CA1335967C - Characterization and detection of sequences associated with insulin-dependent diabetes - Google Patents

Abstract

Four DNA sequences and four corresponding amino acid sequences from the HLA class II DR-beta region of the human genome that are associated with insulin-dependent diabetes mellitus (IDDM) have been identified. These sequences may be used to generate DNA
hybridization probes and antibodies for assays in detecting a person's susceptibility for IDDM.

Description

-PATENT
Case No. 2313 CHARACTERIZATION AND DETECTION OF SEQUENCES
ASSOCIATED WITH INSULIN-DEPENDENT DIABETES

This invention relates to HLA class II beta genes and proteins associated with insulin-dependent diabetes and methods for 5 their diagnostic detection.
Insulin-dependent diabetes mellitus (IDDM), a chronic autoimmune disease also known as Type I diabetes, is a familial disorder of glucose metabolism susceptibility for which is associated with human leukocyte antigens (HLA). The development of IDDM can be divided into six stages, beginning with genetic susceptibility and ending with complete destruction of beta-cells. G. Eisenbarth, N.
Eng. J. Med., 314:1360-1368 (1986). More than 90~ of all IDDMs carry the DR3 and/or DR4 antigen, and individuals with both DR3 and DR4 are at greater risk than individuals who have homozygous DR3/3 or DR4/4 15 genotypes. L. Raffel and J. Rotter, Clinical Diabetes, 3.50-54 (1985); L. Ryder et al., Ann. Rev. Genet., 15:169-187 (1981).
The HLA region, located on the short arm of chromosome 6, encodes many different glycoproteins that have been classified into two categories. The first category, class I products, encoded by the 2 0 HLA-A, -B, and -C loci, are on the surface of all nucleated cells and function as targets in T-cell recognition. The second category, class II products, encoded by the HLA-D/DR region, are on the surface of B
lymphocytes, macrophages and activated T cells. Of all the immunologically defined polymorphisms, the HLA-DR region has been 25 found to be most strongly associated with IDDM. Therefore, restriction fragments of the HLA class II-~ DNA have been analyzed for use as genetic markers of insulin-dependent diabetes mellitus. D.
Owerbach et al., Diabetes, 33:958-964 (1984); O. Cohen-Haguenauer et al., PNAS (USA), 82:3335-3339 (1985); D. Stetler et al., PNAS (USA), 82:8100-8104 (1985).
Allelic variation in the class II antigens is restricted to the outer domain encoded by the second exon of the protein. Serologic 2 133596~
methods for detecting HLA class II gene polymorphism are not capable of detecting much of the variation detectable by DNA methods.
Many HLA DR~ sequences have been published previously. The sequence AspIleLeuGluAspGluArg was reported by Gregersen et al., PNAS
(USA), 83:2642-2646 (1986) as part of a study of the diversity of DR~
genes from HLA DR-4 haplotypes. No mention was made of association with diabetes. In addition, J. Gorski and B. Mach, Nature, 322:67-70 (1986) reported on HLA-DR polymorphism within a group including the haplotypes DR3, DR5 and DRw6. The nucleotide sequences found in the polymorphic regions at the ~I locus were not discussed regarding association with diabetes. The first publication on HLA sequences from diabetics is that by D. Owerbach et al., Immunogenetics, 24:41-46 (1986). This paper bases the study on a HLA-DR~ gene library from one IDDM patient. The analysis of class II polymorphism and disease susceptibility requires the comparison of many sequences derived from patients and HLA-matched controls.
Allelic variations may be detected independently of restriction site polymorphism by using sequence-specific synthetic oligonucleotide probes. Conner et al., PNAS (USA), 80:278 (1983).
This technique has been applied to study the polymorphism of HLA DR-~using Southern blotting. Angelini et al., PNAS (USA), 83:4489-4493 (1986).
A further refinement of the technique using sequence-specific oligonucleotide probes involves amplifying the nucleic acid sample being analyzed using selected primers, four nucleotide triphosphates, and an appropriate enzyme such as DNA polymerase, followed by detecting the nucleotide variation in sequence using the probes in a dot blot format, as described in copending Canadian Application No. 526,476 filed December 30, 1986.
There is a need in the art for subdivision of the serologic markers HLA DR3 and DR4 to obtain more informative and more precisely defined markers for susceptibility to IDDM.
Accordingly, the present invention provides a series of four DNA markers and four protein markers corresponding thereto which are strongly associated with IDDM.

3 133S9~7 Specifically, in one aspect, the present invention provides a DNA sequence from the HLA class II beta genes associated with insulin-dependent diabetes mellitus selected from the group consisting of:
1) GAGCTGCGTAAGTCTGAG, 2) GAGGAGTTCCTGCGCTTC, 3) CCTGTCGCCGAGTCCTGG, and 4) GACATCCTGGAAGACGAGAGA, or the DNA strands which are complementary thereto.
In another aspect, the invention provides an amino acid sequence from the HLA class II beta region of the human genome associated with insulin-dependent diabetes mellitus selected from the group consisting of:
1) Glu Leu Arg Lys Ser Glu, 2) Glu Glu Phe Leu Arg Phe, 3) Pro Val Ala Glu Ser Trp, and 4) Asp Ile Leu Glu Asp Glu Arg.
In a third aspect, the invention relates to a process for detecting the presence or absence of sequences associated with 2 0 Su sceptibility to insulin-dependent diabetes mellitus in a DNA sample comprislng:
(a) treating the sample to expose the DNA therein to hybridization;
(b) affixing the treated sample to a membrane;
(c) treating the membrane under hybridization conditions with a labeled sequence-specific oligonucleotide probe capable of hybridizing with one or more of the four DNA sequences identified above or with the DNA strands complementary thereto; and (d) detecting whether the probe has hybridized to any DNA
in the sample.
In a fourth aspect, the invention provides an antibody that binds to one or more of the four amino acid sequences identified above.

4 13~5~67 In a fifth aspect, the invention provides a serological process for detecting the presence or absence of sequences associated with susceptibility to insulin-dependent diabetes mellitus in a protein sample comprising:
(a) incubating the sample in the presence of one or more of the antibodies described above that are labeled with a detectable moiety; and (b) detecting the moiety.
In a sixth aspect, the invention provides a kit for detecting the presence or absence of sequences associated with susceptibility to insulin-dependent diabetes mellitus in a DNA sample, which kit comprises, in packaged form, a multicontainer unit having one container for each labeled sequence-specific DNA probe capable of hybridizing with one or more of the four DNA sequences identified 15 above or with the DNA strands complementary thereto.
In a final aspect, the invention provides a kit for detecting the presence or absence of sequences associated with susceptibility to insulin-dependent diabetes mellitus in a protein sample, which kit comprises, in packaged form, a multicontainer unit 20 having a container for an antibody labeled with a detectable moiety that binds to one or more of the four amino acid sequences identified above.
As mentioned above, genetic susceptibility to IDDM has been correlated in both family and population studies with the presence of 25 the serologic markers HLA DR3 and DR4. The highest risk for IDDM is associated with HLA DR3,4 heterozygotes, suggesting that the susceptible alleles associated with these two DR types may be different and that two doses may be required for high risk to IDDM.
Prev;ous restriction fragment length polymorphism analysis has subdivided DR3 and DR4 into two subsets each. Molecular analyses of the HLA genes herein has resulted in further subdivision of the HLA
DR3 and DR4 serological types and in the generation of novel, more informative, and more precisely defined genetic markers for susceptibility to IDDM. The molecular techniques herein reveal not -only that the number of class II loci is unexpectedly large, but also that the allelic variation at these loci is greater than the polymorphic series defined by serological typing and can be more precisely localized.
The terms "oligonucleotide" as used herein is defined as a molecule comprised of two or more deoxyribonucleotides or ribonucleotides, preferably more than three. Its exact size will depend on many factors, which in turn depend on the ultimate function or use of the oligonucleotide. The oligonucleotide may be derived synthetically or by cloning.
The term "sequence-specific oligonucleotides" refers to oligonucleotides which will hybridize to one of the four specific DNA
sequences identified herein, which are regions of the locus where allelic variations may occur. Such oligonucleotides have sequences spanning one or more of the DNA regions being detected and are specific for one or more of the regions being detected. One sequence-specific oligonucleotide is employed for each sequence to be detected, as described further hereinbelow.
The term "monoclonal antibodies" as used herein refers to an immunoglobulin composition produced by a clonal population (or clone) derived through mitosis from a single antibody-producing cell. Unless otherwise indicated, the term is not intended to be limited to antibodies of any particular mammalian species or isotype or to antibodies prepared in any given manner. The term is intended to include whole antibody molecules as well as antigen-binding fragments (e.g., Fab, F(ab')2, Fv).
An "antibody-producing cell line" is a clonal population or clone derived through mitosis of a single antibody-producing cell capable of stable growth in vitro for many generations. The term "cell line" refers to individual cells, harvested cells, and cultures containing cells so long as they are derived from cells of the cell line referred to. Preferably the cell lines remain viable for at least about six months and maintain the ability to produce the specified monoclonal antibody through at least about 50 passages.

As used herein, the term "incubation" means contacting antibodies and antigens under conditions that allow for the formation of antigen/antibody complexes (e.g., proper pH, temperature, time, medium, etc.). Also as used herein, "separating" refers to any method, usually washing, of separating a composition from a test support or immobilized antibody, such that any unbound antigen or antibody in the composition are removed and any antigen/antibody complexes on the support remain intact. The selection of the appropriate incubation and separation techniques is within the skill of the art.
HLA class II beta genes have been isolated from HLA-typed IDDM patients and HLA-matched controls and have been sequenced, resulting in four regions of specific nucleotide and amino acid sequence which occur in various combinations and which are associated with IDDM. These specific sequences can be used in DNA or protein diagnostic procedures to determine genetic susceptibility to IDDM.
The four variant sequences A-D found to be associated with IDDM are shown below. In each case, DNA sequences seen in the diabetic genomes produce an alteration in one to three amino acid residues (underlined) of the DR-beta protein. The amino acids normally found in these positions are shown in parentheses.
A. .... .......GluLeuArgLysSerGlu .... .......GAGCTGCGTAAGTCTGAG
.... .......CTCGACGCATTCAGACTC
(Val,Ser,Leu,Pro,Asp,Ala) B. .... GluGluPheLeuArgPhe ... GAGGAGTTCCTGCGCTTC
... CTCCTCAAGGACGCGAAG
(Tyr,Asn,Ser,Asp) 30 C. ..... ProValAlaGluSerTrp ... CCTGTCGCCGAGTCCTGG
... CCGCAGCGGCTCAGGACC
(Asp,Ser) (Tyr) D. ........... AspIleLeuGluAspGluArg ... GACATCCTGGAAGACGAGAGA
... CTGTAGGACCTTCTGCTCTCT
(Leu,Phe) (Gln,Arg,Glu) (Lys,Arg,Ala) -Table I below shows the IDDI~ susceptibility and variation within the DR3 and DR4 haplotypes. Table II shows the correlation between the haplotypes and sequences A-D identified above. Sequences A, B and C
are correlated with B8, DR3 vs. non B8, DR3 haptotypes.

TABLE I

DR~1 Not variable Variable (5) DRR3 Variable (3) Not variable TABLE II
Sequence 10 Type Gene A B C D
DR4 beta-I - - - +
DR6 beta-I - - - +
DR6 beta-III - + +
DR3 beta-III + + +
15 DR3 beta-III + + - +
DR3 beta-III - +

The above-mentioned DNA sequences may be detected by DNA
hybridization probe technology. In one example, which is not exclusive, the sample suspected of containing the genetic marker is 20 spotted directly on a series of membranes and each membrane is hybridized with a different labeled oligonucleotide probe that is specific for the particular sequence variation. One procedure for spotting the sample on a membrane is described by Kafotos et al., Nucleic Acids Research, 7:1541-1552 (1979).
Briefly, the DNA sample affixed to the membrane may be pretreated with a prehybridization solution containing sodium dodecyl sulfate, Ficoll, serum albumin and various salts prior to the probe being added. Then, a labeled oligonucleotide probe that is specific to each sequence to be detected is added to a hybridization solution similar to the prehybridization solution. The hybridization solution is applied to the membrane and the membrane is subjected to hybridization conditions that will depend on the probe type and length, type and concentration of ingredients, etc. Generally, hybridization is carried out at about 25-75C, preferably 35 to 65C, for 0.25-50 hours, preferably less than three hours. The greater the stringency of conditions, the greater the required complementarity for hybridization between the probe and sample. If the background level is high, stringency may be increased accordingly. The stringency can also be incorporated in the wash.
After the hybridization the sample is washed of unhybridized probe using any suitable means such as by washing one or more times with varying concentrations of standard saline phosphate EDTA (SSPE) (180 mM NaCl, 10 mM Na2HP04 and 1 M EDTA, pH 7.4) solutions at 25-75C
for about 10 minutes to one hour, depending on the temperature. The label is then detected by using any appropriate detection techniques.
The sequence-specific oligonucleotide that may be employed herein is an oligonucleotide that may be prepared using any suitable method, such as, for example, the organic synthesis of a nucleic acid from nucleoside derivatives. This synthesis may be performed in solution or on a solid support. One type of organic synthesis is the phosphotriester method, which has been utilized to prepare gene fragments or short genes. In the phosphotriester method, oligonucleotides are prepared that can then be joined together to form longer nucleic acids. For a description of this method, see Narang, S. A., et al., Meth. Enzymol., 68, 90 (1979) and U.S. Patent No.
4,356,270. The patent describes the synthesis and cloning of the somatostatin gene.
A second type of organic synthesis is the phosphodiester method, which has been utilized to prepare tRNA gene. See Brown, E.
L., et al., Meth. Enzymol., 68, 109 (1979) for a description of this method. As in the phosphotriester method, the phosphodiester method involves synthesis of oligonucleotides that are subsequently joined together to form the desired nucleic acid.
Automated embodiments of these methods may also be employed. In one such automated embodiment diethylphosphoramidites are used as starting materials and may be synthesized as described by Beaucage et al., Tetrahedron Letters, 22:1859-1862 (1981). One method for synthesizing oligonucleotides on a modified solid support is described in U.S. Patent No. 4,458,066. It is also possible to use a primer which has been isolated from a biological source (such as a restriction endonuclease digest).
The sequence-specific oligonucleotide must encompass the 5 region of the sequence which spans the nucleotide variation being detected and must be specific for the nucleotide variation being detected. For example, four oligonucleotides may be prepared, each of which contains the nucleotide sequence site characteristic of each of the four DNA sequences herein. Each oligonucleotide would be hybridized to duplicates of the same sample to determine whether the sample contains one or more of the four regions of the locus where allelic variations may occur which are characteristic of IDDM.
The length of the sequence-specific oligonucleotide will depend on many factors, including the source of oligonucleotide and 15 the nucleotide composition. For purposes herein, the oligonucleotide typically contains 15-25 nucleotides, although it may contain more or fewer nucleotides. While oligonucleotides which are at least 19-mers in length may enhance specificity and/or sensitivity, probes which are less than 19-mers, e.g., 16-mers, show more sequence-specific 20 discrimination, presumably because a single mismatch is more destabilizing. If amplification of the sample is carried out as described below prior to detection with the probe, amplification increases specificity so that a longer probe length is less critical, and hybridization and washing temperatures can be lowered for the same 25 salt concentration. Therefore, in such as case it is preferred to use probes which are less than 19-mers.
Where the sample is first placed on the membrane and then detected with the oligonucleotide, the oligonucleotide must be labeled with a suitable label moiety, which may be detected by spectroscopic, 30 photochemical, biochemical, immunochemical or chemical means.
Immunochemical means include antibodies which are capable of forming a complex with the oligonucleotide under suitable conditions, and hiochemical means include polypeptides or lectins capable of forming a complex with the oligonucleotide under the appropriate conditions.
35 Examples include fluorescent dyes, electron-dense reagents, enzymes -capable of depositing insoluble reaction products or being detected chronogenically, such as alkaline phosphatase, a radioactive label such as 32p, or biotin. If biotin is employed, a spacer arm may be utilized to attach it to the oligonucleotide.
In a "reverse" dot blot format, a labeled sequence-specific oligonucleotide probe capable of hybridizing with one of the four DNA
sequences is spotted on (affixed to) the membrane under prehybridization conditions as described above. The sample is then added to the pretreated membrane under hybridization conditions as described above. Then the labeled oligonucleotide or a fragment thereof is released from the membrane in such a way that a detection means can be used to determine if a sequence in the sample hybridized to the labeled oligonucleotide. The release may take place, for example, by adding a restriction enzyme to the membrane which recognizes a restriction site in the probe. This procedure, known as oligomer restriction, is described more fully in EP Patent Publication 164,054 published December 11, 1985.
In an alternative method for detecting the DNA sequences herein, the sample to be analyzed is first amplified using DNA
20 polymerase, four nucleotide triphosphates and two primers, as described more completely in copending Canadian Application Serial No.
526,476 filed December 30, 1986. Briefly, this amplification process involves the steps of:
(a) treating a DNA sample suspected of containing one or 25 more of the four IDDM genetic marker sequences, together or sequentially, with four different nucleotide triphosphates, an agent for polymerization of the nucleotide triphosphates, and one deoxyribonucleotide primer for each strand of each DNA suspected of containing the IDDM genetic markers under hybridizing conditions, such 30 that for each DNA strand containing each different genetic marker to be detected, an extension product of each primer is synthesized which is complementary to each DNA strand, wherein said primer(s) are selected so as to be substantially complementary to each DNA strand containing each different genetic marker, such that the extension 35 product synthesized from one primer, when it is separated from its 1335g~7 complement, can serve as a template for synthesis of the extension product of the other primer;
(b) treating the sample under denaturing conditions to separate the primer extension products from their templates if the 5 sequence(s) to be detected are present; and (c) treating the sample, together or sequentially, with said four nucleotide triphosphates, an agent for polymerization of the nucleotide triphosphates, and oligonucleotide primers such that a primer extension product is synthesized using each of the single strands produced in step (b) as a template, wherein steps (b) and (c) are repeated a sufficient number of times to result in detectable amplification of the nucleic acid containing the sequence(s) if present.
The sample is then affixed to a membrane and detected with a 15 sequence-specific probe as described above. Preferably, steps (b) and (c) are repeated at least five times, and more preferably 15-30 times if the sample contains human genomic DNA. If the sample comprises cells, preferably they are heated before step (a) to expose the DNA
therein to the reagents. This step avoids extraction of the DNA prior 20 to reagent addition.
In a "reverse" dot blot format, at least one of the primers and/or at least one of the four nucleotide triphosphates used in the amplification chain reaction is labeled with a detectable label, so that the resulting amplified sequence is labeled. These labeled 25 moieties may be present initially in the reaction mixture or added during a later cycle. Then an unlabeled sequence-specific oligonucleotide capable of hybridizing with the amplified sequence(s), if the sequence(s) is/are present, is spotted on (affixed to) the membrane under prehybridization conditions as described above. The amplified sample is then added to the pretreated membrane under hybridization conditions as described above. Finally, detection means are used to determine if an amplified sequence in the DNA sample has hybridized to the oligonucleotide affixed to the membrane.
Hybridization will occur only if the membrane-bound sequence 35 containing the variation is present in the amplification product.

13~5967 The amplification method provides for improved specificity and sensitivity of the probe; an interpretable signal can be obtained with a 0.04 ~9 sample in six hours. Also, if the amount of sample spotted on a membrane is increased to 0.1-0.5 ~9, non-isotopically labeled oligonucleotides may be utilized in the amplification process rather than the radioactive probes used in previous methods. Finally, as mentioned above, the amplification process is applicable to use of sequence-specific oligonucleotides less than 19-mers in size, thus allowing use of more discriminatory sequence-specific oligonucleotides.
In a variation of the amplification procedure, a thermostable enzyme, such as one purified from Thermus aquaticus, may be utilized as the DNA polymerase in a temperature-cycled chain reaction. The thermostable enzyme refers to an enzyme which is stable to heat and is heat resistant and catalyzes (facilitates) combination of the nucleotides in the proper manner to form the primer extension products that are complementary to each DNA strand.
In this latter variation of the technique, the primers and nucleotide triphosphates are added to the sample, the mixture is heated and then cooled, and then the enzyme is added, the mixture is then heated to about 90-100C to denature the DNA and then cooled to about 35-40C, and the cycles are repeated until the desired amount of amplification takes place. This process may also be automated.
The invention herein also contemplates a kit format which comprises a packaged multicontainer unit having containers for each labeled sequence-specific DNA probe. The kit may optionally contain a means to detect the label (such as an avidin-enzyme conjugate and enzyme substrate and chromogen if the label is biotin). In addition, the kit may include a container that has a positive control for the probe containing one or more DNA strands with the sequence to be detected and a negative control for the probe that does not contain the DNA strands having any of the sequences to be detected.
One method for detecting the amino acid sequences in a protein sample that are associated with IDDM involves the use of an immunoassay employing one or more antibodies that bind to one or more of the four amino acid sequences. While the antibodies may be polyclonal or monoclonal, monoclonal antibodies are preferred in view of their specificity and affinity for the antigen.
Polyclonal antibodies may be prepared by well-known methods which involve synthesizing a peptide containing one or more of the amino acid sequences associated with IDDM, purifying the peptide, attaching a carrier protein to the peptide by standard techniques, and injecting a host such as a rabbit, rat, goat, mouse, etc. with the peptide. The sera are extracted from the host by known methods and screened to obtain polyclonal antibodies which are specific to the peptide immunogen. The peptide may be synthesized by the solid phase synthesis method described by Merrifield, R. B., Adv. Enzymol. Relat.
Areas Mol. Biol., 32:221-296 (1969) and in "The Chemistry of Polypeptides" tP. G. Katsoyannis, ed.), pp. 336-361, Plenum, New York (1973). The peptide is then purified and may be conjugated to keyhold limpet hemocyanin (KLH) or bovine serum albumin (BSA). This may be accomplished via a sulfhydryl group, if the peptide contains a cysteine residue, using a heterobifunctional crosslinking reagent such as N-maleimido-6-amino caproyl ester of 1-hydroxy-2-nitrobenzene-4-sulfonic acid sodium salt.
The monoclonal antibody will normally be of rodent or humanorigin because of the availability of murine, rat, and human tumor cell lines that may be used to produce immortal hybrid cell lines that secrete monoclonal antibody. The antibody may be of any isotype, but is preferably an IgG, IgM or IgA, most preferably an IgG2a.
The murine monoclonal antibodies may be produced by immunizing the host with the peptide mentioned above. The host may be inoculated intraperitoneally with an immunogenic amount of the peptide and then boosted with similar amounts of the immunogenic peptide.
Spleens or lymphoid tissue is collected from the immunized mice a few days after the final boost and a cell suspension is prepared therefrom for use in the fusion.
Hybridomas may be prepared from the splenocytes or lymphoid tissue and a tumor (myeloma) partner using the general somatic cell hybridization technique of Koehler, B. and Milstein, C., Nature, 256:495-497 (1975) and of Koehler, B. et al., Eur. J. Immunol., 6:511-519 (1976). Preferred myeloma cells for this purpose are those which fuse efficiently, support stable, high-level expression of antibody by the selected antibody-producing cells, and are sensitive to a medium such as HAT medium. Among these, preferred myeloma cell lines are murine myeloma lines, such as those derived from MOPC-21 and MOPC-11 mouse tumors available from the Salk Institute, Cell Distribution Center, San Diego, California, USA, or P3X63-Ag8.653 (653) and Sp2/0-Ag14 (SP2/0) myeloma lines available from the American Type Culture Collection, Rockville, MD, USA, under ATCC CRL Nos. 1580 and 1581, respectively.
Basically, the technique involves fusing the appropriate tumor cells and splenocytes or lymphoid tissue using a fusogen such as polyethylene glycol. After the fusion the cells are separated from the fusion medium and grown on a selective growth medium, such as HAT
medium, to eliminate unhybridized parent cells and to select only those hybridomas that are resistant to the medium and immortal. The hybridomas may be expanded, if desired, and supernatants may be assayed by conventional immunoassay procedures (e.g., radioimmunoassay, enzyme immunoassay, or fluorescence immunoassay) using the immunizing agent as antigen. Positive clones may be characterized further to determine whether they meet the criteria of the antibodies of the invention. For example, the antigen-binding ability of the antibodies may be evaluated in vitro by immunoblots, ELISAs and antigen neutralizing tests.
A preferred procedure for making a hybric cell line that secretes human antibodies against the amino acid genetic markers is somatic cell hybridization using a mouse x human parent hybrid cell line and a human cell line producing sufficiently high levels of such antibodies. The human cell line may be obtained from volunteers immunized with the peptide(s) described above. The human cell line may be transformed with Epstein-Barr virus (EBV) as described, for example, by Foung, et al., J. Immunol. Methods, 70:83-90 (1984).
When EBV transformation is employed, the most successful approaches have been either to pre-select the population of B cells to be transformed or to post-select the antigen-specific transformed populations by panning or rosetting techniques, as described by Kozbar, et al., Scan. J. Immunol., 10:187-194 (1979) and Steinitz, et al., J. Clin. Lab. Immun., 2.1-7 (1979). Recently EBY transformation has been combined with cell fusion to generate human monoclonal antibodies (see, e.g., Foung et al., J. I~mun. Meth., 70:83-90 (1984)), due to instability of immunoglobulin secretion by hybridomas when compared to EBY lymphoblastoid cell lines, and higher frequencies of rescue of the antigen-specific populations. EBY most frequently infects and transforms IgM-bearing B cells, but B cells secreting other classes of Ig can also be made into long-term lines using the EBY fusion technique, as described by Brown and Miller, J. Immunol., 1 :24-29 (1982).
The cell lines which produce the monoclonal antibodies may be grown ln vitro in suitable culture medium such as Iscove's medium, Dulbecco's Modified Eagle's Medium, or RPMI-1640 medium from Gibco, Grand Island, NY, or in vivo in syngeneic or immunodeficient laboratory animals. If desired, the antibody may be separated from the culture medium or body fluid, as the case may be, by conventional 20 techniques such as ammonium sulfate precipitation, hydroxyapatite chromatography, ion exchange chromatography, affinity chromatography, electrophoresis, microfiltration, and ultracentrifugation.
The antibodies herein may be used to detect the presence or absence of one or more of the four amino acid sequences associated 25 with IDDM in white blood cells expressing the HLA class II antigens.
The cells may be incubated in the presence of the antibody, and the presence or absence and/or degree of reaction (antibody-peptide binding) can be determined by any of a variety of methods used to determine or quantitate antibody/antigen interactions (e.g., fluorescence, enzyme-linked immunoassay (ELISA), and cell killing using antibody and complement by standard methods). The antibody employed is preferably a monoclonal antibody.
For use in solid phase immunoassays, the antibodies employed in the present invention can be immobilized on any appropriate solid test support by any appropriate technique. The solid test support can be any suitable insoluble carrier material for the binding of antibodies in immunoassays. Many such materials are known in the art, including, but not limited to, nitrocellulose sheets or filters;
agarose, resin, plastic (e.g., PVC or polystyrene) latex, or metal beads; plastic vessels; and the like. Many methods of immobilizing antibodies are also known in the art. See, e.g., Silman et al., Ann.
Rev. Biochem., 35:873 (1966); Melrose, Rev. Pure & App. Chem., 21:83 (1971); Cuatrecafas, et al., Meth. Enzym., Vol. 22 (1971). Such methods include covalent coupling, direct adsorption, physical entrapment, and attachment to a protein-coated surface. In the latter method, the surface is first coated with a water-insoluble protein such as zein, collagen, fibrinogen, keratin, glutelin, etc. The antibody is attached by simply contacting the protein-coated surface with an aqueous solution of the antibody and allowing it to dry.
Any combination of support and binding technique which leaves the antibody immunoreactive, yet sufficiently immobilizes the antibody so that it can be retained with any bound antigen during a washing, can be employed in the present invention. A preferred solid test support is a plastic bead.
In the sandwich immunoassay, a labeled antibody is employed to measure the amount of antigen bound by the immobilized monoclonal antibody. The label can be any type that allows for the detection of the antibody when bound to a support. Generally, the label directly or indirectly results in a signal which is measurable and related to the amount of label present in the sample. For example, directly measurable labels can include radiolabels (e.g., 125I, 35S, 14C, etc.). A preferred directly measurable label is an enzyme, conjugated to the antibody, which produces a color reaction in the presence of the appropriate substrate (e.g., horseradish peroxidase/o-phenylenediamine). An example of an indirectly measurable label wouldbe antibody that has been biotinylated. The presence of this label is measured by contacting it with a solution containing a labeled avidin complex, whereby the avidin becomes bound to the biotinylated antibody. The label associated with the avidin is then measured. A
preferred example of an indirect label is the avidin/biotin system employing an enzyme conjugated to the avidin, the enzyme producing a color reaction as described above. It is to be understood, however, that the term "label" is used in its broadest sense and can include, for example, employing "labeled" antibodies where the label is a xenotypic or isotypic difference from the immobilized antibody, so that the presence of "labeled" antibodies is detectable by incubation with an anti-xenotypic or anti-isotypic antibody carrying a directly detectable label.
Whatever label is selected, it results in a signal which can be measured and is related to the amount of label in a sample. Common signals are radiation levels (when radioisotopes are used), optical density (e.g., when enzyme color reactions are used), and fluorescence (when fluorescent compounds are used). It is preferred to employ a nonradioactive signal, such as optical density (or color intensity) produced by an enzyme reaction. Numerous enzyme/substrate combinations are known in the immunoassay art which can produce a suitable signal. See, e.g., U.S. Patent Nos. 4,323,647 and 4,190,496.
For diagnostic use, the antibodies will typically be distributed in multicontainer kit form. These kits will typically contain the antibody(ies) in labeled or unlabeled form in suitable containers, any detectable ligand reactive with unlabeled antibody if it is used, reagents for the incubations and washings if necessary, reagents for detecting the label moiety to be detected, such as substrates or derivatizing agents depending on the nature of the label, product inserts and instructions, and a positive control associated with IDDM, such as a cell containing the HLA class II
antigens associated with IDDM. The antibodies in the kit may be affinity purified if they are polyclonal.
The following examples illustrate various embodiments of the invention and are not intended to be limiting in any respect. In the examples all parts and percentages are by weight if solid and by volume if liquid, and all temperatures are in degrees Centigrade, unless otherwise indicated.

EXAMPLE I

This example illustrates how the four sequences associated with IDDM were identified.

I. Analysis of HLA-DR-.beta. Sequences Several HLA class II beta genes were isolated from clinical blood samples of diverse HLA-typed IDDM individuals (from University of Pittsburgh clinic and from cell lines from IDDM patients available from the Human Genetic Mutant Cell Repository, Camden, NJ) and non-diabetic controls (homozygous typing cells) using cloning methods.
In one such method, which is a standard method, human genomic DNA was Maniatis et al., Molecular Cloning: A Laboratory Manual (1982), 280-281 or prepared from the buffy coat fraction, which is composed primarily of perpheral blood lymphocytes, as described by Saiki et al., Biotechnology, 3:1008-1012 (1985). This DNA was then cloned as full genomic libraries into bacteriphage vectors, as described in Maniatis, supra, pp. 269-294. Individual clones for the HLA-DR.beta. genes were selected by hybridization to radioactive cDNA probes (Maniatis et al., pp. 309-328) and characterized by restriction mapping. See U.S.
Patent No. 4,582,788 issued April 15, 1986. Individual clones from IDDM patients were assigned to DR-typed haplotypes by comparing the clone restriction map with the RFLP segregation pattern within the patients' family. Finally, small fragments of these clones representing the variable second exon were subcloned (Maniatis et al., supra, pp. 390-402) into the M13mp10 cloning vector, which is publicly available from Boehringer-Mannheim.
In an alternative procedure for cloning the genes, amplification of the relevant portion (the second exon) of the gene was carried out as described below.
A total of 1 microgram of each isolated human genomic DNA
was amplified in an initial 100 µl reaction volume containing 10 µl of a solution containing 100 mM Tris.HCl buffer (pH 7.5), 500 mM NaCl, and 100 mM MgCl2, 10 µl of 10 µM of primer GH46, 10 µl of 10 µM of primer GH50, 15 µl of 40 mM dNTP (contains 10 mM each of dATP,dCTP, -dGTP and TTP), and 45 ~l of water. Primers GH46 and GH50 have the following sequences:

5'-CCGGATCCTTCGTGTCCCCACAGCACG-3' (GH46) 5'-CTCCCCAACCCCGTAGTTGTGTCTGCA-3' (GH50) These primers, having non-homologous sequences to - act as linker/primers, were prepared as follows:

A. Automated Synthesis Procedures: The diethylphosphoramidites, synthesized according to Beaucage and Caruthers (Tetrahedron Letters (1981) 22:1859-1862) were sequentially condensed to a nucleosi~e derivatized controlled pore glass support using a Biosearch SAM-1. The procedure included detritylation with trichloroacetic acid in dichloromethane, condensation using benzotriazole as activating proton donor, and capping with acetic anhydride and dimethylaminopyridine in tetrahydrofuran and pyridine.
Cycle time was approximately 30 minutes. Yields at each step were essentially quantitative and were determined by collection and spectroscopic examination of the dimethoxytrityl alcohol released during detritylation.

B. Oligodeoxyribonucleotide Deprotection and Purification Procedures: The solid support was removed from the column and exposed to 1 ml concentrated ammonium hydroxide at room temperature for four hours in a closed tube. The support was then removed by filtration and the solution containing the partially protected oligodeoxynucleotide was brought to 55C for five hours. Ammonia was removed and the residue was applied to a preparative polyacrylamide gel. Electrophoresis was carried out at 30 volts/cm for 90 minutes after which the band containing the product was identified by UV
shadowing of a fluorescent plate. The band was excised and eluted with 1 ml distilled water overnight at 4C. This solution was applied to an Altech RP18 column and eluted with a 7-13% gradient of acetonitrile in 1% ammonium acetate buffer at pH 6Ø The elution was monitored by UV absorbance at 260 nm and the appropriate fraction collected, quantitated by UV absorbance in a fixed volume and evaporated to dryness at room temperature in a vacuum centrifuge.

.
r~aJe ~ar~

133~967 C. Characterization of Oligodeoxyribonucleotides: Test aliquots of the purified oligonucleotides were 32p labeled with polynucleotide kinase and y-32P-ATP. The labeled compounds were examined by autoradiography of 14-20% polyacrylamide gels after 5 electrophoresis for 45 minutes at SO volts/cm. This procedure verifies the molecular weight. Base composition was determined by digestion of the oligodeoxyribonucleotide to nucleosides by use of venom diesterase and bacterial alkaline phosphatase and subsequent separation and quantitation of the derived nucleosides using a reverse 10 phase HPLC column and a 10% acetonitrile, 1% ammonium acetate mobile phase.
The above reaction mixtu res were hel d in a heat bl ock set at 95C for 10 minutes to denature the DNA. Then each DNA sample undenrent 28 cycles of amplification, where each cycle was composed of 15 four steps:
(1) spin briefly (10-20 seconds) in microcentrifuge to pellet condensation and transfer the denatured material immediately to a heat bl ock set at 30C for two mi nutes to all ow primers and genomic DNA to anneal, (2) add 2 lll of a solution prepared by mixing 39 ~,l of the Klenow fragment of E. coli DNA Polymerase I (New England Biolabs, 5 units/~,l), 39 ~l of a salt mixture of 100 mM Tris buffer (pH 7.5), 500 mM NaCl and 100 mM MgC12, and 312 l~l of water, (3) all owing the reaction to proceed for two minutes at 30C, and (4) transferring the samples to the 95C heat block for two minutes to denature the newly synthesized DNA, except this reaction was not carried out at the last cycle.
Then the mixtures were stored at -20C. The following cloning procedure was used for the amplified products.
The reaction mixture was sub-cloned into M13mplO by first digesting in 50 ~ll of a buffer containing 50 mM l~aCl, 10 mM Tris HCl, pH 7.8, 10 mM MgCl2, 20 units PstI, and 26 units HindIII at 37C for 90 mi nutes. The reacti on was stopped by freezi ng. The volume was adjusted to llo ~1 with a buffer containing Tris HCl and EDTA and loaded onto a 1 ml BioGel P-4 spin dialysis column. One fraction was collected and ethanol precipitated.
The ethanol pellet was resuspended in 15 ~l water and adjusted to 20 ~l volume containing 50 mM Tris HCl, pH 7.8, 10 mM
MgCl2, 0.5 mM ATP, 10 mM dithiothreitol, 0.5 ~g of M13mplO vector digested with PstI and H dIII and 400 units ligase. This mixture was incubated for three hours at 16C.
Ten microliters of ligation reaction mixture containing Molt 4 DNA was transformed into E. coli strain JM103 competent cells, which are publicly available from BRL in Bethesda, MD. The procedure followed for preparing the transformed strain is described in Messing, J. (1981) Third Cleveland Symposium on Macromolecules:Recombinant DNA, ed. A. Walton, Elsevier, Amsterdam, 143-153.
About 40 different alleles from these two cloning procedures were sequenced. In some of the sequences determined four areas of specific DNA and protein sequence were found to occur in various combinations and to be associated with IDDM. The DNA sequences seen in each of these segments in the genomes of IDDM patients produced an 20 alteration in one to three amino acid residues of the DR~ protein.
These four variable segments of the DR~ second exon, found in sequences obtained from many diabetic sources, and labeled A-D, are identified above. The regions which can be used for devising probes used for detecting such sequences are identified in Table III, where 25 the amino acid abbreviations are shown in Table IY.

TABLE III
: Alllin~nt ot HL~-DRf Pro~-in S ~iU-nc-c EYO--1: 20 ~ ~ li DRB ~ RFI ~ LL~ ~ Ll F~ T~ . 8~ S ~' ~4)~1 d ~
Il d~-- ~6 ) L 'C- ~ 'i-D~9 !i ,~ V d-- ~ ' O --r ~1-- V ~-- ~ I~_ o l ~ L~
D~.: V
R~ V
D~ d- ~'S~-~
_IJ': --............. A 1~ cl ' d ~ '9: .. - : ^ A Ri I ' V 1~
P~ : . . : ~ A R L7 ~ V IR~; --- I
5: . .- - A R ~ ~ V IC ~ --- I
~-1: ---- : 1 r ~ ~ ~ J _ I
' V - Q ~ V ~ *~,~;-.11 -1~ ,, , : V C~; ; L ~ _ 1 1 -~" , Y -, V C~ I ~ 6'- 11 -DRel': _ Y . V r., ' ~C )(DR )-111 AVL~ Y V r LD': --. Y '. V G~ i ~ d 6 ~- 11 -~P~.: --~ Y '. V ~ ' I~ 1'-. Il -H~ 1 __ y ~ V ,~ ' ~
: -- y ~ 4~-~11 -c'~: --Y tY~ _ 7 7 ~ ~ d ~J_---Y~ E H ~ ~ r A l;R
Y : r A C~
--Y--: Y ~ n ~ ~
~1~:--7~~ :? Y ~ ~ 6'-1 D~l.: --Y~ DE V ~ ~)-.
~: Y ~ OE ~ ~; 8~-1 ~Y y ~ I r~ c~ dl " ~
D~P: _Y~~ y ~ V ' le _ ~: Y~~ Y ~ V ~ _ A .1: --Y~~ y - ~ _ c~ _r- Y - ~ V ~ ~c 6~- -o~-: --Y~~ Y
~ r- ~ ~ c r ~
~: --Y~~~Y ~ 7 ' r G; L ~ ~.5 D~ ~ r~- , A DD ~ E V ~ ~G~-_ L--E--C I ' S ~ ~ I d ~_ -~ 11 .7 L-E-CI ' r ~ 8-I
~: --S~.-- 7 L--ELFI-- ~ d~';
~: 11 " 7 ~ ~ ~
n s r I A V , ~-i: ~r M Cl N DL rDP d~
- r L r D , ~:
r L; l~ y L~ 6C~7r~ILr E n~ V N CI~K ~ d' )- 11 ~ ~71--?I~Y ~R~i r E~ v N Cl t dli,3 1 L~Y 1~ '~ ?77E--Fr~L V 11 Cl--Vv~ ~ .-''~- 11 -: --I~?lt~ ~ . P E r V N Cl ;i~ P ~ dS,I~,-- 11 -A C . ~ r~L ~ ~ y v l p~
J5 ~ A ~n~ L- '` 7 ~` ~ d ~, ~,' _- I I -A r~L
A Yi L ~ : ~'.~)~ 11 -PCR--> ~ PCR
A ~ C D ( ~ IDDU) TABLE IV

Amino Acid Abbreviation Codes Alanine Ala A
Arginine Arg R
Asparagine Asn N
Aspartic Acid Asp D
Cysteine Cys C
Glutamine Gln Q
Glutamic Acid Glu E
Glycine Gly G
Histidine His H
Isoleucine Ile Leucine Leu L
Lysine Lys K
Methionine Met M
Phenylalanine Phe F
Proline Pro P
Serine Ser S
Threonine Thr T
2 0 Tryptophan Trp W
Tyrosine Tyr Y
Valine Val V

II. Preparation of Primers for Detection Oligonucleotides designated GH46 and GH50 complementary to 25 opposite strands of the conserved 5' and 3' ends of the DR-~ second exon were used as primers. The primers, having the following sequences, are identified in the section above.

III. Expected Amplification Reaction One microgram of DNA from each DNA sample to be tested (10 ~l of 100 ~g/ml DNA) may be amplified in an initial 100 ~l reaction volume containing 10 ~l of a solution containing 100 mM Tris buffer 133~967 (pH 7.5), 500 mM NaCl, and 100 mM MgCl2. 10 ~l of 10 ~M of primer GH46, 10 ~l of 10 ~M of primer GH50, 15 ~l of 40 mM dNTP (contains 10 mM each of dATP, dCTP, dGTP and TTP), 10 ~l DMS0, and 45 ~l of water.
Each reaction mixture is held in a heat block set at 95C
for 10 minutes to denature the DNA. Then each DNA sample undergoes 30 cycles of amplification where each cycle is composed of four steps:
(1) spin briefly (10-20 seconds) in microcentrifuge to pellet condensation and transfer the denatured material immediately to a heat block set at 37C for two minutes to allow primers and genomic DNA to anneal, (2) add 2 ~l of a solution prepared by mixing 39 ~l of the Klenow fragment of E. coli DNA Polymerase I (New England Biolabs, 5 units/~l), 39 ~l of a salt mixture of 100 mM Tris buffer (pH 7.5), 500 mM NaCl and 100 mM MgC12, and 312 ~l of water, (3) allowing the reaction to proceed for two minutes at 37C, and (4) transferring the samples to the 95C heat block for two minutes to denature the newly synthesized DNA, except this reaction was not carried out at the last cycle.
The final reaction volume is 150 ~l, and the reaction mixture is stored at -20C.

IV. Expected Synthesis and Phosphorylation of Oligodeoxyribonucleo-tide Probes Two of four labeled DNA probes, designated GH54 (V--S) and GH78 (I--DE), from Regions C and D, respectively, are employed.
These two probes are synthesized according to the procedures described above for preparing primers for cloning. The probes are labeled by contacting 10 pmole thereof with 4 units of T4 polynucleotide kinase (New England Biolabs) and about 40 pmole y~32p_ ATP (New England Nuclear, about 7000 Ci/mmole) in a 40 ~l reaction volume containing 70 mM Tris buffer (pH 7.6), 10 mM MgCl2, 1.5 mM
spermine, 100 mM dithiothreitol and water for 60 minutes at 37C. The total volume is then adjusted to 100 ul with 25 mM EDTA and purified 133596~

according to the procedure of Ma~atis et al., Molecular Cloning (1982), 466-467 over a 1 ml Bio Gel P-4 (BioRad) spin dialysis column equilibrated with Tris-EDTA (TE) buffer (10 mM Tris buffer, 0.1 mM
EDTA, pH 8.0).

V. Expected Dot Blot Hybridizations Five microliters of each of the 150 ~l amplified samples from Section III was diluted with 195 ~1 0.4 N NaOH, 25 mM EDTA and spotted onto three replicate nylon filters by first wetting the filter with water, placing it in an apparatus for preparing dot blots which holds the filter in place, applying the samples, and rinsing each well with 0.4 ml of 20 x SSPE (3.6 M NaCl, 200 mM NaH2P04, 20 mM EDTA), as disclosed by Reed and Mann, Nucleic Acids Research, 13, 7202-7221 (1985). The filters are then removed, rinsed in 20 x SSPE, and baked for 30 minutes at 80C in a vacuum oven.
After baking, each filter is then contacted with 6 ml of a hybridization solution consisting of 5 x SSPE, 5 x Denhardt's solution (1 x = 0.02% polyvinylpyrrolidone, 0.02% Ficoll~ 0.02% bovine serum albumin, 0.2 mM Tris HCl, 0.2 mM EDTA, pH 8.0) and 0.5% SDS and incubated for 60 minutes at 55C. Then 5 ~l each of the probes is added to the hybridization solution and the filters are incubated for 60 minutes at 55C.
Finally, each hybridized filter is washed under stringent conditions. The genotypes are expected to be readily apparent after minutes of autoradiography. The probes are expected to have reasonable specificity for the portions of the allele being detected in genomic DNA samples.

EXAMPLE II
The dot blot procedure of Example I can be carried out without using the amplification procedure.

- ir~d~ k -EXAMPLE III
Peptides to the four amino acid sequences disclosed may be prepared as described above and used as immunogens to generate antibodies thereto, useful in immunoassays for detecting the amino -5 acid sequence(s) in protein samples.
In summary, the present invention is seen to provide four DNA sequences and four amino acid sequences associated therewith which are conserved among many diabetic genomes. These sequences may be used to develop probes and antibodies for detecting IDDM
susceptibility in a patient sample.

Claims (6)

1. A DNA sequence from the HLA class II beta genes associated with insulin-dependent diabetes mellitus selected from the group consisting of:
1) GAGCTGCGTAAGTCTGAG,

2) GAGGAGTTCCTGCGCTTC,

3) CCTGTCGCCGAGTCCTGG, and

4) GACATCCTGGAAGACGAGAGA, or the DNA strands which are complementary thereto.

2. An amino acid sequence from the HLA class II beta region of the human genome associated with insulin-dependent diabetes mellitus selected from the group consisting of:
1) Glu Leu Arg Lys Ser Glu, 2) Glu Glu Phe Leu Arg Phe, 3) Pro Val Ala Glu Ser Trp, and 4) Asp Ile Leu Glu Asp Glu Arg.

3. A process for detecting the presence or absence of sequences associated with susceptibility to insulin-dependent diabetes mellitus in a DNA sample comprising:
(a) treating the sample to expose the DNA therein to hybridization;
(b) affixing the treated sample to a membrane;
(c) treating the membrane under hybridization conditions with a labeled sequence-specific oligonucleotide probe capable of hybridizing with one or more of the DNA sequences selected from the group consisting of:
1) GAGCTGCGTAAGTCTGAG, 2) GAGGAGTTCCTGCGCTTC, 3) CCTGTCGCCGAGTCCTGG, and 4) GACATCCTGGAAGACGAGAGA,or with the DNA strands complementary thereto; and (d) detecting whether the probe has hybridized to any DNA
in the sample.

4. A kit for detecting the presence or absence of sequences associated with susceptibility to insulin-dependent diabetes mellitus in a DNA sample, which kit comprises, in packaged form, a multicontainer unit having one container for each labeled sequence-specific DNA probe capable of hybridizing with one or more of the DNA
sequences selected from the group consisting of:
1) GAGCTGCGTAAGTCTGAG, 2) GAGGAGTTCCTGCGCTTC, 3) CCTGTCGCCGAGTCCTGG, and 4) GACATCCTGGAAGACGAGAGA, or with the DNA strands complementary thereto.

5. The kit of claim 11 further comprising one or more containers for reagent(s) for detecting hybridization of the probes to the DNA in the sample.

6. The kit of claim 11 further comprising a container containing a positive control for the probe that contains one or more DNA strands having the sequence to be detected and a negative control for the probe that does not contain any DNA strands having the sequence to be detected.