CA1324093C - Recombinant ricin a fragment and ricin toxin - Google Patents

Abstract

Abstract of the Disclosure Recombinant vectors and methods for producing ricin A and ricin are disclosed. The coding sequence for ricin A was cloned, disposed in suitable expression vectors and produced free of components normally accompanying this peptide. Analogous vectors which carry inserts encoding the B portion are also constructed.

Description

~` - 1324~93 ~ RECOMBI~ANT nICIN TOXIU
f~ , ' DescriPtion ,~ Technical Field ~his invention relates to the production of '~ 5 toxin fragments using recombinant technology. More specifically, the invention relates to producing ricin toxin A fragment using recombinant means.
:, ,.~., Background Art Ricin toxin (RT or ricin) is a naturally 10 occurring toxin composed of an enzymatically active, cytotoxic "A" amino acid sequence, and a "B" sequence, which is presumed to be responsible both for attaching the "A" sequence to a target cell to be killed, and to ~ aid in the translocation of A fragment into the ;~ 15 cytoplasm. Other examples of such toxins include diphtheria toxin and the exotoxin from Pseudomonas aeruginosa~ Other toxic proteins, such as, for example, ~- 1~ those derived from PhYtolacca americana (PA~I, PAPII, and v` ~ PAP-S) and gelonin show in vitro activities comparable to 20 the "A" sequences of the above toxins, but are inactive , i in vivo, presumably due to the absence of a "B" chain.
i~ The "ricin" peptides of the present invent;on `~ are derived from the seeds of Ricinus communis, commonly known as castor beans. Two similar proteins (often ` ~ 25 called lectinsJ are extractable from these seeds: the above-mentioned ricin and Ricin communis agglutinin . (RCA). Both proteins contain A and B portions which do not comprise a single peptide but are joined by a , disulfide link. The A portions of both ricin and RCA are 30 capable of catalytically inactivating the large subunit of ribosomes ~n vitro ~nd the mechanism of ricin for in ~ ;~
'~ ' ~, .

~.

132~93 vivo cytotoxicity is believed to reside in this capacity for ribosome inactivation. Ricin and RCA appear to be highly homologous but differences exist. RCA is dramatically less toxic, and appears to exhibit characteristics corresponding to those expected of a dimer of ricin.
,~ The components of ricin and of RCA have been well characterized on the basis of the extracted materials, and their pcoperties extensively s~ 10 reviewed: Olsnes, S., Perspectives in Toxicoloqv, A. W.
.., ,,~
-~ Bernheimer, Ed ~1977) J. Wiley ~ SonS, NY, pp 122-147;
Olsnes, S., et al, Molecular Action of Toxins and Viruses, Cohen, et al, Ed (1982) Elsevier, Amsterdam, pp 51-105. Ricin has an apparent molecular weight of 58,000 15 daltons and consists of the A chain with a molecular weight of 32,000 daltons and a B chain of molecular weight of 34,700 daltons. RCA is a tetramer which has ~ two A subunits of molecular weight 32,000, and two B
:~ subunits of molecular weight 36,000 each. In their .~ 20 native environments, the A and B chains are generally ; glycosylated. The A and a subunits of both ricin and RCA
~ are linked only by a single disulfide bond, and not by !~' ` peptide linkage unlike, for example diphtheria toxin . i which is found as a single chain peptide. It is also ~
25 known that both ricin and RCA, though having separate peptides for A and B portions, are each derived from a single chain precursor in each case (Butterworth, H. E., et al, Eur J Biochem (1983) 137:57). It is assumed that upon . excision of the dodecameric intervening peptide, the A and B chains ~ ~' ~.~
:. ,, .~
.~
~..... ...

,.,-~ .

ii . ~ .

1324~9~

, remain linked through the single disulfide bond.
. The present invention provides a means for obtaining the A chain of ricin using recombinant technology. Native ricin A exists in a number of homologous but not exactly identical forms depending on the plant variety used as source, but even protein derived from a single plant exhibits more than one ~ primary structure. Recombinantly produced ricin A, of `~ course, permits production of a single desired amino acid ~; 10 sequence, and makes possible an exploration of the structural features required for its activity. The techniques and materials of the present invention further permit selective modification of the amino acid sequence ~ of the A chain and thus permit manipulation to provide ',',3.~ 15 properties which are capable of tailoring the cytoxicity ~'~ and other properties of ricin A. The invention here~n, by enabling the production of ricin A chain using predictable, :., .~.. .
;~ efficient, and economic procedures which, further, premit directed modification, permits the use of A chain in prac~ical and improved 20 ways not before possible. Further, by suitable recombinant ` manipulation employing, as well, the DNA sequence encoding B chain, the full length ricin toxin may be cloned and expressed.

.~
: ~, ~, Disclosure of the Invention The invention relates, in one aspect, to ricin ~ 25 A as the product of recombinant host cells. The -~, amino acid sequence of the ricin A can be, if desired, `r~ absolutely identical to the ricin A peptide amino acid ~: ~equence a~ extracted from a particular sample of castor r~. bean seeds, but the recombinant product i8 inevitably ~;
:~ 3 ~.
:, i~
..~

,.

.

. ~324Q93 ' somewhat modified due to the environment of its production, and may be further modified at the will of ~ the producer to contain alterations in amino acid sequence or in the level of glycosylation. Accordingly, , 5 one aspect of the invention is a method of production of ~- ricin A by recombinant techniques, and the ricin A so 5~ produced.
s; In another aspect, the invention relates to ricin toxin precursor or the processed form thereof which 10 is recombinantly produced.
In other aspects, the invention is directed to :~.
expresslon vectors which are capable of effecting tne expression of the ricin A chain and of ricin, to host cells which have been transformed with sucn vectors, and ~- 15 to cultures thereof.
In still another aspect, the invention relates to modified DNA sequences encoding ricin A and ricin.
;. -.~ .
,,',.'~ 1, Brief Description of the Drawinqs ~-` ; Figure 1 shows the complete sequence of the 20 cloned insert of pRA123 which encodes ~he entire RTA
~ ~ protein. Also shown are the corresponding protein -~ sequence of ricin A as deduced, the sequence of an , isolated, native RTA, and, as well, the portions ~f the nucleot;de sequence modified by primer directed ~ 25 mutagenesis.
`~ Fiqure 2 shows a composite of the nucleotide sequences of the cDNA inserts in the plasmids pRTAllS and ' pRA45 corresponding to the RCA-A chain coding sequence, the amino acid ~equence deduced from it, and the sequence 30 Of native RTA.
Figure 3 shows a Western Blot of extracts from ~ E. coli MM294 and of E. coli MClOOC lambda lysogen '~:
~ A
, '.~, ~;, -,~"

:~:
', ` - 1324~9~

. 5 ..
-~ transformed with plasmids of the invention using controls ' of ricin A.
`, Figure 4 shows the nucleotide seguences of three plasmids containing cDNA inserts obtained by A 5 probing a cDNA library for sequences encoding ricin B.

Modes of CarrYing Out the Invention . .
~ A. Definitions ;~ As used herein, ~ricin A~ refers to a protein whose amino acid sequence is substantially similar to 10 that of t~e ricin A peptide which is extractable from castor bean seeds. The ricin A of castor beans is approximately 265 amino acids in length and has a ; molecular weight of approximately 32,000 daltons.
However, it is known that the precise sequence varies : 15 depending on the variety of ~ean, and, indeed that at r least two slightly different forms of ricin A may be ~` present in a single variety.
~` ~Ricin B" refers to a protein whose amino acid ~ sequence is substantially similar to that of the ricin B
`. 20 peptide which is extractable from castor bean seeds. The ;~ ricin B of castor beans is approximately 260 amino acids -~ in length and has a molecul~r weight of approximately 34,700 daltons; as with ricin A, it is known that the ' precise sequence varies depending on the variety of bean.
~Substantially similar" means that the protein in question must be approximately the same length (arbitrarily within around 10%) but, more importantly, must retain the capacity of ricin A chain to interact with, and incapacitate, the 60S ribosome subunit. It is 30 well known that BOme small alterations in protein sequence may be possible without disturbing the functional abilities of the protein molecule, although other modifications are totally destructive. It is not ~ x ,.

~, .
'r .
~`
~, -.

r.
. ~

f:

132~93 .
, currently possible to predict with any assurance into -. which category a particular alteration will fall. The ` definition herein permits any modifications which are in ~ the first category. Such alterations could result from ;;; 5 chance mutations in the gene sequence or from deliberate ;`- alterations thereof.
~ Further, as is well known, protein sequences .:: may be modified by post-translational processing such as association with other molecules, for example, 10 glycosides, lipids, or such inorganic ions as phosphate.
The ionization status will also vary depending on the pH
of the medium or the pH at which crystallization or precipitation of the isolated form occurs. Further, the ~; presence of air may cause oxiaation of labile groups, 15 such as -SH. Included within the definition of ricin A
are all such modifications of a particular primary , ~
~ structure--i.e., e.g., both glycosylated and non-glycosy--~ lated forms, neutral forms, acidic and basic salts, lipid or other associated peptide forms, side chain alterations 20 due to oxidation or derivatization, and any other such mcdifications of an amino acid seauence which would be ~ encoded by the same genetic codon sequence.
; "Ricin~ refers to peptides which contain both A
` and B chains, defined respect~vely as set forth herein.
25 ~he peptide may mimic the native peptide in that the A
and B proteins are linked only by a disulfide, or may contain the intermediate dodecamer or other short peptiae sequence between the A and B chains.
~Impurities~ as used in describing ricin A or 30 ricin prepared by the method of the invention refers to materials normally associated with these proteins as ~;~ produced in the castor bean seeds, which are not included among the protein modifications above. Accordingly, impurities~ refers to agglutinin as well as to other .~ p, , ,., ,., ~ ` ,..
,, ~ :
` '~; 1~.
: ~' ~' :) ~ -7-. , castor bean cellular materials which ordinarily are associated with ricin or ricin A non-specifically; with , respect to ricin A per se, ~impurities~ includes ricin B.
~Operably linked~ when used in describing DNA
sequences refers to juxtaposition in such a way that the functionality of the sequences is preserved. Thus, for example a coding sequence ~operably linked~ to control sequences is positioned so that the these sequences are capable of effecting the expression of the coding ~'~ 10 sequence.
~Control" sequence refers to those DNA
~r~ ~ sequences which control initiation and termination of transcription and translation. In procaryotic systems, .~ for example, control sequences comprise promoter or promoter/operator and nucleotides encoding a ribosome ~ binding site; in eucaryotes, promoters, terminators and `' enhancers appear to be involved.
. ~Recombinant host cells" refers to cells which have been transformed with DNA sequences constructed by recombinant techniques. Such reference includes both the cells as separated, for example by filtration or as a centrifugation pellet, and to cultures of these cells.
Indeed, ~cells" and "cell cultures," where the context so permits, are used interchangeably herein. Also included in particùlar references to ~cells" are the progeny ~` thereof. Such progeny are either of the same genomic structure, or contain a modified genome due to inherent instability, intentional mutation, or chance alterations ;~. in the genomic structure.
.'~'~.
B. General Description The approach followed to obtain recombinant ricin A is, briefly, as follows:
~ :
~ ~i '. ,A
~, `' Y;
''.
.. ~' _, 132~093 ~ -B-.~ .
1. A cDNA library was constructed by isolating mRNA from maturing castor bean seeds, and preparing the corresponding cDNA by, in general, conventional methods.
~r~ The oligonucleotide 5'-GACCATTTCGACCTACG-3' which 5 complements the mRNA encoding the N-terminal region of the B chain (which is thus just downstream from the A
chain codons) was used as primer in synthesizing the ^ single stranded copy; and an oligo dC homopolymeric tail ;- was added to the 3' end to permit oligo dG to be used as ~' 10 primer in double stranding. ~he resulting double stranded cDNA fraaments were then inserted into the PstI
site of the cloning vector, pBR322, by annealing homopolymeric oligo dC tails provided by standard tailing methods to the cDNA with the oligo dG tails which are ~h~ 15 also thus provided on the cleaved vector. The ligation mixture is transformed into E. coli. About S000 successful transformants were screened for hybridization ~r;. with probe.
~s 2. The oligonucleotide mixture S'-GCATCTTCTTG
.
. 20 GTTGTCNGGATGAAAGAAA~AGGC-3' (wherein N is A, T, G, or C) was used as a probe. This sequence was initially predicted --- based on the amino acid sequence described in the review by Olsnes (supra) and verified as described in SD.2 below.
3. Positive colonies were analyzed by 25 restriction and showed two pattern types - one ~.~
'r"~ predicted to be found from ricin A, and the other :~ presumed to be associated with agglutinin A, since it was r significantly different from that obtained from ricin A.
~U:~ A colony was obtained which contained the entire sequence 30 for ricin A, a~ conflrmed by sequencing and comparison of the deduced amino acid sequence to that of native ricin A. Plasmid DNA isolated from this colony was designated pRA123, and gi~en number CMCC 2108 in the assignee's .:
~ Y
. .
'~
.~:

}: ' ,,1, s 1324~93 s _g_ culture collection. pRA123 was deposited with the ATCC
! on 14 August 1984, and has accession no. 39799.
- 4. The cDNA insert in pRA123, which contained the coding sequence for the entire ricin A chain, was 5 modified by primer directed mutagenesis to place a HindIII site in front of a newly constructed ATG start codon preceding the RTA sequence, and to place a stop signal at the C-terminus.
5. The properly terminating coding sequence ~ 10 for the ricin A chain could then be removed as a - HindrII/BamHI cassetee and ligated into ap?ropriate expression vectors. Two host expression vector systems , were used: pTRP 3 which provides a trp pro~oter and ribosome binding site immediately preceeding the HindIII
15 site, and pLOP which contains the lamda PL promoter and ~'~ the N gene ribosome binding site immediately upstream from the HindIII site, as well as a temperature controlled replicon.
6. The expression vectors were ~hen 20 transformed into suitable hosts - expression vectors ;~. derived from pTRP 3 into E. coli strain K12 MM294, and those derived from pLOP into E. coli strain MC1000 lambda lysogen ~see below). The transformed hosts were then cultured under suitable conditions for the production of 25 the ricin A.
;;; 7. The heterologous protein produced by recombinant cells transformed with the resulting , expression vectors pRATl, pRA~7, pRAL6 and pRAL7 was ~` shown to be the desired ricin A by Western Blot, and 30 by enzymatic activity of partially purified fractions.
8. For expression of ricin, the cDNA
insert of pRA123 i9 modified only in the region of the A chain start codon, and plasmids analogous to ` pRAL6 and pRATl, but without the stop codon at the A
'.~ .
,~
~ ~ .
.~ .
;

.
chain C-terminus are thus obtained in a manner ldentical ` to that described in 15 above. The remaining codons to complete the ricin sequence are then inserted into these analogous plasmids.
9. Expression of secreted forms of ricin ` or ricin A may also be achieved in appropriate vector/host systems such as those of yeast, plant or ' mammalian cells, which are capable of correctly processing ricin precursor and signal sequences. To ~, lO obtain secretion, pRAl23 is modified by primer directed mutagenesis so as to provide a HindIII site upstream of the ATG start codon preceding the signal sequence rather than at the native N-terminus. A suitable primer is shown in Figure l. If ricin itself is to be expressed, lS this is the only modification made in pRAl23; if ricin A
-~ is to be secreted, the modification which provides a stop - ~
~ codon as previously set forth is also made. These ~ suitably modified pRAl23 sequences are then used to construct expression plasmids in a manner analogous to ~-~ 20 that set forth in 15 but incorporating eucaryotic control ~`~ sequences. For those plasmids designed to produce secreted ricin, the remaining ~ portion coding sequences ~- '~ are provided in reading frame to the analogs without stop codons.
Details of, and procedures used in, the strategy ; ` described in this paragraph are set forth in the paragraphs belcw.
. :~
C. Procedures C.l. Purification of mRNA
:. .
The mRNA encoding ricin A was prepared by the method ~; of Belamy, A. R~, et al, Methods in Enzy~ology (1968) 2II, Part B:156-:': .
,. ;`
~ ~, ,:~
'.~ "
.. ,~ _ .
,:~. ...... .
:'; ~: . .
. . , "~

, . .

132~93 160, with some modifications. one such modification succeeds in removing oxidized phenolic compounds from the preparations, which constitute a problem in messenger KNA
prepared from plant tissue sources. Tbe other results in 5 destruction of the association of mRNA with ribosomal RNA
which would interfere with dT affinity column chromatography.
`~ In order to eliminate oxidized phenolics, the preparation was treated with Sephadex*G-100. The gel 10 retains the oxidized phenolics and passes the mRNA in the void volume. (Both polyphenolic compounds and transfer RNA
were retarded.) s To eliminate the ribosomal RNA complexing, thesuspension of RNA emerging from the foregoing G-100 column 15 was reacted with a denaturant prior to applying the preparation to a dT affinity column.

~; C.2. Vectors and Host Cells ;~ The specific embodiments described hereinbelow~*~ 20 set forth procedures for constructing vectors compatible with procaryotes, and for transformation of such vectors into these host cells. E. coli K12 strain, MN294 and a lambda lysogen of E. coli 6train HC1000, ~re described in ~- particular. However, other microbial strains may also be ~; 25 used, such as bacilli, for example Bacillus subtilis, various species of Pseudomonas, or other bacterial strains. In such procaryotic systems, plasmid vectors which contain replication and other control sequences derived from a species compatible with the host are used.
30 For example, E. coli is typically transformed using derivatives of pBR322, a plasmid derived from an E. coli ~; species by Bolivar, et al, Gene (1977) 2:95. pBR322 ~; contains genes for ampicillin and tetracycline resistance, and thus provides markers whicb can be either retained or :........... , *Trademark ~:. s .:

132409~

.
destroyed in constructing the desired vector. Commonly used procaryotic control sequences which are defined herein to include transcription initiation, optionally operator, and ribosome binding site sequences, include such commonly used promoters as the beta-lactamase (penicillinase) and - lactose (lac) promoter systems (Chang, et al, Nature (1977) 198:1056) and the tryptophan (trp) promoter sy6tem (Goeddel, et al, Nucleic Acids Res (1980) 8:4057) and the lambda derived PL promoter and N-gene ribosome binding site ~ 10 (Shimatake, et al, ~u~e (1981) ~ 128). However, any '~ available promoter system compatible with procaryotes can be used.
Ricin A and ricin are toxic to eucaryotic cells, and thus procaryotic hosts are preferred. However, eucaryotic hosts may be used in some circumstances; indeed ~; ricin is natively produced in eucaryotes. It may be thus appropriate to utilize eucaryotic hosts if, for example, the signal sequence is retained for the ricin A or ricin, 5:' , thus permitting secretion before the toxicity is ~: 20 experienced by the cell.
In the alternative, certain eucaryotic ~ environments may provide modified processinq of the ricin -$` or ricin A 80 as to protect the cell against their potential toxcicity. Such mechanisms are not At present establiQhed: however it may prove possible to supprQss toxcicity by a proper folding, glycosylation, or other alterations to the tertiary and derivative structure of the sub~ect protein.
If eucaryotes are employed, eucaryotic microbes, such as yeast, may be used. Saccharomyces cerevisiae, Baker's yeast, is most commonly used although a number of other strains are commonly available. A number of plasmid vectors suitable for yeast expression are also known ~see, , , for example, Stinchcomb, et al, Nature (1979) ~ 39, and Tschempe, et al, Gene ~1980) 10:157). Promoters for yeast ~ vectors include promoters for the synthesis of glycolytic :. ~
: ~ - r ~ - 13 -!
~- enzymes (Hess, et al, J Adv Enzvme Rea (1968) 1:149;Holland, et al, Biochemistry (1978) 17:4900). Any vector containing a yeast compatible promoter, origin of replication and other control sequences is suitable.
Similarly, it has been found possible to express genes encoding polypeptides in eucaryotic host cell cultures derived form multicellular organisms. See, for example, Tissue Cultures, Academic Press, Cruz and ~s Patterson, editors (1973). Useful host cell lines include VERO and HeLa Cells, and Chinese hamster ovary (C~O) cells. Expression vectors for such cells ordinarily include promoters compatible with mammalian sells such as, for example, the commonly used early and late promoters from Simian Virus 40 (SV 40) (Fier , et al, Nature (1978) 273:113).
Finally, cells from and portions of higher plants have been found useful as recombinant hosts, and 5; appropriate control sequences are available for expression in these systems. A suitable promoter and polyadenylation signal are those of the nopaline synthase (NOS) gene derived from the 3.2 kilobase (kb) HindIII-23 DNA fragment in the tr-DNA region of A. tumefaciens Ti plasmid pTiT37 ` (Bevan, N., et al, Nucleic Acid Res (1983) ~1:369;
,~ Depicker, A., et al, J Mol APD1 Genet (1982) 1:56l3).
25 Suitable plant cells include cells derived from, or seedlings of, tobacco, petunia, and cotton. Other pro~oters include the maize promoter for alcohol dehydrogena~e-l or alcohol dehydrogenase-2 ~Gerlach, W.L., et al, proc Natl Acad Sci IUSA) (1982) 79:2981~, Ç 30 cauliflower mosaic virus promoter (Daubert, S., et al, Virology (1982) l~Z:444), and wheat promoter associated ~ with the small subunit of ribulose biphosphate carboxylase t (Broglie, R., et al, ~iotechnoloov (1983) 1:55~. Other ~ polyadenylation signals which are available presently . .

.

include those found on any of the above genes, or those of Schuler, et al, (Schuler, M. S., et al, Nucleic Acid Res (1982) 10:8225).
For procaryotes or other cells which contain substantial cell wall barriers transformation is done using the calcium treatment employing calcium chloride, as described by Cohen, S. N., Proc Natl Acad Sci ~USA~ (1972) s 69:2110. For mammalian cells without such cell walls, the calcium phosphate precipitation method of Graham and van der Eb, Viroloov (1978) 52:546 i8 preferred. For plant cells, direct transformation of protoplast preparations in the presence of polyethylene glycol is employed. Krens, et al, Nature (1982) ~ 72.
The successful expression attained by the invention depends upon correct utilization of the suitable control sequences to regulate expression of the desired toxin fragment. Therefore, whatever the host, control sequences compatible with and suitable for that host are positioned operably with respect to the coding sequence, using a properly placed "start" codon at the 5' end of the desired sequence. Any "native" control sequences are eliminated. The vectors of the invention place the coding sequence for the ricin A or ricin peptide, i~mediately preceded by an ATG start codon directly downstream from control systems chosen to be compatible with the particular ~-~ host.
It is also important, in obtaining good production of the desired fragments, to regulate the "time"
of production 80 as to minimize any lethal effect on the host cell. Most typically, even for procaryotes, this is done by delaying expression of the ricin or ricin ,~,;
i.
~"
~r J
... .
, .

,, :, 132~Q93 .. .
A sequences until substantial growth has occurred.
Accordingly, it is desirable to utilize control sequences which are subject to environmental conditions. By maintaining conditions that repress expression during 5 growth phase, and then converting to conditions which permit expression at the desired time, the negative aspects of any potentially lethal effect can be minimized.
`~ In two particularly preferred approaches, these regulatable control sequences are compatible with .~ .
.~ 10 procaryotic hosts. The trp promoter is a regulatable promoter where expression of the operably linked sequence ~` can be controlled by the level of tryptophan in the ;~ medium. By maintaining high tryptophan levels during growth, expression is repressed. Depletion or l; competitive inhibition of tryptophan turns on the promoter and permits expression.
Still more preferred is the PL promoter derived ~ from lambda phage. This promoter is regulated by a --~ protein which can be temperature sensitive. (There are ~J ~0 mutant forms of the wild type repressor, e.g., CIgs7 which have this characteristic known in the art.) When used in a host which is able to synthesize this mutant ` form of repressor ~such as E. coli K12 strain MC1000 lysogenic for the lambda phage N7Ns3cI8s7susp8o)~ the PL
, 25 promoter will be switched on when the temperature is raised because the higher temperature inactivates the mutant CI repressor. Thus, the host cells can be grown at low temperature without, or with, low production of the foreign protein. The temperature is then raised when 30 growth has been attained and ricin or ricin A production ` is desired.
A plasmid which has temperature sensitive copy number control may al~o be applied. If the cells are grown at low temperatures, coding sequences contained in j ~r .

~,; .
j the plasmid are replicated at low levels at higher ~ temperatures, the number of such copies is increased.
}~ The amount of protein produced is thus indirectly managed by regulating the number of available copies of its ~-~ 5 coding sequence.
c ~
C.3. Methods EmPloved , Isolation of the mRNA fragments comprising the .¦ desired coding sequences is described in detail herein-below. The polyA RNA is used as a template to construct ~ 10 a cDNA library by means now well understood in the art.
-~ Details of such methods can be obtained by reference to Maniatis, E. F. et al, Molecular Cloninq, Cold Spring ~arbor Laboratory (1982). The cDNA library is probed for the desired sequences using procedures after that of 15 Grunstein and Hogness, Proc Natl Acad Sci (1975) 72:3961.
Vector construction employs ligation and . restriction techniques known in the art. The quantity of DNA available can be increased by clonin3 the desired ,~ fragments, i.e., inserting into a suitable cloning 20 vehicle, such as p~R322, pUC13 or pUC8, transforming and ' replicating in E. coli, and, optionally further enhancing thr~ugh ~hlcramphenicol amplification or by phaae ` replication. The desired fragments can then be removed ~ . from the cloning vectors or phage and ligated to suitable ; . 25 promoters compatible with the host intended to be employed in the expression of the gene. Such hosts are , then transformed with these expression vectors and cultured under conditions which favor stabilization of he plasm.d and the safe production of the desired toxin 30 fragments. Such conditions might include repression of ~`i the controlling promoter until most of log phase gtowth has been completed, and then altering conditions so as to favor the synthesis of the peptide. If the peptide is ~. ~

i~

, `~`1 ',' , ;
,~
:, secreted, it can be recovered from the medium. If not, or if secreted into the periplasmic space, the cells are lysed, and the desired fragment recovered from the lysate.
Construction of suitable vectors containing the desired coding and control 6equences employs standard ligation and restriction techniques which are generally understood in the art. Isolated pla6mid6, DNA sequences, or synthesized oligonucleotides are cleaved, tailored, and ~ religated in the form desired.
:~ 10 Site specific DNA cleavage i6 performed by treating with the suitable restriction enzyme (or enzymes) ~3; under conditions which are generally understood in the art, and the particulars of which are specified by the ~ manufacturer of these commercially available restriction -~ 15 enzymes. See, e.g., New England Biolabs, Product Catalog.In general, about 1 ~g of plasmid or DNA sequence is cleaved by one unit of enzyme in about 20 ~1 of buffer ~; solution; in the examples herein, typically, an excess ofrestriction enzyme is used to insure complete digestion of 20 the DNA substrate. Incubation times of about one hour to ~` two hours at about 37-C are workable, although variationsY can be tolerated. After each incubation, protein is removed by extraction with phenoV chloroform which may be $ollowed by ether extraction and the nucleic acid recovered 25 from ~queous fractions by precipitation with ethanol or by running over a Biogel*P-6 spin column followed by lyophilization to concentrate the sample. I$ desired, size separation of th~ cleaved fragménts may be performed by polyacrylamide gel electrophoresis using standard ~ 30 techniques. A general description of size separations is ; ' found in Methods in EnzvmolooY (1980) 65:499-560.
Restriction cleaved fragments may be blunt ended ~ by treating with the large fragment of E. coli DNA
-~ 35 ~'~ .
- ~ *~rademark ., ~ . ~, , .

'$~;

.

,~' .

';

~:

132~3 ,~
; polymerase I (Klenow) in the presence of the four ` nucleotide triphosphates (dNTPs) using incubation-times of about 15 to 25 min at 20 to 25-C in 50 mN Tris pH 7.6, 50 mM NaCl, 6 mN MgC12, 6mM DTT and 0.1 mM dNTPs. The Rlenow fragment fills in at 5' 6ticky ends but chews back single 6trands, even though the four dNTPs are present, at 3' Y sticky ends. If desired, ~elective repair can be performed ~; by supplying only one of the, or selected, dNTPs within thelimitations dictated by the nature of the sticky ends.
10 After treatment with Xlenow, the mixture is extracted with phenol/chloroform and ethanol precipitated and/or followed by running over a Biogel P-6 spin column.
Treatment with Sl nuclease under appropriate .~
-~ conditions results in rapid hydrolysis of any `~ 15 single-stranded portion of DNA and slow hydrolysis of double-stranded portions commencing at the ends. Sl nuclease hydrolyses are typically conducted in a buffer which is 15 mM sodium acetate, pH 4.5, 300 mM NaCl, and 1 mM ZnS04, using approximately 200 units per ~1 of Sl nuclease. Ordinarily, 50-100 units of Sl nuclease is used to hydrolyze approximately 10 ~g of DNA.
Exonuclease III attacks double-stranded DNA, but hydrolyzes beginning at the 3i end of the nucleotide '::
sequence. Thus, digestion of a double-stranded DNA results in two 5' protruding sticky ends. Hydrolysis is carried out in a buffer containing 15 mM Tris, pH 8, 10 mM NaCl, 1 mM NgC12, and 0.1 mM DTT, using approximately 2000 units per ~1 exonuclease III. Ordinarily, 150 units of exonuclease III were used to react with 10 ~g DNA.
Synthetic oligonucleotides are prepared by the triester method of Matteucci, et al (J Am Chem Soc (1981) -lQ~:3185-3191). Kinasing of single strands prior to annealing of for labeling i8 achieved using an excess, e.g., approximately 10 units of polynucleotide kinase to 1 nmole substrate in the presence of 50 mM Tris, p~ 7.6, 10 ~ mM MgC12, 5 mM dithiothreitol, 1-2 mM ATP, 1.7 pmoles 32p .,.. ,,~ ~, .
,.~

.~:
, .'`~ .

.
,, ~; - 1324~93 : -- 19 --., ATP (2.9 mCi/mmole), 0.1 mM spermidine, 0.1 mM EDta.
Ligations are formed using approximately equimolar amounts of the desires DNA fragments (2-10 X
excess of linkers or small oligomers) suitably end tailored 5 to provide correct matching, by treatment with an excess, i.e., in a typical 15-30 ~1 reaction 0.4-4 Weiss units T4 DNA ligase and, when blunt-ended ligation i8 involved, 0.4-1 units of RNA ligase. Ligation mixtures are buffered at approximately pH 7.6 using 66mM Tris along with 5mN
10 magnesium ion, 5mN dithiothreitol, lmM ATP, and 0.1 mg/ml BSA for either blunt-end or sticky end ligations.
i Incubations are carried out at approximately 14 to 25-C
c overnight.
~ In vector construction employing "vector -~ 15 fragments," the vector fragment is sometimes treated with bacterial alkaline phosphatase (BAP) in order to remove the 5' phosphate and prevent religation of the vector. BAP
digestions are conducted at pH 8.3 in approximately 50 mM
Tris, in the presence of Na+ and Mg+2 using about 1 unit of 20 BAP per ~g of vector at 60- for about one hour. In order to recover the nucleic acid fragments, the preparation is extracted with phenol/chloroform and ethanol precipitated and desalted by application to a Biogel P-6 spin column.
Alternatively, religation can be prevented in vectors which 25 have been double digested by additional restriction enzyme cleavage of the unwanted fragments.
.

:' ',. ., .
;, ~.~

:"~
. :~^
. .

~i~
:
,. .. .
'' ' 1~24093 Oligonucleotide induced mutagenesis is conducted using a primer synthetic oligonucleotide ~ complementary to a slngle stranded phage DNA to be -~ mutagenized except for limited mismatching, representing 5 the desired mutation. Briefly, the synthetic ~ oligonucleotide is used as a primer to direct synthesis ;~ of a strand complementary to the phage, the resulting i`~ double-stranded DNA is transfor~ed into a phage-supportin~
;~ host bacterium, and the cultures are permitted to grow.
Cultures are then spread on plates permitting further growth of colonies arising from single cells which harbor the phage.
Theoretically, 50% of the new colonies will contain the phage having, as a single strand, the mutated form; 50% will have the original sequence. The resulting ~; plaques are hybridized with kinased synthetic primer at a temperature which permits hybridization of an exact match, but at which the mismatches with the original strand are sufficient to prevent hybridization. Colonies containing phage which hybridizes with probe are then picked, cultured, and the DNA recovered.
~-( In more detail, approximately one pmole of the ~ . phage single stranded DNA template is mixed with '!,~,'", ', approximately lO pmoles of the synthetic oligonucleotide ~ 25 primer ln 15 ~1 of lO mM Tris, lO mM MgC12, 90 mM NaCl.
- The mixture is heated to 67 for 3-5 min and then to 42 :. .
for 30 min. The mixture is then cooled on ice, and a '.'J~............ cold solution containing the 4 dNTPs at 500 ~M and 3-5 ' units of Polymerase I (Rlenow) in sufficient buffer to bring the volume to 20-25 ~l is added. The mixture is left at 0C for S min and then brought to 37 for 30 min.
` ~i The Klenow is then inactivated for 15 min at 75, and the ,-~ mixture transformed lnto an appropriate bost, such as E. coli JMl03 or E. coli JMl05 using l ~1 reaction .
. .~, ~, ~.. .

`,~ `1 ~!
: ~-~ , ~ .
,.~.
, .

.

`l -21-mixtuce per 300 ~1 cells, which are grown on yeast extract-typtone agar plates. The resulting phage plaques ` are transferred to fllters by lifting onto nitro-cellulose, and pre-hybridized in 5 ml/filter of 6 x SSC, 5 x Denhardt's, 0.1% SDS, 50 ~g/ml carrier (yeast RNA
salmon sperm DNA etc.) at the desired temperature for 1-2 hr.
The fixed, pre-hybridized filters are then hybridized with 2 x 105 cpm/ml of kinased synthetic primer oligonucleotide (approximately 2-10 x 107 cpm/~g) for 3-16 hr, and then washed in 6 x SSC once at room temperature for 5 min and then at the appropr~ate stringent temperature for 5 min. A simultaneous control run containing the original phage is used to verify that hybridization does not take place to the non-mutagenized str,ands.
In the constructions set forth below, correct -.~ ligations for plasmid construction are confirmed by transfor~ing E. coli strain MM294 obtained from E. coli Genetic Stock Center, CGSC ~6135, or other suitable host ~ ^ with the ligation mixture. Successful transformants are `A selected by ampicillin, tetracycline or other antibiotic resistance or using other markers depending on ~he mode ; of plasmid construction, as is understood in the art.
Plasmids from the transformants are then prepared according to the method of Clewell, D. B., et al, Proc Natl Acad Sci (1969) 62:1159, following ; ~ _ chloramphenicol amplification ~Clewell, D. B., J Bacteriol (1972) 110:667) and analyzed by restriction ; 30 and/or sequenced by the method of Messing, et al, Nucleic Acids Res (1981) 9:309, or by the method of Maxam, et al, Methods ln Enz~moloay (1980) 65:499.
. ., Transformations in the examples below were performed u~ing the calcium chloride method described by ,.~ :
, ~,i, .,, '.~
~ J

, .

~i . 132~093 ~ -22-... . .
` Cohen, S. N., et al, Proc Natl Acad Sci (USA) (1972) 69:2110.
Two host strains wece used in cloning and expression of the plasmids set forth below:
'~ 5~or cloning and sequencing, in particular, E. coli strain MM294 (supra), Talmadge, K., et al, Gene (1980) 12:235 Meselson, M., et al, Nature (1968) 217:1110, was used as the host. However, when expression ~; is under control of the PL promoter and NR~5 the E. coli `: 10 strain MC100~ Lambda N7Ns3cI857susp8o as an exp host was used (ATCC 39531 deposited December 21, 1983.
~. This strain is hereinafter sometimes referred to as `~ MC1000-39531). This strain contains a lambda prophage which codes for a temperature sensitive CI repressor, 15 which at the permissive temperature (30-32C) is active.
However, at the non-permissive temperature (36-48C), the . repressor is inactive and transcription from the PL
; promoter can proceed. It is further characteristic of this strain ~hat at elevated temperatures the prophage 20 fails to induce.
The following examples illustrate the invention ~ 1 by describing the production of expression vectors ^`~ `~ suitable for production of ricin A fragment and of ricin.i `` in procaryotes. However, the ricin peptides of the ~ ~ 25 invention can be ligated into a variety of vectors ,.`!-' ". suitable for a range of other hosts subject to the ~-y ~ restraint that in eucaryotes toxicity must be mltiqated , ~ by protection or secretion.

`~1 D. ExamPle D.l. Isolation of Messenaer RNA

50 9 of immature castor beans ~Ricinus ; communis) were placed ln 100 ml homogenizing ~ buffer (150 mM NaCl, 50 mM Tris, pH 8.3, 5 mM DTA and 50 ,.. .

. ; .
.

, - 13240g3 mM freshly added ~-mercaptoethanol) to which wa~ added 12 ml 0.2 M vanadium-ribonucleoside complex,~ 30 mg proteinase K, and 15 ml 20~ SDS. The mlxture wa~
homogenized by blending at high speed for 3-4 min in a 5 Waring blender and then incubating 2-3 hr at room temperature with occasional blending.
The suspension was centrifuged for 15 min at 8000 x 9 at 5C and the pellet discarded. The supernatant was strained through cheesecloth to remove 10 lipids and the filtrate extracted sufficiently with phenol:CHC13:isOamyl alcohol, 24:24:1 containing 1%
~ hydroxy-quinoline, to remove vanadium salts and protein, ;i~ and the aqueous layer brought to 0.4 M with NaCl and 10 -~- mM with EDTA. 2.5 x volume absolute ethanol was added to . ~,,.;
15 precipitate nucleic acids, and the mixture stored at -20C overnight.
The precipitate was centrifuged for 15 min at ~- 7000 x 9 at 2C, and the pellet resuspended in 9.5 ml ~ aqueous solution 0.025 M NaCl, 0.025 M Tris, pH 8, plus .r'~ ' 20 9.5 ml phosphate buffer (2.5 M total phosphate, . .
`- ~ K2HPO4:33~ H3PO4, 20:1), plus 9.5 ml 2-methoxyethanol.
~ The mixture was shaken and chilled on ice for 3-5 min :, .' r" ~The vanadium ribonucleoside solution is prepared as 25 follows: 893 mg VOSO4 . 3H2O was added to 2 ~1 water and ~, the mixture boiled to dissolve the vanadium salt. A
solution containing the 4 ribonucleosides was prepared by dissolving 1 mmole each of adenosine, cytidine, guanosine, and uridine in 17 ml water. Heat is reguired.
, 1 ml of the foregoing VOSO4 solution was then added to the ribonucleoside solution and the resultant titrated to pH 6.5 with 10 N NaOH, and finally to pH 7 with 1 N NaOH
30 while stirring in a boiling water bath. Formation of the complex is ind~cated by a change in color from bright ~; blue to green-black. The solution was finally diluted to 20 ml with water.
:' .:
~ ..
: g:: !
~-1 :.''''~
.
.~ I
. ~ ~

,` ~
r . ~

l 132~9~

with occasional mixing, and then centrifuged at 2000 x 9 for 5 min at 2C. The upper layer was removed and to this was added 10 ml 0.2 M sodium acetate, and 5 ml 1 :!
cetyl trimethylammonium bromide (CTAB) and the mixture chilled on ice for 10 min. The resulting white precipitate was harvested by centrifugation at 2000 x 9 ~- for 10 min at 2C. The precipitate was washed by addition of 70~ ethanol containing 0.1 M sodium acetate and ~: by re-centrifuging at 2500 x g for 10 min at 4C.
~- 10 After removal of the supernatant, the pellet was resuspended in 2 ml G-100 column starting buffec (20 mM Tris, pH 8, 1 mM EDTA, 0.5% SDS), and then adjusted to ~ contain 0.5 M NaCl. Solids were removed by centrifuga--~ tion at 2000 xg for 5 min at room~temperature and the `~ ~ 15 supernatant applied to a SephadexC~G-100 column (1.5 cm x 40 cm) and the column eluted using buffer similar to that applied to the column but lacking SUS. The eluate was ~ assayed by monitoring OD260 Desired messenger RNA was ``~ obtained in the flow through volume, leaving behind oxidized phenolic compounds present in the plant extract.
(These compounds are known to behave similarly to polyA
RNA on dT columns, inhibit protein synthesis, and thus interfere with the assay for mRNA.
The initial peak containing mRNA was treated with formamide, a denaturant, to destroy ribosomal RNA
complexing. To do this, the mRNA containing fractions were pooled, precipitated in ethanol, and the precipitates redissolved in a minimum volume of water.
To this solution was added 9 volumes of deionized formamide containing 20 mM PIPES (piperazine-N,N-bis~2-ethanesulfonic acid), pH 6.5-7Ø
The mixture was then warmed to 37C for 5 min, : and 10 volumes of dT column buffer (0.5 M NaCl, 10 mM
Tris, pH 7.5, 1 mM EDTA) added. The presence of ~1 ~ff~e. ~Q~k .~ .

,, `~ .' 1324~g3 , ~ -25-I formamide dissociates the polyA RNA from any rlbosomal RNA present.
The denatured mixture was then run over an oligo dT column according to procedures well established ; 5 in the art, and approximately 100 ~9 polyA RNA recovered ~`~ upon elution.
. :, ~: D.2. Formation of a cDNA Librarv The polyA mRNA prepared as in the preceding paragraph was used to obtain a cDNA library according to 10 the method of Maniatis, et al (supra). Briefly, a portion of the polyA RNA is treated under appropriate buffer conditions with reverse transcriptase in the -~ presence of the primer set forth in ~B above and then treated with base to destroy the remaining mRNA. A poly 15 dC oligomer is added to the 3' end of the single strand using terminal transferase under standard conditions.
~;~ The resulting single-stranded cDNA is converted to the $ ;~; double stranded form using oligo-dG as primer, employing reverse transcriptase. The double stranded cDNA is then ~. 20 inserted into the PstI site of pBR32Z by tailing the cDNA
;~ with oligo-dC and the cleaved vector with oligo-dG, and `~ ~' annealing. The resulting mixture was used to transform E. coli MM294, and 5000 AmpR strains obtained.
Successful colonies were transferred onto ~ 25 nitrocellulose plates, and probed using the procedure of ;~ Grunstei~ 6 Hogness (supra), with the mixture of four 7~' synthetic oligonucleotides:
'-~j A
T
5'-GCATCTTCTTGGTTGTCCGGATGAAAGAAATAGGC-3' G

".~
;~ ~
`''`.~'i'' ~ . " .
'` '' ',,' .; .
. ~ .
.

. ` 132~093 which are kinased with 32p. This mixture represents the anti-sense strand complementary to the codons for the amino acid sequence contained in ricin A with most codon ambiguities resolved by sequencing cDNA synthesized using a mixture of primers to a portion of the codon sequence and employing the experimentally determined sequence of the synthesized cDNA. Plasmids were isolated from several representative positively hybridizing colonies, and analyzed by restriction analysis. Two groups thus obtained appeared to correspond to ricin A and to agglutinin A. Two plasmids, one from each group, pRA123 and pRA45 were sequenced in the insert region.
~ igures 1 and 2 show the results of this sequencing. Figure l shows the sequence of the insert in pRA123. The base sequence permits the deduction of an amino acid sequence presented immediately below the nucleotide sequence in the figure. It can be compared to that of isolated protein, labeled RTA in the figure, only six residues differ. These difference may be due to errors in the published sequence and/or to varietal differences in the ricin A proteins represented. The entire coding sequence for ricin A is present, as well as codons for the 12 amino acids joining the A to ~ chain, and for the signal sequence. pRA123 was used as the source of the the coding sequence in the expression vectors described below after m-odification to provide correct start and stop codons.
Figure 2 shows the sequence deduced for ricin agglutinin A from a combination of sequences in pRTA115 ~see Figure 4) and of pRA45. In that figure, the base sequence for this composite is shown, and the line immediately below it ~epresents the deduced amino acid sequence. To show the differences from ricin toxin A, that sequence, labeled RTA is also included in the ~ (disclosed if) co~enc~ a~cpl, c~ ~n : ~ ~7~5G3 '~
, ~
A

~' ~' 132~93 ;~ -27-.
~` figure. The cysteine residues at positions 84 and 156 ln -' the agglutinin sequence represent major differences from the toxin sequences obtained.

.5. D.3. Modification of PRA123 pRA123 which contains the entire ricin A coding sequence was modified so that this sequence would be .~ obtainable as a HindIII/BamHI cassette with a termination codon in the proper position after amino acid 267, and a start codon in the position immediately preceding the ~ 10 mature sequence. pRA123 was digested with BamHI, and the -~ approximately 896 bp fragment isolated and subcloned into ,` M13mpl8 in an anti-sense orientation relative to the lac ~?~; promoter in the M13 vector. The phage single stranded :' ~?" DNA was subjected to primer directed mutagenesis using the sequences shown as .superscripts 2 ~ 3 in Figure l as primers. The oligonucleotide shown near the beginning of the A chain sequence (2) imparts modifications which - :,~,;
insert an ATG start codon lmmediately preceding the A
toxin N-terminal amino acid and a HindIII site in turn, ~ 20 immediately upstream of the ATG. The primer placed near :??; the C-terminal end of the toxin coding sequence ~3) ?~ replaces the serine codon with a TAA termination codon.
~?: The resulting modified phage were identified after eacn mutagenesis using the appropriate above primers as probes. The desired constructs were double digested with :~- HindIlI and BamHI and the appropriate ricin A encoding fragments isolated.
If vectors are to be prepared for expression of ~ the complete ricin sequence, the mutation directed by -~t- 30 primer 3 which alters the serine residue to a .`~ termination codon is omitted. If secretion of either '"'``''~! ricin A or ricln is desired, the mutation directed by ~; primer 2 iQ omitted, and that directed by primer labeled ~ ~"
~: .

~1 '.;

132~093 , .

~, 1 in Figure 1, in the region of the start codon for the - signal sequence is substituted. This modificatlon results in provision of a HindIII site immediately , preceding the ATG codon of the signal sequence. Thus, in addition to the above described modifications which enable construction of vectors for ricin A production intracellularly, sequences can be provided for construction of vectors which result in secretion of ricin A, or of intracellular production or secretion of ~i~ 10 the entire ricin sequence. The vectors designed for ;~ secretion must, of course, be constructed for expression in appropriate hosts, as set forth above.
, ~.
D.4. Construction of Expression Vectors for Ricin A
` ~^ 15 The HindIII/BamHI fragment prepared in the previous paragraph was ligated into the host expression vectors p~RP3 and pLOP digested with HindIII/BamHI.
~- pTRP3 is described in qD.7~ and contains the trp promoter immediately preceding a unique HindIII site. pLOP is 20 described in ~D.6, and contains the PL promoter and N
gene ribosome binding site immediately preceding a unique HindIlI site, in a temperature sensitive nigh copy number ~ plasmid.
;~. Ligation products with pTRP 3 were transformed into E. coli MM294 to AmpR. Plasmids were isolated from selected colonies. Two of these plasmids pRAT7 and pRATl ~:- (CMCC 2115) were shown to contain the entire RTA
`'~ ' sequence.
~-; Ligation products with pLOP were transformed into E. coli MC1000 lambda lysogen, and plasmids isolated from two of the AmpR colonies were designated pRAL6 (CMCC
2114~ and pRAL7. These were also shown to contain the ~¦ complete RTA coding insert.
~, ~?

~,~
t~
.,,~.

., , . .

132~G93 In a similar manner, plasmids designed to express ~ecreted rlcin A are constructed u8ing the HindIII/BamHI fragment prepared a~ descrlbed in ~D.3 from !, pRA123 which had been subjected to primer directed 5 mutagenesis using primers 1 and 3 in Figure 1. These plasmids contain the coding sequence for ricin A along with the signal seguence in operable linkage to ~uitable eucaryotic control sequences. In an appropriate vector/host sy~tem, i.e., e.g., yeast, plant or mammalian 10 cells, expression of the coding portlon~ of these . ~ .
;~ plasmids results in the secretion of ricin A, rather than ~;; intracellular production and retention.
- Similarly, plasmids pRABT and pRABB which express complete ricin chains, can be prepared from ~i 15 intermediates made by using the pRA123 ~equences modified by mutagenesis with primer 2 only.
Into these intermediates the coding sequences for the B portion ~ ricin is inserted. The - intermediate plasmids ln each case, obtained as de~cribed 20 above, are treated with BamHI and SalI followed by 8AP to obtain a vector fragment which will frame the 8-portion coding region and a portion of the B-donor vector sequences. pRTB704 is used as the donor of the 8-portion containing fragment. pRT8704 is described in detail in 25 Candi~n S~rial Number 472,563 and the pertinent de~cription , ; ~s~ set ~orth in ~D.8 herein.
' To obt~i~ the ~B~ fragment, pRTB704 ls dige~ted ~ . .
with SalI, then partially with BamHI, and the fragments ~ are separated by agarose gel electrophoresis. Tbe large `~ 30 fragment containing the ~ portion sequence from the Bam~I
ite lmmediately 3' of the N-ter~inal amino acid, to the ~ SalI site in the pUC vector fragment is thus isolated.
-~ Thi~ fragoent i8 then ligated with the BAPed vector, and the ligation ~ixture transfor~ed into 6. coli and ~ ','X
;~' ' . .

f ~.

1324~93 .`'~, .
~! selected for AmpR. Successful transformants are grown, i plasmid DNA isolated, and used to transform the suitable corresponding host for expression of the complete ricin chain.
Thus, in summary, representative vectors $ applicable to procaryotic host expression include:
i pRA123 ,~ modified expression promoter/
Vector w/primer vector for host pRATl 2,3 intracellular ricin A trp/MM124 pRAL6 2,3 intracellular ricin A pL/MC100 ~lysogen 10 pRABT* 2 intracellular ricin trp/MMl24 -~s pRABL* 2 intracellular ricin pL/MC100 ~lysogen ~These represent vectors completed by a BamHI/SalI
~ fragment insert from pRT~704.

,- If the ricin A or ricin is to be secreted, -t 15 p~Al23 will be modified using primers l and 3 or solely l respectively, and the modified sequences ligated to eucaryotic control systems.

D.5. Expression of Ricin A Encodinq Sequences Figure 3 shows Western blots of cell extracts 20 from suitable E. coli hosts transformed with pRAL6, pRAL7, pRATl and pRAT7. Tmmunoreactivity was obtained with antibodies raised against natural ricin A in tabbits. The mobility of the protein product noted as 'rec A' in the figure is consistent with that of a non-25 glycosylated form of ricin A relative to the mobilities !~ of the native, glycosylated forms, denoted ricin Al and ~'~ A2 in the figure. No immunoreactivity, except for : ,;
~1 ' .: ., ':~

: ~f ~ -31-, .1 .
-1 acceptable background, was noted in extracts from cells'!. I cultured under identical conditions which contained the vectors, pLOP and pTRP3, plasmids which do not bear ricin sequences. Analysis of Coomassie Blue stained SDS-5 polyacrylamide gels and of radioautographs of parallel ! ~estern blots permits estimates of production levels.
` For the pRATl transformants the recombinant RTA
;~ represents approximately 0.5~ of total cell protein. ~or . the pRAL6 transformants, the RTA can be approximately 5%
10 of total cell protein.
To obtain purified, active protein, cultures of the foregoing transformants were lysed by sonication and the insoluble material recovered. This material was treated with a chaotropic agent, 8 M urea containing 0.5 lS SDS, to solubilize it and disperse protein aggregates.
The resulting suspension was centrifuged to pellet ,~, residual ~nsolubles and the supernatant applied to a ~ Sephacryl'S-200 (Pharmacia Co.) column to fractionate the - ~u protein components. Fractions containing approximately 20 80~ homogeneous ricin A protein were identified using polyacrylamide gel analysis and these fractions assayed for enzymatic activity associated with ricin A, i.e., the ability to inhibit protein synthesis in a rabbit reticulocyte in vitro translation system (a commercially 25 available system obtainable, e.g., from ~ethesda Research Laboratories, Rockville, Maryland). The purified protein was biologically active in this assay.

D.6. Construction of PLOP
D.6.a. Oriain of RePlication pCS3 provides an origin of replication which confers high copy number on the pLOP host vector at high ; temperatures. PCS3 was deposited 3 June 1982 and assigned ::~
;''~'' ~ f3 ~ e ~Qr k ~1 .
~, ~, ~i ;

.

~ ` 13~093 ~ .

.. ATCC number 39142 .
pCS3 is derived from pEW27 and pOP9. pEW27 is described by E. M. Wong, Proc Natl Acad Sci (USA) (l~B2J
79:3570. It contains mutations near its origin of replication which provide for temperature regulation of copy number. As a result of these mutations replication occurs in high copy number at high temperatures, but at low copy number at lower temperatures.
pOP9 is a high copy number plasmid at all temperatures which was constructed by inserting into `~` pBR322 the EcoRI/PvuII origin containing fragment from J.`' Col El type plasmid pOP6 (Gelfand, D., et al, Proc Natl Acad Sci (USA) (1978) 75:5869). Before insertion, this fragment was modified as follows: 50 ~g of pOP6 was digested to completion with 20 units each BamHI and SstI. In order to eliminate the SstI 3' protruding ends and "fill inN the BamHI 5' ends, the digested pOP6 DNA was treated with E. coli DNA polymerase I (Klenow in a two-stage reaction first at 20C for elimination of the 3' SstI protruding end and then at 9C
~,.
for repair at the 5' end. The blunt-ended fragment was digested and 0.02 pmole used to transform competent DG75 ' (O'Farrell, P., et al, J Bacteriology (1978) 134:645-654). Transformants were selected on L plates containing 50 ~g/ml ampicillin and screened for a 3.3 kb deletion, loss o an SstI site, and presence of a newly formed BamHI site.
One candidate, designated pOP7, was chosen ;~ and the BamHI site deleted by digesting 2S ~g Of poP7 with 20 units BamHI, repairing with E. coli DNA
polymera3e I fragment (Rlenow), and celigating with T4 DNA ligase. Competent DG75 was treated with 0.1 ~9 of the DNA and transformants selected on L plates containing ~ .
.".' :' .
:` .
','`'~, .
. j, ,~
. ~ .
i `` ` 132~93 .

50 ~g/ml ampicillin. Candidates were screened for the loss of the BamHI restriction site. pOP8 was selected.
To obtain pOP9 the AvaI(repaired)/EcoRI TetR fragment from pBR322 was prepared and isolated and ligated to the 5 isolated PvuII(partial)/EcoRI 3560 bp fragment from pOP8.
r Ligation of 1.42 kb EcoRI/AvaI(repair) TetR
(fragment A) and 3.56 kb EcoRI/PvuII AmpR (fragment 8) ;~ used 0.5 ~9 of fragment 8 and 4.5 ~9 of fragment A in a two-stage reaction in order to favor intermolecular 10 ligation of the EcoRI ends.
Competent DG75 was transformed with 5 ~l of the ligation mixture, and transformants were selected on - ampicillin (50 ~g/ml) containing plates. pOP9, isolated .~ from AmpR Tet~ transformants showed high copy number, 15 colicin resistance, single restriction sites for EcoRI, i 8amHI, PvuII, HindIII, 2 restriction sites for HincII, and the appropriate size and HaeIII digestion pattern.
.; To obtain pCS3, 50 ~9 pEW27 DNA was digested to i~
completion with PvuII and the EcoRI. Similarly, 50 ~9 of 20 poP9 was digested to completion with PvuII and EcoRI and the 3.3 kb fragment was isolated.
0.36 ~g t0.327 pmoles) pEW27 fragment and 0.35 ug (0.16 pmoles) pOP9 fragment were ligated and used to transform E. coli MM294. AmpRTetR transformants were 25 selected. Successful colonies were initially screened at ~ ` `:
30C and 41C on beta-lactamase assay plate and then for plasmid DNA levels following growth at 30C and 41C. A
` ~ successful candidate, designated pCS3, was confirmed by sequencing.
~ .
D.6.b. Preparation of the PLNR8S Insert The DNA sequence containing PL phage promoter and the ribosome binding site for the N-gene (NRg5) wag .'` ~
,: ~
'' '.
::
, , ~' .-. ,...
, ~ , ;r `- 132~093 , obtained from pFC5, and ultimately from a derivative of ~j pKC30 described by Shimatake and Rosenberg, Nature (1981) 292:128. pKC30 contains a 2.34 kb fragment from lambda phage cloned into the HindIII/BamHI vector fragment from 5 pBR322. The PL promoter and NR~S occupy a segment in - pKC30 between a 2glII and HpaI site. The derivative of pKC30 has the BglII site converted to an EcoR~ site.
~ The BglII site immediately preceding the PL
!~: promoter was converted into an EcoRI site as follows:
, 10 pKC30 was digested with aglII, repaired with Rlenow and .~ dNTPs and ligated with T4 ligase to an EcoRI linker (available from New England 3iolabs) and transformed into ~- E. coli K12 strain MM294 Lambda+. Plasmids were isolated from AmpR TetS transformants and the desired sequence 15 confirmed by restriction analysis and sequencing. The resulting plasmid, pFC3, was double-digested with PvuI
and HpaI to obtain an approximately 540 bp fragment framing the desired sequence. This fragment was ~. partially digested with HinfI and the 424 bp fraqment : 20 isolated and treated with Klenow and dATP, followed by Sl s ~ nuclease, to generate a blunt-ended fragment with the 3' terminal sequence -AGGAGAA, where the -AGGAGA portion is ; the NRBS- This fragment was restricted with EcoRl to : give a 347 base pair DNA fragment with 5'-EcoRI (sticky) ; `, 25 and HinfI ~partial repair, Sl blunt)-3' termini.
- To complete pPC5, pBI-Z15 was used to create a :: , ,.
; ~ HindIII site 3' of the NRB5. pgI-Z15 was deposited 13 January 1984, ATCC No. 39578, and was prepared by fusing a seguence containing ATG plus 140 bp ofg-IFN fused to 30 lac Z into pBR322. In pBI-Z15, the EcoRI site of p~R322 is retained, and the insert contains a HindIII site ~ - immediately preceding the ATG ~tart codon of B-IFN. pB
-~i Z15 was restricted with HindIII, repaired with Klenow and dNTPs, and then digested with EcoRI. The resulting . ::
'.''' ,1 .~

., .

EcoRI/HindIII (repaired) vector fragment was ligated with the EcoRI/HinfI (repaired) fragment above, and the ligation mixture used to transform MC1000-39531.
Transformants containing the successful construction were ~ 5 identified by ability to grow on lactose minimal plates ;. at 34 but not at 30. ~Transformations were plated on X-gal-Amp plates at 30 and 34 and minimal-lactose plates at 30 and 34. Transformants with the proper construction are blue on X-gal-Amp plates at both ;~ 10 temperatures, but on minimal lactose plates, grow only at 34.) The successful construct was designated pFC5.
."~
i D.6.c. ComPletion of PLOP
~` pCS3 was then modified to provide the PL and NRgs control sequences. pCS3 was digested with HindIII, 5 ' 15 and then digested with EcoRI. The vector fragment was ~ !~ ligated with an isolated EcoRI/HindIII from p~C5 ; containing the PLNRBS and transformed into E. coli MM294.
The correct construction of isolated plasmid DNA was confirmed by restriction analysis and sequencing and the . 20 plasmid designated pLOP.
:~
. D.7. PreParation of pTRP3 To construct the host vector containing the trp ~ control sequenceF behind a HindIII site, the trp -~ pcomotec/opecatoc/ribosome binding site sequence, lacking 25 the attenuator region, was obtained from pVH153, obtained ~ from C. Yanofsky, Stanford University. Trp sequences are -~ available in a variety of such plasmids known in the art.
pVH153 was treated with HhaI (which cuts leaving an ~.
;~ exposed 3' sticky end just 5' of the trp promoter) blunt-0 ended with Klenow, and partially digested with TaqI. The ;! 99 bp fragment corresponding to restrict~on at the TaqI
site, 6 nucleotides preceding the ATG start codon of trp ..
. ~.

~, ' s :~
`!`

/

, leader was isolated, and then ligated to EcoRI
(repair)/ClaI digested, pBR322 to provide pTRP3.

D.8. Preparation of PRTE7o4 pRT~704 is CMCC number 1951 and was deposited with ATCC on 14 Septe~ber l9B4. pRTB704 is an expression plasmid having the ricin B sequence under the control of the PL promoter NRBS- It is constructed from pRTB601, which contains the ricin B coding sequence and pFCS which tains the PLNRBS (~D-6-b) To construct pRTB704, .A,'~ 10 pRTB601 was digested with HindIII to excise the ricin B
~; coding sequence, treated with FnuDII to destroy the AmpR
region of the vector, and ligated using a T4 DNA ligase with a HindII$ digest of pFC5. The mixture was transfor~ed into E. coli MM294 and AmpR selected; the ` 15 correct construction was confirmed by sequencing.
,~
.; D.8.a. pRTB601 The polyA mRNA prepared as in ~D.l was used to obtain a cDNA library as follows: A portion of the polyA
RNA was treated under appropriate buffer condltions with 20 reverse transcriptase and then treated with base to `~f' destroy the remaining mRNA. The resulting single-stranded cDNA was repaired using E. coli Polymerase I
(Klenow fragment) in the presence of the 4 dNTPs and the ~ resulting ~hairpin" then ligated using T4 ligase to a -~ 25 SalI linker (obtained from New England BioLabs). After . treating with Sl nuclease and repairing with Klenow, the blunt end was ligated to an EcoRI linker using T4 ligase.
~; After then digesting with EcoRI and SalI, the resulting ~ double-stranded cDNA fragments, which are bounded by - ~ 30 EcoRI and SalI restriction sites, were ligated into a EcoRI/SalI digested, ~AP treated prepacation of pUC13 obtained and freely available from J. Messing, the .

` ` 132~393 ~ -37- -.

University of Minnesota. pUC13 is a modification of p~R322 capable of conferring Amp resistance (AmpR), and bearing a lac promoter control sequence upstream of :~ linkers bearing convenient restriction sites, lncluding ; 5 EcoRI and PstI sites downstream from the SalI site used ` in the insertion sites which are identical to those ~ found in the analogous M13 phage cloning vectors. The $ resulting liqation mixture was used to transform E. coli MM294, and AmpR strains selected.
~ 10Successful colonies were transferred onto .
nitrocellulose plates, and probed using the procedure of ^~ Grunstein & Hogness (supra), with the mixture of 16 synthetic oligonucleotides 155' CC(G)TC(GA)TT(TC)TT(G)AACATCC 3' :, which is kinased with 32p This mixture represents the ~;s~ anti-sense strand complementary to the codons for the amino acid sequence Trp-Met-Phe-Lys-Asn-Asp-Gly. Of about 5000 colonies probed about 1% were found which 20 hybridized to the probe. Plasmids were isolated from several representations of these colonies, and analyzed by restriction analysis and Maxam-Gilbert sequencing.
Three plasmids, pRTB4, pRTB5, and pRTAl15 were sequenced in the insert region, and the results are shown in Figure 25 4.
The amino acid sequence deduced from the pRTB5 base sequence shows a high level of correspondence to ricin B, although some discrepancies exist. These are due to possible errors in the published sequence and to 30 varietal dlfferences in the ricin B proteins represented.
The entire codlng sequence for ricin B is present in pRTB5 T`except for codons for tbe first 11 amino acids. pRTB5 :~.

~., : .

s i , ~x .

132~093 was used as the source of the bulk of the coding sequence in the expression vectors. The pRTA115 insert contains ~ the upstream coding regions of the ricln B gene.
;A' Although pRTA115 is believed associated with the RCA
5 precursor protein, the amino acid sequence deduced from pRT~115 for RCA matches that of ricin B for the 11 amino acids needed to complete the N-terminus. These sequences ~` were therefore used as models for the construction of oligonucleotides encoding the missing 11 N-terminus 10 codons and also permit the deduction of the amino acid .~ sequence of the 12 amino acid peptide in the single ~ peptide precursorsof RCA and, presumably, of ricin A and ;~ B.
The coding sequences of pRTB5 were disposed so 15 as not to be expressible under the control of the lac ~; promoter as inserted into pUC13. Therefore, pRTB5 was :~, cut with EcoRI and PstI and the vector cleaved into J ~ several fragments with BstNI. The insert fragment was ligated under standard conditions using T4 ligase with an 20 EcoRI/PstI digest of p~C8, another modified pBR322 vector obtained from and freely available from Messing, J., at the University of Minnesota. pUC8 has EcoRI and PstI
~` sites which place an EcoRI/PstI insert under lac promoter control as a fusion protein with the initial 5-8 ~- 25 amino acids of B-galactosidase. It also contains a ~- HindIII site immediately downstream from the PstI site.
; The ligation mixture was transformed into E. coli MM294, and transformants selected for ampicillin resistance.
Plasmid DN~ was isolated from successful transformants in ~o several colonles, and analyzed by restrlction site ~I mapping. Colonies showing the appropriate restriction `I patterns were ~elected. One colony, designated pRTB151,3 wao te~ted for expression of the gene for the fusion protein. On We~tern Blot no peotein band corresponding r ' i ;J

!
,!
, " `' ., 1324~93 '-' to the desired molecular welght was found, although cross-reactir~ proteins were produced. It was assumed il that the reading frame might be improper, since this plasmid was designed to have the B-galactosidase and ; 5 ricin B sequences in different phases.
~` Ten ~9 of pRTB151 DNA was digested to ~ completion with EcoRI, dissolved in 60 ~l Sl buffer and - digested for 4 min at room temperature under conditions which remove about 1 base pair of duplex DNA per min.
10 DNA recovered from the foregoing buffer was dissolved in ~` 60 ~1 exonuclease III buffer and digested for 4 min at room temperature. Subsequent analysis showed that the plasmid DNA had lost approximately 120 bp from each 3' ~r end, leaving S' ends available for hybridization. DNA
lS recovered from the Exonuclease III buffer was dissolved in S0 ~l water and 20~l used in the liqation/repair reaction below.
Thus, 20 ~1 sample (2 pmoles~ was mixed with ~ 20 pmoles each of the synthetic oligonucleotides:
:.,, ,:`~
~ 20 Oligo 2 ;~ ~~ S'- GACCATGATAAGCTTATGGCTGATGTTTGTATGGATCC and HindIII 3'TACCTAGGACTCGGGTATCACGCATAGCATCC-S' Oligo 1 i .
: ., which have complementary sequences as shown, and wherein ` Oligo-2 encodes a HindIII site upstream of an ATG start codon as shown in Figure Sa. The S' end of Oligo-l is ~; complementary to lS bases at the S' end of the pRT~lSl 25 cDNA sequence as there shown and is complementary to the ~` contiguous missing codons of the ricin ~ seguence. The . 5' end of 01~90-2 i9 complementary to the 5' sticky end of the vector residue of the exonuclease III treated ~; pRTU 51.

': .
, i :: .i : :
, , ~;
, .j; i ... .

:, - 132~93 .
The mixture wa~ heated to 60 for 5 min ln order to denature completely complementation of single-stranded DNA, cooled to 37 for 5 min to hybrldized complementary strands, and then chilled on lce. The soluton was brought to polymerase I (Klenow) buffer conditions and reacted for 2 hr at 12 in the presence of the 50 ~M each of the 4 dNTPs, 0.1 mM NAD, 0.3 units/~l Klenow, and 0.0~ units/~l E. coli DNA ligase. The ligation mixture was used directly to transform competent E. coli MM294 and several thousand AmpR colonies found.
~ Several hundred of these were replicated and grown on `~ nitrocellulose filters and subjected to standard colony ~-~ hybridization using p32 kinased Oligo-2 as probe. Two clones which hybridized with the probe were analyzed by restriction analysis and sequenced, and a correct construction designated pRTB601. pRTB601 thus contains the ricin B coding sequence as a HindIII cassette. The upstream HindIII site is introduced immediately upstream of the ATG codon in Oligo-2: the downstream HindIII site arises from the p~C8 vector plasmid.

`~ The following plasmids have been deposited at the American Type Culture Collection, Rockville, Maryland, U.S.A. (ATCC) under the terms of the 8udapest ~ Treaty on the International Recognition of the Deposit of `',t: 2S Microorganisms for the Purposes of Patent Procedure and Regulations thereunder (8udapeRt Treaty) and are thus maintained and made available according to the terms of : , `, the 8udapest Treaty. Availability of such strains is not S;~ to be construed as a llcense to practice the invention in contravention of the rlghts granted under the authority I of any government ln accordance with its patent laws.
`~l The deposlted plasmids have been assigned the ~,` lndlcated ATCC deposit numbers. The plasmids have also :"~`
,, :; ~
.i ,.., 1 .
.'~ ' :~
:, ,, `' `'.:. ~, 132~93 I been deposited with the Master Culture Collection ~CMCC) i of Cetus Corporation, Emeryvllle, California, U.S.A., the ! assignee of the present application, and assigned the indicated CMCC deposit numbers:
" ~
Plasmid CMCC ATCC Date of ~ and Deposit Deposit ATCC
$. 5 Host No. No. DePosit :~ . pRA123/ 2108 39799 17 August 1984 ~ p~I-Z15 1948 39578 13 January 1984 pRATl/MM2942115 pRAL6/MC1000~ 2114 39833 4 September 1984 ~: 10 pCS3 39142 3 June 1982 ~: pRT~704/MC1000~ 1951 14 September 1984 pFC5/MC1000~1935 14 September 1984 :~ .
.
.

':
~:;

. . ,'~
. , ':-. , .

: ~;
;T

/
$
,,

Claims (27)

THE EMBODIMENTS OF THE INVENTION IN WHICH AN EXCLUSIVE PROPERTY OR
PRIVILEGE IS CLAIMED ARE DEFINED AS FOLLOWS:

1. Ricin A as the product of prokaryotic recombinant host cells.

2. Recombinant ricin A as the product of prokaryotic host cells and which is substantially free of impurities.

3. Recombinant ricin A as the product of prokaryotic host cells and which is in non-glycosylated form.

4. A replicable, recombinant expression vector effective in expressing the gene encoding ricin A in prokaryotic recombinant host cells, said expression vector being a plasmid.

5. A plasmid comprising the DNA sequence encoding ricin A operably linked to control sequences compatible with a prokaryotic recombinant host cell.

6. The plasmid of claim 5 wherein the control sequences comprise the PL promoter and N gene ribosome binding site.

7. The plasmid of claim 5 wherein the plasmid is replicated in high copy number at elevated temperatures.

8. The plasmid of claim 7 which is derived from pCS3.

9. The plasmid of claim 6 wherein the plasmid is replicated in high copy number at elevated temperatures.

10. The plasmid of claim 9 which is pRAL6.

11. Prokaryotic recombinant host cells transformed with the plasmid of claim 5.

12. A method of producing ricin A in prokaryotic recombinant host cells which comprises culturing the cells of claim 11 and recovering the ricin A from the culture.

13. Ricin as the product of prokaryotic recombinant host cells.

14. Recombinant ricin as the product of prokaryotic host cells and which is substantially free of impurities.

15. Recombinant ricin as the product of prokaryotic host cells and which is in non-glycosylated form.

16. A replicable, recombinant expression vector effective in expressing the gene encoding ricin in prokaryotic recombinant host cells, wherein the vector is a plasmid.

17. A plasmid comprising the DNA sequence encoding ricin operably linked to control sequences compatible with a prokaryotic recombinant host cell.

18. The plasmid of claim 17 wherein the control sequences comprise the PL promoter and N gene ribosome binding site.

19. The plasmid of claim 17 wherein the plasmid is replicated in high copy number at elevated temperatures.

20. Prokaryotic recombinant host cells transformed with the plasmid of claim 17.

21. A method of producing ricin in prokaryotic recombinant host cells which comprises culturing the cells of claim 18 and recovering the ricin from the culture.

22. A DNA sequence encoding ricin A which comprises codons for the amino acid sequence of ricin A with a stop codon immediately following the C-terminal amino acid codon, as shown in Fig. 1.

23. A DNA sequence encoding ricin A which comprises codons for the amino acid sequence of ricin A with the sequence ATG immediately preceding the N-terminal amino acid codon, as shown in Fig. 1.

24. The DNA sequence of claim 22 with the sequence ATG
immediately preceding the N-terminal amino acid codon.

25. The DNA sequence of claim 23 which further includes a HindIII site immediately preceding the ATG codon.

26. A DNA sequence encoding a ricin toxin which comprises codons for the amino acid sequence of ricin A and ricin B
having the sequence AT? immediately preceding the N-terminal amino acid codon as-shown in Fig. 1.

27. The DNA sequence of claim 26 which further includes a HindIII site immediately preceding the ATG codon.