CA1340853C - Purification of recombinant interleukin-2 - Google Patents
Purification of recombinant interleukin-2Info
- Publication number
- CA1340853C CA1340853C CA000470498A CA470498A CA1340853C CA 1340853 C CA1340853 C CA 1340853C CA 000470498 A CA000470498 A CA 000470498A CA 470498 A CA470498 A CA 470498A CA 1340853 C CA1340853 C CA 1340853C
- Authority
- CA
- Canada
- Prior art keywords
- cell membrane
- membrane components
- solution
- detergent
- salt
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Lifetime
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/70—Vectors or expression systems specially adapted for E. coli
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/52—Cytokines; Lymphokines; Interferons
- C07K14/54—Interleukins [IL]
- C07K14/55—IL-2
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K38/00—Medicinal preparations containing peptides
Abstract
Method for the preparation of substantially homogeneous recombinant mature human IL-2 comprising separating the cell membrane components from a lysate of transformed microorganisms which have expressed and accumulated IL-2, extracting IL-2 from the cell membrane components and purifying chromatographyically the extract.
Description
Human interleukin-2 (I1-2), formerly called T-cell growth factor, is a soluble protein which can be produced from T-cells activated with a lectin or an antigen and which is capable of modulating lymphocyte reactivity and promoting the long-term in vitro culture of antigen-specific effector T-lymphocytes. IL-2 is also known to enhance thymocyte mito-genesis and to induce cytotoxic T-lymphocyte reactivity.
Accordingly, this lymphocyte regulatory substance is useful in potentiating humoral and cellular immune responses and in restoring immune deficient state to a normal humoral and cellular immune state. These identified immunological acti-vities of IL-2 indicate that IL-2 is useful for medical immunotherapy against immunological disorders including neo-plastic diseases, bacterial or viral infections, immure deficient diseases, autoimmune diseases etc. (Papermaster, B. et al., Adv. Immunopharm., 507, [1980]). Recently, a review article in the Journal of The American Medical Asso-ciation, Vol. 249, No. 2 at pages 166-171 (January 14, 1983) discusses the clinical applications of various lymphokines including particularly human IL-2.
Human IL-2 derived from induced human malignant cells has recently been purified to homogeneity using multiple high performancee liquid chromatography (HPLC) steps. The resulting homogeneous human IL-2 demonstrated a specific activity of about 1.4 x 109 units/mg (see e.g. European patent application No. 83.109202.8, publication No. 106 179).
Taniguchi et al. reported on the cloning and sequencing of the IL-2 gene and expression of the immature form of human Interleukin-2 at the Third Annual Recombinant DNA
congress in Philadelphia, Pennsylvania on February 9, 1983 ~~4.~8~~
Accordingly, this lymphocyte regulatory substance is useful in potentiating humoral and cellular immune responses and in restoring immune deficient state to a normal humoral and cellular immune state. These identified immunological acti-vities of IL-2 indicate that IL-2 is useful for medical immunotherapy against immunological disorders including neo-plastic diseases, bacterial or viral infections, immure deficient diseases, autoimmune diseases etc. (Papermaster, B. et al., Adv. Immunopharm., 507, [1980]). Recently, a review article in the Journal of The American Medical Asso-ciation, Vol. 249, No. 2 at pages 166-171 (January 14, 1983) discusses the clinical applications of various lymphokines including particularly human IL-2.
Human IL-2 derived from induced human malignant cells has recently been purified to homogeneity using multiple high performancee liquid chromatography (HPLC) steps. The resulting homogeneous human IL-2 demonstrated a specific activity of about 1.4 x 109 units/mg (see e.g. European patent application No. 83.109202.8, publication No. 106 179).
Taniguchi et al. reported on the cloning and sequencing of the IL-2 gene and expression of the immature form of human Interleukin-2 at the Third Annual Recombinant DNA
congress in Philadelphia, Pennsylvania on February 9, 1983 ~~4.~8~~
(Nature, 302, 305-310 [1983]). The cDNA from which the amino acid sequence of the IL-2 protein was derived was prepared from mRtJA obtained from Jurkat cells induced with Concanava-lin A. The full length cDNA clone is 800 base pairs long and codes for a protsin of 153 amino acids. See also European patent application, publication No. 91539.
Other groups have also reported the cloning and sequen-cing of the IL-2 gene. See Devos et al., ~~Molecular Cloning of Human Interleukin-2 cDNA and Its Expressior_ in E. coli~~, Nucleic Acids Research, 11, 4307-4323 (1983). See also Euro-pean patent application, publication No. 118 977.
Although these references describe the expression of IL-2 in transformed host cells, especially in E. coli, no purification procedures are disclosed which would permit one skilled in the art to obtain mature recombinant human IL-2 in a homogeneous or'substantially pure form.
The present invention relates to a process for the puri-fication of recombinant IL-2 especially of recombinant mature human IL-2. It provides a method for the purification of recombinant mature human IL-2 to homogeneity which over-comes the limitations of prior art purification methods.
This method comprises (a) cultivating a transformed organism containing a DNA
sequence which codes for mature human IL-2;
(b) causing a culture of the transformed organism of step (a) to express and accumulate mature human IL-2:
(c) lysing the culture of transformed organisms of step (b) to form a cell lysate mixture;
(d) separating the cell membrane components from the cell lysate mixture of step (c);
(e) ~,aasring the isolated cell membrane components with an extraction solution to yield a wash solution containing IL-2 ; and (f) chromatographically purifying the wash solution of step (e) to yield a substantially pure or homogenous recombinant human IL-2.
Brief Description of the Drawings Fig. 1 represents the DNA nucleotide sequence of pIL2-2B
and the corresponding amino acid sequence of mature human interleukin-2 (arrow represents amino terminus of mature IL-2 protein).
Fig. 2 graphically illustrates the construction of pRC2 from pBR322.
Fig. 3 graphically illustrates the construction of pRC23 containing a PL promoter.
Fig. 4 shows the construction of the structural gene for expression of Ser-IL-2.
Fig. 5 graphically illustrates the construction of a mature IL-2 expression vector without a promoter system (pRC
201/IL-2).
Fig. 6 graphically illustrates the construction of the mature IL-2 expression vector including a PL promoter system (pRC 233/IL2).
The procedure of the present invention relies on the surprising finding that the IL-2 protein expressed by a microbe tends to associate with the membrane fractions of the host microbe, principally the inner membrane of the microbe (the membrane being a lipid bi-layer often associa-ted with hydrophobic proteins). Therefore, separation of these membranes during the process of recovering IL-2 from the transformed microorganisms ensures high yield and purity levels of IL-2 at the end of the whole purification proce-dure.
While different known methods of cell lysis can be used in the process of the present invention, such as enzymatic or chemical lysis, lysis by sonification is the preferred method. The inner and outer cell membranes are then separa-ted from the other cellular components by known methods such as centrifugation.
Once the cell membranes are separated from the lysate mixture, they are washed with an extraction solution, pre-ferably salt and detergent solutions to yield a solution comprising at least about 50% IL-2. In a preferred embodi-ment, the cell membranes are washed in four separate steps with the salt and detergent solutions. The first step pre-ferably comprises washing the cell membranes with a salt solution, preferably 1M NaCl. In the second step the cell membrane fraction is washed with a detergent solution, pre-ferably 1% Triton X-100. In the third step the cell membrane fraction is washed with another salt solution, preferably 1.75M to 2M guanidine-HCl. The final wash is also with a salt solution, preferable about 4M to 7M guanidine-HC1. The wash solution which results from the fourth and final wash comprises at least about 50% IL-2.
The final IL-2 wash solution is then further purified by chromatography, preferably by reverse phase high performance liquid chromatography (HPLC). The HPLC step yields active IL-2 in a substantially 100% pure or homogeneous form. It is also forseeable that antibody affinity chromatography columns, utilizing polyclonal or monoclonal antibodies to IL-2, could be used as an alternative to HPLC. Other chroma-tographic procedures can also be utilized such as dye-affi-nity columns (e.g., Procion red agarose - as described in European Patent Application No. 83103582.9 published under No. 92163 on October 26, 1983) or sephacryl*5200 columns. In another preferred embodiment of this invention the chromatc-* trade mark.
_ 5 _ graphy comprises multiple steps, i.e. HPLC followed by a dye-affinity chromatography step.
In accordance with this invention the aforementioned purified IL-2 can be used for similar purposes as the other known immunomodulator compounds, e.g. as a means for trea-ting immunosuppressive conditions. It may be administered in pharmaceutically acceptable oral, injectable or topical com-position and modes. Dosage and dose rate may parallel that currently being used in clinical applications of known immunomodulator compounds, typically about 1-200 x106 units daily. These pharmaceutical compositions of the inven-tion contain said IL-2 in association with a compatible pharmaceutically acceptable carrier material. Any conventio-nal carrier material can be utilized. The carrier material can be an organic or inorganic inert carrier material sui-table for enteral, percutaneous or parenteral administra-tion. Suitable carriers include water, gelatin, gum arabic, lactose. starch, magnesium stearate, talc, vegetable oils, polyalkylene-glycols, especially polyethylene-glycols, petroleum jelly and the like. Furthermore, the pharmaceu-tical preparations may contain other pharmaceutically active agents. Additional additives such as flavoring agents, preservatives, stabilizers, emulsifying agents, buffers and the like may be added in accordance with accepted practices of pharmaceutical compounding.
The pharmaceutical preparations can be made up in any conventional form including: a) a solid form for oral administration such as tablets, capsules, pills, powders, granules, and the like; b) a liquid form for oral adminis-tration such as solutions, syrups, suspensions, elixirs and the like; c) preparations for parenteral administration such as sterile solutions, suspensions or emulsions; and d) pre-parations for topical administrations such as solutions, suspensions, ointments, creams, gels, micronized powders, aerosols and the like. The pharmaceutical preparations may be sterilized and/or may contain adjuvants such as preserva-tives, stabilizers, wetting agents, emulsifiers, salts for varying the osmotic pressure and/or buffers.
Parenteral dosage forms may be infusions or injectable solutions which can be injected intravenously or intramuscu-larly. The preparations can also contain other medicinally active substances. Additional additives such as preservati-ves, stabilizers, emulsifying agents, buffers and the like may be added in accordance with accepted practices of phar-l0 maceutical compounding.
The construction of IL-2 expression vectors and of transformants capable of expressing IL-2 is described in more detail below.
The amino acid sequence of the mature IL-2 protein is given in Figure 1. The~protein may be expressed in its mature form with a methionine at the amino terminus of the protein if the gene initiation codon is ATG. The methionine may or may not be removed by the host cell after expression.
The expression vectors used in this invention are deri-vatives of pBR322 containing the PL promoter isolated from bacteriophage lambda DNA. PL was the promoter of choice since it is a very strong promoter that can be efficiently and conveniently controlled by the lambda cI repressor, the gene for which may be located on the microorganism s chromo-some, a compatible vector or the same vector as that con-taining the PL promoter. The gene encoding the repressor carries a mutation, cIts, which renders tre repressor tempe-rature-sensitive. A vector which may be used with this invention and which contains the cI mutation is pRK248cIts, which is known in the art and is described by Kahn et al., P4ethods in Enzymology, 68, 268 (1979). At 30°C the repressor functions normally, and from about 37°C to about 42°C it is inactivated. Thus, the Pr promoter is repressed (turned--cff) at 30°C and derepressed (turned-on) at 42°C. The abi-1~~08~3 _ 7 _ ~, lity to control the PL promoter allows one to grow the culture at about 30°C to about 36°C without expressing the gene product and at an optimum time, shift the temperature from about 30°C to about 42°C to produce the desired mature human IL-2 product.
The preferred vector used in the present invention also contains an EcoRI restriction site distal (downstream in 3' direction) from the SD sequence. The following description serves to illustrate the preparation of a preferred vector, pRC23, into which the IL-2 gene is then introduced. However, other vectors may also be used.
In accordance with the procedure outlined in Figures 2 and 3 20 micrograms of pBR322 were digested with EcoRI and then used in two different reactions: 1) treatment with S1 nuclease to remove the 5' overhang, and 2) treatment with the Klenow fragment of DNA polymerase I to fill-in the ter-mini. Both reactions were terminated by phenol extraction followed by ethanol precipitation. DNA from each reaction was ligated to a synthetic BglII linker, digested with BglII
and PstI, and subjected to gel electrophoresis in 1% aga-rose. The 3600 by (base pairs) and 760 by fragments from both reactions were recovered from the gel. For the con-struction of pRC2, the 3600 by fragment from the Klenow reaction was ligated to the 760 by fragment from the S1 reaction. E. coli RR1 was transformed with the ligation mixture and transformants were selected on media containing 50 ug/ml ampicillin. Transformants containing the expected plasmid construction, i.e. a plasmid containing a BglII
restriction site in proximity of the EcoRl restriction site, were identified by restriction analysis of the isolated plasmid DNA. pRC23 was constructed by ligating synthetic oligonucleotides comprising a "consensus" or computer gene-rated ribosome-binding site (RBS), [Scherer et al. Nucleic Acids Research, 8, 3895 (1980)] to a 250 by Bgl II - Hae III
fragment containing the lambda. PL promoter, and inserting -a-~3~~~~3 the ligation product into pRC2.
In order to isolate the 250 by DNA fragment containing the lambda PL promoter, 1 microgram of a 450 by Bgl II -Hpa I DNA fragment (from by #35260 to 35710 of the lambda phage DNA sequence) was digested with Hae III and the pro-ducts were isolated by preparative gel electrophoresis in 5%
polyacrylamide. About 200 ng of the 250 by Bgl II - Hae III
fragment was ligated to 60 pmoles each of the synthetic oligonucleotides shown in Figure 3 which comprise most of the ~~consensus~~ RBS sequences generated by computer analysis as described by Scherer et al. The ligated molecules were digested with Bgl II and EcoRl (to eliminate oligomers) and purified by gel electrophoresis. The ligated products were then inserted into pRC2 which also had been digested with Bgl II and EcoRI. Transformation of E. coli strain RR1(pRK248cIts) was performed using standard methods and transformants were seclected on media containing ampicillin (50 ug/ml) at 30°C. 50 transformants were obtained, DNA
was isolated from 8 of those and analyzed by digesting with Hinc II. 6 of the 8 showed the expected restriction pattern and Maxam-Gilbert nucleotide sequence analysis of one of these confirmed the expected construction (designated pRC23).
Construction of a alasmidic expression vector containinu DN_A
coding for mature human IL-2 (1) Isolation of mRNA coding for human IL-2 mRNA was isolated from H33HJ-JAI cells (ATCC No.
CRL-8163, deposited August 26, 1982), a clone of Jurkat cell line FHCRC, after induction with PHA and PMA.
12,000 ml of H33HJ-JAI clone cell cultures (106 cells/ml) were grown in RPMI 1640 tissue culture medium supplemented with 10% Fetal Bovine Serum, 50 U/ml peni-cillin, 50 ug/ml streptomycin, 50 ug/ml gentamycin, and 300 ug/ml fresh L-glutamine. These cells were collected by centrifugation and resuspended in 6 1 of 13~0~~3 _ g _ the above detailed medium, lacking serum, but further supplemented with 1% PHA and 10 ng/ml PMA. Cells were dispended in 6 1 aliquots to sterile glass roller bottles and placed on a roller mill (10 rpm at 37°C).
Eight hours later, cells were collected by centrifuga-tion and mRNA was extracted using a standard phenol chloroform extraction procedure. Following phenol chloroform extraction, ethanol precipitated RNA was pelleted by high speed centrifugation, and resuspended in a 0.5M salt solution. Poly A-tailed mRNA contained in the total RNA population was collected by passage of this material over an oligo(dT)cellulose column. Ethanol precipitated mRNA was resuspended in water to a concen-tration of 500 ug/ml. 30 ng of RNA was then microin-jected into Xenopus oocytes. After 24 hours of incuba-tion in sterile Barth~s solution, 4 eggs were trans-ferred into a sterile 1.5 ml Eppendorf centrifuge tube and fed with 540-1500 microliters of fresh sterile Barth~s solution. 48 hours later, 200 microliters of egg conditioned medium was harvested and assayed for IL-Z
activity using a standard CTLL Cell 3H-Tdr incorpora-tion assay (Gillis et al., J. Immunoi. 120, 2027 [1978]). mRNA preparations which when translated by oocytes gave rise to significant IL-2 activity, were pooled, sized by standard sucrose density gradient centrifugation techniques and ethanol precipitated for cDNA library construction.
(2) cDNA Synthesis 3.5 ug of purified mRNA (approximately 10S on sucrose gradients) were used to synthesize double-stranded complementary DNA (ds cDNA) by the following method (Gubler and Hoffmann, Gene 25, 263-269 [1983]).
~3~-0853 (a) First strand cDNA synthesis:
The mRNA was suspended in 17.5 ml containing 50 mM
Tris-HC1, pH 8.3, 10 mM MgCl2, 10 mM DTT, 4 mM
Na-pyrophosphate, 1.25 mM dATP, 1.25 mM dGTP, 1.25 mM dTTP, 0.5 mM dCTP, 100 ug/ml of oligo(dT)12-18' and 10 Ci of 32P-dCTP (Amersham 3000 Ci/mMole). After incubation for 5 min. at 43°C, 3x00 units AMV reverse transcriptase/ml (Life Sciences, Inc.) was added and the mixture incubated for 30 min. at 43°C. The reaction was stopped by the addition of EDTA to 20 mM, extracted with phenol-cresol, and concentrated by ethanol precipi-tation. The yield of the first strand synthesis, as assayed by TCA-insoluble radioactivity, was calcu-lated to be 58.6 ng (1.7%).
(b) Second strand synthesis: , The cDNA-mRNA hybrid was resuspended in 5.8 micro-liters H20. To this solution, 7.7 microliters of the second strand synthesis mix was added to give a solution containing 20 mM Tris-HC1, pH 7.5, 5 mM
MgCl2, 10 mM (NH4)2504, 100 mM KC1, 0.15 nM
beta-NAD, 50 ug/ml BSA, 40 mM dNTPs, 8.5 units/ml of E. coli RNase H (Bethesda Research Labs), 230 Units/ml DNA polymerase I (Boehringer Mannheim), 10 units/ml E.coli DNA ligase (New England Biolabs).
The mixture was incubated for 60 min. at 12°C, then for 60 min. at 22°C. The reaction was stopped by addition of EDTA to 20 mM, and extracted with phenol-cresol. The cDNA was separated from free nucleotides by passage over a Sephadex G-50 fine column in 10 mM TEAB. The yield from this reaction was 107 ng of dscDNA (91%).
(~) Annealing and transformation 64 ng of dscDNA were tailed by addition of dGTP
using standard methods. The vector was prepared by digestion of pBR322 DNA with EcoRV (New England-Biolabs) and tailing with dCTP. 100 ng of tailed BR322 DNA and 1.25 ng of tailed cDNA inserts (ratio - 80:1) were annealed in 250 ul of O.O1M
Tris, pH 7.5, 1 mM EDTA, 0.15 M NaCl for 90 min. at 58°C, and transformed into competent E.coli RRI
cells. Transformed cells were plated on LB plates containing 100 ug/ml ampicillin (Bristol Labs), and incubated at 3?°C for 12 hours. A total of 3,200 colonies were generated for the IL-2 cDNA
library.
(3) Screenincr of cDNA library for.IL-2 gene seauences To detect full-length cDNA copies of the IL-2 gene, a synthetic deoxy-oligonucleotide probe was used which corresponds to nucleotides 45-65 of the human IL-2 cDNA
sequence published by Taniguchi~ et al. (Nature 302, 305-310 [1983]). This probe [ACAATGTACAGGATGCAACTC] was synthesized by the solid-phase phosphodiester method, purified by HPLC, and labeled by using 32P-ATP (ICN
Pharmaceuticals, 7000 Ci/mM) and polynucleotide kinase (New England Biolabs). Colonies representing the cDNA
library were transferred to nitrocellulose filters by the method of Grunstein and Hogness (Methods in Enzymo-logy 68, 379 [1979]). After hybridization at 30°C for 16 hours, filteres were washed in 4xSSC at 45°C for 45 minutes, dried, and autoradiographed. A single posi-tive colony was detected and found to contain the entire IL-2 coding sequence. This colony, designated pIL2-2B, was used to prepare DNA for nucleotide sequence analysis and for expression in E.coli. Nucleotide sequence analy-sis showed it to be identical to that of the sequence published by Taniguchi et al. with two differences:
pIL2-2B contains an insert which begins at nucleotide 17, as designated in the Taniguchi sequence, and has a substation of a G at position 503.
.. ~~~OS~3 (4) Construction of the E.coli plasmidic vector containin DNA coding for Ser-IL-2.
An E.coli expression vector for IL-2 was constructed from three segments (see Fig. 4): (1) the vector pRC23, with the lambda PL promoter, (2) a synthetic adapter molecule, and (3) a Hgi AI - Aha III fragment isolated from the IL-2 cDNA. The vector DNA was prepared by digestion of 50 ng of pRC23 DNA with EcoRI and EcoRV, followed by phenol extraction and ethanol precipitation.
l0 The synthetic adagter molecule was obtained by annealing two complementary synthetic deoxy-oligonucleotide sequences, A and B:
(A) 5' AATTCAATTATGAGTGCA 3' (B) 3' GTTAATACTC 5' This double-stranded adapter can anneal to an EcoRI site at its 5' end and to a HgiAI site at its 3' end. The cDNA insert was prepared by digestion of pIL2-2B DNA
with the restriction enzyme BamHl (Bethesda Research Labs), which releases the 1 kilobase IL-2 insert from this clone. The BamHl fragment was gel-purified and further digested with HgiAI (New England Biolabs) and Aha III (New England Biolabs), then phenol-extracted and ethanol precipitated. HgiAI cuts between the alanine and proline codons at the beginning of the sequence coding for mature IL-2. The cloning strategy for expression uses the EcoRI site adjacent to the PL promoter in the pRC23 vector. The synthetic adapter molecule can join this EcoRI site in the vector to the HgiAI site at the start of the cDNA IL-2 sequence. The adapter was desig-ned to create the methionine codon for translation ini-tation. Codons for serine and for alanine, the first amino acid of mature IL-2, are created when the adapter and the cDNA are ligated at the HgiAI site. The cDNA is joined to pRC23 via blunt-end ligation of the AhaIII
site to the EcoRV site in the vector DNA.
M
- i3 -Ligation of the three segments was performed in a volume of 10 y.l which contained 0.05 pM each of the vector, synthetic adapter and cDNA insert DNAs, 65 mM Tris, pH
7.6, 10 mM MgCl2, 0.5 mM ATP, and 15 mM beta-mercapto-ethanol. The ligation mixture was heated at 65°C for 5 minutes, cooled to 4°C before addition of 200 Units of T4 DNA ligase (New England Biolabs), then incubated at 4°C for 16 hours. The T4 DNA ligase was inactivated by heating at 65°C for 5 minutes. Then the ligated DNAs were digested with EcoRV to remove any undigested vector DNA. The mixture was then used for transformation of E.coli strain RRI (pRK248cIts), and these cells were grown at 30°C for 15 hcurs.
The colonies were transferred to nitrocellulose filters as described previously, baked, and hybridized with a radioactive probe of 32P-labeled synthetic adapter molecule A. One positive colony, designated pRC23/IL-2, #4-1, was chosen for analysis. This clone was found to synthesize more than 200,000 units/ml of IL-2 when the PL promoter was induced to express at 42°C. The IL-2 activity was detected by bioassay on CTLL cells, an indicator cell line for IL-2 (as described in Gillis et al. J. Immunol. 120, 2027 [1978]).
(5) Construction of an E.coli ex ression vector for urodu-cing mature IL-2 (with alanine as the first amino acid at the amino terminus) To express mature IL-2 in E.coli, the following strategy (illustrated in Fig. 5) was followed. A HgiAI restric-tion endonuclease site is located at the Ser-Ala junc-tion, the cleavage site for the removal of the signal peptide of IL-2 (Robb et al., PNAS, 80, 5990-5994 [1983]). Following digestion with HgiAI, the termini were made blunt-ended by treating with T4 DNA poly-merase. The resulting molecules were then blunt-end ligated to a 108 by BglII-Hae III fragment isolated from phage lambda DNA, digested with BglII and XbaI and inserted between BglII and RbaI sites in the vector pRC23/IL-2, #4-1. This intermediate cloning step was included to ensure that the T4 DNA polymerase treatment occurred as expected, which was confirmed by the crea-tion of a new StuI site from the joining of the HaeIII
terminus to the blunt-ended HgIAI terminus. Redigesting with StuI conveniently regenerates at this site the blunt end beginning with the CCT proline codon. The intermediate plasmid construction was designated pRC201/I1-2. Two synthetic deoxyoligonucleotides were designed which incorporate an ATG-translational initia-tion codon, restore the alanine codon, and create an EcoRI terminus. These oligomers were ligated to the EcoRI terminus of the expression vector pRC23, digested with PstI, and the resulting 1025 by fragment was gel purified. The 1025 by (PstI to blunt-end) fragment was inserted between the PstI site and the newly created StuI site in pRC201/IL-2. Transformants containing the expected construction were identified by restriction analysis of the isolated plasmid DNA. The confirmed plasmid construction was designated pRC233/I1-2 (see Fig. 6).
Preferred host organisms for transformation by a vector containing the gene for IL-2 in connection with the present invention include bacteria such as strains of E.coli; bacillaceae, such as Bacillus substillis and the like. Yeasts form a further preferred group of microorganisms for transformation.
A specifically preferred microorganism employed as the recipient in the transformation procedures is Esche-richia coli K-12 strain 294 as described in British patent Publication No. 2055382A, deposited with the American Type Culture Collection, ATCC Accession No.
31446, on October 28, 1978. However, also other known 13~.0~~3 E.coli strains such as E.coli RR1, ATCC Accession No.
31343, or other microorganisms many of which are deposi-ted and available from recognized microorganism deposi-tory institutions, such as the American Type Culture Collection can be used as host organisms. In the prac-tice of this invention overnight cultures of the trans-formed E.coli are grown in LB broth at 30°C. One liter of the overnight culture is preferably diluted to 10 liters with minimal M-9 medium containing casamino acids. At logarithmic growth, the culture is shifted from 30°C to 42°C to induce IL-2 production. Following incubation at 42°C for 2-3 hours, the bacteria are harvested by centrifugation. All fermentations and procedures were performed in accordance with recombinant DNA guidelines of the National Institutes of Health. The purification steps are described in detail in the follo- -wing Examples.
Example 1 One gram of IL-2 (having serine at the NH2 terminus) producing transformed E.coli cells were suspended in 30 mM
Tris-HC1, pH 8.0, 5 mM EDTA, 1 mM phenylmethylsulfonyl fluoride and lysed by sonification. The lysis mixture was centrifuged at 14,000 x g for 15 minutes. The membrane portion of the centrifuged lysate was then removed and iso-lated from the other components of the lysate. The membrane component was then subjected to the four washing or IL-2 extraction steps shown below in Table 1. Each wash solution was used in an amount of at least 5 ml/gram of cells. The bulk of the IL-2 activity was extracted in the final wash as detailed in Table 1. The final resultant wash solution which contained the bulk of the IL-2 activity and which was at least about 50% pure as judged by SDS-PAGE, was then subjec-ted to reverse phase HPLC (RP-C8). There was a 40-60% reco-very of substantially 100% pure IL-2 (with serine at the NH2 terminus). The IL-2 activity was found to be at least <",, , *Trademark -16 - ~3~0~~~
1 x loa u/mg.
Table 1 Extraction of IL-2 from E.coli membrans Total Total IL-2 Specific Protein Activity Activity Extraction (mcr) units u/m 1M NaCl wash 0.4 mg 0.03 x 106 0.1 x 106 1% Triton wash 2 mg 0.75 x 106 0.4 x 106 1.75 guanidine-HC1 wash 1 mg 1.5 x 106 1.5 x 106 7M guanidine-HC1 wash 4.7 mg 250 x 106 53 x 106 (99%) 252.3 x 106 Example 2 This example serves to demonstrate that IL-2 tends to become associated with the membrane components of the trans-formed E.coli host cells.
In order to demonstrate this, one gram of serine-NH2 terminus IL-2 producing transformed E.coli cells were sus-pended in 10 ml of 20% sucrose, 30 mM Tris-HC1, pH 8.0, and lysed using lysozyme-EDTA to separate proteins which are localiced in the periplasmic space. The remainder of the lysed mixture was then subjected to sonification. The mem-brane portion (inner and outer membranes) was then separated from the other cellular components by sucrose gradient cen-trifugation with which the inner and outer membranes were also separated. Table 2 shows that the majority of IL-2 activity was located in the inner cellular membrane.
_ 17 - ~3~O8~J
Table 2 Localization of IL-2 in E.coli cells Total Total IL-2 Recovery of Protein Activity IL-2 Fraction (mct) (units) [%~
Soluble Fraction 37 mg 2 x 106 0.3 Periplasmic Fraction 2 mg 10 x 106 1.5 Outer Membrane 6 mg 8 x 106 1.2 Inner Membrane 15 mg 6.6 x 108 97 Example 3 One gram of mature IL-2 producing transformed E.coli cells was suspended in 30 mM Tris-HC1, pH 8, 5 mM EDTA, 1 mM
phenylmethylsulfonyl'fluoride and lysed by sonification. The lysis mixture was centrifuged at to 14,000 x g for 15 minu-tes. The membrane portion of the centrifuged lysate was iso-lated from the other components of the lysate. The membrane portion was then subjected to the four washing or IL-2 extraction steps shown below in Table 3. Each wash solution was used in an amount of at least 5 ml per each gram of cells. The bulk of the IL-2 activity was finally extracted in the final wash as detailed in Table 3. The final resul-tant wash solution which contained the bulk of the IL-2 activity and which was at least 50% pure as judged by SDS--PAGE, was then subjected to reverse phase high performance liquid chromatography (RP-C8). The recovery of substantially 100% pure mature IL-2 was about 60%. The IL-2 activity was found to be approximately 4 x 108 U/mg.
Table 3 Extraction of Mature IL-2 from E.coli membrane Total Total IL-2 Specific Protein Activity Activity Extraction (ma) (units) _ (u/mcr) 1M NaCl wash 0.5 0.3 x 106 0.6 x 105 1% Triton wash 3.3 5.5 x 106 1.7 x 106 1.75M guanidine-HC1 wash 2.5 10.0 x 106 4.0 x 106 7M guanidine-HC1 wash 10.1 779 x 106 77.1 x 106 (98%) 794.8 x 106 Example 4 The following example illustrates the purification of mature IL-2 from transformed E.coli paste utilizing a Procion Red Agarose chromatographic step in addition to HPLC.
Membrane Extraction of Cells Frozen E.coli cells (containing the plasmid for human IL-2) are thawed and 1 gm is added to 5 ml of Buffer A
(0.03 M Tris-HC1, pH 8.0, 0.005 M EDTA). After mixing 10 minutes, the cells are removed by centrifugation in a Sorval SS-34 rotor (10,000 rpm for 10 minutes). The superna-tant is removed and the cells resuspended in 5 ml Buffer A.
The suspended cells are broken with a Branson Cell Disruptor 350 (sonicator) (6 x 30 sec). The broken cells are centri-fuged (10,000 rpm for 10 minutes) and the supernatant con-taining the soluble proteins is discarded. The residue is washed once with 5 ml Buffer A and centrifuged (10,000 rpm for 10 minutes). The residue containing the membrane frac-Lion is suspended in Buffer B (1 M NaCl, 0.03 M Tris-HC1, pH
8.0, 0.005 M EDTA) with a Wheaton Dounce tissue homogenizes.
After mixing 10 minutes, the membrane fraction is removed by ._ 13~08~~
centrifugation in a Sorval SS-34 rotor (15,000 rpm for minutes). The residue is suspended in 5 ml Buffer C (1%
Triton X-100, 0.03 M Tris-HC1, pH 8.0), homogenized, mixed and centrifuged (15,000 rpm for 10 minutes). The centrifuged 5 residue is suspended in 5 ml of 1.75 M guanidine-HC1, homo-genized, mixed and centrifuged (15,000 rpm for 10 minutes).
The residue is washed once with 5 ml Buffer A and centrifu-ged. The membrane fracticn (residue) is extracted with 5 ml of 7 M guanidine-HC1. After centrifugation, the extract con-10 taming the IL-2 is saved and the residue is extracted a second time with 5 ml of 7 M guanidine-HC1. This extract is also Saved.
Chromatoaraphy on Procion Red Aq_arose The column is set up at room temperature and washed with two volumes of 7 M guanidine-HC1 before using the first time. The column is equilibrated with equilibration buffer (0.01 M Tris-HC1,'pH 7.9, 0.035 M NaCl) at 4°C. At least 1 ml of Procion red agarose should be used for each 100 y.g of IL-2 expected. The flow rate is 2 bed volumes per hour.
The 7 M guanidine-HC1 extract containing the IL-2 is diluted 40-fold with equilibration buffer and the precipitate remo-ved by centrifugation. The supernatant is then loaded on the column. The column is washed with two column volumes of equilibration buffer. The IL-2 is eluted in a peak after 1.5-2 volumes of elution buffer (0.01 M Tris-HC1, pH 7.9, 1.035 M NaCl). After the IL-2 has been removed, the column is rid of extraneous materials by washing with 6M guani-dine-HC1.
Chromatocrraphy on RP-P (C-18) The pH of the Procion red eluate is adjusted to 7 with a slow addition of 1.0 M acetic acid. Aliquots of 0.1 ml each are removed for assay purposed before and after pH adjust-ment. The neutralized eluate (60 mi) is pumped with 1 ml/min. onto a 0.31 x 25 cm RP-18 column, equilibrated with an equilibration buffer mixture consisting of 5% HPLC-13~.08~~
-Buffer II and 95% HPLC-Buffer I. Column flowthrough is collected and assayed for protein content and IL-2 bioacti-vity. The column is eluted at room temperature according to the gradient profile outlined in Table 4. The effluent is monitored at 220 nm and 1.5 ml fractions are collected and assayed for protein content and IL-2 activity. The peak of maximum IL-2 activity elutes at ca. 74% HPLC-Buffer II (59%
acteonitrile). Fractions are stored at 4 to 8°C and are pooled according to specific activity.
Table 4 Conditions for the chromatography of a typical Procion-red eluate on an RP-18 column Sample Load: 60 ml Column Dimensions 0.41 x 25 cm Flow Rate: 1 ml/min HPLC Buffer I: - 0.01 M phosphoric acid, 0.05 M
lithium chloride HPLC-Buffer II: 0.01 M phosphoric acid, 0.05 M
lithium chloride, 80% acetonitrile % HPLC-Buffer II Duration (min) Equilibration 5 20 Sample load - 60 Wash 5 15 Step 1, gradient 5 to 35 15 Step 2, gradient 35 to 85 50 Step 3, constant 85 5 Step 4, constant 5 5 All chromatographic steps are carried out at room tempe-rature.
Other groups have also reported the cloning and sequen-cing of the IL-2 gene. See Devos et al., ~~Molecular Cloning of Human Interleukin-2 cDNA and Its Expressior_ in E. coli~~, Nucleic Acids Research, 11, 4307-4323 (1983). See also Euro-pean patent application, publication No. 118 977.
Although these references describe the expression of IL-2 in transformed host cells, especially in E. coli, no purification procedures are disclosed which would permit one skilled in the art to obtain mature recombinant human IL-2 in a homogeneous or'substantially pure form.
The present invention relates to a process for the puri-fication of recombinant IL-2 especially of recombinant mature human IL-2. It provides a method for the purification of recombinant mature human IL-2 to homogeneity which over-comes the limitations of prior art purification methods.
This method comprises (a) cultivating a transformed organism containing a DNA
sequence which codes for mature human IL-2;
(b) causing a culture of the transformed organism of step (a) to express and accumulate mature human IL-2:
(c) lysing the culture of transformed organisms of step (b) to form a cell lysate mixture;
(d) separating the cell membrane components from the cell lysate mixture of step (c);
(e) ~,aasring the isolated cell membrane components with an extraction solution to yield a wash solution containing IL-2 ; and (f) chromatographically purifying the wash solution of step (e) to yield a substantially pure or homogenous recombinant human IL-2.
Brief Description of the Drawings Fig. 1 represents the DNA nucleotide sequence of pIL2-2B
and the corresponding amino acid sequence of mature human interleukin-2 (arrow represents amino terminus of mature IL-2 protein).
Fig. 2 graphically illustrates the construction of pRC2 from pBR322.
Fig. 3 graphically illustrates the construction of pRC23 containing a PL promoter.
Fig. 4 shows the construction of the structural gene for expression of Ser-IL-2.
Fig. 5 graphically illustrates the construction of a mature IL-2 expression vector without a promoter system (pRC
201/IL-2).
Fig. 6 graphically illustrates the construction of the mature IL-2 expression vector including a PL promoter system (pRC 233/IL2).
The procedure of the present invention relies on the surprising finding that the IL-2 protein expressed by a microbe tends to associate with the membrane fractions of the host microbe, principally the inner membrane of the microbe (the membrane being a lipid bi-layer often associa-ted with hydrophobic proteins). Therefore, separation of these membranes during the process of recovering IL-2 from the transformed microorganisms ensures high yield and purity levels of IL-2 at the end of the whole purification proce-dure.
While different known methods of cell lysis can be used in the process of the present invention, such as enzymatic or chemical lysis, lysis by sonification is the preferred method. The inner and outer cell membranes are then separa-ted from the other cellular components by known methods such as centrifugation.
Once the cell membranes are separated from the lysate mixture, they are washed with an extraction solution, pre-ferably salt and detergent solutions to yield a solution comprising at least about 50% IL-2. In a preferred embodi-ment, the cell membranes are washed in four separate steps with the salt and detergent solutions. The first step pre-ferably comprises washing the cell membranes with a salt solution, preferably 1M NaCl. In the second step the cell membrane fraction is washed with a detergent solution, pre-ferably 1% Triton X-100. In the third step the cell membrane fraction is washed with another salt solution, preferably 1.75M to 2M guanidine-HCl. The final wash is also with a salt solution, preferable about 4M to 7M guanidine-HC1. The wash solution which results from the fourth and final wash comprises at least about 50% IL-2.
The final IL-2 wash solution is then further purified by chromatography, preferably by reverse phase high performance liquid chromatography (HPLC). The HPLC step yields active IL-2 in a substantially 100% pure or homogeneous form. It is also forseeable that antibody affinity chromatography columns, utilizing polyclonal or monoclonal antibodies to IL-2, could be used as an alternative to HPLC. Other chroma-tographic procedures can also be utilized such as dye-affi-nity columns (e.g., Procion red agarose - as described in European Patent Application No. 83103582.9 published under No. 92163 on October 26, 1983) or sephacryl*5200 columns. In another preferred embodiment of this invention the chromatc-* trade mark.
_ 5 _ graphy comprises multiple steps, i.e. HPLC followed by a dye-affinity chromatography step.
In accordance with this invention the aforementioned purified IL-2 can be used for similar purposes as the other known immunomodulator compounds, e.g. as a means for trea-ting immunosuppressive conditions. It may be administered in pharmaceutically acceptable oral, injectable or topical com-position and modes. Dosage and dose rate may parallel that currently being used in clinical applications of known immunomodulator compounds, typically about 1-200 x106 units daily. These pharmaceutical compositions of the inven-tion contain said IL-2 in association with a compatible pharmaceutically acceptable carrier material. Any conventio-nal carrier material can be utilized. The carrier material can be an organic or inorganic inert carrier material sui-table for enteral, percutaneous or parenteral administra-tion. Suitable carriers include water, gelatin, gum arabic, lactose. starch, magnesium stearate, talc, vegetable oils, polyalkylene-glycols, especially polyethylene-glycols, petroleum jelly and the like. Furthermore, the pharmaceu-tical preparations may contain other pharmaceutically active agents. Additional additives such as flavoring agents, preservatives, stabilizers, emulsifying agents, buffers and the like may be added in accordance with accepted practices of pharmaceutical compounding.
The pharmaceutical preparations can be made up in any conventional form including: a) a solid form for oral administration such as tablets, capsules, pills, powders, granules, and the like; b) a liquid form for oral adminis-tration such as solutions, syrups, suspensions, elixirs and the like; c) preparations for parenteral administration such as sterile solutions, suspensions or emulsions; and d) pre-parations for topical administrations such as solutions, suspensions, ointments, creams, gels, micronized powders, aerosols and the like. The pharmaceutical preparations may be sterilized and/or may contain adjuvants such as preserva-tives, stabilizers, wetting agents, emulsifiers, salts for varying the osmotic pressure and/or buffers.
Parenteral dosage forms may be infusions or injectable solutions which can be injected intravenously or intramuscu-larly. The preparations can also contain other medicinally active substances. Additional additives such as preservati-ves, stabilizers, emulsifying agents, buffers and the like may be added in accordance with accepted practices of phar-l0 maceutical compounding.
The construction of IL-2 expression vectors and of transformants capable of expressing IL-2 is described in more detail below.
The amino acid sequence of the mature IL-2 protein is given in Figure 1. The~protein may be expressed in its mature form with a methionine at the amino terminus of the protein if the gene initiation codon is ATG. The methionine may or may not be removed by the host cell after expression.
The expression vectors used in this invention are deri-vatives of pBR322 containing the PL promoter isolated from bacteriophage lambda DNA. PL was the promoter of choice since it is a very strong promoter that can be efficiently and conveniently controlled by the lambda cI repressor, the gene for which may be located on the microorganism s chromo-some, a compatible vector or the same vector as that con-taining the PL promoter. The gene encoding the repressor carries a mutation, cIts, which renders tre repressor tempe-rature-sensitive. A vector which may be used with this invention and which contains the cI mutation is pRK248cIts, which is known in the art and is described by Kahn et al., P4ethods in Enzymology, 68, 268 (1979). At 30°C the repressor functions normally, and from about 37°C to about 42°C it is inactivated. Thus, the Pr promoter is repressed (turned--cff) at 30°C and derepressed (turned-on) at 42°C. The abi-1~~08~3 _ 7 _ ~, lity to control the PL promoter allows one to grow the culture at about 30°C to about 36°C without expressing the gene product and at an optimum time, shift the temperature from about 30°C to about 42°C to produce the desired mature human IL-2 product.
The preferred vector used in the present invention also contains an EcoRI restriction site distal (downstream in 3' direction) from the SD sequence. The following description serves to illustrate the preparation of a preferred vector, pRC23, into which the IL-2 gene is then introduced. However, other vectors may also be used.
In accordance with the procedure outlined in Figures 2 and 3 20 micrograms of pBR322 were digested with EcoRI and then used in two different reactions: 1) treatment with S1 nuclease to remove the 5' overhang, and 2) treatment with the Klenow fragment of DNA polymerase I to fill-in the ter-mini. Both reactions were terminated by phenol extraction followed by ethanol precipitation. DNA from each reaction was ligated to a synthetic BglII linker, digested with BglII
and PstI, and subjected to gel electrophoresis in 1% aga-rose. The 3600 by (base pairs) and 760 by fragments from both reactions were recovered from the gel. For the con-struction of pRC2, the 3600 by fragment from the Klenow reaction was ligated to the 760 by fragment from the S1 reaction. E. coli RR1 was transformed with the ligation mixture and transformants were selected on media containing 50 ug/ml ampicillin. Transformants containing the expected plasmid construction, i.e. a plasmid containing a BglII
restriction site in proximity of the EcoRl restriction site, were identified by restriction analysis of the isolated plasmid DNA. pRC23 was constructed by ligating synthetic oligonucleotides comprising a "consensus" or computer gene-rated ribosome-binding site (RBS), [Scherer et al. Nucleic Acids Research, 8, 3895 (1980)] to a 250 by Bgl II - Hae III
fragment containing the lambda. PL promoter, and inserting -a-~3~~~~3 the ligation product into pRC2.
In order to isolate the 250 by DNA fragment containing the lambda PL promoter, 1 microgram of a 450 by Bgl II -Hpa I DNA fragment (from by #35260 to 35710 of the lambda phage DNA sequence) was digested with Hae III and the pro-ducts were isolated by preparative gel electrophoresis in 5%
polyacrylamide. About 200 ng of the 250 by Bgl II - Hae III
fragment was ligated to 60 pmoles each of the synthetic oligonucleotides shown in Figure 3 which comprise most of the ~~consensus~~ RBS sequences generated by computer analysis as described by Scherer et al. The ligated molecules were digested with Bgl II and EcoRl (to eliminate oligomers) and purified by gel electrophoresis. The ligated products were then inserted into pRC2 which also had been digested with Bgl II and EcoRI. Transformation of E. coli strain RR1(pRK248cIts) was performed using standard methods and transformants were seclected on media containing ampicillin (50 ug/ml) at 30°C. 50 transformants were obtained, DNA
was isolated from 8 of those and analyzed by digesting with Hinc II. 6 of the 8 showed the expected restriction pattern and Maxam-Gilbert nucleotide sequence analysis of one of these confirmed the expected construction (designated pRC23).
Construction of a alasmidic expression vector containinu DN_A
coding for mature human IL-2 (1) Isolation of mRNA coding for human IL-2 mRNA was isolated from H33HJ-JAI cells (ATCC No.
CRL-8163, deposited August 26, 1982), a clone of Jurkat cell line FHCRC, after induction with PHA and PMA.
12,000 ml of H33HJ-JAI clone cell cultures (106 cells/ml) were grown in RPMI 1640 tissue culture medium supplemented with 10% Fetal Bovine Serum, 50 U/ml peni-cillin, 50 ug/ml streptomycin, 50 ug/ml gentamycin, and 300 ug/ml fresh L-glutamine. These cells were collected by centrifugation and resuspended in 6 1 of 13~0~~3 _ g _ the above detailed medium, lacking serum, but further supplemented with 1% PHA and 10 ng/ml PMA. Cells were dispended in 6 1 aliquots to sterile glass roller bottles and placed on a roller mill (10 rpm at 37°C).
Eight hours later, cells were collected by centrifuga-tion and mRNA was extracted using a standard phenol chloroform extraction procedure. Following phenol chloroform extraction, ethanol precipitated RNA was pelleted by high speed centrifugation, and resuspended in a 0.5M salt solution. Poly A-tailed mRNA contained in the total RNA population was collected by passage of this material over an oligo(dT)cellulose column. Ethanol precipitated mRNA was resuspended in water to a concen-tration of 500 ug/ml. 30 ng of RNA was then microin-jected into Xenopus oocytes. After 24 hours of incuba-tion in sterile Barth~s solution, 4 eggs were trans-ferred into a sterile 1.5 ml Eppendorf centrifuge tube and fed with 540-1500 microliters of fresh sterile Barth~s solution. 48 hours later, 200 microliters of egg conditioned medium was harvested and assayed for IL-Z
activity using a standard CTLL Cell 3H-Tdr incorpora-tion assay (Gillis et al., J. Immunoi. 120, 2027 [1978]). mRNA preparations which when translated by oocytes gave rise to significant IL-2 activity, were pooled, sized by standard sucrose density gradient centrifugation techniques and ethanol precipitated for cDNA library construction.
(2) cDNA Synthesis 3.5 ug of purified mRNA (approximately 10S on sucrose gradients) were used to synthesize double-stranded complementary DNA (ds cDNA) by the following method (Gubler and Hoffmann, Gene 25, 263-269 [1983]).
~3~-0853 (a) First strand cDNA synthesis:
The mRNA was suspended in 17.5 ml containing 50 mM
Tris-HC1, pH 8.3, 10 mM MgCl2, 10 mM DTT, 4 mM
Na-pyrophosphate, 1.25 mM dATP, 1.25 mM dGTP, 1.25 mM dTTP, 0.5 mM dCTP, 100 ug/ml of oligo(dT)12-18' and 10 Ci of 32P-dCTP (Amersham 3000 Ci/mMole). After incubation for 5 min. at 43°C, 3x00 units AMV reverse transcriptase/ml (Life Sciences, Inc.) was added and the mixture incubated for 30 min. at 43°C. The reaction was stopped by the addition of EDTA to 20 mM, extracted with phenol-cresol, and concentrated by ethanol precipi-tation. The yield of the first strand synthesis, as assayed by TCA-insoluble radioactivity, was calcu-lated to be 58.6 ng (1.7%).
(b) Second strand synthesis: , The cDNA-mRNA hybrid was resuspended in 5.8 micro-liters H20. To this solution, 7.7 microliters of the second strand synthesis mix was added to give a solution containing 20 mM Tris-HC1, pH 7.5, 5 mM
MgCl2, 10 mM (NH4)2504, 100 mM KC1, 0.15 nM
beta-NAD, 50 ug/ml BSA, 40 mM dNTPs, 8.5 units/ml of E. coli RNase H (Bethesda Research Labs), 230 Units/ml DNA polymerase I (Boehringer Mannheim), 10 units/ml E.coli DNA ligase (New England Biolabs).
The mixture was incubated for 60 min. at 12°C, then for 60 min. at 22°C. The reaction was stopped by addition of EDTA to 20 mM, and extracted with phenol-cresol. The cDNA was separated from free nucleotides by passage over a Sephadex G-50 fine column in 10 mM TEAB. The yield from this reaction was 107 ng of dscDNA (91%).
(~) Annealing and transformation 64 ng of dscDNA were tailed by addition of dGTP
using standard methods. The vector was prepared by digestion of pBR322 DNA with EcoRV (New England-Biolabs) and tailing with dCTP. 100 ng of tailed BR322 DNA and 1.25 ng of tailed cDNA inserts (ratio - 80:1) were annealed in 250 ul of O.O1M
Tris, pH 7.5, 1 mM EDTA, 0.15 M NaCl for 90 min. at 58°C, and transformed into competent E.coli RRI
cells. Transformed cells were plated on LB plates containing 100 ug/ml ampicillin (Bristol Labs), and incubated at 3?°C for 12 hours. A total of 3,200 colonies were generated for the IL-2 cDNA
library.
(3) Screenincr of cDNA library for.IL-2 gene seauences To detect full-length cDNA copies of the IL-2 gene, a synthetic deoxy-oligonucleotide probe was used which corresponds to nucleotides 45-65 of the human IL-2 cDNA
sequence published by Taniguchi~ et al. (Nature 302, 305-310 [1983]). This probe [ACAATGTACAGGATGCAACTC] was synthesized by the solid-phase phosphodiester method, purified by HPLC, and labeled by using 32P-ATP (ICN
Pharmaceuticals, 7000 Ci/mM) and polynucleotide kinase (New England Biolabs). Colonies representing the cDNA
library were transferred to nitrocellulose filters by the method of Grunstein and Hogness (Methods in Enzymo-logy 68, 379 [1979]). After hybridization at 30°C for 16 hours, filteres were washed in 4xSSC at 45°C for 45 minutes, dried, and autoradiographed. A single posi-tive colony was detected and found to contain the entire IL-2 coding sequence. This colony, designated pIL2-2B, was used to prepare DNA for nucleotide sequence analysis and for expression in E.coli. Nucleotide sequence analy-sis showed it to be identical to that of the sequence published by Taniguchi et al. with two differences:
pIL2-2B contains an insert which begins at nucleotide 17, as designated in the Taniguchi sequence, and has a substation of a G at position 503.
.. ~~~OS~3 (4) Construction of the E.coli plasmidic vector containin DNA coding for Ser-IL-2.
An E.coli expression vector for IL-2 was constructed from three segments (see Fig. 4): (1) the vector pRC23, with the lambda PL promoter, (2) a synthetic adapter molecule, and (3) a Hgi AI - Aha III fragment isolated from the IL-2 cDNA. The vector DNA was prepared by digestion of 50 ng of pRC23 DNA with EcoRI and EcoRV, followed by phenol extraction and ethanol precipitation.
l0 The synthetic adagter molecule was obtained by annealing two complementary synthetic deoxy-oligonucleotide sequences, A and B:
(A) 5' AATTCAATTATGAGTGCA 3' (B) 3' GTTAATACTC 5' This double-stranded adapter can anneal to an EcoRI site at its 5' end and to a HgiAI site at its 3' end. The cDNA insert was prepared by digestion of pIL2-2B DNA
with the restriction enzyme BamHl (Bethesda Research Labs), which releases the 1 kilobase IL-2 insert from this clone. The BamHl fragment was gel-purified and further digested with HgiAI (New England Biolabs) and Aha III (New England Biolabs), then phenol-extracted and ethanol precipitated. HgiAI cuts between the alanine and proline codons at the beginning of the sequence coding for mature IL-2. The cloning strategy for expression uses the EcoRI site adjacent to the PL promoter in the pRC23 vector. The synthetic adapter molecule can join this EcoRI site in the vector to the HgiAI site at the start of the cDNA IL-2 sequence. The adapter was desig-ned to create the methionine codon for translation ini-tation. Codons for serine and for alanine, the first amino acid of mature IL-2, are created when the adapter and the cDNA are ligated at the HgiAI site. The cDNA is joined to pRC23 via blunt-end ligation of the AhaIII
site to the EcoRV site in the vector DNA.
M
- i3 -Ligation of the three segments was performed in a volume of 10 y.l which contained 0.05 pM each of the vector, synthetic adapter and cDNA insert DNAs, 65 mM Tris, pH
7.6, 10 mM MgCl2, 0.5 mM ATP, and 15 mM beta-mercapto-ethanol. The ligation mixture was heated at 65°C for 5 minutes, cooled to 4°C before addition of 200 Units of T4 DNA ligase (New England Biolabs), then incubated at 4°C for 16 hours. The T4 DNA ligase was inactivated by heating at 65°C for 5 minutes. Then the ligated DNAs were digested with EcoRV to remove any undigested vector DNA. The mixture was then used for transformation of E.coli strain RRI (pRK248cIts), and these cells were grown at 30°C for 15 hcurs.
The colonies were transferred to nitrocellulose filters as described previously, baked, and hybridized with a radioactive probe of 32P-labeled synthetic adapter molecule A. One positive colony, designated pRC23/IL-2, #4-1, was chosen for analysis. This clone was found to synthesize more than 200,000 units/ml of IL-2 when the PL promoter was induced to express at 42°C. The IL-2 activity was detected by bioassay on CTLL cells, an indicator cell line for IL-2 (as described in Gillis et al. J. Immunol. 120, 2027 [1978]).
(5) Construction of an E.coli ex ression vector for urodu-cing mature IL-2 (with alanine as the first amino acid at the amino terminus) To express mature IL-2 in E.coli, the following strategy (illustrated in Fig. 5) was followed. A HgiAI restric-tion endonuclease site is located at the Ser-Ala junc-tion, the cleavage site for the removal of the signal peptide of IL-2 (Robb et al., PNAS, 80, 5990-5994 [1983]). Following digestion with HgiAI, the termini were made blunt-ended by treating with T4 DNA poly-merase. The resulting molecules were then blunt-end ligated to a 108 by BglII-Hae III fragment isolated from phage lambda DNA, digested with BglII and XbaI and inserted between BglII and RbaI sites in the vector pRC23/IL-2, #4-1. This intermediate cloning step was included to ensure that the T4 DNA polymerase treatment occurred as expected, which was confirmed by the crea-tion of a new StuI site from the joining of the HaeIII
terminus to the blunt-ended HgIAI terminus. Redigesting with StuI conveniently regenerates at this site the blunt end beginning with the CCT proline codon. The intermediate plasmid construction was designated pRC201/I1-2. Two synthetic deoxyoligonucleotides were designed which incorporate an ATG-translational initia-tion codon, restore the alanine codon, and create an EcoRI terminus. These oligomers were ligated to the EcoRI terminus of the expression vector pRC23, digested with PstI, and the resulting 1025 by fragment was gel purified. The 1025 by (PstI to blunt-end) fragment was inserted between the PstI site and the newly created StuI site in pRC201/IL-2. Transformants containing the expected construction were identified by restriction analysis of the isolated plasmid DNA. The confirmed plasmid construction was designated pRC233/I1-2 (see Fig. 6).
Preferred host organisms for transformation by a vector containing the gene for IL-2 in connection with the present invention include bacteria such as strains of E.coli; bacillaceae, such as Bacillus substillis and the like. Yeasts form a further preferred group of microorganisms for transformation.
A specifically preferred microorganism employed as the recipient in the transformation procedures is Esche-richia coli K-12 strain 294 as described in British patent Publication No. 2055382A, deposited with the American Type Culture Collection, ATCC Accession No.
31446, on October 28, 1978. However, also other known 13~.0~~3 E.coli strains such as E.coli RR1, ATCC Accession No.
31343, or other microorganisms many of which are deposi-ted and available from recognized microorganism deposi-tory institutions, such as the American Type Culture Collection can be used as host organisms. In the prac-tice of this invention overnight cultures of the trans-formed E.coli are grown in LB broth at 30°C. One liter of the overnight culture is preferably diluted to 10 liters with minimal M-9 medium containing casamino acids. At logarithmic growth, the culture is shifted from 30°C to 42°C to induce IL-2 production. Following incubation at 42°C for 2-3 hours, the bacteria are harvested by centrifugation. All fermentations and procedures were performed in accordance with recombinant DNA guidelines of the National Institutes of Health. The purification steps are described in detail in the follo- -wing Examples.
Example 1 One gram of IL-2 (having serine at the NH2 terminus) producing transformed E.coli cells were suspended in 30 mM
Tris-HC1, pH 8.0, 5 mM EDTA, 1 mM phenylmethylsulfonyl fluoride and lysed by sonification. The lysis mixture was centrifuged at 14,000 x g for 15 minutes. The membrane portion of the centrifuged lysate was then removed and iso-lated from the other components of the lysate. The membrane component was then subjected to the four washing or IL-2 extraction steps shown below in Table 1. Each wash solution was used in an amount of at least 5 ml/gram of cells. The bulk of the IL-2 activity was extracted in the final wash as detailed in Table 1. The final resultant wash solution which contained the bulk of the IL-2 activity and which was at least about 50% pure as judged by SDS-PAGE, was then subjec-ted to reverse phase HPLC (RP-C8). There was a 40-60% reco-very of substantially 100% pure IL-2 (with serine at the NH2 terminus). The IL-2 activity was found to be at least <",, , *Trademark -16 - ~3~0~~~
1 x loa u/mg.
Table 1 Extraction of IL-2 from E.coli membrans Total Total IL-2 Specific Protein Activity Activity Extraction (mcr) units u/m 1M NaCl wash 0.4 mg 0.03 x 106 0.1 x 106 1% Triton wash 2 mg 0.75 x 106 0.4 x 106 1.75 guanidine-HC1 wash 1 mg 1.5 x 106 1.5 x 106 7M guanidine-HC1 wash 4.7 mg 250 x 106 53 x 106 (99%) 252.3 x 106 Example 2 This example serves to demonstrate that IL-2 tends to become associated with the membrane components of the trans-formed E.coli host cells.
In order to demonstrate this, one gram of serine-NH2 terminus IL-2 producing transformed E.coli cells were sus-pended in 10 ml of 20% sucrose, 30 mM Tris-HC1, pH 8.0, and lysed using lysozyme-EDTA to separate proteins which are localiced in the periplasmic space. The remainder of the lysed mixture was then subjected to sonification. The mem-brane portion (inner and outer membranes) was then separated from the other cellular components by sucrose gradient cen-trifugation with which the inner and outer membranes were also separated. Table 2 shows that the majority of IL-2 activity was located in the inner cellular membrane.
_ 17 - ~3~O8~J
Table 2 Localization of IL-2 in E.coli cells Total Total IL-2 Recovery of Protein Activity IL-2 Fraction (mct) (units) [%~
Soluble Fraction 37 mg 2 x 106 0.3 Periplasmic Fraction 2 mg 10 x 106 1.5 Outer Membrane 6 mg 8 x 106 1.2 Inner Membrane 15 mg 6.6 x 108 97 Example 3 One gram of mature IL-2 producing transformed E.coli cells was suspended in 30 mM Tris-HC1, pH 8, 5 mM EDTA, 1 mM
phenylmethylsulfonyl'fluoride and lysed by sonification. The lysis mixture was centrifuged at to 14,000 x g for 15 minu-tes. The membrane portion of the centrifuged lysate was iso-lated from the other components of the lysate. The membrane portion was then subjected to the four washing or IL-2 extraction steps shown below in Table 3. Each wash solution was used in an amount of at least 5 ml per each gram of cells. The bulk of the IL-2 activity was finally extracted in the final wash as detailed in Table 3. The final resul-tant wash solution which contained the bulk of the IL-2 activity and which was at least 50% pure as judged by SDS--PAGE, was then subjected to reverse phase high performance liquid chromatography (RP-C8). The recovery of substantially 100% pure mature IL-2 was about 60%. The IL-2 activity was found to be approximately 4 x 108 U/mg.
Table 3 Extraction of Mature IL-2 from E.coli membrane Total Total IL-2 Specific Protein Activity Activity Extraction (ma) (units) _ (u/mcr) 1M NaCl wash 0.5 0.3 x 106 0.6 x 105 1% Triton wash 3.3 5.5 x 106 1.7 x 106 1.75M guanidine-HC1 wash 2.5 10.0 x 106 4.0 x 106 7M guanidine-HC1 wash 10.1 779 x 106 77.1 x 106 (98%) 794.8 x 106 Example 4 The following example illustrates the purification of mature IL-2 from transformed E.coli paste utilizing a Procion Red Agarose chromatographic step in addition to HPLC.
Membrane Extraction of Cells Frozen E.coli cells (containing the plasmid for human IL-2) are thawed and 1 gm is added to 5 ml of Buffer A
(0.03 M Tris-HC1, pH 8.0, 0.005 M EDTA). After mixing 10 minutes, the cells are removed by centrifugation in a Sorval SS-34 rotor (10,000 rpm for 10 minutes). The superna-tant is removed and the cells resuspended in 5 ml Buffer A.
The suspended cells are broken with a Branson Cell Disruptor 350 (sonicator) (6 x 30 sec). The broken cells are centri-fuged (10,000 rpm for 10 minutes) and the supernatant con-taining the soluble proteins is discarded. The residue is washed once with 5 ml Buffer A and centrifuged (10,000 rpm for 10 minutes). The residue containing the membrane frac-Lion is suspended in Buffer B (1 M NaCl, 0.03 M Tris-HC1, pH
8.0, 0.005 M EDTA) with a Wheaton Dounce tissue homogenizes.
After mixing 10 minutes, the membrane fraction is removed by ._ 13~08~~
centrifugation in a Sorval SS-34 rotor (15,000 rpm for minutes). The residue is suspended in 5 ml Buffer C (1%
Triton X-100, 0.03 M Tris-HC1, pH 8.0), homogenized, mixed and centrifuged (15,000 rpm for 10 minutes). The centrifuged 5 residue is suspended in 5 ml of 1.75 M guanidine-HC1, homo-genized, mixed and centrifuged (15,000 rpm for 10 minutes).
The residue is washed once with 5 ml Buffer A and centrifu-ged. The membrane fracticn (residue) is extracted with 5 ml of 7 M guanidine-HC1. After centrifugation, the extract con-10 taming the IL-2 is saved and the residue is extracted a second time with 5 ml of 7 M guanidine-HC1. This extract is also Saved.
Chromatoaraphy on Procion Red Aq_arose The column is set up at room temperature and washed with two volumes of 7 M guanidine-HC1 before using the first time. The column is equilibrated with equilibration buffer (0.01 M Tris-HC1,'pH 7.9, 0.035 M NaCl) at 4°C. At least 1 ml of Procion red agarose should be used for each 100 y.g of IL-2 expected. The flow rate is 2 bed volumes per hour.
The 7 M guanidine-HC1 extract containing the IL-2 is diluted 40-fold with equilibration buffer and the precipitate remo-ved by centrifugation. The supernatant is then loaded on the column. The column is washed with two column volumes of equilibration buffer. The IL-2 is eluted in a peak after 1.5-2 volumes of elution buffer (0.01 M Tris-HC1, pH 7.9, 1.035 M NaCl). After the IL-2 has been removed, the column is rid of extraneous materials by washing with 6M guani-dine-HC1.
Chromatocrraphy on RP-P (C-18) The pH of the Procion red eluate is adjusted to 7 with a slow addition of 1.0 M acetic acid. Aliquots of 0.1 ml each are removed for assay purposed before and after pH adjust-ment. The neutralized eluate (60 mi) is pumped with 1 ml/min. onto a 0.31 x 25 cm RP-18 column, equilibrated with an equilibration buffer mixture consisting of 5% HPLC-13~.08~~
-Buffer II and 95% HPLC-Buffer I. Column flowthrough is collected and assayed for protein content and IL-2 bioacti-vity. The column is eluted at room temperature according to the gradient profile outlined in Table 4. The effluent is monitored at 220 nm and 1.5 ml fractions are collected and assayed for protein content and IL-2 activity. The peak of maximum IL-2 activity elutes at ca. 74% HPLC-Buffer II (59%
acteonitrile). Fractions are stored at 4 to 8°C and are pooled according to specific activity.
Table 4 Conditions for the chromatography of a typical Procion-red eluate on an RP-18 column Sample Load: 60 ml Column Dimensions 0.41 x 25 cm Flow Rate: 1 ml/min HPLC Buffer I: - 0.01 M phosphoric acid, 0.05 M
lithium chloride HPLC-Buffer II: 0.01 M phosphoric acid, 0.05 M
lithium chloride, 80% acetonitrile % HPLC-Buffer II Duration (min) Equilibration 5 20 Sample load - 60 Wash 5 15 Step 1, gradient 5 to 35 15 Step 2, gradient 35 to 85 50 Step 3, constant 85 5 Step 4, constant 5 5 All chromatographic steps are carried out at room tempe-rature.
Claims (13)
1. A method for producing substantially homogeneous mature recombinant human interleukin-2 (IL-2), which comprises (a) cultivating a transformed microorganism containing a DNA sequence which codes for mature human IL-2;
(b) causing a culture of the transformed microorganism of step (a) to express and accumulate mature human IL-2;
(c) lysing the culture of transformed microorganism of step (b) to form a cell lysate mixture;
(d) separating the cell membrane components from the cell lysate mixture of step (c):
(e) washing the isolated cell membrane components with an extraction solution, comprising salt and detergent to yield a wash solution containing IL-2.
(f) chromatographically purifying the wash solution of step (e) to yield a substantially pure or homogeneous recombinant human IL-2.
(b) causing a culture of the transformed microorganism of step (a) to express and accumulate mature human IL-2;
(c) lysing the culture of transformed microorganism of step (b) to form a cell lysate mixture;
(d) separating the cell membrane components from the cell lysate mixture of step (c):
(e) washing the isolated cell membrane components with an extraction solution, comprising salt and detergent to yield a wash solution containing IL-2.
(f) chromatographically purifying the wash solution of step (e) to yield a substantially pure or homogeneous recombinant human IL-2.
2. The method of claim 1 wherein the culture of transformed microorganisms are lysed by sonification.
3. The method of claim 1 wherein the cell membrane components are separated from the cell lysate mixture by centrifugation.
4. The method of claim 1 wherein the isolated cell membrane components are washed with salt and detergent solutions prior to washing with the extraction solution.
5. The method of claim 4 wherein the salt and detergent washes are carried out sequentially in three separate steps.
6. The method of claim 5 wherein the cell membrane components are washed in the first step with a NaCl solution, in the second step with a detergent and in the third step with a guanidine-HCl solution having a molarity of about 1.75 to 2Ø
7. The method of claim 6 wherein the concentration of the guanidine-HCl solution is about 7M.
8. The method of claim 1 wherein the chromatographic purification is carried out by high performance liquid chromatography.
9. The method of claim 1 wherein the chromatographic purification is carried out by affinity chromatography.
10. The method of claim 9 wherein the affinity chromatography is dye affinity chromatography.
11. The method of claim 1 wherein the chromatographic purification is a multiple step procedure utilizing high performance liquid chromatography and affinity chromatography.
12. The method of claim 2 wherein the cell membrane components are separated from the cell lysate mixture by centrifugation.
13. The method of claim 2, 3 or 12 wherein the isolated cell membrane components are washed with salt and detergent solutions prior to washing with the extraction solution.
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US56498683A | 1983-12-23 | 1983-12-23 | |
| US564,986 | 1983-12-23 |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CA1340853C true CA1340853C (en) | 1999-12-21 |
Family
ID=24256731
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CA000470498A Expired - Lifetime CA1340853C (en) | 1983-12-23 | 1984-12-19 | Purification of recombinant interleukin-2 |
Country Status (12)
| Country | Link |
|---|---|
| EP (1) | EP0147819B1 (en) |
| JP (2) | JPH0728753B2 (en) |
| AT (1) | ATE76905T1 (en) |
| AU (1) | AU580276B2 (en) |
| CA (1) | CA1340853C (en) |
| DE (1) | DE3485759D1 (en) |
| DK (1) | DK174501B1 (en) |
| IE (1) | IE57914B1 (en) |
| IL (1) | IL73882A (en) |
| NZ (1) | NZ210634A (en) |
| PH (1) | PH19584A (en) |
| ZA (1) | ZA849910B (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US10889643B2 (en) | 2016-01-11 | 2021-01-12 | Universität Zürich | Immune-stimulating humanized monoclonal antibodies against human interleukin-2, and fusion proteins thereof |
| US10894828B2 (en) | 2014-07-10 | 2021-01-19 | Universität Zürich | Immune-stimulating monoclonal antibodies against human interleukin-2 |
Families Citing this family (24)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US4925919A (en) * | 1984-04-25 | 1990-05-15 | Roland Mertelsmann | Purified interleukin 2 |
| US4992271A (en) * | 1982-09-23 | 1991-02-12 | Cetus Corporation | Formulation for lipophilic IL-2 proteins |
| US4853332A (en) * | 1982-10-19 | 1989-08-01 | Cetus Corporation | Structural genes, plasmids and transformed cells for producing cysteine depleted muteins of biologically active proteins |
| JPS60115528A (en) * | 1983-11-28 | 1985-06-22 | Takeda Chem Ind Ltd | Human interleukin-2 protein, its production and pharmacological composition containing the same |
| US4569790A (en) * | 1984-03-28 | 1986-02-11 | Cetus Corporation | Process for recovering microbially produced interleukin-2 and purified recombinant interleukin-2 compositions |
| US4908433A (en) * | 1984-04-25 | 1990-03-13 | Sloan-Kettering Institute For Cancer Research | Uses of interleukin-2 |
| US4908434A (en) * | 1984-04-25 | 1990-03-13 | Sloan-Kettering Institute For Cancer Research | Process for preparing purified interleukin-2 |
| WO1986002068A1 (en) * | 1984-09-26 | 1986-04-10 | Takeda Chemical Industries, Ltd. | Mutual separation of proteins |
| IL76360A0 (en) * | 1984-09-26 | 1986-01-31 | Takeda Chemical Industries Ltd | Mutual separation of proteins |
| WO1986007093A1 (en) * | 1985-05-29 | 1986-12-04 | The Green Cross Corporation | Process for preparing heterogenic protein |
| US4748234A (en) * | 1985-06-26 | 1988-05-31 | Cetus Corporation | Process for recovering refractile bodies containing heterologous proteins from microbial hosts |
| DE3581412D1 (en) * | 1985-07-16 | 1991-02-21 | Green Cross Corp | METHOD FOR PRODUCING HETEROPROTEINS. |
| US5831022A (en) * | 1986-02-18 | 1998-11-03 | Hoffmann-La Roche Inc. | Purification of recombinant human IL-1α |
| US4929700A (en) * | 1987-04-16 | 1990-05-29 | Cetus Corporation | Production of purified, biologically active, bacterially produced recombinant human CSF-1 |
| CA1339757C (en) * | 1987-04-16 | 1998-03-17 | Robert F. Halenbeck | Production of purified biologically active, bacterially produced recombinant human csf-1 |
| US5162507A (en) * | 1987-05-11 | 1992-11-10 | Cetus Corporation | Process for recovering purified, oxidized, renatured recombinant interleukin-2 from microorganisms |
| US4931543A (en) * | 1987-05-11 | 1990-06-05 | Cetus Corporation | Process for recovering microbially produced interleukin-2 |
| US5162503A (en) * | 1987-05-19 | 1992-11-10 | Hoffmann-La Roche, Inc. | Purification of interleukin-2 by receptor-affinity chromatography |
| EP0337243A1 (en) * | 1988-04-14 | 1989-10-18 | F. Hoffmann-La Roche Ag | Process for purifying recombinant human interleukin-2 |
| ZA898139B (en) * | 1988-11-17 | 1990-08-29 | Hoffmann La Roche | Recombinant interleukin-2 hybrid proteins |
| IT1262981B (en) * | 1992-09-09 | 1996-07-23 | Tecnogen Scpa | PROCEDURE FOR PURIFYING THE BIG ENDOTELINE PROTEIN |
| US7144999B2 (en) | 2002-11-23 | 2006-12-05 | Isis Pharmaceuticals, Inc. | Modulation of hypoxia-inducible factor 1 alpha expression |
| JP2006141263A (en) * | 2004-11-18 | 2006-06-08 | Kyoto Univ | Method for producing (r)-hydroxynitril lyase |
| RU2565553C2 (en) * | 2013-04-09 | 2015-10-20 | Общество с ограниченной ответственностью "Стратегия" | Method of obtaining interleukin-2 preparation, interleukin-2 preparation and pharmaceutical immunomodulating preparation |
Family Cites Families (9)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| JPS58159420A (en) * | 1982-03-18 | 1983-09-21 | Ajinomoto Co Inc | Purification method of interleukin 2 |
| EP0091539B2 (en) * | 1982-03-31 | 1996-11-27 | Ajinomoto Co., Inc. | Gene coding for interleukin-2 polypeptide, recombinant DNA carrying said gene, cell lines possessing the recombinant DNA,and method for producing interleukin-2 using said cells |
| EP0092163B1 (en) * | 1982-04-20 | 1988-09-28 | Sloan-Kettering Institute For Cancer Research | Purification of interleukin 2 |
| JPS58198293A (en) * | 1982-05-12 | 1983-11-18 | Shionogi & Co Ltd | Production of immunoregulator such as interleukin |
| JPS59144719A (en) * | 1983-02-03 | 1984-08-18 | Japan Found Cancer | Gene coding interleukin-2 polypeptide, recombined dna substance containing gene, and preparation of interleukin-2 using live cell strain containing dna substance and cell |
| EP0119621A1 (en) * | 1983-03-21 | 1984-09-26 | F. HOFFMANN-LA ROCHE & CO. Aktiengesellschaft | Interleukin-2 |
| JPS60115528A (en) * | 1983-11-28 | 1985-06-22 | Takeda Chem Ind Ltd | Human interleukin-2 protein, its production and pharmacological composition containing the same |
| US4569790A (en) * | 1984-03-28 | 1986-02-11 | Cetus Corporation | Process for recovering microbially produced interleukin-2 and purified recombinant interleukin-2 compositions |
| DE3419995A1 (en) * | 1984-05-29 | 1985-12-05 | Hoechst Ag, 6230 Frankfurt | GENE TECHNOLOGICAL METHOD FOR PRODUCING HUMAN INTERLEUKIN-2 AND MEANS FOR CARRYING OUT THIS METHOD |
-
1984
- 1984-12-19 NZ NZ210634A patent/NZ210634A/en unknown
- 1984-12-19 DK DK198406124A patent/DK174501B1/en not_active IP Right Cessation
- 1984-12-19 CA CA000470498A patent/CA1340853C/en not_active Expired - Lifetime
- 1984-12-19 ZA ZA849910A patent/ZA849910B/en unknown
- 1984-12-20 AU AU36995/84A patent/AU580276B2/en not_active Expired
- 1984-12-20 IL IL73882A patent/IL73882A/en not_active IP Right Cessation
- 1984-12-21 EP EP84116054A patent/EP0147819B1/en not_active Expired - Lifetime
- 1984-12-21 AT AT84116054T patent/ATE76905T1/en not_active IP Right Cessation
- 1984-12-21 DE DE8484116054T patent/DE3485759D1/en not_active Expired - Lifetime
- 1984-12-21 IE IE3320/84A patent/IE57914B1/en not_active IP Right Cessation
- 1984-12-22 JP JP59271681A patent/JPH0728753B2/en not_active Expired - Lifetime
- 1984-12-26 PH PH31644A patent/PH19584A/en unknown
-
1994
- 1994-09-08 JP JP6215128A patent/JP2864996B2/en not_active Expired - Lifetime
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US10894828B2 (en) | 2014-07-10 | 2021-01-19 | Universität Zürich | Immune-stimulating monoclonal antibodies against human interleukin-2 |
| US10889643B2 (en) | 2016-01-11 | 2021-01-12 | Universität Zürich | Immune-stimulating humanized monoclonal antibodies against human interleukin-2, and fusion proteins thereof |
| US11851484B2 (en) | 2016-01-11 | 2023-12-26 | Universität Zürich | Immune-stimulating humanized monoclonal antibodies against human interleukin-2, and fusion proteins thereof |
Also Published As
| Publication number | Publication date |
|---|---|
| JPH07233082A (en) | 1995-09-05 |
| IL73882A (en) | 1989-05-15 |
| DK612484A (en) | 1985-06-24 |
| EP0147819A3 (en) | 1987-09-23 |
| DE3485759D1 (en) | 1992-07-09 |
| EP0147819A2 (en) | 1985-07-10 |
| JP2864996B2 (en) | 1999-03-08 |
| ZA849910B (en) | 1985-09-25 |
| ATE76905T1 (en) | 1992-06-15 |
| DK174501B1 (en) | 2003-04-28 |
| NZ210634A (en) | 1989-05-29 |
| IE843320L (en) | 1985-06-23 |
| IE57914B1 (en) | 1993-05-19 |
| PH19584A (en) | 1986-05-26 |
| EP0147819B1 (en) | 1992-06-03 |
| JPH0728753B2 (en) | 1995-04-05 |
| AU580276B2 (en) | 1989-01-12 |
| DK612484D0 (en) | 1984-12-19 |
| IL73882A0 (en) | 1985-03-31 |
| JPS60172295A (en) | 1985-09-05 |
| AU3699584A (en) | 1985-07-04 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CA1340853C (en) | Purification of recombinant interleukin-2 | |
| US5643758A (en) | Production and purification of a protein fused to a binding protein | |
| US4762791A (en) | Human immune interferon | |
| US4456748A (en) | Hybrid human leukocyte interferons | |
| US5460811A (en) | Mature human fibroblast interferon | |
| US7635466B1 (en) | DNA sequences, recombinant DNA molecules and processes for producing human fibroblast interferon-like polypeptides | |
| US4678751A (en) | Hybrid human leukocyte interferons | |
| US4897348A (en) | Recombinant materials and methods for producing human connective tissue-activating peptide-III and analogs thereof | |
| US5096705A (en) | Human immune interferon | |
| EP0158198A1 (en) | DNA and use thereof | |
| CA1340173C (en) | Production and purification of a protein fused to a binding protein | |
| US6268180B1 (en) | Recombinant human recombinant human interleukin-1α | |
| US5582824A (en) | Recombinant DES-CYS-TYR-CYS human immune interferon | |
| JPH0240080B2 (en) | ||
| US4801685A (en) | Microbial production of mature human leukocyte interferon K and L | |
| EP0091527A2 (en) | DNA sequences, recombinant DNA molecules and processes for producing human serum albumin-like polypeptides | |
| US5026639A (en) | Method to improve mRNA translation and use thereof for production of platelet factor-4 | |
| US5317011A (en) | Cloning and expression of a variant gene of platelet factor 4 and compositions thereof to modulate immune responses | |
| EP0126230A1 (en) | Novel DNA and use thereof | |
| JPS61149089A (en) | Polypeptide secretion development vector, microorganism transformed with same, and production of polypeptide with microorganism | |
| WO1985001067A1 (en) | Recombinant materials and methods for producing human connective tissue-activating peptide-iii and analogs thereof | |
| JPS61181380A (en) | Novel dna and use thereof | |
| JPH08245695A (en) | Substance having antitumor activity |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| MKEX | Expiry |
Effective date: 20161221 |