.0le r :

11 tvrc t.r: el.m ss.los r1 taro I.:11 ee.W -s..tr1 r to i ce t.x:i ss.e.1 -st.:o t1 i cc t.lls s:.ee: -si.ees s1 iw co I.e:s si.lol -si.ts f1 iw eti e.lr1 ~r.em r...
~

s1 oarrt: t.s: so.st .se.:s1 0o i~rr t.l0s ft.t:! -st.ell ~e l1 ca I.ll1 !1.111 -1:.111 !0 1~1c .s11 ie.ll: li.eee io t~10 .:s 01.:11 s:.:is :r tIfr 0.tet tl.eos se.tli ti 11fc1 .m a sl.0si t1.1s tr tIfc 1.e11 e1.s: :.s:s 11fo 0..:: sl.e?. t1.111 0i IIfce s.lle el..l~ tl...s ti 11fcc :.11s ss.l0. so.lel ;t 11 col 0.1s 0l.ss: ss.se ti tIfcoi s.ISO s..11 -s~.le, tr tIfcci s.so1 0s.111 st.l.1 =f tIftti 1.fr 1..111 lt.111 tl 111ct =.111 ..tle 11.11 ti 11fo~ r.lo> >..t.i -s..eso t: t~fY 0.ei el.Iee tl.tel tt t~fc1 1.:1: ~o.s:1 .tl.stl tt t~ c 0.els ~e.~tt -:Lx..

:t trfo s.:11 .s.~:s :s.s:s := 1f ce 0.rss as.lsl tl.Iii xt f~faG1 ..111 1=.s1 t1.111 !! 1wfCGt L 411 11.lt1 tl.etl 0i1Y f.s1 ~o.tes .tl..ss t! ailc1 0.oe1 le.ICa =s.
l.:

:r cm c -o.is1 1s.si :.m a :s 0v10 s.eis I:.els es.sso t ef r -o.o:s w .111 t,.! t. 0t c1 e.el1 ~t.~s, .te.e~t t~ 0efc =.sr 1:.I:1 tl.el. t. 0efo -:.eis lf.0e1 te.ile t sf c0 -o.ls ls.i:c :.s:o : 00fac o.ss ~s.Il: :.t:e :s as.Y -s.os1 1s.11: -fl.sis is aspca ..ew I0.Ie1 -:l.ss :s Isrc e.ois .:.01s tl.ts :s asro -L xss ~t.Ile -tl.rle is asrc1 -0.ils ls.t:1 te.lo~ :s asrcc -..IO ~l.sle -:.s xs asroo~ 1.s 1s.111 -si.oes is asrwa: 1.1.1 1e..li tl.sl.

_ 11~r ..111 1=.1 :.tt :1 talc1 .e1 lr.all :1.
r1!

t1 ~w c 1.1s: l:.es: -=:.s1 t ~w o -s.es1 ls.lil ::.Ie1 :1 a~ c1 s.li. lo.sos -:s.l:i :I a~ ccs l.rlo el.lo: ::.s.e t1 em cc: s.el1 s1.s11 -tl.om t1 GIs~ -s.lio lf.Im tt.soi :1 vIsca .irs ls.s:. t~.ils a vTfc s.es1 a:.01: ~e.es :1 GIso -a..os 1i.01s r1.i! t1 ms ce -1.0 1s.11i .ti.i1 t~ ~Ircc 0Ø1 1.01s tt..lo t1 ifsca -.sti 11.10: tt.e:o m ce io.sa. 10..11 ts.isl t1 ~I:Y: -1.111 ll.ess x..tl.
s to 11~r ...eis 1s..1: -rl.:o~ t1 ~a~c1 1.1s1 :.so -r1.111 t1 vavc ..111 1s.s1 -x1.1:s x1 rm o -..xe1 ls.els -m.1~1 s1 ~a~ce -:.1:1 :.111 -r1.11: :1 ~~~cai :..I ~:.rs f L

:s a~ cc: -:.111 li.los fl.rls x1 w r -s.le. w.s:1 xe.lis =1 w ca -t.11 w .sso f.IS1 t1 w c -l.lso ~..wo rs.sss t1 a~10 ..111 1t.l.s -rs.io. t1 a~1c1 -1. r1: 1.111 -fl.fli so vw r -..ss1 ~.osr -il.ol: 00 ~w c1 s.xl1 1..1I: .m.l~o se w c s.s1 10..01 -fe.lli so m o -1.r01 1I. -r0.e11 eo a~ c1 .i.Ie1 ls.0io s:.i.1 eo ~a~cai e.l,e1 11.oi -re.llo so r1ica: -r.ess .ts1 is.sol m =~tY 1.0i. w.s~s 1.11 si titc1 -s.st1 1..1.1 0.11 m titc -1. s.1 a .s .tØ1 ss tv10 -s.0:s 1s.1~1 -1.111 !~ :~tc1 -Lls~ ~s.111 0.se~

si tvtcci -t.:le ls.lol -1.1s si tm cc: -1.t11 ~l.0re -t.::s sr titcoi .i1 lt.esl -1.111 st a1 Y ..e1 11.ss -1.a1 s: as c1 -t. w..11 L :ss 0: as c -s.elr 11.011 1.1s e..

s: as o ..~11 ll..s1 -0.se: s: a1 ce f.I~s le.i:1 t.el:

st as cc e..s ~0.1e: I.:~! s: as eai ~.el. ~1.0s: -e.sl1 st asroa: e.el~ X1.1:1 0.sso ~! oef~ i.~li ~0.t: -0.
s1 s! osfca i.els 1e.s1 .l.0oi ~! 00fc -f. let oe.11 -s.111 11 etfa 1.101 1!.111 e.lll is ff ce 1.1111 .:i s.111 as 0efoc 0.sss 0o.o:s -..11. 0 im ~ .:.rls ee.llo 1.
e1.

s. im ca .t.:ss 0r.1:1 0.11 ~. m c s.e0s 01.1.1 -1.111 s. iw o -.i.. 0e. 0.11 os :~tw -ells 0:..si .ie.rer em a1 thec1 e.:o1 a:..s1 -io.lls 00 :~ec 0.ele 0s.s1 ~s.:s a1 tvto -e.s:1 e..se f~.l.. s1 :vtce e.e.t 01.11 -s:.sl1 as tiecc~ e.eso 0o.eso -f:.el1 ss :~ecc: s.r.1 0f.l.i .rs.sl:

~s w coi -e.elt 1l..es rs..= 01 as r f.0s1 0..ts se.lli t 01 ao ca 0.sse 01.er1 -fi.t0t e1 as c 0.xei es.s1 il.le:

asro s.eoa ss.a~r.s sa asrca s.t ss.~te -re.sra s,asrcc .s s~.e~~-re.ee. sa asroor sass s~.~~, -rr.azs saasraot s.aae s~.tm re.tm s~ sre~ ~.~ea s~.otz -rs.rrr W sEeca s.rw st.zzr-s.. sit stec t.s se.ess -ra.s.s sisEeo z.sas se.se~-ra.rsr m seeee -e.e~s se.ete -ia.~ee s~sEeoc -e.ero s s.rss-i~.~ se seer s.res se.ara -ra.eer sesfeca a.zar ss.sas-~.ae, so srec s.aaa se.~es -ra.
z sesEeo ~.s.~ se.zsr-rs.zes srea ~.~,z ~o.a~s -i~.s~e seseeor s.s~a ss.oas-rz.zs ss itsr s.asa st.sse -r.o,z Hisca e. s~.s~.-is.z~r s~ rrsc a.aer sa.aer -ia.T~e s~m o s. e ss.e -i~.aw orsce a.a ss.zo~ -ra.srs s m s~rrsce e.era sa.aoe-ra.ass itsror s.~~s sa.~sa -rs.sar m m coz a. m sa.s.sis.sev itscEr ~.~~o s~.~~e -rs.rso s m itsrcz s.sm ss.me -m.eoe o rror ~.eo~ sa.esa -m.
set aereoca ~.~ee sa.~~~-io.e~r to reoc a.rsa ss.zeo r~.sst e reoo e.esz ss.e te.sie e reois ~.za~ s~.ss~ -m.rm aoreocr m.os~ s~.aes-m.~ez ao reoco a.see st.asl -ra.T
m aras r e..m s,.s:e-re..ss w asrooz sr.rae se.ss~ -re.~ae arasroor re.szs si.3ss-to.azs r asrcc ie.a sr.ser -m.zm arasrce ~. s st.z ro.zza ar asrca a.aas sz.~s~ -ie.wa ,rasrc ~.sr~ sz.r -re.e ar asro ~.~ se.s.~ -ream vtAEUr .res sz.eo~re.sse z AEUca a.e~z st.rai -re.aaa z veuc s.sza sz.~oi-r~.m ~ az vEUo sass sa.rss -r~.a~o azm ce .azi sz.ise-r~.eoe t vEUcc s.iez sr.sas -rs.~w a z ceucor .sss sr.saa-ra.ser z m coz s.tm as.w -ra.sse a asms r sere sz.rss-rs.saa w s ca r.,ess sz.us -te.~zr s DTsc e.s sz.rsa-to. ere s inso a.sea se.~ze -rs.ezo w s cs t.ezr sz.so~-tz.ras w s cc a.~os st.asa -tz.rro ajs co e.sse sZ.osi-ta.s s s cE -e.reo sz.sea -ts.zao 11lTSrr e.sji sr.lS1-z.ara a ~a~r -e.r~r ss.ws -r~.a~o a w ca -i.4o~ s:.ass-re. ms a ~a~c -t.,s,r stew -rs.TSr asw a -:.azs ss.sea-t a as, as sayce r..aeo ss.ssr -m.sw as~m ccr -z.~z, sz.sarra.se= 4a IalcGt -e.r1 ss.rla -W.ss~

asam r -s.a~a sr.ssr-m.em as am ca -a.,am si.~m -te.ero asam c -s. ear sz.so~-zo.esj as wa o -s.,Tw ss.ees -ze.tea asam ce -a.e3r se.seo-tr.~e~ a em r -s.,~re sz.ssa -re.
me asem ca -~.eez sz.em -re.oor s e~Tc -a.~t~ sz.aas -ra.s~e asem o -s.sre sz.eo i.ws a~ em r -e.e~z si.~se -rs.
m w ccfca -o.ora sz.zw -ra.see ai cm c -s.rts sz.sst -rs.s~z ~~c~~o -~.~ee ss.aer-ra.res o a~ar -s.zzr sz.a,~ -iz.sso aew ca -ie.zss st.wo -rr.sez ae w c -s,.iso st.aTS -s.
we aeua o -s.esa sr.me -s.tzs ae aaace -rr.sse sz.roo -ri.am a~sEer -ie.rw ss.sw -seat 1 sEeCa -~.~sz s~.~ss -~.~sz w sEec -ro.~.i sz.se~-~.~e~ as sEeo -rr.z s~.~m -~.~oe a~sEeee - ~.o~z sa.see-~.oz~ ~ sEeoe -e.e sa.zss s.aso serETr -ie.eas sz.ew -s.~~z se ~m ca -rr.esz si.sw -a.ma seSETc -rr..a~ sr.~az-s.sar so ~E~o m.~~~ si.sve -z.s~s se~c~ce -rz.erz so.ere-a.~~a se pctc~ -rr.~rz w .w -~.~e~

seaftso -rs.aao 1 ~.ee~~.zss se rm cE -~t.eov se.rrr -e.~o~

sr~w r -re.azr sz. -s.azz sr ~a~ca -~.~e ss.r~e -z.
me em sr~a~c -re. o sa.saz-r.re~ sr ~a~o -ie.tsi ss.as~ -t.aez srsacce -e.aas ss.rss-t. see sr tw cer -t.tsz ss.s -e.esr sr~a~cet ~. m. sr.ers-t.soz st reor -it.etr sv.a~s -r.es~

streoca -rz.sm ss.~m -e.etr sz reoc -rr.a~e s~.izs -e.aae szreoa -ir.r se.tzee.szs sz reoce -~s.vae ss.s~. e.zaa s:reocc -rs.se~ sa.re~e.ees sz reoco -rz.iaa ss.aze -e.r~s ssseer -re.aaz sa.seaa. as ss seeea -s.sse st.soz e.aez s~sEec -e.a:e se.tas-e.sz~ ss sEeo -~.~t~ s~.zza -e.ese s~seece -~.eea st.re~t.e ss stere -e.zss se.szr t.iz~

sacw e.tsa s~.sz~-r.s sa cw ca -r.tea st.~ae -t.azr r sac~u -~.~a~ s~.~e~s.~os sa c~uo -Y.s sa.z~ a.sT~
c s.cm -a.rw s~.s~~t.ssa s. cm cc -s.ze~ s~.~s~ -e.~t~
ca totug -..waa ss.was-1.11w t C~~~Hs1 -H.Nt t. -1.1 ~w ._ s,,~r -s. see ss.ttt o.tti ss tear -o.sti so.tsi -.tas ~t sstreca -s.a se.iti -s.aas ss t~ a -o.taa se.i -a.tts ss~r o -sa s~.sss - t.oio ss t~ co -io.soa ss.toe -s.ief sstreoci -sees ee.sse s.so ss trecet es.st ss.saa -.eit s~asrr -t.aet ss.e~ -~.ti~ sa asrrot -.~~o ai.it -~.o~i ~

s~asrooi -sets so.~~t io.t sa asrcc -s.tt~ s~.~ts -s.sss saasrce -s.o~o s~.a~a -o. tee sa asrca -s.nt seats e. tee saasrc -~.e~t s~.e~a -e.sos sa asro s.~ea sa.e~a -t..te stno r -a.t sa.tsi -s.tse st erocc t.sti ss.tst is.str streoco -t.sia sa.w -ie.ttt st ~~oce a.aaa sa.~to -ie.t~s ~

streoca -s.a~s sa.tm -s.mt st eeoc -a.sw ss.eat -s.s stn o -~.se~ sa.ite -~.~.s se r~Er -s.~~e s~.tat -~o.a~i o semE ca -:.tat sa.stt -si.ttt so arct -i.tst st.its -m.tss se~rEo -o. ass st.st -ie.aeo se erscs :.s.s st.set it.ats so~~Ecc -~.~i~ s~.~~~ -.is~ so r~Ecoi -~.ts~ ss.tee -sa.ess se~~ecot -s.tii st. -i~.as~ st ~~Eefi ~.ttt ss.tss -ia.~to o s 1E Cft -a.i~a s~.o~s -za.tt~ so ~~tct -s.~as ss. -zs.esi ~

s~carr -t.eaa st.iis o.~~e s~ carca -~.i~t s~.st~ -t.s;a s~carc -e.eot s~.ao~ t.eoo ss earo -i.~ sa.oes ~.iss sscarce -s.et se.aae -~.ees ss etrce -r.s.t ss.tw -a.wa ssearco -s.tso ao.ist -s.iso s~ earoEi -i.aea as. -.esa toe ssearret -t.sss ss.~es -..tat ao asrr o.ro ss.o~s -t.tii ~oasrca o.esi sa.t~z -a.~o. so asrc i.aai ss.tat -s.eso aour o t.ett ss.sso -s.t ea aspce sssa ss.t.a -t.iee ~

aoasrcc t.ott st.s~e -~.~eo ~e esreos s.taa st.m -s.~se ~oasroot :.~is si.oa~ -t.eso as asrr o.~sr ss.tas -~.~so siasrrot -i.fsa st.tat -t.~a~ st asrooi o.aas st.sw -t.ets siasrcc -e.eae s~.m -t. s ~~ asrce o.sm sa.vei -i.tea a ~1asrca i.sst ss.ma -t. too si asrc ttm sa.s~t -i.sae alasro t.sis sa.oat o. sot at asrr t.tio ss.afa -t.we atasrca t.e st.sae i.tes st asrc a.ita si.t -t..ts atasro a.ssi ss.m -s.t~o at asrce i.tos si.m -i.ati a a atasrcc t.sm so.sej -east a asrooi t.am as.em -i.sw ~:asrrot t.att se.toe o.aoi a~ seer ~.~sz st.iea -~.t~i ~~sceca s.ies si.~w -a.te~ as sE~c s.eti se.ts~ -s.te~

sssEeo s.se3 s.tso -a.tas as sEres a.sts ss.sse -a.eit assEeoe a.em se.ase -a.ase as r:sr a.tet w.ats -v.w asitsca i.~~a ~e.ess -a.s ~. itsc ~.a ~~.ts~ -a.t~i asm o ~.w w.w -t.ioe ~a ~:sc~ s.iea w .soi -s.
s tat asms tc s.iaa w.oti -i.tta as r:sroi t.~ot vs.tw -. tai ~.riscot .esa ~s.i~a -~.i~s N rIScE1 t.ai~ ~f.l~ -a.esa ~aHISrEt s.ssa ~~.sto -a.e ~s eatr t.tet ~o.ate -a.set ascm ca i.sst ve.t~a -t.om ~s cm c t.t w.~s~ -~.em asc~~o t.tse .o.ete -so.isa as T~ar s.t s. ass -e.es:

astieto ~.eaa se.iit -.ss as t~ t s.oes as.ooe -ae.tw asryeo s.a ve.te~ -.am T~~cs v.tw si.sm -~.wt w Tw eci ~.m st.a:s - ~.aov w tw cct s.sw st.ete -~e.o4~

at~:sr saes ~t.a.s -~.:ta at ~~sca ~.to~ ~t.~ -~.ase atrisc a.esi w.r.s io.ias at itso a.as vs.ase -ri.iso ~tr:sce t.soo .t.o -o. ova .t itscc o.s~s ~a.tts -e.iae m atr:sroi o.sso w.sot -e.tta at itscot e.soa aa.ate -e.et ~titscei ~.est w.asi -e.t~~ ~t r:srt ie.~te ~s.sia -e.~ev e 1a~r v.e~t ~s.ta~ -1.t7~ to taito v.lat ~a.et -ie.ta aerava s.esv a.ee -is.tao ee raao a.ma as. -tt.sis sat ~ew co t.~~s ~a.tst - s.~ev ~e ~w cci i.~~o a~.t~e -se.ete aeeareet s.s~s as.tes -e.oee es acar s.sts aa.eas -it.
s c~aeaa l.eW ~c.aae W.at ~~ W c ~.'i~1 a~.sve -W..l~

~~wa a a.ete as.~i~ ~s.s~s ~~ w cs i.t at.esi -.m~

tocm r s.sae ~a.tet i~.~ia c ca a.s~s ~o.ees -ia.w tocm c t.ea. as.m -~s.o:~ to cm o t.~ea ~s.isa -ia.m a t~~~e ~.tto ~a.am -ta.~~e tt tryca t.ttt W.tm -tv.aa~
r titre a.tta at.sea -is.sai tr r~nro .e.aet ai.eti ia..ss c tie t.i ~t.o~o -~~.i ~~ tw ec~ o.i~i ~t.s~t -~t.o ce 134 app 11t~1 cct 1.:11 N.se7 -17.s11 ~r eu r 1.ao 1t.1t -ls.ltt 1teat to a.tt1 :.111 1.101 1t eat c l.slt la. -1t.li ell ttrat o 1.7s l:.aee -le.ue tt tat ce t.s7a 1:.elt -ll.ees tteat cel l.slt l:.lee -st.t ~t eai cc: tilt lt.7t1 -i..ttl 17ata r 1.s1. N.111 1t.11 is 1ta ca l.set 11.e11 -11.11t 11ata C 1.171 11.711 -11.7sS to la r s.et 11.111 -tl.til 1)It1 L ~.11t 11.111 11.177 71 Ita r .s1 a.t1 -11.17s 11ala Ca 1.1t1 11.s1 11.1s1 11 at C t.tle ll.HO tl.at 11ata 1 1.s1 1.10 -ties. 11 ata to Las7 1t.11 -1t.ts tfLEU r 1.161 11.111 -11.171 1s lEU Ca l.olt 11.11 -tt.lS1 tfttu C 1.111 11.f11 -11.111 tf LEU o 11.111 le.tsl -tt.tSl isicu t1 t.sl1 so.lli -tt.ool ss icu cc .1t7 s1.ll :z.7t1 istcu col .et1 sz.171 -tt.7eo ~s LEU cot s.e1 se.llz -tl.les t asr r s.lt 11.107 -t. l1 11 asr rot It.7s 1a.7t -t1.7e1 toasr ool Io.so 1s.1o -tt.t1 to asr cc 11.1s la.ttl -tale:

11asr c1 11.110 11.sl -ts.lel n asr ca Ie.7s1 lt.tal -1.171 11asr c le.tl 11.e11 -ts.1l 1 asr o se.lst 1.111 -t1.a11 ttasr r 11.10 11.. -ts.etl n asr ca It.tte s1.st -ts.11 m asr c l7.tot sl.etl -ts.71 tt asr o 1.711 11.11 -ts.7ll Ttasr c1 11.77s sz.eTS -a.llt n asr cc li.tso st.ett -11.111 11asr ool It.o7z sl.a1 -11.11 n asr roz Io.tl1 st.tll -tl.ezs tosca r ll.lzs st.tlt -ts.l s1 sEa ca Is.sl7 sz.1 -t1.1o1 11sEa c 1s.le sz.tlt -:a.ll1 sE1 0 1a.1z s7.Tl 1:1.11 tosea c1 is.los sl.eli -ts.st t1 sc1 oe 1s.t1 s7.to -11.111 t1lic r L .s1 sz.sls -tt.stl 11 =ic ca Is.lss st.te -ti.ize 11ItE c 11.111 s1.1l -to.t7o aE o 1x.117 so.1i -to.t1 istic ce Il.tl s.l m -to.1r lic ccl it.lls sl.e7t -to.oi t1Itc eet 11. nt ss.7to -11.111 lte coi tt.l7s ss.lt -to.iss o ctt r 1.s sl.t1 -11.111 oe ciT to 11.1ta s1.11e -It.17 o itT t 11.111 1 1..1 11.111 Ie it1 0 If.ll1 11.11 -11.711 1 Tat r l7.sll 11.11 -1t.11o 11 Tat ca 11.111 11.111 -I.e11 11tat C It.sil 1.11 -11.111 11 Tat o It. t0 11.171 -to.
lit 11eat ca l7.eoi ll.tss -11.x11 11 rat cei 11.070 t.ee. -is.st7 1 Tat CGt 11.x)1 t.tel -1.111 a tEU 11.111 1S. -I.ti Ns t LEU ca 11.711 ls.e:o -te.tsl a icu c le. ll.etl -ll.sle t icu o io.s1 17.7s1 -11.100 z tEU t1 l:.tea 11.:11 -11.111 t icu tc 11.10 l.s1 -:1.711 z tcu col 1e.111 v.ls~ -tl.t:~

t tcu tot Iz.ls1 lz.lts 1:1.11: 17 cir r 1.171 1.110 -11.111 IlGl1 Ca 1.177 17.711 -11.11. 17 Gtt C l.etT 1.111 -11.125 17Gt1 0 .s11 11.11 -tl.etl 1 Tat r 1.111 11.111 -11.111 1.Tat ca 1.111 71.oT -11.111 0 Tat t .111 ll.elo -ti.i.o 1.Tat o 1.111 x1.11 -tz.ll. o. Tat c1 . a 1 a1.to -11.11 e.Tat cci s.alo x1.11 -ll.ssT e. Tu cct 1.Io al. -lt.TOs sot s ata r s.is 1o.ta -ti.ot is ata ca 1.111 11.11. -tt.isl esata c 1.117 11.11 -:1.711 s ua o s.tl1 l.el -tt.elo esata co 1.1.1 11.11 11.111 a eeo r s.tlo 11.111 -zl.osl 11e1o ca s.il 1..lls -t7.tes 11 eao c 1.x11 s.7tl 1:7.1.1 I1~to o 1.111 la.los -tl.evl 11 Leo ce 1.111 11. -tl.eil t1 e ~o cc t.elo 1.111 -t..sl1 11 Leo co 1.x11 1t.1o -11.171 t sEt r 1.611 11.11 -:.111 17 sEa ca t.le1 s.lt. -ts.szl 11sEa C l.lol ls.ilt 111.1 t sE1 a e.llt ls.sl7 ts.111 t sEa c1 t..oi 1..111 -:1.1:~ et sc1 0: 7.s1 s.il -z~.sll 11ata r l.olt 11. s1. -17.1.1 11 ata ce -0.117 l7.sio -11.11 e as ca -e.ttl 11.7s7 -:t.el. e1 ua c e.ele ls.Tit tt.llo e ata a -e.lt. 1. tit -tz.ls e1 sE1 ~ -:.cie 1s.111 -tt.w1 11sE1 oc -..11 lt.let -t.zeo e1 sca cs -1. s7 11.117 -11.111 11sE1 ca a.eol 11.11 -tt.:z~ t1 sca c -a: i7 ll.teo -tl.tz~

11sE1 0 -a. a 1s.11 -to.tol o itu r -t.1 11.1sa -to.el~

o tcu ca -1.711 11.111 -IO.sl e itu c -7.lel 1e.17e -11.11 e itu o -7.st 1 1.10. I.:ls e icu cs -o.st le.ttl -11..11 e teu ec -e.z77 ll.osl -11.11. e iru tot -e.eta 1x.7.1 -m .111 11tcu cot 1.110 ll.sz. -It.et 11 tTa r -..111 1r.11. -11.11 1 1~~ ca -s.ts1 1e.T 11.171 11 111 c -1.17 ll.tse 11.1s 111 11.!7 1 T11 c1 -1.111 11.1 1.111 1 TTe -1.111 . 11.111 l t1t c1 -1.fs 1.11s tl.7ss i 111 CG , . 11 i tt1 cEi 1.IS lT.s1! 11.11 1.1 -11 i T11 cot -1.11 1.tli . 11 T1t Lt -1.11 .st -1.111 11TTt cEt -e.lis 1.151 1.1z z a a r -1.1s 1.s1 -11.11, i ttt or -a.toz le.tst -11.111 z ata c -s.ezl so.11 -li.e) t ata ca -l.sls e.le -lz.tes t ata cs -!.1 si.tt -11.,11 z at1 0 -1.1z) se.eoe -lt.eso I at to 1.11 11.s1 -le.szs I "at r -s.s 11.~~ -11.1:1 ! at o -1.111 1.I -l.Itz ~

1 tat c -~.~01 1.11 -t.l 1 at cci -.zil 11.11 -.tzs ) pat c1 -1.s7 aT.sss -11.11 ~ cts a -1.et sl.zt7 -.lzt ) eat ccz -1.11s 11.11 -tt.e7z 1 t1s c -1.111 1.11s -s.11.

. tts ca -1.1 sell. 1.1 1 t1s ce -1.si st.11 -1.111 . tts o -1.1s1 so..lo -s.11) 1 t1s co 111 st.sls -s.sl:

tts cG -s.)~ st.lzo -s.lls 1 t1s rc ss.sll 1.111 tls -I

, tts cE 1.11 sl.zel -1. t1 ca . 11.1s7 -I.lzo pa 111 s vat r -1.10 1.e~i -s.ez1 s t . ll.lsl -t.sei o -l lts s tat c -1.111 11.1s -t.sl1 s pat . 11.sz -s.lt cci 111 s tat c1 -l.te. 11.111 -1.111 s u. . 71 -t.le.

-s s tat ccz -1.00 ll.teo -l.llz 1 tEU r . . -I.lti c -1 sl.s5 11tEU Ca -1.711 1 1.11 1.111 1 tEU . 11.111 -i.s1) c1 s1 11tEU a -1.111 si.iti -t. l)1 1 N . 11x -x.111 t tet 11 -t s1tEU cc -).s11 11.111 -t. o7: 1 tEu CDt . . 1.11 11 1s -1 !e 1 tEu co! -1.,1! 11.11 -l..S 17 Gtf r . . e.!s t C )11 st.111 1 Gtr ca -1.10 si.)e7 1.111 1 Gt . l.1 e.ts1 s. sI
-t i Git o -1.11 si.l1) e.tls 1 ata r . . e.1s s11 111 - s1 1 ata c1 -o.lz1 ss.l~1 l.slo 1 ata ca . . 1.11) l1) zt 1 sz 1 ua c 1.111 sl.itl 1.117 e ua o . . l.isi asr oat 111 sl.l.z asr r -. so. sz.sll 1.11: 1 r cc . si.llt s.11 e1) -t asr ooi -t.tlo s1.et 1.11) as . st.111 L 1ss asr ca lei asr ce -e.1.1 st.lll s.i7s . 1 1.1:
1ls ls) a:r c .111 soils !.)zo asr o . . t.lis ca lll le.szi -o leectT r -1.1:1 1.11) t.tla l1o cm . ll 1.171 1 siz leeGt1 c -i.sz1 l.lsi t.eoz l1o cit o . . f.Its slt 11 -l 17 letsEe r -t.f.t 11.1:1 t.o tt tEt to . . l.o~
ts1 11 l 7:

lol:Et c: -l.ts 11.11 t.sm loi sEt o . . s.ze 111 1).
-1 1e 111tEt C1 -1.111 11.117 1.17 lei sEt 0G . . t.es1 11 1::

lotGtr r -s.e:i 11.11: t.s77 lo: GL ca . . 1.1)0 11 1)t -7 1s 1zGL c -1.111 ll.sll t.sze 11z GL o . . l.ezo r ca sls 11.117 -la leicir r -.)m l.IS1 1.111 le) ct . 1s.11z e.lm lo)ctr c -to.1) ls.tlz t.ozz lo) Gtr o . ees 1.s11 c Il1 ll -lu lo)Gtr c1 11.171 t.lo7 l.z71 lo) Gtr . . s.oz c lsl 1 e.ei1 r oEt -lt G

lo)ctr co -iz.lle .114 1.is lo) t . N .t.1 t.lst t1f r 111 lo)Gtr rEt 1).11 1. t7 1.111 111 i . w .lse e.1 m ~ c 31 -1x te.t1t t1 -1:.111 ls.izl i.se1 11. ~ . 111 z.t1) lsT w -lz le.tte o -iz.1)1 l~.zt1 -a.le7 11 tw ce . . L)~t -1x !

lo.trt cc -it.lzs lo.sz 1.111 to. me cot . . l.to~
0 11s 11.T1t coz -to.IT le.lsr i.elo lo. 111 ct 10.1 . 1.111 . ezz !

le.T11 cEZ -.lsz le.os7 1.171 lo. t1t cc -.sl . e) w e s7z lo.tw o~ -e..11 se.m ~.it1 los sEt r -il.e . .
1s lsv ie -i t1ssEt ca -i..om ls.lu -~.ea. 11s sEa c -i~.lm . .
1:1 l.let 1x lossEt a -i..rss 1s.IS -t.zs1 los set c1 -is.llo . et.

1:s 11ssEt oc -is.:e 11.1 l.lso tot ttr r -1).w . .
111 et:

lett1r ca -lz.lzt 11.111 -1.111 101 Tt. c -1t.1s . .
zsl )ss ll -t 111ttr a -iz.lzt 11.111 -1.zs lc1 ttr c' -11.1:1 . .
sz. o.tl.

111t1r cc -1 .l.s 1.111 -.ze1 111 ttr cot -11.11: . 110 111ter cot -to.lsl 1 .liz . set 111 ttr rct 1z.1t sl.lsl .
s71 111t1r cEZ lt.IS se.s~l l.slt te ttr cEl -.tts 1.lst .
szs t letter tct -11.111 st.lrl t.soo 111 ter ccl rsll sl.slt .
e lel -c lettt c~z -.z1) st.tt t.lss log ctc r -11.11 s.)l .
to let1tE ca -le.rls ll.zso I.IZS let tic c -li.sss ll.sl. .
s:) -z to7ctE o -tt.lls 11.11. s. lee let of cs -.111 11.111 .
lel -I

iwctE cci -1.1)1 1.11. -i.!1 lei ctE ccz -.11z 11.110 .
stt I

iwttr cei -.z.) 1z.1 -l.lzr tee tt~ r -1z.1 11.z1z .

1 3~~ X80 ieeIlE ca -14.111 ~t.lt= -1.111 Ze1 IlE c -i.aa)1 ~).1. -s.fe1 100IlE a -i..n. .~11 -~.sst ~e ttE c0 is.:al ~:.tls -6.611 te0IlE ccl -1..711 x1.11 -t.aet ie0 nE cct -11.61 t. et. -4.016 100tte col -!6.461 ~e.e.s -i.l)1 ie asr r -l4.TSi 14.160 -4.101 ie1asr ca -ls.te. ~a.ele -6.111 ie1 asr c -14t~t 1.07 7.01.

setasr a -1..110 ~.tT: -e.t)s 10 asr c0 -is.t0o 17.)61 -6.111 ie1asr cc -1!.610 7.101 -l.ss) 101 asr eel -11.66 11.116 -4.1.1 11 asr ~Dt -11.11) ae...1 -~...t 111 elT -11.16! f.le1 11.71.

ileitT ca -11.161 ~s.lm 7.016 ilo cm c -11.10 14.711 -0.011 ilocm o -11.111 14.111 -io.e). 111 tm ~ 1!1..)7111.66! -a.
t.1 islIlE ca -it. at.~)4 0.011 111 tlE c -16.61 11.61 - 1.141 lo) illIlE a -1!.111 t.Il. -11.14 111 t1E CI -it. 11.1.1 1.)1.
t)4 illIlE CG1 -11..11 le.sel -T.isS 111 IlE Ci! -1).111 I1.T11 -1.1.1 111Ilf col !1.111 11.111 l. I)1 111 etu r -1.. 1).e7s - l.te1 e1) iltilu ca -11.111 1).)Ta -ie.e41 sit clu c -16.71 14.).7 11.111 iltcm o -11..11 l4.lso -11.141 it: cm c0 -17.111 1).011 -1.1.1 lltFlu cc -11Ø7 1.117 -e.l)s iit clu co -10.71. 1.01. -0.106 llzc~u oEl -11Ø1 10.011 1.011 iit ctu eEt 111.!1) 1.110 1.011 117Tar ~ -16.14 f..e) 1.111 ii) Tel ca -ll.TS1 11.401 -it.
ell il)TaI c -1..171 S.17 -17.14 il) ter o -1..)11 16.1)1 -1..))t llsT0r c0 -1).00: 17.66) -11.4). il) tar cc -11.401 !0.661 -11.401 il)T0r col -14.1.0 11.761 -11.101 11) tar cot 11.441 x.661 -16.41) 11)Ter rEl -1).611 61.4.1 1).7t1 11) Tar cEt 11.6.6 11.71 -1..116 il)Tar cE) -11..61 11.1.6 -i).0o1 11) ter cIt -11.111 soØs -16.174 11)Ter t:~ -lo.lo ~ T.~~~-l4.oT1 il) tr cat -10.761 11.07. -i s le) r a~a r -m .o0s 44.001 -11.0)1 114 w to -1t.))) w.0ls -1;.01.
.

5:.aLa C -11.111 1).171 -l4.TSt 114 ala o -11.11) 1).eT. 16.!11 11.Ila Ce -11.11! 1I.11t i).l.o its IlE r -14.114 t.s4o 1..111 itsi~E to 16.11 1l.l.e -i..el7 its tlE c -16.11 lt.4eS -16.61 ilsILE o -11.17 11.1:6 -iT.OTO ils tl.Ec0 -i.00o 10Ø0 -1).111 ilsIlE ccl -16.1!0 ~1.e~1 -i).e.3 ils tlE cct 17.161 x0.110 -1..766 ilsIlE Col -ll.eo. ~l.ai1 -11.7.) ill W r 111.6). 4).611 -16.11 111ala ca -17.s1o 1..4.0 -11.0so ill am c -11.101 16.01 -IT.tTO

111ala a -17.)z) 6.166 110.6.) ill ua co -10.11 4s.slo -16.16!

111aiw a -11..11 s.llo -11.1:1 111 asr ca -14.66! S.17 -10.1)1 111asr c -1).111 14.114 -11.1). 117 asr o -11.111 s..)1 -!6.010 117asr c0 -m .ls 11.160 -17..11 117 asr cc -14.400 40.111 -11.1)1 117asp ooi -1..616 .00z -11.17) i1T air rot -14.1x1 10. -16.761 t1 110asr w -1..116 6.716 -10.11 il0 asr ca -1).710 41.1.1 -11.06:

110asr c -lt.t.o 11.4.4 -11Ø) il0 asr o -11.111 4t.so1 -te.~~z il0asr c0 -14.1.1 t. u) -11.11 110 asr cc -ls~.T)7s.elo -11.)66 il0asr ool -il.slo 11.)11 -10.766 il0 asr rot -11.1)1 44.011 -11.16) 111rET w 11.101 4t.soo -10.TS 111 ~~T ca -i0. 1.111 -10.410 tit tl~rET c -loots 10.1 -10.110 111 rET o -10.000 .0)0 -10.761 111rET c0 -1.011 41.411 -iT.oss 111 rET cc -1. a 46.00) -11.61:
o 111rrT so -0.100 ~..lw -17.611 111 reT e~ -1.10: 11.01 -10.116 lteasr r -0.10. x0..)7 -11.604 ito. asr ca -0.. X1.110 -:l.e~o e1 ltoasr c -7.011 .610 -10.061 ito asr o -0.060 )7.10 -11.11 lzoasr e0 7.666 ~l.ls1 -tl.t)1 ito asr ea -e.t)T ~1.T)o -tt..s.

lteas aol -7.001 lo.7e1 -1).00. ito as ooz -1.611 01.1)6 -tt.r)~

111tal r 17.11 X1.117 -1.111 itl al ca 1!.111 60.111 -11.11 itl~~l c -1.111 )l.ss. 16.701 itl 1al o -1.10. 40.700 1s.11~

itl~av c0 -..TSS ~0.s07 -17.411 itl 1al cci ).760 )0.111 -1l..zT

itlgal cct -4.707 ~7.~11 -10Ø1 itt tlE ~ -1.)10 ~0.~70 -l..sle lt!IlE L1 l.t.e 71.711 11).)17 itt IlE t -S.lt1 ~.t! 1!1.!11 itttlE a -~.1t1 Sl.e1! -11..11 ltt ILE CI -N.T1 ~1.11a 11..11 i!ttlE cGl -.111 1.111 -1).11 itt ilE cGt -7.111 ~l.ell -le.ls.

itt1lE cel 1.171 ~l.te 11.71) it) air r 1..111 1.111 -11.111 1t)asr ca -0.16 61.06 -1!.161 it) asr c -s.~t 10..e. -1.011 11)asr o -).700 1.111 -1.066 it) asr t0 -i.u0 ~0.aT0 -11.1~T

itsasr cc -0.111 aoØ0 -10.777 it) ass osl -0.01) s0.slo -11.111 ltsair r: -.041 X0.7.7 -1.7:0 1: ~tT r -).460 X1.10. -0.0)z it.rET ca -).160 ~1.17~ -7..)1 it. ~Et t -1.411 X1.111 -1.11 il. ~t o t.lo le.loe .efa i:. ~t ce -..e.l le.le, -a.e~l !. ~tTcc a.~ee .e.eei t..,e it. .t l: -,.eef le..i a..so ~. ~t ce ,.e.o le.ere ,.l.i i lt ~ -i.l. .e..el -a.le:
a sll lt c. -l.iei .e.ie, 1.,11 i:s lt c l..is ~e.~i: -.iif it1 tt~o I.tee I.~~ -1. lee itl 1t c1 l.lii ~t.t, a.tl et1 itelc i.. .o..e ,.s,s ii teur -i..le e.l,l l."e w Btuca i.ei o.i~ s.le it Btuc -t..le le.el i.eo, iil ~!uo -t. l.. ~e.~i -=.sie 1: Btuce :.,ei ax.le l..io ito vt~cc l. lee .i., -1. lei ii ~eucox -~e.:,e vx.ss~ -i.s,e i: veuco: ...x,e .:.~.o .v.em i:~ c~ r i.s:i le.ee: e..ei ii, !;lc. l.ele ~,.e~i I.iri i:, 1l c -~.1, le.feo t.ee:

tt~ sw o -:... w .eic :.:io ite wr r -..i:> 1,...i t.t::

itl t~ c. ...,e l,..e ~.: iie c ~... l.eee ..ie.

ite su o -..eoi le.xee l.i,. i:o ~o r ....1i1 lees, L.o:

iie ~~cc. -..l,i l..l:e l.eee i:e ~o c -l.ixl l..eeo a.ee:

iie ~loo -.iie l:.ee, a.ios sie lo ce -..eo l..ae. ~.le ite Leocc -...~1 la.ixo ~.i, ite ~o co -a.tie la.eo ~..se ilo te.r ,.oes ll.ois e.exi ilo teec. l..,o l..xi a.eti ilo t1~c -e.txl l.le. v.,:v ito ie ~ - L e.e ll.eex v.e:e llo ltdce e.ee ~s.s~ 1. i1 i1o ft~of 1.,: !.e: l..oi m~ om w io.ee> li.e .l.e iti su c~ -io.e:. l.::e l.e, ill i1 c -i:.ics l.,li l.ei its ilro xt..el W.,:: a.lll il: tt r -ii.wo le.oee t.sv. iii et ca -x...o, ll..ii l.em i7t lt.c xl.tle l~.tos l.el i1! ileo i..lee l.t L t il: ltece -i..leo s.e:, l.xe ii: lt~ac -i..eei l,.lie i.e,l iie w r -i.1., l.see t.ie. r wa ca i,.eo, l..el, s.l:.

iii au.c -x,.eso l..ee l.ee, ili a~.o a~.~t l.l, -i.ei.

ilI 1~.C 11.11 !1.111 1.11 il ~ ~ i,.lle 11.111 L te.

il. auaca -x,.e~: l,.:er o.,r: il. am c il.aie 1,.111 -s.
a,.

il. W 0 -1.,el l,.lef i.Ile xl aW to -xl.ile il.eoc l.ie, xle Btuw -xe..,e t,.:ir -i.e.l its veuc -x..ie, lt.:.. -i.ee xie vtuc x..sle la.ooe :.,oe ile ttuo -d~.~e. l.eio l.eeo ile vevce i~.ost 1~.~:e Ø1 ill Btuct -xx.eei l,.ilo x.
lee iie veucoi -m .vo le..is -t.iet ils vt~co: io.le: m .eo, e.se ~l~ m ~ -x..lo1 e..ezs :.x ill tvito a..l.i ll.le, -i.esi s ie orsc ie.s.. li.,er ...ieo sll trsc xe.t,e ll..li -l.eos ilv vs ce -i..eoi lt.i.i -=.xe ila v,icc iv.~.~ li.ew -l.ei il. w co -is.om le.ef: -i.tl il mi ct il.,i te.,o, -:.
s "1 ilv vi ~: -xe.eol :e..m ..xvo it, auaw -x.,.. l.:lo -1.
e iit w ca i,.s 1...10 -..eei il, W c i,.lie ll.los a.e.s il, au.o s,.,ot tl.o.e .:.:ol is, w cl -ie.ee. l.e.x -a.:li ile w k -x.1=f l.ioi -l.,ie ill w c. -il.eos l,.ax .~s ile au c i..eoi l.e -,.s, ite au.o i.els l.e.l e.,li ile a~.c1 -x1.11: le.l., -l.ei. ilr ~a~r -il.eso .ele -,.e:~

ile ~w c. -i:.e. le.ies ,.em ile eaic -il.lil l.iie -e.,:o ile eauo ie.:oe l..o,o e.et ile a c1 ii.eio l..e,i -a.ele a ile e.ucci xo.eie ll.ee ,.e i eauc.: -ii.ew le.,eo -.ies io ai w -i..le~ li.ee -e.itt io as ca il.i. li..eo e.etv i.o ai c -i.e:i ~~.xer -io.oe ue al o i.eeo li.ee ix.ieo t.o ai cl i.xe ls.lr e.iee i.r as cc .xl.lee le.e.e -,.xe ia ai oo~ -i..i1 le..ei -,.ie: io a: oei ie.xie lo.ti: v.~:1 .i w w -i.111 s.:1 e.e:o i.x vi c -i~.~,~ le.eo ie.ee s ii i,ic -il. le..il -xi.e. i.x w o -i.,eo ll.i.e il.iii > s i.i ~: ce -xe.ele la.ie io.lie i.i i cc -ie.ee. l,.ee -is.le ai vs cl -ie.ee le.ie, xo.liv t~ ti ce -te.l,: le.eex -ii.iso i.i a r: s~.iie .o.ei, ie.i1 i.: au.w -il.il, le.e.e xx.e it a~ac. -i.i,~ l.te: it.s it am c ii.ese ll.eio ii.eri ~.: w o -il. le.~1 -i.,le ii w ce -i:.e,o lv.w .i~.v.i "o i.i w r -xl.ee: li.lel it.ee: i~ e.uc. -m .xee si.,ee -il.leo i.i eatc I..i. li.tee -i..e1 i.i e.lo i..i.o ll.ee -if.i~

tw eu ce -i:.lei lr.i -i:.,s. i.i eaucci ii.leo le.io -il..oi ii eaucc: i~.~of li.xee xi.oi. i. w w -il.lex l:.eee il.e,e i.. w ca xl.,.. li.ei. t..> >.. auac -i.e:e l:.eex il.e.i 1 34~ 2~0 w aw a s,.tle lt.tw -sv.~fs s.. w ce s,.~.t ls.saotl.,ee s.s1sa ~ sa.so, lt.r.o ss.roa sas t: c. sa.alt 1.. sa.,o.
r1, ss 1er c ss.aor !.. s~.etr ts !e~o -ss.rse ll.ttssl.ors "1 ss !e~ ce s~.em la.sa sa..s. s.s 1fro~ ss. a ta.rssss.e.r :

sw tw ~ r..sm ls.rsa s,.las saa tm ca -ss.asr ll.rrsso.a,s s.atm c -s:.t~~ l...rs sl.ros t.a tm o ss..:e l.loa -sr.taa s.,ray ~ st.sso ls.s.t s,.ts tvt rayca so.Im 11.1sasa.rlt s.rray c -r.eso l..osa sa.sts s., ravo se.s,s ll.rrlss..ea s.trw ce ss.sst la.r" ss.oor s~ rayccs r.lra t,.losss.o~o t.,rw cc:-st.s.o t~.vss s~.tso se rw w l.sos ls.llosa.aos s.oray ca -,..et 1.tso -sa.eos sao rayc -~.ss, l..ro,s..,o1 t.oray o a.l.o la.sst s..,lo t.e r~~co a.t l..stasa.eso s.1ray ccss.o~e ls..os sa.tos s.1 raicct a.sro ll..stsl.tat s.rray ~ :.tsr l..sss ss.sts s.r ravca a.rl, l..rasst.tr s.rray c s.~oe l.tls ss.ass t rayo l. at. ts.s,sss.alr s.rrw ce o.tt 1..lro ss.sss sat raiccs -,.lrt ls.asr-sl.eer s.rray c~:-e..sa ls.soa -st.era sso rayr ..,lt ls.lolss..o.

feorav ca l.trt 1.eet lo.rol iso ralc l.ll1 ll.ats~.fee s1orw o l.srt ~a. r..oo sso ratce l. t,. ls.tosss.~ss "e ssorav cc1o.rm l..alt ss..a1 sso raicct t.o,s t.e.t st.lel sssa~ w t. sae ~..~.~ l.srs ss a~~ca -1. a ~s.sett.te, s ss1w c s.oeo ls.osa a. as, tss am o e.as1 .ler a.ro.

ss1a~a cs l.ss, ls.sro e. to, t1t aLaw l..so ls.~e,l.ltt ssta ca l.,s. ls..se l.sst slt a~ac 1.10. la.ttoa.sss a ssta~~ o -e., l...aa l..a, t1t a~aco s.taa la.ao,a.tr.
t1 sssa~a ~ s.sts ll.so: l.rst sss au ca e.l.e st.tset.l.t sstam c l.sss lt.Tts s.sss tls wa o t.ls, lt.sst-e.lsr ss~w ce s.,so ls.ess l.s~s t1. tm ~ t.ltr ll.arss.
t ss.tm ca =.e.t l..ts1 l.sts sl. tm c l.lsr l..eare.lso ss.tm o a.sor ls.tar e.ss1 t1s asw l.~so 1..,11t.lao sssasw ca l.a.. s..~e, t.os, t1s aspc l.lrr l..ts1l.aat sssa:w o a.so1 t.ltr ..trs sss aswce a.eoe lasso t.~o.

sssasp cc s.lro la.,ot l.soo sss aswo01 a.sts la.eas-e.ss.

sssvs~ ~o:l..s. l,.ras e.ss: ssa tw w a.,ss ls.saol.a,s ssam ca a.ast lt.ss, ..r,e ssa tw c l.ltt ls.ltel.sls a ssatw o l.t, lo. a.tst ssa tm ce l.tos ls.reol.seo as, ssam cc t..rs at...t a.lao s1a t~uco 1.1r ls.rsla.t,e a ssatiu oe1s.,.. l..ttt l.lst ssa w ott l.soa l...sa~.sw a ss,em ~ a.sor ll.os, ..tt, ss, tm ca ,.loa r.rlt v.so, ss,m. c a.sos tl.att ..sss ss, tw o l..sa io.l.a~.eos sssra ~ t.s, t~.,e~ l.llt sso tr cc: e.o,r ts.lral.eso sso,~~ oc1l.,o, ts..r, a.tl, sso t cs ,.sa. :s.l.al.tra sssr~ c. asst ta..s, o.,ot sls ~~~c a seo :a..lot.ss, ssot~ o a..,r t,.lss t.r,~ ssr t1a~ l.lso :s...sr..r, ssr1ta oc 1.ss ts.ro. so.sts s1r 1erce l.a~s ta.sesl.tlt ssrsee ca ..lts ts.tso e.oss ssr s~~c ...r. 1l.,toe.
H

ssrlea o l.ssr :~.te~ l.eso sao t~ r s.l,. tt.r Less "

saot~~ ca l..s. ts.lo. l.ors tao t c ~.a ls.o.sr.e saotw o ..leo ts.l:a a.sss sas oe~w l.lts lo.lsel.ssa sattea ca t.as. sr. ,.os. sa1 leic t.a " o.,eo a.~oe ", sat1ta o e.ara to. l.lar sas teece 1.1. te.trs,.t~s l., sat1ta oc s.ls. sl.eto a.oos sat lei~ s.les a Ø1r..sr setlea c. e.sa, tt.zts r.sm sat lers o..so ts.rstl.o.o satsee o s.s~f tt.e.o s.lr sat 1e c1 e.tss ls.aaal.t.t satlea oc t.so :s.or1 e..oc sat leaw e.a,r ll.rtll.sr, satlea to -o. ass t.,so l.rro sas 1tec l.a.s :a.s,ra.oss satssa o s.ee la.s.o l.so. sat 1tato s.lro l..a.tl.tss satlea oy s.rrt ls.,so tats sa r~ w o.loe la.rstl.es:

ta.t~ ca e.aor 1l.s.o ..1st sa. ta c l.sos lr.toal.sr ta.ts o e..ss lo. l.t~e ta. ,~seo l.ers lo.ssoa.elo set sa ,~~ ocst.re la. tart sa t~~cct l.tr, =T.asoa.oe1 tot taerat r .e1 le.,.t t.iro tar ratc e.ler 1r.lt 1.110 sasray c t.eoa ea.s.s f..r, sas r o t.rtr le.sstt.toe a 1~4~~~0 Iettatce s.tle te.et e.ses 111 w c -s. H ~~.~s, -s.
a t t setew cct -o.tsc t.ts -o.w s1. ~w ~ s~se ts.ets s.ste sw ~m ca t.e.s ~t.l,es.et s1 << c -.eee ~t.em e.es, se ~i~o ..st. tt.se.-e.te set t,.w t.ee. tt.tte e.e,e s1tttec. -l.t:~ t..e..e.sst set t,.c -t.eet tl.tee -e.ee.

te1t,ea -e.. t.tes e.ee. sat t11ce t.111 ~.tet e.el t.

t1tt,ecG l.te1 tt.ll.I.tee se, t,1cDi 1.111 lt.tlt t.., f111t ceJ 1.110 tt.ll 1.1t1 11, 111ct1 l.tlt tl.etl 1.111 setttecet e.ee tows s.eo1 t1~ trec: e.e1 te.ets t.e..

sett,ee~ -e.eec tl..est.ele sae ~.ow -l.teo to..ee .s.eso 111X10cG N.1.) t.It1 t.lte 111 ~.Ot0 .ttt i1.11t t.It set~tcce .t.e. ts.l..t.so1 see ea ca -t.st. t..tt -t.e.o s11Leoc -e.tle ts.IS -t.tto see Leoo t.ee1 tt.tte t.est setm ~ -s.ee. ts.sel-t.see s11 ~w c~ -..1 tt.e,1 -t.ett s11sw c ..lst to.tost..to s11 ~m o -a.eeo =e.tts -a.
t1 stoc1sr -t..ot so.It1i.tl1 sto ~xsc~ t.eo ~s.tl1 -s.tls sto4,sc t.ess te.tm -t.ISe sto it10 t.toe a.te. t.t:

sto" ce e. t.. tl.te e.tt. sto ~~scc t.tes te.sel e.tt1 s s1os,,sco e.tlo tl.se,t.ess sto w ct t.lts tt.tls t.et1 s s1os,swt -..ts, tt..s t.tss sts ttew t.ete te.esa t.s.e stsxw ca .Loss tl.o.s-t.el, sts t,.c e.les te.tee -t.sst s1sx,ea -1.1.o te.,s.s.ete sts ttece e.elt to.tt. ..tlt ststtecc -so..It to.ee t.ot s1s t,.cas -ss.llo so.tos s.ees s,st,ecas so..l. t:.tt .~.o: sts t,ects -ss.eto ts.eas -e.
e, s1srm ce: -so.e.s ts.oel-s.es. its w ct -ss.tte ~t.tse -e.te.

s1st,10~ -st.eoe ts.ssee.sto ttt eeow e.tet :t.te. .t.tt.

s1trecc. -e.ol1 t...s,1.s1. stt ~toc -e.tts =t.ste t.ee1 s1tyeao e.tts te.le..e.ees stt reoce -se. tt.tte -e.tss set sttyeacc so.loo tl.:ts.t.ee. s1t ~w co so.te. =e.lee -..ts.

ststt1~ .so.llt te.srte.ose sts /t~c. so.tto te.ese -e.tso ststt c e.o:s tl.l,se.sl1 sts te o -e. e te.tts -se.t.t s,sstyto ss.s:e t1.:~ -e..es ss tt oc ss.tls te.t1 -e.o1 s,.1.4w -e. s.: te.e..1.1s st. ~w c. -t.lls to.ees l.els s,.1w c 1.11. to.sss- e.e.1 s1. Srio -test te.slt e.
t..

st.~m ce -1.e11 ts.lls~.t1 st. ,raytas t.te tt.111 .t.lsr l1.1W cc: l.:to tt.so7t.lll she !lt~ l. ell te.tte e.eer st1tiecv -t.1.1 tc.slvso.o:. s11 :vtc .t.ts1 to.tsl -e.w.

st1tito -t.. ts.ele-t.ess s1s m ce t.est ~e.tJ1 ss..se so t st1sitccs - test te.vtsst.s: sts titcc: s.vss ~e.em a s.tst s1sseeces -t.el: to.sslst.e. st1 mr r -t.tto to.ete -t.ete s, a~.c. s.tss ~o.sste.eto sta ma c e.sto te.tes l.tso s11aw o e..ss tl.tsl-l.ese s11 w ce -s.ete te.ese t.t.s st,1w r e.e. ts..sot.seo stt ~w c. t.tes ts.tl. .t.el.

st11w c t.tts ts.els-e..ls st1 ~w o t.ste tt.elt -t.tts s 1w ce t..s, ts.eote.,os st1 ~ ccs t.et tt.eet .e.tls " n s1,~w cc: s.tt. tt.ss:-e.es ste tm w 1.e11 te.el. l.tle steim c. s.sle ta.los-I.ts1 ste svrc 1.... ts.tts -e.
et.

111~l~a 1.111 t1..111.t11 11e lL w t.tlt tl...l t.tet ste1m ca e.tss t:.ost-e.es, str al.c r.st1 ts.eel .s.t,e stew c so.sel te..esv.,sv s,e aw ce vets tt.tls .els seow w se.lre ts.svs- lees seo ~w cv ss.elo ~e..et l.ees seo1w c st.e.e ts.lest.s,s seo ~m o sx.tst tt.ew .l.esr seow ce st.ets tl.ss -e.s1 seo ~w ces ss.tts te.tss -t.ess seo~w tct ss.e,1 to.stee.loo ses es r s.tet ts.tos .e.eoo ses1s c. sl..ss s:.soe.1.e11 tes as c se.e.t ts.eo. -1..:

ses1s o st.tse ~s.evoe.tet Ies 1t ce s1.. ts.ets -1.1s.

ses1s cc s~.sto ~o.es..I.e,s ses asrors st.sel te.tll e.lts ses1s oot st.lec to.tl..ee, set to.w st.ee tt.te. e.et sette c. st.ss ts.ts -so.ses set tt~c t1.s11 ~e.es, -se..e setteeo se.ss to..ss.ss.eto set teece se.ete tt.tss se.

settt~oc sees. t..1s se..ts ses tt ~ se.tll te.e.t -e..ss littt~c. 11.11. 11.11 1.... set itsC tt.lll i1.1. 1.1t sestt o s,.el1 t..st e.tlt ses teece se.tte rte.tts-e.eot totteroc :e.oee ie.ese o.sls te ate r la.otl :o.oe. e.ees tt.t~ ca le.s.. ot.lst .e.eeo se. atr c l..ets ta.tso e.st to.at o u.stt :e.ttf o.et le. ate ce to.os. sa.os se.tss te.ae~cc s..e~~ t.fee -s:.ot se. ate e~s t.too =o. -ss.stt se.

to.ateros le.tt: :~.sso -stet. tot ttr ~ tt.e.s a.t.t t.set sett c se.tt t.r1 e.ett sot t~~ c s..teo :t..e. e.ses tootaro l..ste te.tsl .o.lt sot t ce tv.ow ta.ee o.ses tettw cc se.tl tr.ss t.rs. stt tm co te.ess :r.ses -o.se1 tottw ots se.el. if.tw ..IS i11 ttw rtt tl.t 1.11 s.w.

se arc~ le.ste tr.ett ....e se aec c1 lt.ses =t.tt. -o.es serarcc ss.teo :e.tli -:.e11 ser uc o sl.eee te.te. -t.eet seaarcce ss.tst er.e.t -l.ss toe atc ca se.ts =t..ts s.sas t11arGco e..t ll.st~ s..t te1 arG ~t e.er ia.lll I.ttt so arccs e.e.s ~.tt~ s.et sot rrt r~s e.llt tt.oeo s.eee to artr~: so. :.tss stet sot u1 r s:.te eo.ee -:.ets e lotW c1 l:.t: ei.o1 t.oee tet W c it.tl: io.re. e.tlt totam o ss.stl ~o.o.~ .o.let set w ct st.s.. st.es t.
t..

soettrr slots to.tto o.o.e soe tt ca ss.ets se.se s.oae seettrc ss.ltl ~o.e.t :..ss see a o se.t.o oo.sss s.:ss seett co st.tt to..tv ~.vle soe ter oc s.stt ~s.o: i.e.s set~~er so.e.t es.oso s.et se ~e c e.eet es.aee =.ISI

sev~~~c e..w a:.set s.eoe see ~~e o t.eet ~s.tt t.ess sef.t ce e.tet o..sst :.tt see ~t cc so.sst e.ee o.ert lof~t cas e.s.t m .ego e.sss le ~t tot ss..se ~t.ss o.ot set~~eces e..et tt.set -s..ss see ~~t cts ls.te ~e.e.t -o.tes set~~ecs se.te el.tel -s.tse tea ter r e.tol es.es o.~

seote ca t.a: os.eel e.tes seo ter c a.e1 ie.ses o.lse seottro t.el oe.ees o.e seo ttr ce e.ses ~o.wo -1.
tee seottroc t.sl1 ~a.~st :.ese tes ser r e.tee ~e.ets o.t:s sesttrc1 ..t.s i.f1 e.eet ss tt c L :e.llo o.tsl srs sestt o ..t.~ :e.sle -o.eet ts ter ce t.est ~o.~ss o.ess seste oc t.tst ts.set s.et. ses a r e.tt tt.lso o.se a ss ~w ca ~.st tt.et: e. s ses ~av c t.se :e.ss o.te1 sesai o s.etf tt.eet s.lee ses ~w ce .tes te.sst s.eee m: ~w ccs .s.. :t.t:t e.tss set ~w cc: a.ast te.so. t.ee:

s1 tlt~ l.ell =.11t e.e.t t1t tl1 CI e.It1 :l.e. e..lC

settm c o.ots tt.o:~ o.eos sel im o o.seo tt.:. s.est te.~e:r -s.o:~ :s.sef e.t:: se pro ca -s.r: :s.ets .s.ett st.~tcc -t.stt ss.rot s.es t pro o i..os t:.s.. -..tet te.Leoce -!.te to.te7 -i.tlo le. fro cf. t.tsi le.e:i l.llt se.proco -s.st ts.es. e.etl see tw w .t.oss :l.tel -t.vsv sett~uca -~.s.t =.eto -l.sts see t~u c s. te.ets -I.ett eel sett~uo -s.ts s.see ..el se ttu to -..t.t te.te .:..to settw cc -..e.s ts.st -s.lt st tm co -..tst t~.wo -e.seo st tm ets -s.sso s.wc e.set mt tm ots o.seo t..eso o.tet servev~ -e.t:e :t.s. t.tto ser ttu c1 o.:vs te.ese .a.

se ttuc e.sse tt.st -e.ote set Btu o o.lot o..sss -a.sel le ttuce i.e.o :t.ttf t.ee se ttu cc =. ito=e.ste -..s te vtucos t.ttf ot.ts ..ele se Btu tot w st te.tss l.ess tett r o.s.o :. set .t.eel 1t at cr o.el: a .tt. -e..eo setal c slot st.tst e.oet set at o s.ett s..tl. - e.es setat ce s.et t.tve e.ses let at cc -s.. se.lts .e.e.e o set1 oas s.eo. tt.sst l.tt. set at oD: e.ott :t.lst e.eee seem ~ t.osl o.eee -e.e.. te ~w t1 t.to t.eto -se.sev leerm c v.stt :t.no -e.ts see wt o e.tes oe.we -o.oet them ce :.ee. tt..t1 ss.ast tee ~w ccs l.elo t.ts -ss.ott tee11~cts t.tst te.ese ss..e ~ ~tt r ou~t1 =t.es se.esl teerttc1 a..le :e.oo: e..re se rt c ~.o.t te.eso .se.ete te yeto a.re1 te.sse -ss.tet sef rtt ce ~.o ot.eto e.ett te1~ttcG t.elt s.e1 1.111 tee tt tD t.tee it...1 e.
e1 leeyetcl o.sst tt.tte .t.eet too am ~ t.te eo.e.s se.set ieoa~1c1 t.s os.e:~ ss.eot too ail c tote ~s. .se.tts geea~1o e.s:t et.ot. -e.eo :ec a~a ce a.els f:.ote ss.te ~ ~~+~ X80 tes 11c~ e.et1 ts..1 -se.els tes 1esc1 ss.euf ~.seo s1.t11 tes 11oc se..so f1.1t1 e.IS1 =el 11ca e.ete w .el, e.lls tes 11oc1 u1.111 t1.1:) ss.leo !el 1tccc Is.ft ~.e.e si.l,1 tls CIOco e.l.l ~f.It1 s:..es toi cL,r se.e:o ~s.:l. I.e~s =IS m c1 ul.,s w.lo. -t.el. :es ~m c su.elo ~.w1 e.lss :o: ~~,o ss.)1: f,.ls ...e,l res 1~ ~ u:.esl ~l.~e~ -1.111 :es 1~ ca ss.e.1 w.vs1 -o.ts1 tel w c I.te1 tl.es, .1.11 te1 tavs .lil f,.,l1 -t. ell !ei trvtt 11.11 11.111 1.111 to) v1~ccl s1.11 ~.so1 1.s: =el m ccr sl.e,l ~.t.s .e,1 to. 111w t..lls 11.11: s.lsl te sttca sl.l,t le.tll .e, :e cltc ss.oll 10.11 .t.l,: to1 e1 s ul.tel e.lls 11.11 :e. et1c1 u,.le, 11.1,1 ..fs1 :e It10: u,.Ist 11.111 -1.1,:

to! sit~ ul.l,s e.1s e.oo1 tos tiect ss.ell s.ts. e.:ss te1 sitc us.:o1 ls.,l 1..11 :ol utto u!.,e 11.11 -e.1.1 :es m c1 sl.lss lo.ISS .e.11. =es tvlcps us.lel ~o.fi -e.elo t tos m c: uo.111 l.:Il -so..l, tos t~lcol s:.:11 ie.ls: . ms :01 ~w r ss.lsl i.ols uo.111 :e1 ~m ca sl.:e. 1.11, se.lf.

:01 s c m .oo: 11.1,1 is.fo :01 cw o s:.11 1.111 us.l:l tot cm cl sl..ls l..to1 -s1.11o tot cl.rct :1.111 11.u1s se.elo sot cvrco st.tls ls.ls -so.oo, =01 carols tl.f:1 11.11 e.fss le. cm re: sl.ssl .slo e.IS, sto, s11w st.fel 11.1. ss.:l.

:et sttca s1.:11 11.:,1 sl.elT tet fetc ss.ell le.el) -ul.tle to, st1o ul.11 11.1s~ -ll.oo. tot s11c1 e.es1 ll.ISS 1:1.:11 :o, setoc e.els ll.osl -st.ls =ol titw so.es. 1.11. sl.asl tot 1~1cc: o.s,s eo.s)1 sl.,s. =ee t~ oal t.e,o 11.11 -ss.sl.

:e1 ,w c1 e.l:o eo..ss ss.ssl :ol ,~1c1 ~.em ee.els -s:.sls :e1 T~1c e.sl1 eo..el -solos tot t~1o e.l:s le.eo, se.l.l !ol Btu~ e.s1 el.sf ue.l:1 :el vtuca .11: a:.ls1 e.ISI

tol vtuc e.l,s ss.le -e.:: tel veuo e.ulo ~.:s1 se.::s te1 revc1 so.fss es.ll: -t.ese tot ieucc ue.eol fe.ell t.11 tol ieucol ss.11 1.111 ..ts !el vtuco: e.eo1 ~o.:IS -1.11 t1C 110w t.TeO e..l)1 e.... !le 110C1 t.l,! el.esl 1.111 Ilo 1toc e.sls el.sTS -e.sl :so 11co e.les 11.11: e.le.

tso 1w c1 e.fo: sl.TSS .t.ll, tlo 1eccc e.oo1 fl.f,e e.
e..

=l0 11oco t.ss es..1 1.:I1 tls s~ w e.e,t st.1s -e.sll :11 cm c1 e.el1 ee.,s I..lo tsl cw c ue.el el..s. -s1.11o tll c o ss.s~1 el.ool so.tll tl: 1s~r .111 et.lle -sl.elT
"

tls sw ca solos et..:: -st.l.s tls es~.c x:.ell sl.,ls 1::.111 tl7 asp0 11.111 el.lil 1l.1t0 !tt a~,c1 es.=t1 1.111 -11..11 tl! fw Ct 11.101 11.11! 11.1 lt 11~C~1 ll.el) et.le. -slit!

:1: 1s~wo: s:.:~) el.ssl -ss.stl tss ms w is.eos el.l.l ss.:., els m c1 I:.ISO I..e.1 -uo.ssl tls ms c a:.e el..sl 1.111 s tls GIso us.tls ff.oll s1.11~ tss ~,sc1 a:.t1 ~s.:ll 1.111 :ls w cc ss.sol e1.l. .1.111 :11 ms co us.:1 fl.eso -t.ss:
s :1) m ct s.s~s sl.sll .e,o tll ~,s~s 11..1 te.tos I.esl s :1 111~ ss.lls s:.IOi -uo.... t11 t11c. m.lo> >1.:11 se.lss :1. IIIC 11.11 e0.C0 1.11 tl1 1T1p .11.=11 es.l1) -I.IIT

=l. 111c1 1..1.1 10.11 -11.11 tl~ 111C: ;11.11C 1.111 11.1.1 !l. 111cal 11.11 el.l, -1:.111 11. t11CD! ~ll.s~l el.elf 1:1.11 tl. 111ctl s.:so ei..l1 :1.111 ts. t11ces s1.1 es.11 -ss.l,1 tl. tItcs s).to. et.els il.lso =s. ,110~ s:.IS1 es.111 11.111 t11 ilt~ 1..111 1e.1, 1.11 ill ti,to 11.It 11.11: t.eol tl1 cv,c sl.lse t.stl .t.t.e tss s~,a ss.tll 11.e1t -e.l:l t11 l1 w t..so 11.1 . ell !11 l1 t1 11.11. 11.=01 1.111 ts1 w c ss.ll: 1..1:: I.ISS ts1 ~m a ss.e.1 ls.s:, ....11 !11 ~a CI 1.111 .. If. e.el, =11 111w lt.tel II.IIt 1.1,1 =11 111C1 11.11 11.111 4.110 t11 IIIc 1:.111 ls.It1 l.
e, t11 tttp lt.lCi s...= e.1 =s1 IIIC! 11.11) e. ell 1.111 tlt 111cc so.ls, 11.:11 l.:s =11 t,1cos ue.111 10.11 -s.:11 tl, t11cos .011 11.ss I.IIS tl, 111cll ue..ll 1t.:1, u.leo l1, 111Llt 1.l. lT.ti1 1.111 tl, t11(t 1.111 11.11 1.11 :l1 111p~ e.1) 11.110 t.111 !s1 sw ~ 11.110 1.111 1.11 :s1 sw c1 u1.11s fl.l.s -s.t:, tll 1s~c uo.tel ~l.s1 .:.111 1 34~ X80 tsrs~ 0 1. n7 ~o.r., -s.11 tss rt t1 tt.ess Il.so t.ls.

tstat tc t..e71 sl.s t.7.t tss t ool t.ist ol.tel t..tt tsoasr rot s.o I1... s.sls ts1 itsr l.ete Il.ss. ..ts1 tt1ilt t 1.1t II.sIt t.11 t11 eltC t.It lt.tl. -).111 ts1ill a t.t7 I.lo: -..tt tto tw w ~.sw Is.rs1 t.tls ttotm c s.1t Is.ll. ...1t1 tto tw c ..et1 It.i.. ..s..

ttstar o ...st I.t.t -r.lss tto t~. ..ots e..os1 ..st1 ttt~f il 1.11 11..7 t..11 tt0 t~tCGt i.ti. II.il1 t.111 ttster r ..tts ts.tsl ..7c7 tts tt1c t.ls. Il.tol -t.sl1 ttstt1 c ..tvo t1..s r.sss ttl tee0 ..sst .e.to1 -t.ttt ttlit1 ct t.sss .o.7ss ..s. tts itroc I..7s ..tst -I.s1 itt~!~ r 1.CW l1.f11 1..f tit ~!tCt i..ts .t.Ttl 1.11) tttrtr so t.,1 ls.ssl -..11s ttt ~ttcc e.so 11.111 -r.ot tttret c1 i.7ss .o.oss -t.tss ttt rttc. r.11 t1.to -t.71 ttt~tt c ~.ttt ts..7s -.st ttt rtto t.es It.st l.tts tt7rl. r r.ss. tt.t. -e.1.1 tts a cr i..rs I.oto -t.tss r ttsrw c s.too I.e.s -l.tot tts al.o e.ls7 Is.l.s -so.ltl ttrl. c1 r.so1 I..sot -t.lts tt. st r ..ot el.t.a - s.ts1 tt.te1 c t.tss t..ss -s. too tt styc t.rrs It.ss -ss.ssl tt.tt1 o t.s.s t.sls st.ost tt a cs s.tos I.11s -t.os at.tt1 oc e..lt I.s11 -l.sst tts repr t.ss Is..ss ls.ssl ttsrra c. t.tls I1.17o 11..71 tts ~e:c I.t. It..1 -s7.t ttsr1o a t..o Is.so s..to. tts reocs i.es7 .i.sss st.el.

ttsrrc cc ...ls .o..ot -so. m tts rigco L tIS tl.tt -so.ls tt~its r ..t1 tt.: -ss.tll tt assca e... I.st1 s..tt ttv~:s c ...ss Is.l.t -ss.ow tta m o ...ts ts.lol .s.tls s tt.ass cs r.loe t.e.r st.ts tt ~:ttc t.ts Il.ss1 s7.ISs tt~m ros i.l.s It..s -st.lto ttv itscat e.tsl tt.sss s..sw s tt.its c!s l.tta w est -st.ts tta ~:tret e.tts tt.t1 -s7...s tttval r I.sls Is.sl. .s..111 ttt valcr t.sss t.7s1 -s.ttt tttv.l c s.a1 Is.slt ss..ts :tt wl o s.iss t..tt7 .s..le tttw.l c1 t.sC) tt.... 11..11 ttt arttcl 1.1t It..tr s.t ittvrl tct I.ta. It.rl1 11.111 ttt alrr l.io7 I.it -i..tf.

st1alr c. i.oss t.si1 -ss.sst tts am t e.s.s It.sss sv.w s ttsal. o -t.tss It..ss -st.sts tts al.ce -o.7et Is.rss -1...1 tt1il r s.tls Is.ets sr.l.s tt1 ilttr t.7st I..os -ss.tll tt1ilt c t..to It.slt sl.lst tt1 clvo t.ss1 It. -to.7l.
Its ttcrm w t.tss ts.lss s1.1. tso am c. t.tl. I..sos -m .s.1 t7crlv c t..t I..soo -to.sss tto rlro t.sso I..tos .ts.7.s t7cal. c I.tls It.t. -ss.tol tIS alrr o.7ss I..rt7 -s1.7t1 t7srl. c. s.oso I..sv -sl.t.. tm aw c -s.ts Is..ts -to.rl.

tmrl. o s.lo1 Is.ssr ts.sst ts al.c1 s.lst L .r.. .ss.s1 1strl. r -o.tts I.st -tc.tts t7t rtrtr s.ess tt.s ts.tlt 1strlr c -o.tls it.ts. -ts.ots ttt alro -o.ts tt.sol -t..sst 1stal. c -e.t.t Il.st1 ts.stt tss tiur l.lis I.tt1 11.11 tssltu ca t..st Ir.tl7 t.to1 tfs ltuc e.sts Is.sr1 t.tsc m ltu o e.1 Is.tsl -tl.sss t7s ltuct I.o7 Is.stt -ts.lot s 177ltu tc 1.11 ..11. 11..11 tt1 ltutel 1.111 .l.t 11.111 tIf4tu Cot ..t.i It.sl -t..IC tI. TLtr I.tlt f.i11 -t..lt ts.tl! cos e.7o. Io.ll -ti.vst t7 ll!cil e~.s. Is.tts .tr.ses tt.tlt cs e.sll It.os. -t7.sto sI tltcct -s.tos to. -t..sl1 loo tstl! ca -o..o~ It.et1 t. tt =lsc s.ttl I7.slt ts..7.

tt.tl! o -s.sss It.s.. t.s.. tss Btur -t.7lc t..rs .t.

t~sltv c. -7. Is.ot1 -ts..ts tts ltut -s.tss Is. -t.rtt s1 s.7 tssleu o -..so1 s.11. .tt.ssl t7s leuce ...st ts.ts t..sts tssltu cc -s.s.o L .s11 -17.7.: t7s ltucos s. at Is.1s tt.l.s ts~ltu tot .tst L .sss t..sto t7. 1!~~ t.el Ia.ss t..
m ts.1!~ cr -s. It.tst :t.w~ tw seec s..11 I.tlt .tl.s..
t.

ts.te1 0 -s. .rs. 7o.tlc tt st1c' i.rst Is. .tt.tss t. t7.

tt.it1 eG 1.111 It.sts -11.11 tIt L,tr t. l. Ii.elt -11.111 1stlvs c i. e.1 L .oss tl.ls: ttt ms c -t.sss 17.111 -7o.
t1 1stl,s o t.lts at.lsl ss.... 1st l~sc1 e.ttt I7.slt -tl.ssl tttwt cc e..tt It.t.c -IO.ts. 1st ms co t.oto Is.sss .IO...t 111m ct l.t.s lo.tli 1111: Ift ws ~s L 11s 11.111I1.s11 s 111wll r t.ISI 11.111 11.11" 111 ~tiC1 1.111 11.11 ll.ttl 111ass c -I.sl. Is.111 11.11 ts1 wslo - L tl1 sl.se.-:1.111 ifewsi CI 1.1.1 Ie.lll 11.11 111 r1fCi 1.111 11.11111.111 1stass rDil. tot 11.111 II.IIS Ise wslcos l.lf1 tl.IS1se.sl.

Isoass 1 1.111 I Loll 11.1 110 ass~t: 1.1.1 11.11ele.sll 111IO r 1.1.1 11.111 11.11: tl1 o ca .111 ~..tt1-lo.ttl 111CIO c -e.:o. l..cs Il.sss :s1 to a -1.1.1 11.:11-1111:

111e0 CI -t.el1 11.111 11.117 111 ItDCC .11 11.11.11.111 ll1110 CD 11.11 1..11 IO.11 11e Isrr 1.111 11.11111.111 110aew C1 1.111 lt.ei 11.111 11e i~ C 1.1e1 11.11eIt.lle 11erIr o 10.110 0.110 11.:11 11o aspce l..el 11.1.1lo.sss l.ea1r cc -1.111 Ic.111 -so.111 !1D IIwoal t.ee1 Il.sla)111.1 11oasr rost.tc ll.IO1 fo.lw =1 tIrw l.ss. 11.101-It.le l.!ttr c l. lo. lo.ls .1l.l:c 111 ttrc l. let lo.tsl11.111 l.ittr o -1.1.1 11.11: 11.11 1.1 tt c1 -1111 11.1seIS.lt1 t.!ttr cc -.01. 11.1os 1.ss1 111 ttrcol l.slo :1.11111.111 !i ttr totx.111 11.11. -ll.llf 111 ttr~t! e.11! ll.Ia 11.1:1 1.1ttr CtI...1. 11..11 11.111 111 ttrCtl 1.et 11.1111.111 l.!ter css).11s 11.111 .11.11. 111 ttrcss -:.111 :1111 1..1.1 l.!ttr Cw!l..te 11.111 il.eel 111 twtr 1.111 11.11111.1.1 1.1Twt C1 11..f1 .111 11.11 !Z thtC 1..11 11.11111.111 i1 twt 0 1.111 :1111. 11.111 111 tt CI 11.111 11.11!11.111 ls twt oGi-1e.11t 11.111 11..11 l.s twtccl 11..1. 11.1otIS.lls ll Ilr r -1Ø1 Io.IS1 10.11 111 esrCol -:1.111 lo.le.11.1.1 ll asw oo!111..1: 111111 -11.111 l1s sr cc l1.e11 Ills! 11.11:

l.stsr c1 l.to1 Il.sso sl.sss l.s Isrc1 .l.ISS to.tss11.1..

ll 11. c 1.111 ll.sc~ .ll.olo !.) Isro -1.111 11.111-11...e l..twt ~ -11:11 11.11: -11.111 l.. T~tc. -~.t11 :v.ls.:111:1 l..tit C -1.611 11.f11 11.10: 1 t~110 -1111 11.11111.111 l..twt c1 l o w ll.osl -:1111. _. titoGl 11.1:1 1. -11.11.
s Its l..twt cc:lo.sol l.svs -ll.lse 1s tw r -1. D1: 11.111Il.etl 1.1sir c1 -.11. 1.11: :1111: l.s sirc -1111 It.l:oIl.s:o t.1sir o -11:11 111:1: 11...1 11s sm to t.sfo =.111 11.:11 l.ssir cc -1111: Is.s:~ 11.111 l.s ~~rco -1.11) 11.11)IS.1:1 l.ssir oe!1.101 11.111 -IS.tst l.s iw ~tl 1111: 11.11:.t.sto 1.1v1~ r 1.111 Il.lo. 1:.111 i1 v1~c1 -11.11 tl.o.olo.tto 1.1vw c l.os1 It..1= -11..1 111 vw o I.to1 11.1:111.e11 1.1~m c1 1..111 Io.ss1 -lo.lsl 11 vm cGl -1.11. 11.:11.le.lst 1.1vu cc:1:1:11 Il.s)1 -11.1:1 1t Itcr ..t1 1l. 11..11 l.0 l.twe c1 -..slc It.tl. 11.111 1t ttac l.tto 11.111-st.s.o l.twe o 1.101 11.11: 11.11. 111 we c1 -l.ISS It.wt -11.1.1 l.tatG cc -1.111 11.e1s 111.1:: 1.1 we co 11.1:1 11111111.111 l.ttG rE 1.e 1.11 11.1 t.t ItCCl -1.111 11.11111.11:

l.tme r~l.t.ol. 111.1 ll.slo 11 we r~l 1:.111 I..so lo.lto 11 tt r l..IO Is.los :1.111 1.1 letc1 11.1:1 111::1111..:1 11 itt c -111:1 11.011 -11. 11 itto -1.111 I1.s1111.111 e1!

111Itt c1 s.os. Il..o1 111.:1: 1.1 seto. -1.111 Il.olc111.:1:

1.11tt r I.ICD I..IS1 .IC.111 111 1ttC1 -1. Ill 11.11.11.111 1.1tet c o.otl ts.los 11.1.o s.1 Itto : a l..tos-le.e.1 1.1Itt c1 -11:11 1:.111 -I1.o11 t1 1ttec l. see Is..l1.11.111 IIO~eu r -l.so1 1.111 s1.1o tse ~eucDl 1.11 11.11.-1111::

ssoBtu co!-o.ltl )o..s~ -lt.lo 111 ~eucc e.fss 11..1111.111 IIOBtu c1 L s11 II.ol1 lt.oes Iso veuc1 1.111 ll.ost:1.111 Iso~u c l.ols 1:111. -11.111 Iso Btuc 1.111 Is..:!-lt.ols Islm r I.ol1 Is.lc1 1.11. Is! svrrES -l.tso ::1111-:11:11 r Is!sir ot!1.111 Il..! 11.111 111 tw Co -I.I.s 1.11e -ll.el Islm cc 11.:11 1..11. -:1111. Isl sw c1 11.1:1 Is.lsl1..111 r 111svr C1 1.111 11.1.1 11.1.1 111 i~~C 1.111 It.ll.1.111 le!tar o :1111 ll.ol 11:.11 t1s tsrw s.es1 =1. -11.s1c s1.

111ir C1 1111? Il.to1 11.111 111 tlrC 1.11. 11111111.111 111vs~ o t.lo1 lo.s 11.111 t1s alrco 1.1e. :I.too1:1.11:

Issvs~ cc -1.0)1 11.1:1 111.:1: 11s 1swoo! 1.11 ll.ISS-111:1:

tsxisr ~o: t.tx 61.16. .61.11: :sx tear i.et1 tt.le6 61.1x1 t6xtm c1 ~.ts1 t:.ttt -61.:11 tIx tv c e.xlt tx.:lr -:1.111 t6xti 0 i.x.1 tx.rxx -11.1:, t6x t~.c1 ..~11 tx.it: 11.16:

sextit eci x.616 t..IS~ to..r1 t6x t~1eex x.111 11.:x1 t:.ex:

t1.tie r e.tl1 1x.11: -1:.661 ts r~ c1 i.tti tx.it: -ti.sll t6.t~1 c t. a1 t:.tao 61.11: t1. t~~o t..ot tt.llo -tr.lls t1.r~i c1 l.ii :x.161 -16.16: t6. tm oct 6.1:1 11.1:1 -t6.o.e t1.tie cc: l.6xo t..st s.lo: ts6 t~~1, e..11 1x.:11 11.1:1 t6st~1 c1 I.t,l 11.61. -16.11: t6s t~1c I.iti tt.oxi 1..11.

tsst~1 0 1..x1 11.:11 sx..t. tss t.~c1 st.ela :x.166 16.11:

166tm oci sl.el: tx.tol tt.x:1 t6s t~ cct 1x.:11 t:.lt1 sl..e1 161~s r 1.01 to. -t..si. ts1 itsc1 1.x1. te.elx -tx.llo to:

161w c so.6:: :c.xst l:.oix tsi ttso x6.11: tl.:~. -6x.11:
s ts1its c1 I.o: sl.sla ~x.tt t1i itscc L e11 sv.lo6 11.1:1 t6iw ca xe.:l1 61.1.1 -sl.vtt t6i ws ee so.ttt s6.l.o 11.1:6 s 161its rt e.:.x 1.111 ll.os. 1st Btur se.xi: to.it. 61.1:.

tsrvtu c1 si.:~: t1.e61 -1.11) tsr ~e~c xl.tso to.txx -o.ii t6vvt~ o x:.ol1 te.6is -1.1x1 tf~ ttue! 61.x1: t:.x.t .o.ltt t6tveu cc 66.x6: tx.ito -se.6i1 t6r ~eucol 61.:16 t6.lex 1.111 t6tveu co: s:.it1 1x..11 -11.x:6 161 im r so.xi sl.:It e.tl1 ts1i~~ c1 so.io: 11.:1x -1.111 te1 mt c L tit sl.rox i.xrx ts1tm o e.tl7 tl.ISi v.to: 161 1s r 1.1:. 61.x1: 6.slo ts11s c1 T.t6t sr.111 ..611 161 1s c o.i61 x1.1.1 l.to1 161is o 1.161 to.oxl -..ti. 111 ~s ce T.IIi st.llo x.osx 1611s cc 1.111 tr.lxl t.es 161 is ool e.itt st.6:s -t.
x6.

ts1is oct r.el1 1.x11 -t.x:1 do st1r l.6io sl.iso 1.x11 do set c1 1.161 61.61, 1.6:1 do x11c i.l.i te.xlt -1.111 do x11 o x.6oc tl.les .11 do x6 e1 1.x16 61.111 -1.111 tiexte oc t.rls tr.Ixt 6...1 til I~er i.tl sl.vtl -x.
ti:

111r~t c1 1.6x1 11..11 -1.116 tii ~~tc 1.6 11.1.1 -t.
lit tiirye o x.l.. t:.1.1 l.x: til ~~1e1 l.esx 61.:11 e.6ix a rye ee x.6.1 tD.xxt 1.111 111 rt Cal t.xoi to.tix x.t:s tiio~e ca: 1..11 tl.olo 6.666 til ~~tcei 1.1x1 te.tir 1.x16 tiieat ct: x.l.s tl.eo: 1.1.6 til ~~tcI t.ios 1:.116 x.111 tittt1 r e.111 11.:11 l.x0f tit tt C1 1.11 11.11. 1.161 tt tti C 1.110 1x.61 x.1.1 tit Tt1a l.tel :1.161 1.x11 ti:tt1 e1 t.i:: t:..s6 -1.161 tit tt1ee 1. t1 11.11: 1..6.

t1:tt1 coi 1.11. :o..i. 0.61. ti: theeo: 1.11 1:.111 e.il1 a: tt1 cei e.ol: 11.6:1 0.11: ti: tticet e.ti t=.111 6.111 titrte ct e.oi1 to.itx t.el1 ti: tteo~ 1.116 te.etl x.tos tixtt1 1~ 1.111 tx.le 11.1:1 tit tt1c1 1.111 :x.166 i.ext t1xtt1 c 6.i:1 tx.ilo 11.:61 tix xti0 1.v11 11.11: 1.111 tixtt1 c1 1.111 11.:11 1.111 tix ttec6 L Zt1 t6.exs 1.111 tixtt1 coi so.ol. t.e.1 11.16: tix tticot L Ioo t:.6.: -1.111 t1stt1 cti 61.1x6 tl.x:i 1.111 tix Tt1cet sl.oi: t:.i.o -..111 titvt1 c: 11.6x1 :x.111 6.io1 tix tt10~ st.ei6 16.1.1 11.61 ti.i~t r 1.111 :7.111 1.611 ti. yt c1 x.xoi tx.el. -1.11:

t1.i~t t x.11 :1.111 1.111 t1. ilt0 ..it Il.It. i.xif ti6~.tsr 1..x1 t:.ltt 11.16. tis itsc1 x.lx. 11.:11 -10.1,1 ti!1tt c e.111 1:.1x1 :1.411 tit ~tt0 1.11. 1:.117 1::.x11 111ktt c1 1.166 tt.e~l -xt.e.1 tIS ltt~c p.llC 11.61: 11.x0!

t1s'ts co o.,io to. -lt.otl tis itsct -e.il: 11..11 1::.x11 s.1 116uts rt -s.ite ta.vsT 11:..11 tit cv ~ x.161 1x.1:1 -1o.11t 111i~t C1 1.110 1x.11: ll.xtf 111 catc 1.166 tf.ett 11.111 t1 ilt a .117 16.11 11.11 tit ltUr 1.li! :6.x11 :.110 tit1!u c1 t..It ti.iio t7.oW tit Btuc t.le. 11.1:1 11...x1 ti,~u o r.ISx ts.lot 61.:11 t1v vtuc1 sa.eio :1.166 -1x.11.

tit~eu ee se..6: tl.ole t.es1 tw Btueoi s l :1.1x1 tx.tse ew titc6u eoe 61.1:. tt.l:1 -l.x:~ tit tutr x.el. 1:.111 11..16:

titt~ e1 i.o1 tl.oxs -16.1.. tit x~ec x..ti 11.1.1 -tt.els ti tit o e.6x1 11.11 1:1.11! 111 ZLtc1 e.6i1 tl.:ie 16.111 tiet.t cci i.el1 xo.s.i -11.11: tit titcc: 1.111 tl.l:s -1..11, tittie toi 1.x11 xi.,w 111.:1: 111 1srr 1.111 11.1.x -tl.:st ot asp ca toes lr.trf -ss..f t1t 1f~C .ft ll.ff.tl..ef 1141i~ 0 e.f.f t.T: te.t! t1 1f~Cf . aft le.If111.11 S1 ei~ tG f.ili ll.fa -li.tlc tat 1f~171 l.ttl ~T.t1 il.fti tet1:~ wo: so.ol! tf.Tt tl..,j tr: ~w ~ a.too tt.olo-to.,s.

=TO1~ c. o.o4f 7:..se t1.11. tTe ~aLc l oft ~o.oe~:o.of.

tTO~a~ o o.etr tf.tlt tf.oT: ~,o taLco o.ef4 ~s.lfots.4::

=TO,aL cc! .o.t :.,t, -:s.of tro ~w cc: 4..:0 t.ol: -tt.ofs t,stL~ ~ T.i:s lt.,os tf.ff: tT! iL~ca t.oef lo.t,o:..f..

tTScLr c 1.ot tT.ts -tf.of! tm t o .tss tT.oo -te.ots tT!cL~ co t.le. tf.:to t..t4 1T1 tL~cc t..e to.lsot.off tTScm co so.to! to.fff :e.fot t,! w ocs ss.o4f to.oTt-7T.fse r tTScL~ ~f: sl.,ot lo.ffs tt.f~o tT: ~~~r o.tTT tl.tttt..oos tT:IL4 c. .t:. tf.Tl: -t..:.~ tT: aLet 4.Tas to.tfo-:..s4 tTSrm o 7.111 tf.fof -tf.oo! =r: am to .T.7 =..T.:ti.sTt tTfaLa ~ ..l.T 14.11 -:f.sff 1T7 ILKc4 ~.o.o te.tsstt.oot 1T71~. c :.of! :T.f:f -:..eso =r7 ILro o.ott tT.lst-:4.:of 1~1 c1 l.T! t~.TT7 ll.ff t1. IL4w =.Tff 51.41.-=.T1 :T.aLa co =.tfl oo.ft! :4.:so :T. u. c. t.sef =t.s..-:o.o.T

_,.1,4 c s.T7o :o.7aT -tr.oto t T. ILro e.too :o.t.ttT.ots =rfil~ r =.110 Il.lt. =1.11 =1f tlwt1 :.1.1 =e.ift-11.tT

trfcLr c t.s.T :.tls tt.TrT t,f caro o.te =T.ooT-tt.ts :Tftw or s.sf7 :.f4i io.st~ t,f tm co 0.11 =o.TO.-to.fso tTfcL. cc o.fa! :..e4 :~...~ =Tf cw to -0.0:i t7.t7 -:T.oi!

tTfc~~ oei -s.7T :i.otf :o.Ta tTO cm rc: -s.sT7 to.4s1tl.ooo _~~_ 1341280 The above structural studies together with the kinetic data presented herein and elsewhere (Philipp, M., et al. (1983) Mol. Cell. Biochem. 51, 5-32; Svendsen, I.B. (1976) Carlsberg Res.
Comm. 41, 237-291; Markland, S.F. Id; Stauffe~, D.C., et al. (1965) J. Biol. Chem. 244, 5333-5338) indicate that the subsites in the binding cleft of subtilisin are capable of interacting with substrate amino acid residues from P-4 to P-2'.
The most extensively studied of the above residues are Glyl66, G1y169 and A1a152. These amino acids were identified as residues within the S-1 subsite. As seen in Fig. 3, which is a stereoview of the S-1 subsite, Glyl66 and G1y169 not identified in this figure occupy positions at the bottom of the S-1 subsite, whereas A1a152, not identified in this figure occupies a position near the top of S-1, close to the catalytic Ser221.
All 19 amino acid substitutions of G1y166 and G1y169 have been made. As wil:1 be indicated in the examples which follow, the preferred replacement amino acids for Glyl66 and/or Glyl69 will depend on the specific amino acid occupying the P-1 position of a given substrate.
The only substitutions of A1a152 presently made and analyzed comprise the replacement of A1a152 with Gly and Ser. The results of these substitutions on P-1 specificity will be presented .in the examples.
In addition to those residues speci:Eically associated with specificity for the P-1 substrate amino acid, Tyr104 has been identified as being involved with P-4 specificity. Substitutions at Phe189 and Tyr217, however, are expected to respectively effect P-2' and P-1' specificity.
The catalytic activity of subtilisin has also been modified by single amino acid substitutions at Asn155.
The catalytic triad of subtilisin is shown in Fig. 4.
As can be seen, Ser221, His64 and Asp32 are positioned to facilitate nucleophilic attach by the serine hydoxylate on the carbonyl of the scissile peptide bond. Crystallographic studies of subtilisin (Robertus, et al. (1972) Biochem. ,~1, 4293-4303;
Matthews, et al. (1975) J. Biol. Chem. 250, 7120-7126;
Poulos, et al. (1976) J. Biol. Chem. 250, 1097-1103) show that two hydrogen bonds are formed with the oxyanion of the substrate transition state. One hydrogen bond donor is from the catalytic serine-221 main-chain amide while the other is from one of the NE2 protons of the asparagine-155 side chain. See Fig. 4.
Asn155 was substituted with Ala, Asp~, His, Glu and Thr. These substitutions were made to investigate the the stabilization of the charged tetrahedral intenaediate of the transition state complex by the potential hydrogen band between the side chain of Asn155 and the oxyanion of the intermediate. These particular substitutions caused large decreases in substrate turnover, kcat (200 to 4,000 fold), marginal decreases in substrate binding Km (up to 7 fold), and a loss in transition state stabilization energy of 2.2 to 4.7 kcal/mol. The retention of Km and the drop in kcat will make these mutant enzymes useful as binding proteins for specific peptide sequences, the nature of which will be determined by the specificity of the precursor protease.

134~~80_, Various other amino acid residues have been identified which affect alkaline stability. I:n some cases, mutants having altered alkaline stability also have altered thermal stability.
In _B am~rloliguefaciens subtilisin residues Asp36, I1e107, Lysl70, Ser204 and Lys213 have been identified as residues which upon substitution with a different amino acid alter the alkaline stability of the mutated enzyme as compared to the precursor. enzyme. The substitution of Asp36 with Ala and the substitution of Lys170 with Glu each resulted in a mutant enzyme having a lower alkaline stability as compared to the wild type subtilisin. When I1e107 was substituted with Val, Ser204 substituted with Cys,, Arg or Leu or Lys213 substituted with Arg, the mutant: subtilisin had a greater alkaline stability as compaxed to the wild type subtilisin. However, the mutant Ser204P
demonstrated a decrease in alkaline stability.
In addition, other residues, identified as being associated with the modification of other properties of subtilisin, also affect alkaline stability. These residues include Ser24, Met50, G1u156, G1y166, G1y169 and Tyr217. Specifically the following particular substitutions result in an increased alkaline stability: Ser24C, Met50F, G1y156Q or S, G1y166A, H, K, N or Q, G1y169S or A, and Tyr217F, K, R or L. The mutant Met50V, on the other hand, results in a decrease in the alkaline stability of the mutant subtilisin as compared to wild type subtilisin.
Other residues involved in alkaline stability based on the alkaline stability screen include Asp197 and Met222. Particular mutants include Asp197(R or A) and Met 222 (all other amino acids).

~34~280 Various other residues have been identified as being involved in thermal stability as determined by the thermal stability screen herein. These residues include the above identified residues which effect alkaline stability and Metl99 and Tyr27.. These latter two residues are also believed to be important for alkaline stability. Mutants at these residues include I199 and F21.
The amino acid sequence of ~. amylolic~uefaciens substilisin has also been modified by substituting two or more amino acids of the wild-type sequence. Six categories of multiply substituted mutant subtilisin have been identified. The first two categories comprise thermally and oxidatively stable mutants.
The next three other categories comprise mutants which combine the useful properties of any of several single mutations of ~. amyloliquefaciens subtilisin. The last category comprises mutants which have modified alkaline and/or thermal stability.
The first category comprises double mutants in which two cysteine residues have been substituted at various amino acid residue positions within the subtilisin molecule. Formation of disulfide bridges between the two substituted cysteine residues results in mutant subtilisins with altered thermal stability and catalytic activity. These mutants include A21/C22/C87 and C24/C87 which will be described in more detail in Example 11.
The second category of multiple subtilisin mutants comprises mutants which are stable in the presence of various oxidizing agents such as hydrogen peroxide or J
peracids. Examples 1 and 2 describe these mutants which include F50/I124/Q222, F50/I124, F50/Q222, F50/L124/Q222, I124/Q222 and L124/Q222.
The third category of multiple subtilisin mutants comprises mutants with substitutions at position 222 combined with various substitutions at positions 166 or 169. These mutants, for example, combine the property of oxidative stability of the A222 mutation with the altered substrate specificity of the various 166 or 169 substitutions. Such multiple mutants include A166/A222, A166/C222, F166/C222, K166/A222, K166/C222, V166/A222 and V166/C222. The K166/A222 mutant subtilisin, for example, has a kcat/Km ratio which is approximately two times greater than that of the single A222 mutant subtilisin wher,~ compared using a substrate with phenylalanine as the P-1 amino acid.
This category of multiple mutant is described in more detail in Example 12.
The fourth category of multiple mutants combines substitutions at position 156 (Glu to Q or S) with the substitution of Lys at position 166. Either of these single mutations improve enzyme performance upon substrates with glutamate as the P-1 amino acid. When these single mutations are combined, the resulting multiple enzyme mutants perform better than either precursor. See Example 9.
The fifth category of multiple mutants contain the substitution of up to four amino acids of the amyloliquefaciens subtilisin sequence. These mutants have specific properties which are virtually identicle to the properties of the subtilisin from licheniformis. The subtilisin from E~. licheniformis differs from _B. amyloliguefaciens subtilisin at 87 out of 275 amino acids. The multiple mutant 134~2go .

F50/S156/A169/L217 was found to have similar substrate specificity and kinetics to the licheniformis enzyme.
(See Example 13.) However, this is probably due to only three of the mutations (S156, A169 and L217) which are present in the substrate binding region of the enzyme. It is quite surprising that, by making only three changes out of the 87 different amino acids between the sequence of the two enzymes, the _B.
amYloliquifaciens enzyme was converted into an enzyme with properties similar to ~. licheniformis enzyme.
Other enzymes in this series include F50/Q156/N166/L217 and F50/5156/L217.
The sixth category of multiple mutants includes the combination of substitutions at position 107 (Ile to V) with the substitution of Lys at position 213 with Arg, and the combination of substitutions of position 204 (preferably Ser to C or L but also to all other amino acids) with the substituion of Lys at position 213 with R. Other multiple mutants which have altered alkaline stability include Q156/K166, Q156/N166, S156/K166, 5156/N166 (previously identified as having altered substrate specificity), and F50/S156/A169/L217 (previously identified as a mutant of $.
amyloliquifaciens subtilisin having properties similar to subtilisin from ~. licheniformis). The mutant F50/V107/R213 was constructed based an the observed increase in alkaline stability for the single mutants F50, V107 and 8213. It was determined that the V107/R213 mutant had an increased alkaline stability as compared to the wild type subtilisin. In this particular mutant, the increased alkaline stability was the result of the cumulative stability of each of the individual mutations. Similarly, the mutant F50/V107/R213 had an even greater alkaline stability as compared to the V107/R213 mutant indicating that ~341~80 the increase in the alkaline stability due to the F50 mutation was also cumulative.
Table IV summarizes the multiple mutants which have been made including those not mentioned above.
In addition, based in part on the above results, substitution at the following residues in subtilisin is expected to produce a multiple mutant having increased thermal and alkaline stability: Ser24, Met50, I1e107, G1u156, G1y166, G1y169, Ser204, Lys213, G1y215, and Tyr217.

TABLE IV
Triple, Quadruple Double Mutants or Other Multiple C49/C95 F50/S156/N166,/L217 C50/C95 F50/Q156/N166,/L217 F50/Q222 F50/Q156/K166,/L217 I124/Q222 F50/S156/K166,/L217 Q156/D166 F50/Q156/K166,~K217 Q156/K166 F50/S 156/K166,~K217 S156/D166 [S153/S156/A158,~G159/5160/0161-S156/K166 164/I165/S166/A169/R170]

5156/A169 R213/204A, E, Q, D, N, G, K, A166/A222 V, R, T, P, I, M, F, Y, W

A166/C222 or H

In addition to the above identified amino acid residues, other amino acid residues of subtilisin are also considered to be important with regard to substrate specificity. Mutation of each of these residues is expected to produce changes in the substrate specificity of subtilisin. Moreover, multiple mutations among these residues and among the previously identified residues are also expected to produce subtilisin mutants having novel substrate specificity.
Particularly important residues are His67, I1e107, Leu126 and Leu135. Mutation of His67 should alter the S-1' subsite, thereby altering the specificity of the mutant for the P-1' substrate residue. Changes at this position could also affect the pH activity profile of the mutant. This residue was identified based on the inventor's substrate modeling from product inhibitor complexes.
I1e107 is involved in P-4 binding. Mutation at this position thus should alter specificity for the P-4 substrate residue in addition to the observed effect on alkaline stability. I1e107 was also identified by molecular modeling from product inhibitor complexes.
The S-2 binding site includes the Leu126 residue.
Modification at this position should therefore affect P-2 specificity. Moreover, this residue is believed to be important to convert subtilisin to an amino peptidase. The pH activity profile should also be J O
modified by appropriate substitution. These residues were identified from inspection of the refined model, the three dimensional structure from modeling studies.
A longer side chain is expected to preclude binding of any side chain at the S-2 subsite. Therefore, binding would be restricted to subsites S-1, S-1', S-2', S-3' 134T2~0 and cleavage would be forced to occur after the amino terminal peptide.
Leu135 is in the S-4 subsite and if mutated should alter substrate specificity for P-4 if' mutated. This residue was identified by inspection of the three-dimensional structure and modeling based on the product inhibitor complex of F222.
In addition to these sites, specific amino acid residues within the segments 97-103, 126-129 and 213-215 are also believed to be important to substrate binding.
Segments 97-103 and 126-129 form an antiparallel beta sheet with the main chain of substrate residues P-4 through P-2. Mutating residues in those regions should affect the substrate orientation through main chain (enzyme) - main chain (substrate) interactions, since the main chain of these substrate residues do not interact with these particular residues within the S-4 through S-2 subsites.
Within the segment 97-103, G1y97 and Asp99 may be mutated to alter the position of residues 101-103 within the segment. Changes at these: sites must be compatible, however. In ~. amyloliquifaciens subtilisin Asp99 stabilizes a turn in the main chain tertiary folding that affects the direction of residues 101-103. ~. licheniformis su.btilisin Asp97, functions in an analogous manner.
In addition to G1y97 and Asp99, Ser101 interacts with Asp99 in _B. am_yliguefaciens subtilisin to stabilize the same main chain turn. Alterations at this residue should alter the 101-103 main chain direction.

Mutations at G1n103 are also expected to affect the 101-103 main chain direction.
The side chain of G1y102 interacts with the substrate P-3 amino acid. Side chains of substituted amino acids thus are expected to significantly affect specificity for the P-3 substrate amino acids.
All the amino acids within the 127-129 segment are considered important to substrate specificity. G1y127 is positioned such that its side chain interacts with the S-1 and S-3 subsites. Altering this residue thus should alter the Specificity for P-1 and P-3 residues of the substrate.
The side chain of G1y128 comprises a part of both the S-2 and S-4 subsites. Altered specificity for P-2 and P-4 therefore would be expected upon mutation. Moreover, such mutation may convert subtilisin into an amino peptidase for the same reasons substitutions of Leu126 would be expected to :produce that result.
The Pro129 residue is likely to restrict the conformational freedom of the sequence 126-133, residues which v:nay play a major role in determining P-1 specificity.
Replacing Pro may introduce more flexibility thereby broadening the range of binding capabilities of such mutants.
The side chain of Lys213 is located within the S-3 subsite. All of the amino acids within the 213-215 segment are also considered to be important to substrate specificity.
Accordingly, altered P-3 substrate specificity is expected upon mutation of this residue.
J

1341~~0 The Tyr214 residue does not interact with substrate but is positioned such that it could affect the conformation of the hair pin loop 204-217.
Finally, mutation of the G1y215 residue should affect the S-3' subsite, and thereby alter P-3' specificity.
In addition to the above substitutions of amino acids, the insertion or deletion of one or more amino acids within the external loop comprising residues 152-172 may also affect specificity. This is because these residues may play a role in the "secondary contact region" described in the model of streptomyces subtilisin inhibitor complexed with subtilisin.
girono, et al. (1984) J. Mol. Biol. 178, 389-413.
Thermitase K has a deletion in this region, which eliminates several of these "secondary contact"
residues. In particular, deletion of residues 161 through 164 is expected to produce a mutant subtilisin having modified substrate specificity. In addition, a rearrangement in this area induced by the deletion should alter the position of many residues involved in substrate binding, predominantly at P-1. This, in turn, should affect overall activity against proteinaceous substrates.
The effect of deletion of residues 161 through 164 has been shown by comparing the activity of the wild type (WT) enzyme with a mutant enzyme containing this deletion as well as multiple substitutions (i.e., S153/5156/A158/6159/S160/o161-164/I165/S166/A169/
R170). This produced the following results:

1341~~0 TABLE V
kcat Km _ kcat/Km WT 50 1.4x10 4 3.6x105 Deletion mutant 8 5.0x10 6 1.6x106 The WT has a kcat 6 times greater than the deletion.
mutant but substrate binding is 28 fold tighter by the deletion mutant. The overall efficiency of the deletion mutant is thus 4.4 times higher than the WT
enzyme.
All of these above identified residues which have yet to be substituted, deleted or inserted into are presented in Table VI.
TABLE VI
Substitution/Insertion/Deletion His67 A1a152 Leu126 A1a153 Leu135 Glyl54 G1y97 Asnl55 Asp99 G1y156 Ser101 Gly:L57 G1y102 G1y160 G1u103 Thr:L58 Leul26 Ser:L59 G1y127 Ser:161 G1y128 Ser:l62 Pro129 Ser163 Tyr214 Thr164 G1y215 Va1165 G1y166 G1y169 Tyr167 Lys170 Pro168 Tyr171 Pro172 The following disclosure is intended to serve as a representation of embodiments herein, and should not be construed as limiting the scope of this application. These specific examples disclose the construction of certain of the above identified mutants. The construction of the other mutants, however, is apparent from the disclosure herein and that presented in EPO Publication No. O:I30756.
All literature citations are expressly :incorporated by reference.

Identification of Peracid Oxidizable Residues of Subtilisin Q222 and L222 As shown in Figures 6A and 6B, organic peracid oxidants inactivate the mutant subtilisins Met222L and Met222Q (L222 and Q222). This example describes the identification of peracid oxidizable sites in these mutant subtilisins.
First, the type of amino acid involved in peracid oxidation was determined. Except under drastic conditions (Means, G.E., et al. (1971) Chemical Modifications of Proteins, Holden-Day, S.F., CA, pp. 160-162), organic peracids modify only methionine and tryptophan in subtilisin. Difference spectra of the enzyme over the 250nm to 350nm range were determined during an inactivation titration employing the reagent, diperdodecanoic acid (DPDA) as oxidant.
Despite quantitative inactivation of the enzyme, no change in absorbance over this wavelength range was noted as shown in Figures 7A and 7B indicating that tryptophan was not oxidized. Fontana, A., et al.
(1980) Methods in Peptide and Protein Sequence Analysis (C. Birr ed.) Elsevier, New York, p. 309.
The absence of tryptophan modification implied oxidation of one or more of the remaining methionines of B. amyloliquefaciens subtilisin. Seep Figure 1.
To confirm this result the recombinant subtilisin Met222F was cleaved with cyanogen bromide (CNBr) both before and after oxidation by DPDA. The peptides produced by CNBr cleavage were ana7.yzed on high resolution SDS-pyridine peptide gels (SPG).
Subtilisin Met222F (F222) was oxidized in the following manner. Purified F222 was resuspended in 0.1 M sodium borate pH 9.5 at 10 mg/ml and was added to a final concentration of 26 diperdodecanoic acid (DPDA) at 26 mg/ml was added to produce an effective active oxygen concentration of 30 ppm. The sample was incubated for at least 30 minutes at room temperature and then quenched with 0.1 volume of 1 M Tris pH 8.6 buffer to produce a final concentration of 0.1 M Tris pH 8.6). 3mM phenylmethylsulfonyl fluoride (PMSF) was added and 2.5 ml of the sample was applied to a Pharmacia PD10 column equilibrated in 10 mM sodium phosphate pH 6.2, 1 mM PMSF. 3.5 ml of 10 mM sodium phosphate pH6.2, 1mM PMSF was applied and the eluant collected.
F222 and DPDA oxidized F222 were precipitated with 9 volumes of acetone at -20°C. The samples were resuspended at 10 mg/ml in 8M urea in 88$ formic acid and allowed to sit for 5 minutes. An equal volume of 200 mg/ml CNBr in 88$ formic acid was added (5 mg/ml protein) and the samples incubated for 2 hours at room temperature in the dark. Prior to gel electrophoresis, the samples were lyophilized and resuspended at 2-5 mg/ml in sampl'~e buffer (1$

pyridine, 5$ NaDodS04, 5$ glycerol .and bromophenol blue) and disassociated at 95°C for 3 minutes.
The samples were electrophoresed on discontinuous polyacrylamide gels (Kyte, J., et al. (1983) Anal. Bioch. 133, 515-522). The gels were stained using the Pharmacia silver staining technique (Sammons, D.W., et al. (1981) Electrophoresis 2 135-141).
The results of this experiment are shown in Figure 8.
As can be seen, F222 treated with CNBr only gives nine resolved bands on SPG. However, when F222 is also treated with DPDA prior to cleavage, bands X, 7 and 9 disappear whereas bands 5 and 6 are greatly increased in intensity.
In order to determine which of the methionines were effected, each of the CNBr peptides was isolated by reversed phase HPLC and further characterized. The buffer system in both Solvent A (aqueous) and Solvent B (organic) for all HPLC separations was 0.05$
triethylamime/trifloroacetic acid (TEA-TFA). In all cases unless noted, solvent A consisted of 0.05$
TEA-TFA in H20, solvent B was 0.05$ TEA-TFA in 1-propanol, and the flow rate was 0.5 ml/minute.
For HPLC analysis, two injections of 1 mg enzyme digest were used. Three samples were acetone precipitated, washed and dried. The dried 1 mg samples were resuspended at 10 mg/ml in 8M urea, 88$
formic acid; an equal volume of 200 mg/ml CNBr in 88$
formic acid was added (5 mg/ml protein). After incubation for 2 hours in the dark at room temperature, the samples were desalted on a 0.8 cm X 7 1 341 ~$ 0 cm column of Tris Acryl GF05 coarse resin (IBF, Paris, France) equilibrated with 40$ solvent B, 60$ solvent A. 200 ul samples were applied at a flow rate of 1 ml a minute and 1.0-1.2 ml collected by monitoring the absorbance at 280nm. Prior to injection on the HPLC, each desalted sample was diluted with 3 volumes of solvent A. The samples were injected at 1.0 ml/min (2 minutes) and the flow then adjusted to 0.5 ml/min (100$ A). After 2 minutes, a linear gradient to 60$ B
at 1.0$ B/min was initiated. From each. 1 mg run, the pooled peaks were sampled (50u1) and analyzed by gel electrophoresis as described above.
Each polypeptide isolated by reversed phase HPLC was further analyzed for homogeneity by SPG. The position of each peptide on the known gene serquence (Wells, J.A., et al. (1983) Nucleic Acids Res., 11 7911-7924) was obtained through a combination of amino acid compositional analysis and, where needed, amino terminal sequencing.
Prior to such analysis the following pa_ptides were to rechromatographed.
1. CNBr peptides from F222 not treated with DPDA:
Peptide 5 was subjected to two additional reversed phase separations. The 10 cm C4 column was equilibrated to 80$A/ 20$B and the pooled sample applied and washed for 2 minutes. Next an 0.5~ ml B/min gradient was initiated. Fractions from this separation were again rerun, this time on the 25 cm C4 column, and employing 0.05 TEA-TFA in acetonitrile/1-propanol (1:1) for solvent B. The gradient was identical to the one just described.

134 2~p Peptide "X" was subjected to one additional separation after the initial chromatography. T:he sample was applied and washed for 2 minutes at 0.5m1/min (1008A), and a 0.58 ml B/min gradient was initiated.
Peptides 7 and 9 were rechromatographed in a similar manner to the first rerun of peptide 5.
Peptide 8 was purified to homogeneity after the initial separation.
2. CNBr Peptides from DPDA Oxidized F222:
Peptides 5 and 6 from a CNBr digest of the oxidized F222 were purified in the same manner as peptide 5 from the untreated enzyme.
Amino acid compositional analysis was obtained as follows. Samples (-1nM each amino acid) were dried, hydrolyzed in vacuo with 100 ul 6N HC1 at 106°C for 24 hours and then dried in a Speed Vac. T'.he samples were analyzed on a Beckmann 6300 AA analyzer employing ninhydrin detection.
Amino terminal sequence data was obtained as previously described (Rodriguez, H., et al. (1984) Anal. Biochem. 134, 538-547).
The results are shown in Table VII and Figure 9.

TABLE VII
Amino and COOH terminii of CNBr fragments Terminus and Method Fragment amino, method COON, method X l, sequence 50, composition 9 51, sequence 119, composition 7 125, sequence 199, composition 200, sequence 275, composition Sox 1, sequence 119, composition box 120, composition 199, composition Peptides Sox and box refer to peptides 5 and 6 isolated from CNBr digests of the oxidized protein where their respective levels are enhanced.
From the data in Table VII and the comparison of SPG
tracks for the oxidized and native protein digests in Figure 8, it is apparent that (1) Met50 is oxidized leading to the loss of peptides X and 9 and the appearance of 5; and (2) Metl24 is also oxidized leading to the loss of peptide 7 and the accumulation of peptide 6. Thus oxidation of B. am~lolic~uifaciens subtilisin with the peracid, diperdocecanoic acid leads to the specific oxidation of methionine at residues 50 and 124.
'0 Substitution at Met50 and Met124 in Subtilisin Met2220 '5 The choice of amino acid for substitution at Met50 was based on the available sequence data for subtilisins from H. licheniformis (Smith, E.C., et al. (1968) J. Biol. Chem. 4~3, 2184-2191), B.DY (Nedkov, P., et al. (1983) No~pe Sayler's Z. Physiol. Chem. 364 1537-1540), B. amylosacchariticus (Markland, F.S., et al. (1967) J. Biol. Chem. 242 5198-5211) and B.
subtilis (Stahl, M.L., et al. (1984) J. Bacteriol.
158, 411-418). In all cases, position 50 is a phenylalanine. See Figure 5. Therefore, Phe50 was chosen for construction.
At position 124, all known subtilisins possess a methionine. See Figure 5. Molecular modelling of the x-ray derived protein structure was therefore required to determine the most probable candidates for substitution. From all 19 candidates, isoleucine and leucine were chosen as the best residues to employ.
In order to test whether or not modification at one site but not both was sufficient to increase oxidative stability, all possible combinations were built on the Q222 backbone (F50/Q222, I124/Q222, F50/I124/Q222).
A. Construction of Mutations Between Codons 45 and 50 All manipulations for cassette mutagenesis were carried out on pS4.5 using methods disclosed in EPO
Publication No. 0130756 and Wells, J.A., et al, (1985) Gene 34, 315-323. The po50 in Fig. 10, line 4, mutations was produced using the mutagenesis primer shown in Fig. 10, line 6, and emplo5red an approach designated as restriction-purification which is described below. Briefly, a M13 template containing the subtilisin gene, M13mp11-SUET was used for heteroduplex -synthesis (Adelman, et ~ (1983), DNA 2, 183-193). Following transfection of JM101 (ATCC
33876), the 1.5 kb coRI-BamHI fragment containing the 13412gp subtilisin gene was subcloned from M13mp11 SUBT rf into a recipient vector fragment of pHS42 the construction of which is described in EPO Publication No. 0130756. To enrich for the mutant sequence (po50, line 4), the resulting plasmid pool was digested with KpnI, and linear molecules were purified by polyacrylamide gel electrophoresis. Linear molecules were ligated back to a circular form, and transformed into 1~. coli MM294 cells (ATCC 31446). Isolated plasmids were screened by restriction analysis for the KpnI site. ~nI+ plasmids were sequenced and confirmed the po50 sequence. Asterisks in Figure 11 indicate the bases that are mutated from the wid type sequence (line 4). po50 (line 4) was cut with StuI
and coRI and the 0.5 I~ fragment containing the 5' half of the subtilisin gene was purified (fragment 1).
po50 (line 4) was digested with KpnI and EcoRI and the 4.0 Kb fragment containing the 3' half of the subtilisin gene and vector sequences was purified (fragment 2). Fragments 1 and 2 (line 5), and duplex DNA cassettes coding for mutations desired (shaded sequence, line 6) were mixed in a molar ratio of 1:1:10, respectively. For the particular construction of this example the DNA cassette contained the triplet TTT for codon 50 which encodes Phe. This plasmid was designated pF50. The mutant subtilisin was designated F50.
B. Construction of Mutation Between Codons 122 and 127 The procedure of Example 2A was followed in substantial detail except that the mutagenesis primer of Figure 11, line 7 was used and restriction-purification for the coRV site in po124 was used. In addition, the DNA cassette (shaded sequence, Figure 11, line 6) contained the triplet ATT for codon 124 which encodes Ile and CTT for Leu. 'Those plasmids which contained the substitution of Ile for Met124were designeated pI124. The mutant subtilisin was designated I124.
C. Construction of Various F50/I12.~JQ222 Multiple Mutants :0 The triple mutant, F50/I124/Q222, was canstructed from a three-way ligation in which each fragment contained one of the three mutations. The single mutant Q222 (pQ222) was prepared by cassette mutagenesis as described in EPO Publication No. 0130756. The F50 mutation was contained on a 2.2kb AVaII to vuII
fragment from pF50; the I124 mutation was contained on a 260 by vuII to vaII fragment from pI124; and the Q222 mutation was contained on 2.7 kb AvaII to AvaII
fragment from pQ222. The three fragments were ligated together and transformed into ~. coli. MM294 cells.
Restriction analysis of plasmids from isolated transformants confirmed the construction. To analyze the final construction it was convenient that the AvaII site at position 798 in the wild-type subtilisin gene was eliminated by the 1124 construction.
The F50/Q222 and I124/Q222 mutants were constructed in a similar manner except that the appropriate fragment from pS4.5 was used for the final construction.

D. Oxidative Stability of Q222 Mutants The above mutants were analyzed for stability to peracid oxidation. As shown in Fig. 12, upon incubation with diperdodecanoic acid (protein 2mg!mL, oxidant 75ppm[0~), both the I124/Q222 and the 1~41~80 F50/I124/Q222 are completely stable whereas the F50/Q222 and the Q222 are inactivated. This indicates that conversion of Met124 to I124 in subtilisin Q222 is sufficient to confer resistance to organic peracid oxidants.

Subtilisin Mutants Having Altered Substrate Specificity-Hydrophobic Substitutions at Residues 166 Subtilisin contains an extended binding cleft which is hydrophobic in character. A conserved glycine at residue 166 was replaced with twelve non-ionic amino acids which can project their side-chains into the S-1 subsite. These mutants were constructed to determine the effect of changes in size and hydrophobicity on the binding of various substrates.
A. Kinetics for Hydrolysis of Substrates Having Altered P-1 Amino Acids by Subtilisin from B Amyloliauefaciens Wild-type subtilisin was purified from _H. subtilis culture supernatants expressing the $. amylolique-faciens subtilisin gene (Wells, J.A., et al. (1983) Nucleic Acids Res. ~, 7911-7925) as previously described (Estell, D.A., et al. (1985) J. Biol. Chem.
260, 6518-6521). Details of the synthesis of tetrapeptide substrates having the form succinyl-L-AlaL-AlaL-ProL-(X]-p-nitroanilide (where X
is the P1 amino acid) are described by DelMar, E.G., et ,ate. (1979) anal. Biochem. 99, 316-320. Kinetic parameters, Km(M) and kcat(s 1) were measured using a modified progress curve analysis (Estel.l, D.A., et al.
(1985) J. Hiol. Chem. X60_, 6518-6521). Briefly, plots 134 ~~0 of rate versus product concentration were fit to the differential form of the rate equation using a nor.-linear regression algorithm. Errors in kcat and Km for all values reported are less than five percent.
The various substrates in Table VIII are ranged in order of decreasing hydrophobicity. Nozaki, Y.
(1971), J. Piol. Chem. 246, 2211-2217; Tanford C.
(1978) Science 200, 1012).

'0 TABLE VIII
P1 substrate kcat/Km Amino Acid kcat(S 1) 1/Km(M 1) (s-1M-1) Phe 50 7,100 360,000 Tyr 28 40,000 1,100,000 Leu 24 3,100 75,000 Met 13 9,400 120,000 20 His 7.9 1,600 13,000 Ala 1 . 9 5, 500 11, 000 Gly 0.003 8,300 21 Gln 3. 2 2, 200 7, 100 Ser 2.8 1,500 4,200 25 Glu 0.54 32 16 The ratio of kcat/Km (also referred to as catalytic efficienty) is the apparent second order rate constant 30 for the conversion of free enzyme plus substrate (E+S) to enzyme plus products (E+p) (Jencks, W.P., Catalysis in Chemistry and Enzymology (McGraw-Hill, 1969) pp.
321-436; Fersht, A., Enzyme Structure and Mechanism (Freeman, San Francisco, 1977) pp. 226-287). The log 35 (kcat/Km) is proportional to transition state binding ~34~~80 energy, oGT. A plot of the log kcat/Km versus the hydrophobicity of the P1 side-chain (Figure 14) shows a strong correlation (r = 0.98), with t:he exception of the glycine substrate which shows evidence for non-productive binding. These data Shaw that relative differences between transition-state binding energies can be accounted for by differences in P-1 side-chain hydrophobicity. When the transition-state binding energies are calculated for these substrates and plotted versus their respective side-chain hydrophobicities, the line slope is 1.2 (not shown).
A slope greater than unity, as is also the case for chymotrypsin (Fersht, A., Enzyme Structure and Mechanism (Freeman, San Francisco, 1977) pp. 226-287;
Harper, J.W., et ~. (1984) Biochemistry, 23, 2995-3002), suggests that the P1 binding cleft is more hydrophobic than ethanol or dioxane so:Lvents that were used to empirically determine the hydrophobicity of amino acids (Nozaki, Y., et al. J. Biol. Chem. (1971) 246, 2211-2217: Tanford, C. (1978) Science 200, 1012).
For amide hydrolysis by subtilisin, kcat can be interpreted as the acylation rate constant and Km as the dissociation constant, for the Mi.chaelis complex (E~S), -Ks. Gutfreund, H., et a~ (1956) Biochem. J. 63, 656. The fact that the log kcat, as well as log 1/Km, correlates with substrate hydrophobicity is consistent with proposals (Robertus, J.D., bet al. (1972) Biochemistry ~l, 2439-2449; Robertus, J.D., et al.
(1972) Hiochemistry ~1, 4293-4303) that during the acylation step the P-1 side-chain moves deeper into the hydrophobic cleft as the substrate advances from the Michaelis complex (E~S) to the tetrahedral transition-state complex (E~S~). However, these data can also be interpreted as the hydrophobicity of the P1 side-chain effecting the orientatian, and thus the susceptibility of the scissile peptide bond to nucleophilic attack by the hydroxyl group of the catalytic Ser221.
The dependence of kcat/Km on P-1 Bide chain hydrophobicity suggested that the kcat/Km for hydrophobic substrates may be increased by increasing the hydrophobicity of the S-1 binding subsite. To test this hypothesis, hydrophobic amino acid s~stitutions of Glyl66 were produced.
Since hydrophobicity of aliphatic ide-chains is directly proportional to side-chain surface area (Rose, G.D., et al. (1985) Science 229, 834-838;
Reynolds, J.A., et al. (1974) Proc. Natl. Acad. Sci.
USA 71, 2825-2927), increasing the hydrophobicity in the S-1 subsite may also sterically hinder binding of larger substrates. Because of difficulties in predicting the relative importance of these two opposing effects, we elected to generate twelve non-charged mutations at position 166 to determine the resulting specificities against non-charged substrates of varied size and hydrophobicity.
B. Cassette Mutagenesis of the P1 Bindinq_Cleft The preparation of mutant subtilisims containing the substitution of the hydrophobic amino acids Ala, Val and Phe into residue 166 has been described in EPO
Publication No. 0130756. The same method was used to produce the remaining hydrophobic mutants at residue 166. In applying this method, two unique and silent restriction sites were introduced in the subtilisin genes to closely flank the target codon 166. As can be seen in Figure 13, the wild type sequence (line 1) 1341~gp was altered by site-directed mutagenesis in M13 using the indicated 37mer mutagenesis primer, to introduce a 13 by delection (dashedline) and unique S~cI and XmaI
sites (underlined sequences) that closely flank codon 166. The subtilisin gene fragment was subcloned back into the ~. coli - _H. subtilis shuttle plasmid, pBS42, giving the plasmid po166 (Figure 13, line 2). po166 was cut open with SacI and ~na,I, and gapped linear molecules were purified (Figure 13, line 3). Pools of synthetic oligonucleotides containing the mutation of interest were annealed to give duplex DNA cassettes that were ligated into gapped po166 (underlined and overlined sequences in Figure 13, line 4). This construction restored the coding sequence except over position 166(NNN; line 4). Mutant sequences were confirmed by dideoxy sequencing. Asterisks denote sequence changes from the wild type sequence.
Plasmids containing each mutant ~. am_yloliguefaciens subtilisin gene Were expressed at roughly equivalent levels in a protease deficient strain of _B. subtilis, BG2036 as previously described. EPO Publication No.
0130756: Yang, M., g~ al. (1984) J. Hacteriol. X60, 15-21; Estell, D.A., et ~1_ (1985) J. Hiol. Chem. 260, 6518-6521.
C. Narrowing Substrate Specificity by Steric Hindrance To probe the change in substrate specificity caused by steric alterations in the S-1 subsite, position 166 mutants were kinetically analyzed versus Pl substrates of increasing size (i.e., Ala, Met, Phe and Tyr).
Ratios of kcat/Km are presented in log form in Figure 15 to allow direct comparisons of transition state binding energies between various enzyme-substrate pairs.

1~341C80 According to transition state theory, the free enery difference between the free enzyme plus substrate (E + S) and the transition state complex (E~S~) can be calculated from equation (1), (1) °GT = -RT In kcat/Km + RT In ~kT/h in which kcat is the turnover number, Km is the Michaelis constant, R is the gas constant, T is the temperature, k is Boltzmann's constant, and h is Planck's constant. Specificity differences are ezpressed quantitatively as differences between transition state binding energies (i.e., °°Gt), and can be calculated from equation (2).
(2) °°GT = -RT In (kcat/Km)A/(kcat/Km)B
A and B represent either two different substrates assayed againt the same enzyme, or two mutant enzymes assayed against the same substrate.
As can be seen from Figure 15A, as the size of the side-chain at position 166 increases the substrate preference shifts from large to small P'-1 side-chains.
Enlarging the side-chain at position 166 causes kcat/Km to decrease in proportion to t:he size of the P-1 substrate side-chain (e. g., from G1y166 (wild-type) through W166, the kcat/Km for the Tyr substrate is decreased most followed in order by the Phe, Met and Ala P-1 substrates).
Specific steric changes in the position 166 side-chain, such as he presence of a ~-hydroxyl group, p- or -y-aliphatic branching, cause large decreases in kcat/Km for larger P1 substrates. Introducing a 'S ~-hydroxyl group in going from A166 (Figure 15A) to 1 341 ~g p 5166 (Figure 15B), causes an 8 fold and 4 fold reduction in kcat/Km for Phe and Tyr substrates, respectively, while the values for Ala and Met substrates are unchanged. Producing a p-branched structure, in going from S166 to T166, results in a drop of 14 and 4 fold in kcat/Km for Phe and Tyr, respectively. These differences are slightly magnified for V166 which is slightly larger and isosteric with T166. Enlarging the ~-branched substituents from V166 to I166 causes a lowering of kcat/Km between two and six fold toward Met, Phe and Tyr substrates. Inserting a y-branched structure, by replacing M166 (Figure 15A) with L166 (Figure 158), produces a 5 fold and 18 fold decrease in kcat/Km for Phe and Tyr substrates, respectively. Aliphatic ~-branched appears to induce less steric hindrance toward the Phe P-1 substrate than ,9-branching, as evidenced by the 100 fold decrease in kcat/Km for the Phe substrate in going from L166 to I166.
Reductions in kcat/Km resulting from increases in side chain size in the S-1 subsite, or specific structural features such as ~- and y-branching, are quantita tively illustrated in Figure 16. The kcat/Km values for the position 166 mutants determined for the Ala, Met, Phe, and Tyr P-1 substrates (top panel through bottom panel, respectively), are plotted versus the position 166 side-chain volumes (Chothia, C. (1984) Ann. Rev. Biochem. 53, 537-572). Catalytic efficiency for the Ala substrate reaches a maximum for I166, and for the Met substrate it reaches a maximum between V166 and L166. The Phe substrate shows a broad kcat/Km peak but is optimal with A166. Here, the p-branched position 166 substitutions form a line that is parallel to, but roughly 50 fold lower in kcat/Km than side-chains of similar size [i.e., C166 versus 134~,~8p T166, L166 versus I166]. The Tyr substrate is most efficiently utilized by wild type enzyme (G1y166), and there is a steady decrease as one proceeds to large position 166 side-chains. The ~9-branched and 7-branched substitutions form a parallel line below the other non-charged substitutions of similar molecular volume.
The optimal substitution at position 1.66 decreases in volume with increasing volume of the P1 substrate [i.e., I166/Ala substrate, L166/Met substrate, A166/Phe substrate, G1y166/Tyr substrate]. The combined volumes for these optimal pairs may approximate the volume for productive binding in the S-1 subsite. For the optimal pairs, Glyl66/Tyr substrate, A166/Phe substrate, L166,iMet substrate, V166/Met substrate, and I166/Ala substrate, the combined volumes are 266,295,313,33! and 261 A3, respectively. Subtracting the volume of the peptide backbone from each pair (i.e., two times the volume of glycine), an average side-chain volume of 160~32A3 for productive binding can be calculated.
The effect of volume, in excess to the productive binding volume, on the drop in transition-state binding energy can be estimated from the Tyr substrate curve (bottom panel, Figure 16), because these data, and modeling studies (Figure 2), suggest that any substitution beyond glycine causes steric repulsion.
A best-fit line drawn to all the data (r = 0.87) gives a slope indicating a loss of roughly 3 kcal/mol in transition state binding energy per 100A3 of excess volume. (100A3 is approximately the size of a leucyl side-chain.) D. Enhanced Catalytic Efficiency Correlates with Increasing Hydrophobicity of the Position 166 Substitution Substantial increases in kcat/Km occur with enlargement of the position 166 hide-chain, except for the Tyr P-1 substrate (Figure 16). For example, kcat/Km increases in progressing from G1y166 to I166 for the Ala substrate (net of ten-fold), from G1y166 to L166 for the Met substrate (net of ten-fold) and from Glyl66 to A166 for the Phe substrate (net of two-fold). The increases in kcat/Km cannot be entirely explained by the attractive terms in the van der Waals potential energy function because of their strong distance dependence (1/r6) and because of the weak nature of these attractive forces (Jencks, W.P., Catalvsis in Chemistry and Enzymoloay (McGraw-Hill, 1969) pp. 321-436: Fersht, A., enzyme Structure and Mechanism (Freeman, San Francisco, 197'7) pp. 226-287;
Levitt, M. (1976) J. Mol. Biol. X04, 59-107). For example, Levitt (Levitt, M. (1976) J. Mol. Biol. 104, 59-107) has calculated that the van der Waals attraction between two methionyl residues would produce a maximal interaction energy of roughly -0.2 kcal/mol. This energy would translate to only 1.4 fold increase in kcat/Km.
The increases of catalytic efficiency caused by side-chain substitutions at position 166 are better accounted for by increases in the hydrophobicity of the S-1 subsite. The increase kcat/F'~m observed for the Ala and Met substrates with increasing position 166 side-chain size would be expected, because hydrophobicity is roughly proportional to side-chain surface area (Rose, G.D., gt ~. (1985) Science 229, 834-838: Reynolds, J.A., et ~,1_. (19T4) Proc. Natl.
Acad. Sci. USA 7~, 2825-2927).

1 341 ~~ 0 Another example that can be interpreted as a hydrophobic effect is seen when comparing kcat/Km for isosteric substitutions that differ in hydrophobicity such as S166 and C166 (Figure 16). Cysteine is considerably more hydrophobic than serine (-1.0 versus +0.3 kcal/mol) (Nozaki, Y., et ~1_. (1971) J. Biol.
Chem. X46, 2211-2217; Tanford, C. (1978) Science 200, 1012). The difference in hydrophobicity correlates with the observation that C166 becomes more efficient relative to Ser166 as the hydrophobicity of the substrates increases (i.e., Ala < Met < Tye < Phe).
Steric hindrance cannot explain these differences because serine is considerably smaller than cysteine (99 versus 118A3). Paul, I.C., Chemistry of the -SH
Group (ed. S. Patai, Wiley Interscience, New York, 1974) pp. 111-149.
E. Production of an Elastase-Like SQecificitv in Subtilisin The I166 mutation illustrates particularly well that large changes in specificity can be produced by altering the structure and hydrophobic:ity of the S-1 subsite by a single mutation (Figure 17). Progressing through the small hydrophobic substrates, a maximal specificity improvement over wild type occurs for the Val substrate (16 fold in kcat/Km). As the substrate side chain size increases, these enhancements shrink to near unity (i.e., Leu and His substrates). The 1166 enzyme becomes poorer against :larger aromatic substrates of increasing size (e. g., I166 is over 1,000 fold worse against the Tyr substrate than is G1y166). We interpret the increase in catalytic efficiency toward the small hydrophobic; substrates for 1166 compared to G1y166 to the greater hydrophobicity of isoluecine (i.e., -1.8 kcal/mol versus 0). Nozaki, _78_ Y., et al. (1971) J. Hiol. hem. '~, 2211-2217;
Tanford, C. (1978) Science X00, 1012. The decrease in catalytic efficiency toward the very large substrates for I166 versus G1y166 is attributed to steric S
repulsion.
The specificity differences between Glyl66 and I166 are similar to the specificity differences between chymotrypsin and the evolutionary relative, elastase (Harper, J.W., et ~ (1984) Biochemistry 23, 2995-3002). In elastase, the bulky amino acids, Thr and Val, block access to the P-1 binding site for large hydrophobic substrates that are preferred by chymotrypsin. In addition, the catalytic efficiencies toward small hydrophobic substrates are greater for elastase than for chymotrypsin as we obeseve for I166 versus Glyl66 in subtilisin.

Substitution of Ionic Amino Acids for Glyl66 The construction of subtilisin mutants containing the substitution of the ionic amino acids Asp, Asn, Gln, Lys and Ang are disclosed in EPO Publication No.
0130756. The present example describes the construction of the mutant subtilisin. containing Glu at position 166 (E166) and presents substrate specificity data on these mutants. Further data on position 166 and 156 single and double mutants is presented infra.
po166, described in Example 3, was digested with SacI
and XmaI. The double strand DNA cassette (underlined and overlined) of line 4 in Figure 1.3 contained the 134~,~gp triplet GAA for the codon 166 to encode the replacement of Glu for Glyl66. This mutant plasmid designated pQ166 was propagated i.n BG2036 as described. This mutant subtilisin, together with the other mutants containing ionic substituent amino acids at residue 166, were isolated as described and further analyzed for variations in substrate specificity.
Each of these mutants was analyzed with the tetrapeptide substrates, succinyl-L-AlaL-AlaProL-X--p-nitroanilide, where X was Phe, Ala and Glu.
The results of this analysis are shown .in Table IX.
TABLE IX
P-1 Substrate (kcat/Km x 10 4) Position 166 Phe Ala Glu Gly (wild type) 36.0 1.4 0.002 Asp (D) 0.5 0.4 <0.001 Glu (E) 3.5 0.4 <0.001 Asn (N) 18.0 1.2 0.004 Gln (Q) 57.0 2.6 0.002 Lys (K) 52.0 2.8 1.2 Arg (R) 42.0 5.0 0.08 These results indicate that charged amino acid substitutions at G1y166 have improved catalytic efficiencies (kcat/Km) for oppositely charged P-1 substrates (as much as 500 fold) and poorer catalytic efficiency for like charged P-1 substrates.

1341$0 -so-Substitution of Glycine at Position 169 The substitution of Glyl69 in ~. amyloliquefaciens subtilisin with Ala and Ser is described in EPO
Publication No. 0130756. The same method was used to make the remaining 17 mutants containing all other substituent amino acids for position 16.9.
The construction protocol is summarized in Figure 18.
The overscored and underscored double stranded DNA
cassettes used contained the following triplet encoding the substitution of the indicated amino acid at residue 169.
GCT A ATG M

TGT C AAC N

GAT D CCT P

GAA E CAA Q

TTC F AGA R

GGC G AGC S

CAC H ACA T

ATC I GTT V

AAA K TGG W

CTT L TAC Y

Each of the plasmids containing a substituted G1y169 was designated pX169, where X represents the substituent amino acid. The mutant subtilisins were simialrly designated.
Two of the above mutant subtilisins, A169 and 5169, were analyzed for substrate specificity against synthetic substrates containing Phe, Leu, Ala and Arg in the P-1 position. The following results are shown in Table X.

1 341 ~g 0 TABLE X
Effect of Serine and Alanine Mutations at Position 169 on P-1 Substrate Specificity ~?-1 Substrate LkcatJKm x 10-4) Position 169 ~_e Leu ~a_ Ara Gly (wild type) 40 10 1 0.4 A169 120 20 1 0.9 5169 50 10 1 0.6 These results indicate that substitutions of Ala and Ser at Glyl69 have remarkably similar catalytic efficiencies against a range of P-1 substrates compared to their position 166 counterparts. This is probably because position 169 is at the bottom of the P-1 specificity subsite.

Substitution at Position 104 ,~5 Tyr104 has been substituted with Ala, His, Leu, Met and Ser. The method used was a modification of the site directed mutagenesis method. According to the protocol of Figure 19, a primer (shaded in line 4) introduced a unique HindIII site and a frame shift mutation at codon 104. Restriction-purification for the unique HindIII site facilitated the isolation of the mutant sequence (line 4). Restriction-selection against this HindIII site using pimers in line 5 was used to obtain position 104 mutants.

134128~
_s2_ The following triplets were used in the primers of Figure 19, line 5 for the 104 codon which substituted the following amino acids.
GCT A TTC F

ATG M CCT P

CTT L ACA T

AGC S TGG W

CAC H TAC Y

CAA Q GTT V

GAA E AGA R

GGC G AAC N

ATC I GAT D

AAA K TGT C

The substrates in Table XI were used to analyze the substrate specificity of these mutants. The results obtained fo H104 subtilisin are shown in Table XI.
TABLE XI

kcat Km Kcat/Km SubstrateWT H104 WT H104 WT H104 sAAPFpNA 50.0 22.0 1.4x10 7.1x10 3.6x1053.1x104 sAAPApNA 3.2 2.0 2.3x10 1.9x10 7!.4x1041x103 sFAPFpNA 26.0 38.0 1.8x10 4.1x10 1.5x1059.1x104 sFAPApNA 0.32 2.4 7.3x10 1.5x,10 4.4x1031.6x104 From these data it is clear that the substitution of His for Tyr at position 104 produces .an enzyme which is more efficient (higher kcat/Km) when Phe is at the P-4 substrate position than when Ala is at the P-4 substrate position.

EXAMPLE ?
Substitution of A1a152 A1a152 has been substituted by Gl.y and Ser to determine the effect of such substitutions on substrate specificity.
The wild type DNA sequence was mutated by the V152/P153 primer (Figure 20, line 4) using the above restriction-purification approach for. the new KDnI
site. Other mutant primers (shaded sequences Figure 20; 5152, line 5 and 6152, line 6) mutated the new K~anI site away and such mutants were isolated using the restriction-selection procedure as described above for loss of the KpnI site.
The results of these substitutions for the above synthetic substrates containing the P-1 amino acids phe, Leu and Ala are shown in Table XII.
TABLE XII
p-1 Substrate (kcat/KmxlO 4) Position 152 Phe Leu Ala Gly (G) 0.2 0.4 <0.04 Ala (wild type) 40.0 10.0 1.0 Ser (S) 1.0 0.5 0.2 These results indicate that, in contrast to positions 166 and 169, replacement of A1a152 with Ser or Gly causes a dramatic reduction in catalytic efficiencies ~ 34' 28 0_ across all substrates tested. This suggests A1a152, at the top of the S-1 subsite, may be the optimal amino acid because Ser and Gly are homologous Ala substitutes.

Substitution at Position 156 Mutants containing the substitution of Ser and Gln for G1u156 have been constructed according to the overall method depicted in Figure 21. This method was designed to facilitate the construcit.on of multiple mutants at position 156 and 166 as will be described hereinafter. However, by regenerating the wild type G1y166, single mutations at G1u156 were obtained.
The plasmid po166 is already depicted in line 2 of Figure 13. The synthetic oligonucleotides at the top right of Figure 21 represent the same DNA cassettes depicted in line 4 of Figure 13. The plasmid p166 in Figure 21 thus represents the mutant plasmids of Examples 3 and 4. In this particular example, p166 contains the wild type G1y166.
Construction of position 156 single mutants were prepared by ligation of the three fragments (1-3) indicated at the bottom of Figure 21. Fragment 3, containing the carboxy-terminal partion of the subtilisin gene including the wild ty~,pe position 166 codon, was isolated as a 610 by acI-HamHI fragment.
Fragment 1 contained the vector sequences, as well as the amino-terminal sequences of the subtilisin gene through codon 151. To produce fragment 1, a unique KDnI site at codon 152 was introduced into the wild type subtilisin sequence from pS4.5. Site-directed 1341~~p mutagenesis in M13 employed a primer having the sequence 5'-TA-GTC-GTT-GCG-GTA-CCC-GGT-AAC-GAA-3' to produce the mutation. Enrichment for the mutant sequence was accomplished by restriction with t~nI, purification and self ligation. The mutant sequence containing the ~Cp_nI site was confirmed by direct plasmid sequencing to give pV152. pV152 (-1 gig) was digested with C nI and treated with 2 units of DNA
polymerise I large fragment (Klenow fragment from Boeringer-Mannheim) plus 50 ~M deoxynucleotide triphosphates at 37'C for 30 min. 'This created a blunt end that terminated with codon 151. The DNA was extracted with 1:1 volumes phenol and CHC13 and DNA in the aqueous phase was precipitated by addition of 0.1 volumes 5M ammonium acetate and two volumes ethanol.
After centrifugation and washing the DNA pellet with 70% ethanol, the DNA was lyophilized. DNA was digested with BamHI and the 4.6kb piece (fragment 1) was purified by acrylamide gel electrophoresis followed by electroelution. Fragment 2 was a duplex synthetic DNA cassette which when ligated with fragments 1 and 3 properly restored the coding sequence except at codon 156. The top strand was synthesized to contain a glutamine codon, and the complementary bottom strand coded for serine at 156.
Ligation of heterophosphorylated cassettes leads to a large and favorable bias for the phosphorylated over the non-phosphorylated oligonucleotide sequence in the final segrated plasmid product. Therefore, to obtain Q156 the top strand was phosphorylated, and annealed to the non-phosphorylated bottom strand prior to ligation. Similarly, to obtain S156 the bottom strand was phosphorylated and annealed to the non-phosphorylated top strand. Mutant sequences were isolated after ligation and transformation, and were confirmed by restriction analysis and DNA sequencing ~34~280 as before. To express variant subtil:isins, plasmids were transformed into a subtilisin-neutral protease deletion mutant of _H. subtilis, BG2036, as previously described. Cultures were fermented in shake flasks for 24 h at 37'C in LB media containing 12.5 mg/mL
chloramphenicol and subtilisin was purified from culture supernatants as described. Purity of subtilisin was greater than 95% as judged by SDS PAGE.
These mutant plasmids designated pS156 and pQ156 and mutant subtilisins designated 5156 and Q156 were analyzed with the above synthetic substrates where P-1 comprised the amino acids Glu, Gln, Met and Lys. The results of this analyses are presented in Example 9.

Multiple Mutants With Altered Substrate Specificity - Substitution at Positions 156 and 166 Single substitutions of position 166 are described in Examples 3 and 4. Example 8 describes single substitutions at position 156 as well as the protocol of Figure 21 whereby various double mutants comprising the substitution of various amino acids at positions 156 and 166 can be made. This example describes the construction and substrate specificity of subtilisin containing substitutions at position 156 and 166 and summarizes some of the data for single and double mutants at positions 156 and 166 with various substrates.
K166 is a common replacement amino acid in the 156/166 mutants described herein. The replacement of Lys for 1341~~a G1y166 was achieved by using the synthetic DNA
cassette at the top right of Figure 21 which contained the triplet AAA for NNN. This produced fragment 2 with Lys substituting for G1y166.
The 156 substituents were Gln and Ser. The Gln and Ser substitutions at Glyl56 are contained within fragment 3 (bottom right Figure 21).
The multiple mutants were produced by combining fragments 1, 2 and 3 as described in Example 8: The mutants Q156/K166 and S156/K166 were selectively generated by differential phosphorylation as described. Alternatively, the double 156/166 mutants, c.f. Q156/K166 and 5156/K166, were prepared by ligation of the 4.6kb SacI-BamHI fragment from the relevant p156 plasmid containing the G.6kb SacI-BamHI
fragment from the relevant p166 plasmid.
These mutants, the single mutant K166, and the S156 and Q156 mutants of Example 8 were analyzed for substitute specificity against synthetic polypeptides containing Phe or Glu as the P-1 substrate residue.
The results are presented in Table XIII.

134280_ ro y E _ E

x -- ~ o a~o c~o o c. .-~

w ..., '.,. u, . o . o . . .
r.

x +.r -- .-1r~ c .-iero N ~o M

ro M .-, y v rox U

x x u, ~ ~r,~ ~oc ~o a ~r,N toc.~

rox x x x ~cx x x x x x x U ~D ~DN N ~DO 10 ~DM r1 .-~1I' . . . . . .

M r-1111.-1r-1lf1r-1.-~('~.-I'-1N

sT N 1f1tffU1 tf1111if1U1M 1f1 I I I (~"1 O O O O O O O O O O I
O
O

'-1 rirl r-1e-1r-1ri rlr1r-1r-1 ri H x x x x x x x x x x x x x H Q' ~ O 1001 ~ CO O~f'~W II1 M

E..~

M el'U1r-1M r-iM Q'~ ~' M

W

(~

1J O st'O O O O O O O O O
O

ro O u'1O t'~O ~DO 10O ~' O
O'i U
~ 0 x o 0 0 0 0 .-o o c o 0 u'1 N M M M sr CJ

ro a .-,ro v a v a v a v a v a v a y.l I .t"..r-1.L r-I,T:.-1,i'..r-I.4~ .L:
rl r-1 ~n w a.~ ~ w c,~w c~w ~ w ~ w ~n c.~

.n v a x .a w H

ro E

O

U 7.

m c W o vo w vo x x w w N rl ~O ~O ~D ~O ~D

C a ~O ~I1 t!1 tf1 ~1 W ri ri r-i .-~ .-1 r-i C7 x a C!7 tn W

1341$0 As can be seen in Table XIV, either of these single mutations improve enzyme performance upon substrates with glutamate at the P-1 enzyme binding site. When these single mutations were combined, the resulting multiple enzyme mutants are better than either parent.
These single or multiple mutations also alter the relative pH activity profiles of the enzymes as shown in Figure 23.
To isolate the contribution of electrostatics to s~strate specificity from other chemical binding forces, these various single and double mutants were analyzed for their ability to bind and cleave synthetic substrates containing Glu, Gln, Met and Lys as the P-1 substrate amino acid. This permitted comparisons between side-chains that were more sterically similar but differed in charge (e.g., Glu versus Gln, Lys versus Met). Similarly, mutant enzymes were assayed against homologous P-1 substrates that were most sterically similar but differed in charge (Table XIV).

,341280 O O~OO vf1N I~01 erM N ~T ~ C)O M )I1'V' O

O 1DC1D.-1N O C~ N ri 00t'~I~Ct)00 tJ11~OD

.

t~ M M N M M M M M M N N N N N N N N
,.....r. .........., ._. . ..._,_.~ .. _..
. .

.. .

U M oou~ o ..aa o o o vovo m a)o~ M M M

N ~ .-i.-m0' N t~ ~ 1p f'~d' I~\L)~ N N t~ M

E ~ ~f~ ~ et'sr~' sr~T M M M ~~1M d' M M .-i x ct'ODtf1~DI~ ODM v0f~ .-1~!otDQ'N tf1ODO

Q r N OD M 00 W OJ sTOW D u1 1D1~N d' ~DO'v N

N M M arM M ~' d'M ~'t1'e!'d'a? d' C'er N

.........~ ~ ....r.....................r..~ ............ ._.

E ~

cn x M ~DO~ M e!'~ Q' 1f~f~ t"~.-~01f~iN lf1I~10 u~ w o, aoo~ sr'o, m o voo twc r r M .-,o~.-, M

w y.~ . . . . . . , , ~
O .

u~ ro ~, M a' u~er d'vr,u~~n umn u~~rmr,~o ui~o +~

.n U
ro --~ x s~

.~
y +~
cn ,ca 0 ~ ,-,c a'00 0~a n ~n r-,W o ~~0 00 00 ,L1 r-I tf1CW-1 ~DO O .-itoM 00~O r CGN CD ~D01 et' v C N N M M M M M M M M M M tr1M M M M '-i v0 1~ r-~ ..............~ .~..,r..~~ .....~....."..~......r.r ...
r-1 ~a~ ro ~

Y-1 N vDu1 tDO ~--1C' Wi't,nM Ov ~-~I~10 O e~'tr 1~ L~ O O OJ M ~!'~!'CD M 00 1nO 1f1Lf1N tw o 00 00 H ~p N . . .
C

ll1 ,L7 M M M ~'M M M d'M C'C' C b'et''' Q' v W v tJ~

a c w _ _ _ _ _ _ _ _ _ _ _ _ _ _ a7O
w r~ ( N N C1 M O I~ 00M N O O tf1O O
r1 Ea+~ C~ N r-1t~ rlM et ?'I',f~f~M N ~f1et' O
D

fn ~ N N ~ N N .-iN N N C~IM sr er~ M
la O ~ v .~~ ...... ..~~ ....~ ~.r..,.r....
O

G~ C~
w N O O M O O N .-ncr.-W 01 O H

w ~ 'WO N M N N b N srM O O'vOv O t'~N II1 'L3 .r, C" [.,"'-ir-~.-1.-Ie-1.('.,.-1N N N '-1N V' V'~' M

r~

U
E

~I
~.1 ~
v vw c v ~
a x v _ v N N ~ H 'i ~ m i .-iO O O C)O O H ..~ E
l.r z ~ i i i i i i i i + + x ro w U v '-' U

G b~

v O

N '-' w +~ w E

ro 3 ~ x .... .r .~ ., c voa, ~ ~ ~ a n.a.~ro>. >.>, ~ c;~ N u~~n .u v vou~ .~cn ~ u~ N v ,-,~ .-,r, u~u~~r >. >,>. E ro o a c~a c~a a ~ a c~ c~~ a a:a a a a ~ x r.i .o~ a a ~ G ~ ~ ~ ~ c s~ ~ isa ~ c s~ x o~

w ~r,~ ...,~ .-a.-~v ~ .-,.-a,-,v ,-rv .-,.-a,-~v ro o o w .-,c~ c~c~ ~ c~ cnC~ c~c~ C~v~ C~viC~ C~ c~

Footnotes to Table XIV:
(a) _B. subtilis, BG 2036, expressing indicated variant subtilisin were fermented and enzymes purified as previously described (Estell, et ~,. (1985) J.
Hiol. Chem. 2~ 60, 6518-6521) . Wild type subtilisin is indicated (wt) containing Glul56 and G1y166.
(b) Net charge in the P-1 binding site is defined as the sum of charges from positions 156 and 166 at pH
8.6.
(c) Values for kcat(s 1) and Km(M) were measured i~
O.1M Tris pH 8.6 at 25'C as previously described against P-1 substrates having the form succinyl-L-AlaL-AlaL-ProL-[X]-p-nitroanilide, where X
is the indicated P-1 amino acid. Values for log 1/Km are shown inside parentheses. All errors in determination of kcat/Km and 1/Km are below 5%.
(d) Because values for G1u156/Asp166(D166) are too small to determine accurately, the maximum difference taken for Glue-1 substrate is limited to a charge range of +1 to -1 charge change.
n.d. = not determined The kcat/Km ratios shown are the second order rate constants for the conversion of substrate to product, and represent the catalytic efficiency of the enzyme.
These ratios are presented in logarithmic form to scale the data, and because log kcat/Km is proportional to the lowering of transition-state activation energy (oGT). Mutations at position 156 and 166 produce changes in catalytic efficiency toward Glu, Gln, Met and Lys P-1 substrates of 3100, 60, 200 and 20 fold, respectively. Making the P-1 binding-site more positively charged [e. g., compare G1n156/Lys166 (Q156/K166) versus G1u156/Met166 (G1u156/M166)] dramatically increased kcat/Km toward the Glu P-1 substrate (up to 3100 fold), and decreased the catalytic efficiency toward the Lys P-1 substrate (up to 10 fold). In addition, the results show that the catalytic efficiency of wild type enzyme can be 1341~~0 greatly improved toward any of the four P-1 substrates by mutagenesis of the P-1 binding site.
The changes in kcat/Km are caused predominantly by changes in 1/Km. Because 1/Km is approximately equal to 1/Ks, the enzyme-substrate association constant, the mutations primarily cause a change in substrate binding. These mutations produce sma7.ler effects on kcat that run parallel to the effects on 1/Km. The changes in kcat suggest either an alteration in binding in the P-1 binding site in going from the Michaelis-complex E~S) to the transition-state complex (E-S~) as previously proposed (Robertus, J.D., et al.
(1972) Biochemistry ~l_, 2439-2449: Robertus, J.D., et al. (1972) Biochemistr~r ~, 4293-4303), or change in the position of the scissile peptide bond over the catalytic serine in the E~S complex.
Changes in substrate preference that arise from changes in the net charge in the P-1 binding site show trends that are best accounted for by electrostatic effects (Figure 28). As the P-1 binding cleft becomes more positively charged, the average catalytic efficiency increases much more for the Glu P-1 substrate than for its neutral and isosteric P-1 homolog, Gln (Figure 28A). Furthermore, at the positive extreme both substrates have nearly identical catalytic efficiencies.
In contrast, as the P-1 site becomes more positively charged the catalytic efficiency toward the Lys P-1 substrate decreases, and diverges sharply from its neutral and isosteric homolog, Met (Figure 28B). The similar and parallel upward trend seen with increasing positive charge for the Met and Glu P-1 substrates probably results from the fact that all the substrates are succinylated on their amino-terminal end, and thus carry a formal negative charge.
The trends observed in log kcat/Km are dominated by changes in the Km term (Figures 28C and 28D). As the pocket becomes more positively charged, the log 1/Km values converge for Glu and Gln P-1 substrates (Figure 28C), and diverge for Lys and Met P-1 substrates (Figure 28D). Although less pronounced effects are seen in log kcat, the effects of P-1 charge on log kcat parallel those seen in log 1/Km a:nd become larger as the P-1 pocket becomes more positively charged.
This may result from the fact that the transition-state is a tetrahedral anion, and a net positive charge in the enzyme may serve to provide some added stabilization to the transition-state.
The effect of the change in P-1 binding-site charge on substrate preference can be estimated from the differences in slopes between the charged and neutral isosteric P-1 substrates (Figure 28B). The average change in substrate preference (olog kcat/Km) between charged and neutral isosteric substrates increases roughly 10-fold as the complementary charge or the enzyme increases (Table XV). When comparing Glu versus Lys, this difference is 100-fold and the change in substrate preference appears predominantly in the Km term .

Differential Effect on Binding Site Charge on log kcat/Km or (log 1/Km) for P-1 Substrates that Differ in Charge(a) Change in P-1 Binding flog kcat/Km (flog 1/Km) Site Charge(b) GluGln MetLys GluLys -2 to -1 n.d. 1.2 (1.2) n.d.

-1 to 0 0.7 (0.6) 1.3 (0.8) 2.1 (1.4) 0 to +1 1.5 (1.3) 0.5 (0.3) 2.0 (1.5) Avg. change in log kcat/K or (log 1/Km)mper unit charge change 1.1 (1.0) 1.0 (0.8) 2.1 (1.5) (a) The difference in the slopes of curves were taken between the P-1 substrates over the charge interval given for log (kcat/Km) (Figure 28A, B) and (log 1/Km) (Figure 28C, D). Values represent the differential effect a charge change has in distinguishing the substrates that are compared.
(b) Charge in P-1 binding site is defined as the sum of charges from positions 156 and 166.

The free energy of electrostatic interactions in the structure and energetics of salt-bridge formation depends on the distance between the charges and the microscopic dielectric of the media. 7.'o dissect these structural and microenvironmental effects, the energies involved in specific salt-bridges were evaluated. In addition to the possible salt-bridges shown (Figures 29A and 29B), reasonable salt-bridges can be built between a Lys P-1 substrate and Asp at position 166, and between a Glu P-1 substrate and a Lys at position 166 (not shown). Although only one of these structures is confirmed by X-ray crystalography (Poulos, T.L., et ~. (1976) J. Mol. Biol. 257 1097-1103), all models have favorable torsion angles (Sielecki, A.R., et al. (1979) J. Mol. Biol. 134, 781-804), and do not introduce unfavorable van der Waals contacts.
2p The change in charged P-1 substrate preference brought about by formation of the model salt-bridges above are shown in Table XVI.
JO

E

M M

.u a;
~. 0 ro a 0 +~

cu N -c ro O~N N +i +i v U

C tn 1 Li .~

ro ,ra r.,M o M N o a m .-~.-wo 0 c~
~-.C a oo N ~ w .-i .- m uwo o r w f.l O v-1.-iO r-1 r~1 .-1.-i.-1N
~

C. Ll.i r~

rr G

d x x \ \

M ero a ro ~r M crv a~ ro T7 E m o .-ic~ U oo M o o ~ U

-- vx N x x v U O N N N "' O .-~<VN N
\

1~ :; I 1 I 1 1 1 I I I
1~

rovro v i~r 0 O
f-.i U

+~ v -- m -., x ~

N .LI O 'a't' N 4 O N M M M d '~' v N ~ ~ M a~cr ov M vo m am o w U cn r~ ~ . . . . ~ . . . . . v o .-i o 0 0 ~ ~ 0 0 0 0 0 >

v G + 1 1 1 a + + 1 I i a v v v v v s~v b c~ a.+~ v ro ~ .u +~+~ +~ +~ .v .vr~ c s; v .-~ v v v v v v v v s~
ro roa, u~ U7 U1tl)U7 N N VIU7 W

1~ S-1.ta ~, ? W, ?, 7, ?~ ?,7, O

x ro ~ as a a a a a a ~~a w a o ascv ~n a v o ~o H v ~ ~ .~
v tr a.~"~ w o ~o ~o vo vc ~~c~o vo b N ri Ln U'1tn tn t0 lD ~.OlD ~D
~

..I ~ ~ m .-,.-~.-.,r., ro o w o~

v ro ro w .c~ w e ~c vc vo vo ~,cvo va o w e ~o~c ~c ~o ~ ~~ovo vo a s;

U ~O fn fl).-1~., U7 r-ItnU7 v c N a a c~ a a a a a w ro.C~ \ \ \ \ ~. \ '\\ \

W '~' t0 \O~D ~D l0 ~D 10~O ~O

w Tf ll1U1Lf1tf1 tf1 Lf1LC7tI11n ~ rir1 r-i '-i r-1r1ri r~1 ro ~ .~r, ~ .--~.-~,-~v C~ c~a c7 c~ a a cn c~

V

~n ~o ~ ~o ~o ~c ~o ~ ~o ~o v ~o w ~o ~ ~ ~o ~o~o ~o a. ~ ~, ~, n, a a~a ~n N fn fn.-1tl! tO .-1V7N ?, a a c~ a a ~ a a a w ', \ \ \ \ \ '\ \ \

r, a a ~ a a c~ a ~

1 34 a 2s o Footnotes to Table XVI:
(a) Molecular modeling shows it is possible to form a salt bridge between the indicated charged P-1 substrate and a complementary charge in the P-1 binding site of the enzyme at the indicated position changed.
(b) Enzymes compared have sterically similar amino acid substitutions that differ in charge at the indicated position.
(c) The P-1 substrates compared are structurally similar but differ in charge. The charged P-1 substrate is complementary to the charge change at the position indicated between enzymes 1 and 2.
(d) Date from Table XIV was used to compute the difference in log (kcat/Km) between the charged and the non-charged P-1 substrate (i.e., the substrate preference). The substrate preference is shown separately for enzyme 1 and 2.
(e) The difference in substrate preference between enzyme 1 (more highly charged) and enzyme 2 (more neutral) represents the rate change accompanying the electrostatic interaction.
The difference between catalytic efficiencies (i.e., olog kcat/Km) for the charged and neutral P-1 substrates (e. g., Lys minus Met or Glu minus Gln) give the substrate preference for each enzyme. The change in substrate preference (oolog kcat/I~m) between the charged and more neutral enzyme homologs (e. g., Glul56/Glyl66 minus G1n156(Q156)/G1y166) reflects the change in catalytic efficiency that may be attributed solely to electrostatic effects.
These results show that the average change in substrate preference is considerably greater when electrostatic substitutions are produced at position 166 (50-fold in kcat/Km) versus position 156 (12-fold in kcat/Km). From these oolog kcat/Km values, an average change in transition-state stabilization energy can be calculated of -1.5 and -2.4 kcal/mol for '134280 substitutions at positions 156 and 166, respectively.
This should represent the stabilization energy contributed from a favorable electrostatic interaction for the binding of free enzyme and substrate to form the transition-state complex.

Substitutions at Position 217 Tyr217 has been substituted by all other 19 amino acids. Cassette mutagenesis as de~~cribed in EPO
publication No. 0130756 was used according to the protocol of Figure 22. The EcoRV restriction site was used for restriction-purification of pG217.
Since this position is involved in substrate binding, mutations here effect kinetic parameters of the enzyme. An example is the substitution of Leu for Tyr at position 217. For the substrate sAAPFpNa, this mutant has a kcat of 277 5' and a Km o~f 4.7x10 4 with a kcat/Km ratio of 6x105. This represents a 5.5-fold increase in kcat with a 3-fold increase in Km over the wild type enzyme.
In addition, replacement of Tyr217 by hys, Arg, Phe or Leu results in mutant enzymes which are more stable at pHs of about 9-11 than the WT enzyme. Conversely, replacement of Tyr217 by Asp, Glu, Gly or Pro results in enzymes which are less stable at pHs of about 9-11 than the WT enzyme.

1 34~ 280 Multiple Mutants Having Altered Thermal Stabilitv _H. amyloliguefacien subtilisin does not contain any cysteine residues. Thus, any attempt to produce thermal stability by Cys cross-linkage required the substitution of more than one amino acid in subtilisin with Cys. The following subtilisin residues were multiply substituted with cysteine:
Thr22/Ser87 Ser24/Ser87 Mutagenesis of Ser24 to Cys was carried out with a 5' phosphorylated oligonucleotide primer having the sequence **
5'-pC-TAC-ACT-GGATGC-AAT-GTT-AAA-G-3'.
(Asterisks show the location of mismatches and the underlined sequence shows the position of the altered Sau3A site.) The ~. amyloliquefaciens subtilisin gene on a 1.5 kb EcoRI-BAMHI fragment from pS4.5 was cloned into M13mp11 and single stranded DNA was isolated.
This template (M13mp11SUBT) was double primed with the 5' phosphorylated M13 universal sequencing primer and the mutagenesis primer. Adelman, et al. (1983) DNA 2_, 183-193. The heteroduplex was transfected into competent JM101 cells and plaques were probed for the mutant sequence (Zoller, M.J., et al. (1982) Nucleic Acid Res. ~, 6487-6500: Wallace, et al. (1981) Nucleic Acid Res. ~, 3647-3656) using a tetramethylammonium chloride hybridization protocol (Wood, et ~. (1985) Proc. Natl. Acad. Sci. USA 82, 1585-1588). The Ser87 to Cys mutation was prepared in -loo-a similar fashion using a 5' phospho:rylated primer having the sequence 5'-pGGC-GTT-GCG-CCA-TGC-GCA-TCA-CT-3'.
(The asterisk indicates the position of the mismatch and the underlined sequence shows the position of a new MstI site.) The C24 and C87 mutations were obtained at a frequency of one and two percent, respectively. Mutant sequences were confirmed by dideoxy sequencing in M13.
Mutagenesis of Tyr21/Thr22 to A21/C22 was carried out with a 5' phosphorylated oligonucleotide primer having the sequence 5'-pAC-TCT-CAA-GGC-GCT-TGT-GGC-TCA-AAT-GTT-3'.
(The asterisks show mismatches to the wild type sequence and the underlined sequence shows the position of an altered Sau3A site.) Manipulations for heteroduplex synthesis were identical to those described for C24. Because direct cloning of the heteroduplex DNA fragment can yield increased frequencies of mutagenesis, the EcoRI-BamHI subtilisin fragment was purified and ligated into pBS42. E_. coli MM 294 cells were transfonaed with the ligation mixture and plasmid DNA was purified from isolated transformants. Plasmid DNA was screened for the loss of the Sau3A site at codon 23 that was eliminated by the mutagenesis primer. Two out of 16 plasmid preparations had lost the wild type Sau3A site. The mutant sequence was confirmed by dideoxy sequencing in M13.

X3412$0 -lol-Double mutants, C22/C87 and C24/C87, were constructed by ligating fragments sharing a common C aI site that separated the single parent cystine codons.
Specifically, the 500 by coRI-ClaI fragment containing the 5' portion of the subtilisin gene (including codons 22 and 24) was ligated with the 4.7 kb ClaI-EcoRI fragment that contained the 3' portion of the subtilisin gene (including codon 87) plus pBS42 vector sequence. E_. coli MM 294 was transformed with ligation mixtures and plasmid DNA was purified from individual transformants. Double-cysteine plasmid constructions were identified by restriction site markers originating from the parent cysteine mutants (i.e., C22 and C24, Sau3A minus: Cys87, MstI plus).
Plasmids from ~. poli were transformed into subtilis BG2036. The thermal stability of these mutants as compared to wild type subtilisin are presented in Figure 30 and Tables XVII and XVIII.

9341~~0 -l02-TABLE XVII
Effect of DTT on the Half-Time of Autolytic Inactivation of Wild-Type and Disulfide Mutants of Subtilisin*
S
t~
Enzyme -DDT +DTT -DTT/+DTT
min Wild-type 95 85 1.1 C22/C87 44 25 1.8 C24/C87 92 62 1.5 (*) Purified enzymes were either treated or not treated with 25mM DTT and dialyzed with or without lOmM DTT in 2mM CaCl2, 50mM Tris (pH 7.5) for 14 hr.
at 4°C. Enzyme concentrations were adjusted to 80u1 aliquots were quenched on ice and assayed for residual activity. Half-times for autolytic inactivation were determined from semi-log plots of l.ogl0 (residual activity) versus time. These plots were linear for over 90$ of the inactivation.

TABLE XVIII
Effect of Mutations in Subtilisin on the Half-Time of Autolytic Inactivation at 58'C*
Enzyme min Wild-type 120 (*) Half-times for autolytic inactivation were determined for wild-type and mutant subtilisins as described in the legend to Table III. Unpurified and non-reduced enzymes were used directly from _B.
subtilis culture supernatants.
The disulfides introduced into subtilisin did not improve the autolytic stability of the mutant enzymes when compared to the wild-type enzyme. However, the disulfide bonds did provide a margin of autolytic stability when compared to their corresponding reduced double-cysteine enzyme. Inspection of a highly refined x-ray structure of wild-type _B. amylolique-faciens subtilisin reveals a hydrogen bond between Thr22 and Ser87. Because cysteine is a poor hydrogen donor or acceptor (Paul, I.C. (1974) in Chemistry of the -SH Group (Patai, S., ed.) pp. 111-149, Wiley Interscience, New York) weakening of 22/87 hydrogen bond may explain why the C22 and C87 single-cysteine mutant proteins are less autolytica:lly stable than either C24 or wild-type (Table XVIII). The fact that C22 is less autolytically stable than C87 may be the result of the Tyr2lA mutation (Table XVIII). Indeed, ~ 341 28 0 construction and analysis of Tyr21/'C22 shows the mutant protein has an autolytic stability closer to that of C87. In summary, the C22 and C87 of single-cysteine mutations destabilize the protein toward autolysis, and disulfide bond formation increases the stability to a level less than or equal to that of wild-type enzyme.

Multiple Mutants Containing Substitutians at Position 222 and Position 166 or 169 Double mutants 166/222 and 169/222 were prepared by ligating together (1) the 2.3kb AcaII fragment from pS4.5 which contains the 5' portion of the subtilisin gene and vector sequences, (2) the 200bp AvaII
fragment which contains the relevant 166 or 169 mutations from the respective 166 or 169 plasmids, and (3) the 2.2kb vaII fragment which contains the relevant 222 mutation 3' and of the subtilisin genes and vector sequence from the respective p222 plasmid.
Although mutations at position 222 improve oxidation stability they also tend to increase the Km. An example is shown in Table XIX. In this case the A222 mutation was combined with the K166 mutation to give an enzyme with kcat and Km intermediate between the two parent enzymes.

TABLE XIX
kcat Km WT 50 1.4x10 4 A222 42 9.9x10 4 K166 21 3.7x10 5 K166/A222 29 2.0x10 4 substrate sAAPFpNa Multiple Mutants Containing Substitutions at Positions 50, 156, 166 217 and Combinations Thereof The double mutant 5156/A169 was prepared by ligation of two fragments, each containing one of the relevant mutations. The plasmid pS156 was cut. with XmaI and treated with S1 nuclease to create a blunt end at codon 167. After removal of the nuclease by phenol/chloroform extraction and ethanol precipita tion, the DNA was digested with BamHI and the approximately 4kb fragment containing the vector plus the 5' portion of the subtilisin gene through codon 167 was purified.
The pA169 plasmid was digested with RpnI and treated with DNA polymerise Klenow fragment plus 50 uM dNTPs to create a blunt end codon at codon 168. The Klenow was removed by phenol/chloroform extraction and ethanol precipitation. The DNA was digested with BamHI and the 590bp fragment including codon 168 through the carboxy terminus of the subtilisin gene 1 34~ 280 was isolated. The two fragments were then ligated to give S156/A169.
Triple and quadruple mutants were prepared by ligating together (1) the 220bp PvuII/HaeII fragment containing S the relevant 156, 166 and/or 169 mutations from the respective p156, p166 and/or p169 double of single mutant plasmid, (2) the 550bp HaeII/BamHI fragment containing the relevant 217 mutant from the respective p217 plasmid, and (3) the 3.9kb PvuII/BamHI fragment containing the F50 mutation and vector sequences.
The multiple mutant F50/S156/A169/L217, as well as B.
amyloliquefaciens subtilisin, B. lichenformis subtilisin and the single mutant L217 were analyzed with the above synthetic polypeptides where the P-1 amino acid in the substrate was Lys, His, Ala, Gln, Tyr, Phe, Met and Leu. These results. are shown in Figures 26 and 27.
These results show that the F50/5156/A7.69/L217 mutant has substrate specificity similar to that of the B.
licheniformis enzyme and differs dramatically from the wild type enzyme. Although only data for the L217 mutant are shown, none of the single mutants (e. g., F50, S156 or A169) showed this effect. Although B.
licheniformis differs in 88 residue positions from B.
amyloliauefaciens, the combination. of only these four mutations accounts for most of the differences in substrate specificity between the two enzymes.
JO

Subtilisin Mutants Having Altered Alkaline Stability A random mutagenesis technique was used to generate J
single and multiple mutations within the B.

-l07-amylolic~uefaciens subtilisin gene. Such mutants were screened for altered alkaline stability. Clones having increased (positive) alkaline stability and decreased (negative) alkaline stability were isolated and sequenced to identify the mutations within the subtilisin gene. Among the positive clones, the mutants V107 and 8213 were identified. These single mutants were subsequently combined to produce the mutant V107/R213.
One of the negative clones (V50) from the random mutagenesis experiments resulted in a marked decrease in alkaline stability. Another mutant (P50) was analyzed for alkaline stability to determine the effect of a different substitution at position 50.
The F50 mutant was found to have a greater alkaline stability than wild type subtilisin and when combined with the double mutant V107/R213 resulted in a mutant having an alkaline stability which reflected the aggregate of the alkaline stabilities for each of the individual mutants.
The single mutant 8204 and double mutant C204/R213 were identified by alkaline screening after random cassette mutagenesis over the region from position 197 to 228. The C204/R213 mutant was thereafter modified to produce mutants containing the individual mutations C204 and 8213 to determine the contribution of each of the individual mutations. Cassette mutagenesis using pooled oligonucleotides to substitute all amino acids at position 204, was utilized to determine which substitution at position 204 would maximize the increase in alkaline stability. The mutation from Lys213 to Arg was maintained constant for each of these substitutions at position 204.

1341?80 -l08-A. Construction of pB0180, an E. coli-B. subtilis Shuttle Plasmi<:
The 2.9 kb EcoRI-BamHI fragment from pBR327 (Covarrubias, L., et al. (1981) Gene 13, 25-35) was ligated to the 3.7kb EcoRI-BamHI fragment of pBD64 (Gryczan, T., et al. (1980) J. Bac:teriol., 141, 246-253) to give the recombinant plasmid pB0153. The unique EcoRI recognition sequence in pBD64 was eliminated by digestion with EcoRI followed by treatment with Klenow and deoxynucleotide triphosphates (Maniatis, T., et al. (eds.) (1982) in Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y.). Blunt end ligation and transformation yielded pB0154. The unique AvaI recognition sequence in pB0154 was eliminated in a similar manner to yield pB0171.
pB0171 was digested with BamHI and PvuII and treated with Klenow and deoxynucleotide tr:iphosphates to create blunt ends. The 6.4 kb fragment was purified, ligated and transformed into LE392 cells (Enquest, L.W., et al. (1977) J. Mol. Biol. 111, 97-120), to yield pB0172 which retains the unique BamHI site. To facilitate subcloning of subtilisin mui:ants, a unique and silent K~nI site starting at codon 166 was introduced into the subtilisin gene from pS4.5 (Wells, J.A., et al. (1983) Nucleic Acids Res., 11, 7911-7925) by site-directed mutagenesis. The K~mI+ plasmid was digested with EcoRI and treated with Klenow and deoxynucleotide triphosphates to create a blunt end.
The Klenow was inactivated by heating for 20 min at 68°C, and the DNA was digested with BamHI. The 1.5 kb blunt EcoRI-BamHI fragment containing the entire subtilisin was ligated with the 5.8 kb NruI-BamHI from pB0172 to yield pB0180. The ligation of the blunt NruI end to the blunt EcoRI end recreated an EcoRI

~~4~~80 site. Proceeding clockwise around pB0180 from the EcoRI site at the 5' end of the subtilisin gene is the unique BamHI site at the 3' end of the subtilisin gene, the chloramphenicol and neomycin resistance genes and UB110 gram positive replication origin derived from pBD64, the ampicillin resistance gene and gram negative replication origin derived from pBR327.
B' Construction of Random Mutagenesis Library The 1.5 kb EcoRI-BamHI fragment containing the B.
amyloliquefaciens subtilisin gene (Wel:Ls et al., 1983) from pB0180 was cloned into M13mp11 to give M13mp11 SUBT essentially as previously described (Wells, J.A., et al. (1986) J. Biol. Chem., 261,6564-6570).
Deoxyuridine containing template DNA was prepared according to Kunkel (Kunkel, T.A. (1985) Proc. Natl.
Acad. Sci. USA, 82 488-492). Uridine containing template DNA (Kunkel, 1985) was purified by CsCl density gradients (Maniatis, T. et al. (eds.) (1982) in Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y.). A
primer (AvaI ) having the sequence 5'GAAAAAAGACCCTAGCGTCGCTTA
ending at colon -11, was used to alter the unique AvaI
recognition sequence within the subtilisin gene. (The asterisk denates the mismatches from the wild-type sequence and underlined is the altered AvaI site.) The 5' phosphorylated AvaI primer (--320 pmol) and -40 pmol (-120ug) of uridine containing M13mp11 SUBT
template in 1.88 ml of 53 mM NaCl, 7.4 mM MgCl2 and 7.4 mM Tris.HCl (pH 7.5) were annealed by heating to -llo-90°C for 2 min. and cooling 15 min at 24°C (Fig. 31).
Primer extension at 24°C was initiated by addition of 100uL containing 1 mM in all four deoxynucleotide triphosphates, and 20,1 Klenew fragmer.~t (5 units/1).
The extension reaction was stopped every 15 seconds over ten min by addition of 10u1 0.25 M EDTA (pH 8) to 50,.1 aliquots of the reaction mixture.. Samples were pooled, phenol chlorophorm extracted and DNA was precipitated twice by addition of 2.5 vol 100$
ethanol, and washed twice with 70$ ethanol. The pellet was dried, and redissolved in 0.4 ml 1 mM EDTA, 10 mM Tris (pH 8).
Misincorporation of a-thiodeoxynucleotides onto the 3' ends of the pool of randomly terminated template was carried out by incubating four 0.2 ml solutions each containing one-fourth of the randomly terminated template mixture (-20ug), 0.25 mM of a given a-thiodeoxynucleotide triphosphate, :100 units AMV
Polymerase, 50 mM KCL, 10 mM MgCl2, 0.4 mM
dithiothreitol, and 50 mM Tris (pH F3.3) (Champoux, J.J. (1984) Genetics, 2, 454-464). After incubation at 37°C for 90 minutes, misincorporation reactions were sealed by incubation for five minutes at 37°C
with 50 mM all four deoxynucleotide triphosphates (pH
8), and 50 units AMV polymerase. Reactions were stopped by addition of 25 mM EDTA (final), and heated at 68°C for ten min to inactivate AMV polymerase.
After ethanol precipitation and resuspension, synthesis of closed circular hete:roduplexes was carried out for two days at 14°C under the same conditions used for the timed extension reactions above, except the reactions also contained 1000 units T4 DNA ligase, 0.5 mM ATP and 1 mM s-mercaptoethanol.
Simultaneous restriction of each het:eroduplex pool with K~nI, BamHI, and EcoRI confirmed that the extension reactions were nearly quantitative.
Heteroduplex DNA in each reaction mixture was methylated by incubation with 80uM.
S-adenosylmethionine and 150 units dam methylase for 1 hour at 37°C. Methylation reactions were stopped by heating at 68°C for 15 min.
One-half of each of the four methylated heteroduplex reactions were transformed into 2.5 ml competent E.
coli JM101 (Messing, J. (1979) Recombinant DNA Tech.
Bull., 2, 43-48). The number of independent transformants from each of the four transformations ranged from 0.4-2.0 x 105. After growing out phage pools, RF DNA from each of the four transformations was isolated and purified by centrifugation through CsCl density gradients. Approximately tug of RF DNA
from. each of the four pools was digested with EcoRI, BamHI and AvaI. The 1.5 kb EcoRI--BamHI fragment (i.e., AvaI resistant) was purified on low gel temperature agarose and ligated into the 5.5 kb EcoRI-BamHI vector fragment of pB0180. The total number of independent transformants from each a-thiodeoxynucleotide misincorporation plasmid library ranged from 1.2-2.4 x 104. The pool of plasmids from each of the four transformations was grown out in 200 ml LB media containing 12.5ug/ml cmp and plasmid DNA
was purified by centrifugation through CsCl density gradients.
C. Expression and Screening of Subtilisin Point Mutants Plasmid DNA from each of the four misincorporation pools was transformed (Anagnostopoulos, C., et al.
(1967), J. Bacteriol., 81, 741-746) into BG2036. For each transformation, 5ug of DNA produced approximately 1 341 2p 0 2.5 x 105 independent BG2036 transformants, and liquid culture aliquots from the four libraries were stored in 10% glycerol at 70'C. Thawed aliquots of frozen cultures were plated on LH/5~g/ml cmp,/1.6% skim milk plates (Wells, J.A., et al. (1983) Nucleic Acids Res., 7911-7925), and fresh colonies were arrayed onto 96-well microtiter plates containing 150 1 per well LB
media plus 12.5ug/ml cmp. After 1 h at room temperature, a replica was stamped (using a matched 96 prong stamp) onto a 132 mm BA 85 nitrocellulose filter (Schleicher and Scheull) which was layered on a 140 mm diameter LB/cmp/skim milk plate. Cells were grown about 16 h at 30°C until halos of proteolysis were roughly 5-7 mm in diameter and filters were transferred directly to a freshly prepared agar plate at 37°C containing only 1.6% skim milk and 50 mM
sodium phosphate pH 11.5. Filters were incubated on plates for 3-6 h at 37°C to produce halos of about 5 mm for wild-type subtilisin and were discarded. The Plates were stained for 10 min at 24'C with Coomassie blue solution (0.25% Coomassie blue (R-250) 25%
ethanol) and destained with 25% ethanol, 10% acetic acid for 20 min. Zones of proteolysis appeared as blue halos on a white background on the underside of the plate and were compared to the original growth plate that was similarly stained and destained as a control. Clones were considered positive that produced proportionately larger zones of proteolysis on the high pH plates relative to the original growth plate. Negative clones gave smaller halos under alkaline conditions. Positive and negative clones were restreaked to colony purify and screened again in triplicate to confirm alkaline pH results.

D. Identification and Analysis of Mutant Subtilisins Plasmid DNA from 5 ml overnight cultures of more alkaline active B.subtilis clones was prepared according to Birnboim and Doly (Birnboim, H.C., et al.
(1979) Nucleic Acid Res. 7, 1513) except that incubation with 2 mg/ml lysozyme proceeded for 5 min at 37°C to ensure cell lysis and an additional phenol/CHC13 extraction was employed to remove contaminants. The 1.5 kb EcoRI-E3amHI fragment containing the subtilisin gene was ligated into M13mp11 and template DNA was prepared for DNA
sequencing (Messing, J., et al. (1982) Gene, 19 269-276). Three DNA sequencing primers ending at codon 26, +95, and +155 were synthesized to match the subtilisin coding sequence. For preliminary sequence identification a single track of DNA sequence, corresponding to the dNTPaS misincorporation library from which the mutant came, was app?lied over the entire mature protein coding sequence (i.e., a single dideoxyguanosine sequence track was applied to identify a mutant from the dGTPas library). A
complete four track of DNA sequence was performed 200 by over the site of mutagenesis t.o confirm and identify the mutant sequence (Sanger, F., et al., (1980) J. Mol. Biol., 143, 161-178). Confirmed positive and negative bacilli clones were cultured in LB media containing l2.Sug/mL cmp and purified from culture supernatants as previously described (Estell, D.A., et al. (I985) J. Biol. Chem., 260, 6518-6521).
Enzymes were greater than 98$ pure as analyzed by SDS-polyacrylamide gel electrophoresis (Laemmli, U.K.
(1970), Nature, 227, 680-685), and protein concentrations were calculated from the absorbance at 280 nm, E~8~$ - 1.17 (Maturbara, H., et. al. (1965), J.
-Biol. Chem, 240, 1125-1130).

Enzyme activity was measured 'with 200~g/mL
succinyl-L-AlaL-AlaL-ProL-Phep-nitroanilide (Sigma) in O.1M Tris pH 8.6 or 0.1 M CAPS pH 10.8 at 25'C.
Specific activity (~ moles product/min-mg) was calculated from the change in absorbance at 410 nm from production of p-nitroaniline with time per mg of enzyme (E410 = 8,480 M-lcm-l; Del Man, E.G., et al.
(1979), Anal. Biochem., 99, 316-320). Alkaline autolytic stability studies were performed on purified enzymes (200~g/mL) in 0.1 M potassium phosphate (pH
12.0) at 37'C. At various times aliquats were assayed for residual enzyme activity (Wells, J.A., et al.
(1986) J. Biol. Chem., ~, 6564-6570)..
E. Results 1. Optimization and analysis of mutagenesis frequency A set of primer-template molecules that were randomly 3~-terminated over the subtilisin gene (Fig. 31) was produced by variable extension from a fixed 5'-primer (The primer mutated a unique AvaI site at codon 11 in the subtilisin gene). This was achieved by stopping polymerase reactions with EDTA after various times of extension. The extent and distribution of duplex formation over the 1 kb subtilisin gene fragment was assessed by multiple restriction digestion (not shown). For example, production of new HinfI
fragments identified when polymerase extension had proceeded past I1e110, Leu233, and Asp259 in the subtilisin gene.
Misincorporation of each dNTPas at randomly terminated 3' ends by AMV reverse transcriptase (Zakour, R.A., et al. (1982), Nature, ~9 , 708-710; Zakour, R.A., et al.
(1984), Nucleic Acids Res., ~?, 6615-6628) used 134~,~8p conditions previously described (Champoux, J.J., (1984), Genetics, ~, 454-464). The efficiency of each misincorporation reaction was estimated to be greater than 80% by the addition of each dNTPas to the AvaI
restriction primer, and analysis by polyacrylamide gel electrophoresis. Misincorporations were sealed by polymerization with all four dNTP's and closed circular DNA was produced by reaction with DNA ligase.
Several manipulations were employed to maximize the yield of the mutant sequences in the heteroduplex.
These included the use of a deoxyuri.dine containing template (Kunkel, T.A. (1985), Proc. Natl. Acad. Sci.
USA, 82 488-492; Pukkila, P.J. et al. (1983), Genetics, X04, 571-582), ~_n vi ro methylation of the mutagenic strand (Kramer, W. et al. (1982) Nucleic Acids Res., ~0 6475-6485), and the use of AvaI
restriction-selection against the wild-type template strand which contained a unique AvaI site. The separate contribution of each of these enrichment procedures to the final mutagenesis frequency was not determined, except that prior to vaI restriction-selection roughly one-third of the segregated clones in each of the four pools still retained a wild-type AvaI site within the subtilisin gene. After AvaI
restriction-selection greater than 98% of the plasmids lacked the wild-type AvaI site.
The 1.5 kb coRI-HamHI subtilisin gene fragment that was resistant to vaI restriction digestion, from each of the four CsCl purified M13 RF pools was isolated on low melting agarose. The fragment was ligated Win, situ from the agarose with a similarly cut ~. coli-H.
subtilis shuttle vector, p80180, and transformed directly into ~ coli LE392. Such direct ligation and transformation of DNA isolated from agarose avoided 1 34 ~ 2~ p loses and allowed large numbers of recombinants to be obtained (>100,000 per ug equivalent of input M13 pool) .
The frequency of mutagenesis for each of the four dNTPas misincorporation reactions was estimated from the frequency that unique restriction sites were eliminated (Table XX). The unique restriction sites chosen for this analysis, ClaI, PvuII, and K~nI, were distributed over the subtilisin gene starting at codons 35, 104, and 166, respectively. As a control, the mutagenesis frequency was determined at the PstI
site located in the S lactamase gene which was outside the window of mutagenesis. Because the absolute mutagenesis frequency was close to the' percentage of undigested plasmid DNA, two rounds of restriction-selection were necessary to reduce the' background of surviving uncut wild-type plasmid DNA below the mutant plasmid (Table XX). The background of surviving plasmid from wild-type DNA probably represents the sum total of spontaneous mutations, uncut wild-type plasmid, plus the efficiency with which linear DNA can transform E. coli. Subtracting the frequency for unmutagenized DNA (background) from the frequency for mutant DNA, and normalizing for i:he window of mutagenesis sampled by a given restriction analysis (4-6 bp) provides an estimate of t:he mutagenesis efficiency over the entire coding sequence (-1000 bp).
JO

13~~ 280 a-thiol Restriction$ clonesc$ :resistant~
resistant ~
misincor- Site 1st 2nd clones overts per poratsd(b)Selection roundroundTotal Ba~kgroundd10.
OObpe None PstI 0.32 0.7 0.002 0 -G PstI 0.33 1.0 0.003 0.001 0.2 T PstI 0.32 <0.5 <0.002 0 0 C PstI 0.43 3.0 0.013 0.011 3 None ClaI 0.28 5 0.014 0 -G ClaI 2.26 85 1.92 1.91 380 T ClaI 0.48 31 0.15 0.14 35 C ClaI 0.55 15 0.08 0.066 17 None PvuII 0.08 29 0.023 0 -G PvuII 0.41 90 0.37 0.35 88 T PvuII 0.10 67 0.067 0.044 9 C PvuII 0.76 53 0.40 0.38 95 None K~nI 0.41 3 0.012 0 -G K~~nI 0.98 35 0.34 0.33 83 T K~nI 0.36 15 0.054 0.042 8 C K~nI 1.47 26 0.38 0.37 93 (a) Mutagenesis frequency is estimated from the frequency for obtaining mutations theft alter unique restriction sites within the mutagenized subtilisin gene (i.e., ClaI, PvuII, or KpnI) compared to mutation frequencies of the Pstl site, that is outside the window of n~utagenesis.
(b) Plasmid DNA was from wild-type (none) or mutagenized by dNTPas misincorporation as described.
(c) Percentage of resistant clones was calculated from the fraction of clones obtained after three fold or greater over-digestion of the plasmid with the indicated restriction enzyme compared to a ~ 341 28 0 non-digested control. Restriction-resistant plasmid DNA from the first round was subjected to a second round of restriction-selection. The total represents the product of the fractions of resistant clones obtained from both rounds of selection and gives percentage off' restriction-site mutant clones in the original starting pool. Frequencies were derived from counting at least 20 colonies and usually greater than 100.
(d) Percent resistant clones was calculated by subtracting the percentage of restriction-resistant clones obtained for wild-type DNA (i,.e., none) from that obtained for mutant DNA.
(e) This extrapolates from the frequency of mutation over each restriction site to the entire subtilisin gene (-1 kb). This has been normalized to the number of possible bases (4-6 bp) within each restriction site that can be mutagenized by a given misincorporation event.
From this analysis, the average percentage of subtilisin genes containing mutations that result from dGTPas, dCTPas, or dTTPas misincorporation was estimated to be 90, 70, and 20 percent, respectively.
These high mutagenesis frequencies were generally quite variable depending upon the dNTPas and misincorporation efficiencies at this site.
Misincorporation efficiency has been reported to be both dependent on the kind of mismatch, and the context of primer (Champoux, J.J., (1984); Skinner, J.A., et al. (1986) Nucleic Acids Res., 14, 6945-6964). Biased misincorporation efficiency of dGTPas and dCTPas over dTTPas has been previously observed (Shortle, D., et al. (1985), Genetics, 110, 539-555). Unlike the dGTPas, dCTPas, and dTTPas libraries the efficiency of mutagenesis for the dATPas misincorporation library could not be accurately assessed because 90$ of the restriction-resistant plasmids analyzed simply lacked the aubtilisin gene insert. This problem probably arose from self-ligation of the vector when the dATPas mutagenized subtilisin gene was subcloned from M13 into pB0180. Correcting for the vector background, we estimate the mutagenesis frequency around 20 percent in the dATPas misincorporation library. In a separate experiment (not shown), the mutagenesis efficiencies for dGTPas and dTTPas misincorporation were estimated to be around 50 and 30 percent, respectively, based on the frequency of reversion of an inactivating mutation at codon 169.
The location and identity of each mutation was determined by a single track of DNA sequencing corresponding to the misincorporated athiodeoxy-nucleotide over the entire gene followed by a complete four track of DNA sequencing focused over the site of mutation. Of 14 mutants identified, the distribution was similar to that reported by Shortle and Lin (1985) except we did not observe nucleotide insertion or deletion mutations. The proportion of AG mutations was highest in the G misincorporation library, and some unexpected point mutations appeared in the dTTPas and dCTPas libraries.
2. Screening and Identification of Alkaline Stabilitv Mutants of Subtilisin It is possible to screen colonies producing subtilisin by halos of casein digestion (Wells, J.A. et al.
(1983) Nucleic Acids Res., 11, 7911-7925). However, two problems were posed by screening colonies under high alkaline conditions (>pH ll). First, B, subtilis will not grow at high pH, and we have been unable to transform an alkylophilic strain of bacillus. This problem was overcome by adopting a replica plating strategy in which colonies were grown on filters at neutral pH to produce subtilisin and filters subsequently transferred to casein plates at pH 11.5 to assay subtilisin activity. However,, at pH 11.5 the casein micelle no longer formed a turbid background and thus prevented a clear observation of proteolysis halos. The problem was overcome by briefly staining the plate with Coomassie blue to amplify proteolysis zones and acidifying the plates to develop casein micell turbidity. By comparison of the halo size produced on the reference growth plate (pH 7) to the high pH plate (pH 11.5), it was possible to identify mutant subtilisins that had increased (positives) or decreased (negatives) stability under alkaline conditions.
Roughly 1000 colonies were screened from each of the four misincorporation libraries. The percentage of colonies showing a differential loss of activity at pH
11.5 versus pH 7 represented 1.4, 1.8, 1.4, and 0.6%
of the total colonies screened from the thiol dGTPas, dATPas, dTTPas, and dCTPas libraries, respectively.
Several of these negative clones were sequenced and all were found to contain a single base change as expected from the misincorporation library from which they came. Negative mutants included A36, E170 and V50. Two positive mutants were identified as V107 and 8213. The ratio of negatives to positives was roughly 50:1.

~~41280 3. Stability and Activity of Subtilisin Mutants at Alkaline pH
Subtilisin mutants were purified and their autolytic stabilities were measured by the time course of inactivation at pH 12.0 (Figs. 32 and 33). Positive mutants identified from the screen (i.e., V107 and 8213) were more resistant to alkaline induced autolytic inactivation compared to wild-type; negative mutants (i.e., E170 and V50) were less resistant. We had advantageously produced another mutant at position 50 (F50) by site-directed mutagenesis. This mutant was more stable than wild-type enzyme to alkaline autolytic inactivation (Fig. 33) At the termination of the autolysis study, SDS-PAGE analysis confirmed that each subtilisin variant had autolyzed to an extent consistent with the remaining enzyme activity.
The stabilizing effects of V107, 8213, and F50 are cumulative. See Table XXI. The double mutant, V107/R213 (made by subcloning the 920 by EcoRI-K~nI
fragment of pB0180V107 into the 6.6 kb EcoRI-K~.nI
fragment of pB0180R213), is more stable than either single mutant. The triple mutant, F50/V107/R213 (made by subcloning the 735 by coRI-PvuII fragment of pF50 (Example 2) into the 6.8 kb coRI-PvuII fragment of pH0180/V107, is more stable than the double mutant V107/R213 or F50. The inactivation curves show a biphasic character that becomes more pronounced the more stable the mutant analyzed. This may result from some destablizing chemical modifications) (eg., deamidation) during the autolysis study and/or reduced stabilization caused by complete digestion of larger autolysis peptides. These alkaline autolysis studies have been repeated on separately purified enzyme batches with essentially the same results. Rates of autolysis should depend both on the conformational '134180 stability as well as the specific activity of the subtilisin -variant (Wells, J.A., et al. (1986), J.
Biol. Chem., X61, 6564-6570). It was therefore possible that the decreases in autolytic inactivation rates may result from decreases in specific activity of the more stable mutant under alkaline conditions.
In general the opposite appears to be the case. The more stable mutants, if anything, have a relatively higher specific activity than wild-type under alkaline conditions and the less stable mutants have a relatively lower specific activity. These subtle effects on specific activity for V107/R213 and F50/V107/R213 are cumulative at both pH 8.6 and 10.8.
The changes in specific activity may reflect slight differences in substrate specificity, however, it is noteworthy that only positions 170 and 107 are within 6A of a bound model substrate (Robertus, J.D., et al.
(1972), Biochemistry 1~, 2438-2449).

134'e80 TABLE XXI
Relationship between relative specific acitivity at pH 8 6 or 10.8 and alkaline autolytic stabilitv Alkaline Relative ecific activitw autolysis sp half-time En2~rme ~H 8 . 6 pH 10 . 8 _ (mint' b Wild-type 1001 1003 86 ~a~ Relative specific activity was t:he average from triplicate activity determinations divided by the wild-type value at the same pH. The .average specific activity of wild-type enzyme at pH 8.6 and 10.8 was 70~moles/min-mg and 37~moles/min-mg, respectively.
~b~ Time to reach 50% activity was taken from Figs. 32 and 33.

1~4~~80__ F. Random Cassette Mutagenesis of Residues 197 throuclh 228 Plasmid pe222 (Wells, et al. (1985) en ~, 315-323) was digested with ~stI and ~amHI and the 0.4 kb PstI/BamHI fragment (fragment 1, see Fig. 34) purified from a polyacrylamide gel by electroelution.
The 1.5 kb coRI/BamIiI fragment from pS4.5 was cloned into M13mp9. Site directed mutagenesis was performed to create the A197 mutant and simultaneously insert a silent SstI site over codons 195-196. The mutant EcoRI/BamHI fragment was cloned back into pBS42. The pA197 plasmid was digested with $amFiI and Sstl and the 5.3 kb BamFiI/SstI fragment (fragment 2) was purified from low melting agarose.
Complimentary oligonucleotides were synthesized to span the region from SstI (codons 195-196) to PstI
(codons 228-230). These oligodeoxynucleotides were designed to (1) restore codon 197 to the wild type, (2) re-create a silent KpnI site present in po222 at codons 219-220, (3) create a silent SmaI site over codons 210-211, and (4) eliminate the ~stI site over codons 228-230 (see Fig. 35). Oligodeoxynucleotides were synthesized with 2% contaminating nucleotides at each cycle of synthesis, e.g., dATP reagent was spiked with 2% dCTP, 2% dGTP, and 2% dTTP. Far 97-mers, this 2% poisoning should give the following percentages of non-mutant, single mutants and double or higher mutants per strand with two or more misincorporations per complimentary strand: 14% non-mutant, 28% single mutant, and 57% with a2 mutations, according to the general formula n f n!

where ~ is the average number of mutations and n is a number class of mutations and f is the fraction of the total having that number of mutations., Complimentary oligodeoxynucleotide pools were phosphorylated and annealed (fragment 3) and then ligated at 2-fold molar excess over fragments 1 and 2 in a three-way ligation.
coli I~i294 was transformed with the ligation reaction, the transformation pool grown up over night and the pooled plasmid DNA was isolated. This pool represented 3.4 x 104 independent transformants. This plasmid pool was digested with ~I and then used to retransform ,~. co i. A second plasmid pool was prepared and used to transform ~. subtilis (BG2036).
Approximately 40% of the BG2036 transformants actively expressed subtilisin as judged by halo-clearing on casein plates. Several of the non-expressing transformants were sequenced and found to have insertions or deletions in the synthetic cassettes.
Ey~pressing BG2036 mutants were arrayed in microtiter dishes with 1501 of LB/12.5~g/mL chloramphenicol (cmp) per well, incubated at 37'C for 3-4 hours and then stamped in duplicate onto nitrocellulose filters laid on LB 1.5% skim milk/5~g/mL cmp plates and incubated overnight at 33'C (until halos were approximately 4-8 mm in diameter). Filters were then lifted to stacks of filter paper saturated with 1 x Tide commercial grade detergent, 50 mM Na2C03, pH
11.5 and incubated at 65'C for 90 min. Overnight growth plates were Commassie stained and destained to establish basal levels of expression. After this treatment, filters were returned to pIi7/skim milk/20~g/mL tetracycline plates and incubated at 37'C
for 4 hours to overnight.

Mutants identified by the high pH stability screen to be more alkaline stable were purified and analyzed for autolytic stability at high pH or high temperature.
The double mutant C204/R213 was more stable than wild type at either high pH or high temperature (Table XXII).
This mutant was dissected into single mutant parents (C204 and 8213) by cutting at the unique SmaI
restriction site (Fig. 35) and either ligating wild type sequence 3' to the m~I site to create the single C204 mutant or ligating wild type sequence 5' to the SmaI site to create the single 8213 mutant. Of the two single parents, C204 was nearly as alkaline stable as the parent double mutant (C04/R213) and slightly more thenaally stable. See Table x:XII. The 8213 mutant was only slightly more stable than wild type under both conditions (not shown).
Another mutant identified from the screen of the 197 to 228 random cassette mutagenesis was 8204. This mutant was more stable than wild type at both high pH
and high temperature but less stable than C204.
'0 J

TABLE XXII
Stabili~ of subtilisin variants Purified enzymes (200~g/mL) were incubated in O.1M
phosphate, pH 12 at 30'C for alkaline autolysis, or in 2mM CaCl2, 50mM MOPS, pH 7.0 at 62'C for thermal autolysis. At various times samples were assayed for residual enzyme activity. Inactivations were roughly pseudo-first order, and t 1/2 gives the time it took to reach 50% of the starting activity in two separate experiments.
t 1/2 t 1/2 (alkaline (thermal autolysis) autolysis) Exp. Exp. Exp. Exp.

Subtilisin variant ~1 ~2 ~1 ~2 wild type 30 25 20 23 G. Random Mutagenesis at Codon 204 Based on the above results, codon 204 was targeted for random mutagenesis. Mutagenic DNA cassettes (for codon at 204) all contained a fixed 8213 mutation which was found to slightly augment the stability of the C204 mutant.

Plasmid DNA encoding the subtilisin mutant C204/R213 was digested with ~stl and coRI and a 1.0 kb EcoRI/SstI fragment was isolated by electro-elution from polyacrylamide gel (fragment 1, see Fig. 35).
C204/R213 was also digested with ma7: and coRI and the large 4.7 kb fragment, including vector sequences and the 3' portion of coding region, was isolated from low melting agarose (fragment 2, see Fig. 36).
Fragments 1 and 2 were combined in. four separate three-way legations with heterophosphorylated fragments 3 (see Figs. 36 and 37). This hetero-phosphorylation of synthetic duplexes should preferentially drive the phosphorylated strand into the plasmid legation product. Four plasmid pools, corresponding to the four legations, were restricted with SmaI in order to linearize any single cut C204/R213 present from fragment 2 isolation, thus reducing the background of C204/R213. E_. coli was then re-transformed with SmaI-restricted plasmid pools to yield a second set of plasmid pools which are essentially free of C204/R213 and any non-segregated heterduplex material.
These second enriched plasmid pools were then used to transfona ~. subtilis (BG2036) and the resulting four mutant pools were screened for clones expressing subtilisin resistant to high pFi/temperature inactivation. Mutants found positive by such a screen were further characterized and identified by sequencing.
The mutant L204/R213 was found to be slightly more stable than the wild type subtilisin. See Table XXII.

Having described the preferred embodiments of the present invention, it will appear to those ordinarily skilled in the art that various modifications may be made to the disclosed embodiments, and that such modifications are intended to be within the scope of the present invention.

Claims (38)

1. A substantially pure subtilisin-related protease derived by the replacement of one or more amino acid residues of a precursor subtilisin-related protease with a different naturally occurring amino acid, said one or more amino acid residues replaced being selected from the. group of equivalent amino acid residues of subtilisin naturally produced by Bacillus amyloliquefaciens consisting of Tyr21, Thr22, Ser24, Asp36, Gly46, Ala48, Ser49, Met50, Asn77, Ser87, Lys94, Val95, Leu96, Ile107, Gly110, Met124, Lys170, Tyr171, Pro172, Asp197, Met199, Ser204, Lys213, His67, Leu126, Leu135, Gly97, Ser101, G1y102, Gln103, Gly127, Gly128, Pro129, Tyr214 and Gly215.

2. The subtilisin-related protease of claim 1 wherein said group of equivalent residues consists of Tyr21, Thr22, Ser24, Asp36, Gly46, Ala48, Ser49, Met50, Asn77, Ser87, Lys94, Val95, Leu96, Ile107, Gly110, Met124, Lys170, Tyr171, Pro172, Asp197, Met199, Ser204 and Lys213.

3. The subtilisin-related protease of claim 1 wherein said selected amino acid residue of said precursor is replaced with an amino acid residue selected from those listed in Tables I and II for said selected residues.

4. The subtilisin-related protease of claim 2 wherein said selected amino acid residue of said precursor is replaced with an amino acid residue selected from those listed in Table I for said selected residue.

5. A substantially pure subtilisin-related protease having an amino acid sequence derived from the amino acid sequence of a precursor subtilisin-related protease by the substitution of a different naturally occurring amino acid for a combination of two or more amino acid residues of said amino acid sequence of said precursor subtilisin-related protease, provided that one of said amino acid residues replaced is selected from the first group of equivalent amino acid residues of subtilisin naturally produced by Bacillus amyloliquefaciens consisting of Tyr21, Thr22, Ser24, Asp36, Gly46, Ala48, Ser49, Met50, Asn77, Ser87, Lys94, Va195, Leu96, Ile107, Gly110 Met124, Lys170, Tyr171, Pro172, Asp197, Met199, Ser204, Lys213, His67, Leu126, Leu135, Gly97, Ser101, Gly102, Gln103, Leu126, Gly127, Gly128, Pro129, Tyr214 and Gly215 and further provided that one of said amino acid residues replaced is selected from the group of equivalent amino acid residues of subtilisin naturally produced by Bacillus amyloliquefaciens consisting of Asp32, Ser33, His64, Tyr104, Ala152, Asn155, Glu156, Gly166, Gly169, Phe189, Tyr217 and Met222.

6. The subtilisin-related protease of claim 5 wherein one of said selected amino acid residues in raid precursor is replaced with an amino acid residue selected from those listed in Tables I and II for said selected residue.

7. The subtilisin-related protease of claim 5 wherein one of said selected amino acid residues in said precursor is replaced with an amino acid residue selected from those listed in Table I for said selected residue.

8. A substantially pure subtilisin-related protease derived by the replacement of one or more amino acid residues of a precursor subtilisin-related protease with a different naturally occurring amino acid, said subtilisin-related protease being modified in at least substrate specificity as compared to said precursor, said amino acid residues replaced being selected from the group of equivalent amino acid residues of subtilisin naturally produced by Bacillus amyloliquefaciens consisting of His67, Ile107, Leu135, G1y97 through Gln103, Leu126 through Pro129, Lys213 through Gly215, Gly153, Asn154, Gly157 through Val165, Tyr167, Pro168 and Lys170 through Pro172.

9. The subtilisin-related protease of claim 8 further comprising the substitution of one or more additional amino acid residues selected from the group of equivalent amino acid residues of subtilisin naturally produced by Bacillus amyloliquefaciens consisting of Tyr104, Ala152, Glu156, Gly166, Gly169, Phe189 and Tyr217.

10. A substantially pure subtilisin-related protease derived by the replacement of one or more amino acid residues of a precursor subtilisin-related protease with a different naturally occurring amino acid, said subtilisin-related protease being altered in at least alkaline stability as compared to said precursor, said amino acid residues replaced being selected from the group of equivalent amino acid residues of subtilisin naturally produced by Bacillus amyloliquefaciens consisting of Asp36, Ile107, Lys170, Asp197, Ser204, Lys213, Ser24, and Met50.

11. A substantially pure subtilisin-related protease of claim 10 further comprising the substitution of a second amino acid residue selected from the group equivalent amino acid residues of subtilisin naturally produced by Bacillus amyloliquefaciens consisting of Glu156, Gly166, Gly169, Tyr217 and Met222.

12. A substantially pure subtilisin-related protease derived by the replacement of one or more amino acid residues of a precursor subtilisin-related protease with a different naturally occurring amino acid, said subtilisin-related protease being modified in at least thermal stability as compared to said precursor, said amino acid residues replaced being selected from the group of equivalent amino acid residues of subtilisin naturally produced by Bacillus amyloliquefaciens consisting of Asp36, Ile107, Lys170, Ser204, Lys213, Met199 and Tyr21.

13. A substantially pure subtilisin-related protease derived by the replacement of one or more amino acid residues of a precursor subtilisin-related protease with a different naturally occurring amino acid, said subtilisin-related protease being modified in at least oxidative stability as compared to said precursor, said amino acid residues replaced being selected from the group of equivalent amino acid residues of subtilisin naturally produced by Bacillus amyloliquefaciens consisting of Met50 and Met124.

14. The subtilisin-related protease of claim 13 further comprising the substitution of a second amino acid residue comprising Met222.

15. A substantially pure subtilisin-related protease derived from the amino acid sequence of a precursor subtilisin-related protease by a combination of substitutions of two or more amino acid residues in said precursor equivalent to amino acid residues of subtilisin naturally produced by Bacillus amyloliquefaciens, wherein said subtilisin-related protease being modified in at least thermal stability as compared to said precursor and wherein said combination of substitutions of two or more amino acid residues is selected from the group consisting of Thr22/Ser87, Ser24/Ser87 and Tyr21/Thr22/Ser87.

16. The subtilisin-related protease of claim 15 wherein said Thr22, Ser24 and Ser87 are substituted with cysteine.

17. A substantially pure subtilisin-related protease having amino acid sequence derived from the amino acid sequence of a precursor subtilisin-related protease by a combination of substitutions of two or more amino acid residues in said precursor equivalent to amino acid residues of subtilisin naturally produced by Bacillus amyloliquefaciens, said subtilisin-related protease having at least modified oxidative stability as compared to said precursor, said combination of substitutions of two or more amino acid residues being selected from the croup consisting of Met50/Met124, Met50/Met222, Met124/Met222 and Met50/Met125/Met222.

18. The subtilisin-related protease of claim 17 wherein said Met50 is substituted with Phe, said Met124 is substituted with Ile or Leu and said Met222 is substituted with Gln.

19. A substantially pure subtilisin-related protease derived from the amino acid sequence of a precursor subtilisin-related protease by a combination of substitutions of two or more amino acid residues in said precursor equivalent to amino acid residues of subtilisin naturally produced by Bacillus amyloliquefaciens, said subtilisin-related protease having at least altered oxidative stability and substrate specificity as compared to said precursor, wherein said combination of substitutions of two or more amino acid residues is selected from the group consisting of Gly166/Met222 and Gly169/Met222.

20. The subtilisin-related protease of claim 19 wherein said Gly166 is substituted with Ala, Phe, Lys and Val, and said Met222 is substituted with Ala or Cys.

21. A substantially pure subtilisin-related protease derived from the amino acid sequence of a precursor subtilisin-related protease by a combination of substitutions of two or more amino acid residues in said precursor equivalent to amino acid residues of subtilisin naturally produced by Bacillus amyloliquefaciens, said subtilisin-related protease having at least improved enzyme performance as compared to said precursor, wherein said combination of substitution of two or more amino acid residues comprises Glu156 and Gly166.

22. The subtilisin-related protease of claim 21 wherein said Glu156 is substituted with Gln or Ser and said Gly166 is substituted with Lys.

23. A substantially pure subtilisin-related protease derived from the amino acid sequence of a precursor subtilisin-related protease by a combination of substitutions of two or more amino acid residues in said precursor equivalent to amino acid residues of subtilisin naturally produced by Bacillus amyloliquefaciens, said subtilisin-related protease having at least altered substrate specificity and kinetics as compared to said precursor, wherein said combination of substitutions of two or more amino acid residues is selected from the group consisting of Glu156/Gly169/Tyr217, Gly156/Gly166/Tyr217 and Glu156/Tyr217.

24. The subtilisin-related protease of claim 23 further comprising the substitution of Met50 with Phe.

25. The subtilisin-related protease of claim 23 wherein said Glu156 is substituted with Ser or Gln, said Gly169 is substituted with Ala and said Tyr217 is substituted with Leu.

26. A substantially pure subtilisin-related protease derived from the amino acid sequence of a precursor subtilisin-related protease by a combination of substitutions of two or more amino acid residues in said precursor equivalent to amino acid residues of subtilisin naturally produced by Bacillus amyloliquefaciens, said subtilisin-related protease having at least modified alkaline or thermal stability as compared to said precursor, wherein said combination of substitution of two or more amino acid residues is selected from the group consisting of Ile107/Lys213, Ser204/Lys213, Glu156/Gly166, Met50/Glu156/Gly169/Tyr217 and Met50/Ile107/Lys213.

27. The subtilisin-related protease of claim 26 wherein said Ile107 is substituted with Val, said Lys213 is substituted with Arg, said Glu156 is substituted with Gln or Ser, said Gly166 is substituted with Lys or Asn, and said Gly169 is substituted with Ala.

28. A substantially pure subtilisin-related protease derived from the amino acid sequence of a precursor subtilisin-related protease by a combination of substitutions of two or more amino acid residues in said precursor equivalent to amino acid residues of subtilisin naturally produced by Bacillus amyloliquefaciens, wherein said combination of substitutions of two or more amino acid residues is selected from the group consisting of Thr22/Ser87, Ser24/Ser87, Ala45/Ala48, Ser49/Lys94, Ser49/Va195, Met50/Va195, Met50/Gly110, Met50/Met124, Met50/Met222, Met124/Met222, Glu156/G1y166, Glu156/Gly169, Gly166/Met222, Gly169/Met222, Tyr21/Thr22, Met50/Met124/Met222, Tyr21/Thr22/Ser87, Met50/Glu156/G1y166/Tyr217, Met50/G1u156/Tyr217, Met50/Glu156/Gly169/Tyr217, Met50/Ile107/Lys213, Ser204/Lys213, and Ile107/Lys213.

29. The subtilisin-related protease of claim 28 wherein said selected combination of residues are replaced with an amino acid residue selected from those listed in Table IV.

30. A substantially pure subtilisin-related protease derived from the amino acid sequence of a precursor subtilisin-related protease by the deletion of one or more amino acid residues in said precursor equivalent to amino acid residues of subtilisin naturally produced by Bacillus amyloliquefaciens, wherein said one deleted residue is selected from the group consisting of Ser161,, Ser162, Ser163 and Thr164.

31. The subtilisin-related protease of claim 30 wherein said deletion comprises .DELTA.161-164.

32. The subtilisin-related protease of claims 1 or 5 wherein said precursor is a Bacillus subtilisin.

33. The subtilisin-related protease of claim 32 wherein said Bacillus subtilisin is Bacillus amyloliquefaciens subtilisin.

34. The subtilisin-related protease of claim 33 resulting form the expression of DNA encoding said protease.

35. A substantially pure subtilisin-related protease derived by the replacement of one or more amino acid residues of a precursor subtilisin-related protease with a different naturally occurring amino acid, said one or more amino acid residues replaced being selected from the group of equivalent amino acid residues of subtilisin naturally produced by Bacillus amyloliquefaciens consisting of Met50, Ile107, Ser204, Lys213, Met124 + Met222, Met50 + Met124 + Met222, Thr22 + Ser87, Ser24 + Ser87, Met50 + Glu156 + Gly169 +
Tyr217, Ile107 + Lys213, Ser204 + Lys213, and Met50 + Ile107 +
Lys213, wherein the amino acid substitution at position Met50 is Phe, the substitution at position Il107 is Val, the substitution at position Ser204 is Cys, Leu or Arg, the substitution at position Lys213 is Arg, the substitution at position Met124 is Ile, the substitution at position Met222 is any amino acid, the substitution at position Thr22 is Cys, the substitution at position Ser87 is Cys, the substitution at Ser24 is Cys, the substitution at position G:Lu156 is Ser, the substitution at position Gly169 is Ala, and the substitution at position Tyr217 is Leu.

36. DNA encoding the subtilisin-related protease of claims 1 or 5.

37. Expression vector containing the DNA of claim 35.

38. Host cell transformed with the expression vector of claim 36.