CA1295560C - Telomeric dna probe - Google Patents

Telomeric dna probe

Info

Publication number
CA1295560C
CA1295560C CA000526211A CA526211A CA1295560C CA 1295560 C CA1295560 C CA 1295560C CA 000526211 A CA000526211 A CA 000526211A CA 526211 A CA526211 A CA 526211A CA 1295560 C CA1295560 C CA 1295560C
Authority
CA
Canada
Prior art keywords
dna
fragments
probe
fragment
individuals
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Expired - Lifetime
Application number
CA000526211A
Other languages
French (fr)
Inventor
Howard J. Cooke
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
3I Research Exploitation Ltd
Original Assignee
3I Research Exploitation Ltd
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 3I Research Exploitation Ltd filed Critical 3I Research Exploitation Ltd
Application granted granted Critical
Publication of CA1295560C publication Critical patent/CA1295560C/en
Anticipated expiration legal-status Critical
Expired - Lifetime legal-status Critical Current

Links

Landscapes

  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

ABSTRACT

A DNA probe, designated 29C, comprises a telomeric deoxynucleotide sequence from near the short arm ends of the X and Y chromosomes wherein there exists a region of hypervariability amongst unrelated individual members of a population. The probe has application in paternity determination and in the identification of individuals and provides a useful addition to the range of probes of this type which are used in forensic science and in pathology.

Description

1~955~`0 Telomeric DNA Probe This invention relates to a telomeric DNA probe and its use in the identification of individuals by means of their characteristic genetic profile. Although the probe is of particular interest for the identification of human individuals, it is applicable, with appropriate selection of the source materials, to any primate species.

The genetic profile of each individual member of a species is unique, with the notable exception of identical twins. It is that uniqueness of the genetic make-up which defines individuality and is responsible for the infinite variation in living organisms. In the same way that examination of the traces left by an individual's fingerprints may be used to characterise and so identify that individual from all others, examination of the genetic profile (the "genetic fingerprint") will also provide conclusive evidence of the individual's identity. Genetic fingerprinting, however, uses samples of body fluids or tissue such as blood, skin or semen which contain the individual's cells inside which is located the DNA which encodes the unique genetic complement. Since the genes are carried by most of the cells of an organism, there is a wide selection of genetic material available for use in generating a genetic fingerprint.
In general, the generation of a DNA fingerprint requires the extraction of the DNA from the cellular sample. The DNA is then degraded by treatment with one or more restriction endonucleases, which are enzymes which will cleave the double-stranded DNA at specific sites. For example, the enzyme Smal is known to cleave 3~

lZ955fiO

DNA between the bases cytosine and guanine at loci where there are adjacent triplets of cystosine (C) and guanine (G); that is, at the sequence -C-C-C-G-G-G-, cleavage occurring between the central -C-G-.

The result of the enzymic degradation of the DNA is a mixture of fragments of DNA of differing length (or, more accurately, molecular weight), the spectrum of length distribution being unique to the individual's genetic profile. The mixture may then be separated in accordance with the lengths of the fragments by means of gel electrophoresis, the distance travelled by each band being related to the size of each fragment. The electrophoretogram so produced is visualized, using an analytically detectable reagent which is allowed to bind (or hybridize) to the bands and which produces a colorimetric or fluorimetric result or, most commonly, a radioactively labelled agent, containing, for example, phosphorus32. Autoradiography is a process in which the electrophoretogram is laid on an unexposed photographic plate or film and the radioactive emissions from the radioactively labelled bands expose the film and are visualized as dark bands on the developed film. More usually, the method also involves an intermediate technique known as Southern blotting where a sheet of cellulosic film is laid on the gel and the bands are transferred thereto by adsorption into the cellulosic material giving a more easily handleable form to the electrophoretogram.

An electrophoretogram produced in accordance with the general principle described above is extremely complex, having a vast number of bands and is extremely lZ95S~iO

difficult to interpret, so much so that it is impractical for routine laboratory use. To render the DNA
fingerprinting technique more useful it is desirable to analyze only a limited number of DNA fragments. For example, one may be interested only in examining the defective gene which is responsible for an inherited disease, such as haemophilia, and so one would only examine the bands of the electrophoretogram which contain the fragments of that gene.

In order to restrict the visualization of the bands to those of interest, materials known as DNA "probes" may be used. DNA probes, or, in the context of this application "gene probes", are relatively short deoxynucleotide sequences, produced by recombinant DNA
(rDNA) techniques, which are complementary in structure to a specific nucleotide sequence which is known to occur only in fragments of the DNA (gene) of interest.

Within the structure of DNA there exist areas which vary greatly from one individual to another, known as "polymorphisms" and it is the examination of these regions which is of interest in the determination of the identity of individuals as the chance occurrence of two unrelated individuals having the exactly the same polymorphisms is remote. Thus, by designing probes which detect base sequences occurring in the polymorphic regions the characteristic genetic profile of the individual may be visualized on the electrophoretogram of the restricted DNA.

One application of the genetic fingerprinting technique of the type to which the present invention relates is in forensic science where DNA fingerprinting may provide strong evidence for presentation to a court in criminal cases. The DNA fingerprint may be generated from semen deposited by a rapist or from bloodstains and tissue traces left at the scene of violent crimes. When compared with a fingerprint prepared in parallel from a DNA sample taken from a suspect, the fingerprint will indicate the involvement or otherwise of the suspect.

It is characteristic of sexually reproducing species that offspring inherit one half of their genetic complement from each parent. Examination of the genetic fingerprint of a child will reveal DNA banding which also occurs in the genetic fingerprint of each parent and thus the technique may be used to determine with a high degree of certainty the presence or absence of a blood relationship between individuals in addition to its more general application in the identification of individuals. This ability to determine blood relationship between individuals is of interest in the production of evidence for paternity suits, immigration disputes where establishment of a blood relationship between a would-be immigrant and an already existing resident of the country concerned is necessary before immigration is permissible, identification of hitherto unidentifiable bodies, and the reuniting of runaway children with their biological parents.

United Kingdom Patent Application Number 2,135,774, describes a method for the identification of individual members of a species of organism by analysis of DNA fragment length polymorphisms generated by the action of restriction endonucleases on the DNA of individuals. The sized, single-stranded DNA molecules produced are hybridised with probe DNA and the ;

12~SS60 number and the location of the hybridized fragments is identified. The method may be used in paternity tests. The said application contains full experimental details of the procedures employed in the production of genetic fingerprints and in the analysis of the results obtained.
on object of the present invention is to provide a DNA probe for use in the generation of genetic fingerprints.
In accordance with an embodiment of the present invention there is provided an isolated DNA comprising a telomeric deoxynucleotide region of the short arm ends of X or Y
chromosomes, wherein the region is derived from the human DNA
cloned into cosmid CY29.
Other particular aspects of the present invention provide a probe prepared from the above DNA and a transformed bacterium harboring said DNA.
It is preferred that the above noted DNA comprises a restriction fragment of CY29 designated 29Cl; it being particularly preferred that the fragment 29Cl has a nucleotide sequence comprising:
~ 70 GAGGGTclGGAGAT~GccccGAGG~GGTcccGATAG~c~ b~y7D~7G7c~cToclD~AGGGAA 140 GAAGCCGTCTGGTGTGGTCrGG~AAAnaGG~GCPGGGGGTClGGGGTGGTCCCGAG3GGPGGAGOGGG3G 210 _______________________ ______ ____________________ ___________ TCTGGGGTGGTCCCGAGGC~YX~Y3~3GGGGTCnGGGG'rGGTCCCGPGGGGAGG~iCGlGGGTCTGGGGT 280 _______________:,__________________________~ ______________ GGTCCCGAGGGGAGGAGC~GGGGGTTCT~GGTGTGGTCCCGTGGGIAGGPEGGGGGGTCTGGGGTGGTCC 350 ___________ ___________ ______________~_______________~______ TAAGAGGAGGAGC ~GGG'~DG3GGrGGTCCCAGAGGX~Y~4~133GGG~CqGGGGIGGTCCCAGAGGGG 420 AGGA ~ TCTGGGGT&GTCCCGPG3GGAGGA ~ T ~ TGGICCC ~ 490 DG~bGDGDl~CGA ~ TICIGGGTGTGGTCCCGTGGGTAGGAGaGaG3GT 560 CT~ZGGATGGICCTAAGAGJ;iX~YX13GG3GTCTGCATGIGG~ T'n~hGGGGTGGAGCAlGGGGnCDCCC 630 TGTGGTICGGAGGGTGGAGCAGGGGGT~IGGGGTlGGTACITrlCGCCGGGACACCGCTAq ~ Tl'r 700 TGGT~cGGTTcccATclxcTGATcTGGGGGTccTTGTGATccl~AcGGcGoGccAGATGGG~GGGTcAAG 770 GT~AGGGAAGGAAGGAGT&GcAGcTTGGncccAGGGAGchG-~AAhGGGlTTGTGGTTcAGTrcTGATm~m 840 TGACCCATCCATAGGAGAAT&GACACCTCAGACTCTCTCAATCIIGGCCAG~G~CPaGICCCAGTAGCTG 9lO
CC3q~X~r~3GClGTCCTTGAGGCTCA~rGGAGGATA~ ATICIGGCAAATTTrAAAAAATTC 980 TTCTATAGATCTCAGTGAGTTCAAAGCTGCCTGTGTGCAGGCATAGATCCGTTCTTTGCIGAGCTICCAC l050 TCTAGTCGGCIGAAAGGAAAGGGTAATATA&CIGXZUUUY~GrAT~CTGGGGTGAT~AGAGGAT~CTACAT 1l20 TTcATcTTpyAAAGGGATATTGAcAGGAGAccAGAAcITccAGAq~ rGAATl~rcAAGAAcTAcTTc 1190 CAA~CCTGGACAATAn~xx~YXiYTCATCTCTACAAAATAAAAATTA~UATTX~ACGT~CG~TGG 1260 ~ i~ CACACn~CD~rAGTCCCACCTWC~=n~AC~D=~r~b~ U~DOO~nC~C~rC~D~,X~G~ 1330 ~.~

12~5~0 - 5a -In accordance with another embodiment of the present invention there is provided an isolated DNA sufficiently complementary to hybridize to the human DNA cloned in cosmid CY29.
It is preferred that the cloned DNA comprises a 17-kb HindIII fragment, and particularly preferred that the cloned DNA comprises a 5.7-kb HindIII fragment. In another particularly preferred embodiment, the cloned DNA has a 1.7-kb PstI restriction fragment of a 5.7-kb HindIII fragment.
In accordance with a further embodiment of the present invention there is provided cosmid CY29 comprising 3E7 DNA
having a telomeric deoxynucleotide sequence occurring in a polymorphic genetic region proximate the short arm end of X or Y chromosomes.
The invention also provides the bacterium Escherichia coli strain HB101 harboring the cosmid CY29 which expresses the deoxynucleotide sequence of this invention and which was deposited, pursuant to the Budapest Treaty, with the American Type Culture Collection, 12301 Parklawn Drive, Rockville, Maryland on December 8, 1987. The accession number, ATCC
67573, was assigned and the requisite fees were paid. The strain will be made available if a patent office signatory to the Budapest Treaty certifies one's rights to receive a sample. The strain will be maintained for a period of at least five years after the most recent request for a sample and, in any event, for a period of at least 30 years after the date of deposit. Should the culture die or be destroyed during the effective term of the deposit, it will be replaced with a viable culture of the same taxonomic description.
The invention also provides a method of identifying individuals comprising, extracting DNA from a sample of DNA-containing cells of the individual, digesting the said sample with a restriction endonuclease to produce a mixture of DNA
fragments having a variety of lengths, separating the fragments in accordance with length, rendering the separated lZ95560 fragments single stranded, hybridizing the single stranded fragments with the DNA probe of this invention and locating and enumerating the hybridized fragments.
Preferably the single-stranded fragments are probedadditionally with other DNA probes hybridizing with different DNA sequences, said additional probing being effected simultaneously or separately from the probing with the probe of this invention.
The method may also include the further step of comparing the number and location of the hybridized fragments derived from samples taken from individuals to be compared and noting similarities and dissimilarities therebetween in order to establish the presence or absence of a biological relationship between the individuals.
The two samples may be taken from a child and putative parent. As a matter of practice, however, the child's fingerprint would be compared with those of both parents.
Should it be determined that the sizes of the DNA fragments of the child are different from those of the putative father than it may be concluded that he is not the biological father. The statistical probability of paternity may be ascertained by reference to the probability of the DNA of two random unrelated individual members of a population having identical restriction fragment sizes. It will be appreciated that the rarer the recurrence of a fragment in the population at large is the more conclusive will be the test. Reference is directed to "Inclusion Probabilities in Parentage Testing"
(1983) ed. R.H. Walker, American Association of Blood Banks, where the so-called "paternity index" is fully described. The probe of this invention detects variable numbers of restricted DNA fragments in different individuals. Where families are involved the fragments can be assigned to one of two alleles present on both XX chromosomes or on the X and the Y. The number of different alleles in the population is thought to be in excess of fifty.

12955~0 In a second type of analysis, hybridized fragments derived from a first sample taken from an individual of known identity and second or subsequent samples of unknown biological origin may be compared to establish whether said second or subsequent sample originated from the known individual.
The invention further provides a kit of components usable in accordance with a set of procedural instructions, for the generation of a genetic profile, comprising a preparation containing one or more than one restriction endonucleases and a preparation containing the DNA probe aforesaid either alone or in combination with one or more additional DNA probes.
A further application of the probe of the present invention is in the medical monitoring of bone marrow transplantation.
At intervals after transplantation, genetic profiles are generated using the probe in the manner herein described from samples of the DNA of the recipient of the transplant. These profiles are compared with the profiles obtained from donor DNA and the recipient's pre-transplant profile. Successful engraftment is indicated by progressive change of the recipient's profile to that of the donor and failure shown by the recipient's profile remaining in, or reverting to, its pre-transplantation condition.
The probe of this invention visualizes only a limited number of restriction fragments, normally about four to six. This is a desirable number since, on the one hand a small number of DNA fragments may easily be separated electrophoretically, yet the pattern of sequences (referred to as haplotypes) detected by the probe are sufficiently variable within unrelated individual members of a population to give that degree of uniqueness which satisfies the criteria for utility in determining individuality.
The probe of this invention is derived from the telomeric regions of the sex chromosomes. Telomeres are base sequences in DNA whose action is to preserve the integrity of linear chromosomes during the meiotic and mitotic phases of cell 12~SStiO

division. Telomeric DNA is specialized to ensure complete replication of the 3' ends of linear chromosomal DNA.
Human X and Y chromosomes display a pairing behaviour distinct from that of the autosomes during meiosis but there is evidence that they undergo an obligatory recombination event which results in transposition of the telomeric sequences from one chromosome to the other with the result that sequences distal to the site of recombination are inherited as though autosomal. The term "pseudoautosomal" has been coined to describe such a region.
Despite intensive efforts to provide DNA probes for the human X and Y chromosomes, no human X or Y-derived sequences which are inherited in an autosomal manner have hitherto been reported in the literature. Several sequences which are highly homologous on both sex chromosomes have been found.
These sequences have arisen as a result of transposition of X
chromosome sequences on to the Y chromosome in primate evolution but to positions which are non-homologous. For example, in humans the STS locus which maps close to the tip of Xp is clearly X-linked, implying that it must be more proximal than a site of obligatory recombination. Also, MIC2, a human locus which controls expression of a cell-surface antigen 12E7, and which has alleles on Xp and Yp, shows a sex-linked expression of a polymorphism in the levels of 12E7, suggesting that MIC2 is also proximal to any obligatory recombination site. However, the probe sequence 29Cl has been found to be inherited pseudoautosomally following transposition from one chromosome to a homologous position in the telomeric region of the other. Similar behaviour has been observed with the sex reversion factor (Sxr) and the STS locus in the normal mouse.
The inheritance of human Xp and Yp telomeric sequences provides a stringent test for the existence of a pseudoautosomal region of the sex chromosomes since unless two obligate recombinations events occur, these regions of the X
and Y chromosomes would have to show an autosomal pattern of inheritance. It has been confirmed by the present inventors that the telomeric regions of the X and Y chromosomes 1;~95560 are inherited as if autosomally located, as predicted by the hypothesis that the X and Y chromosomes undergo an obligate crossover between one pair of chromatids during meiosis.

With respect to the accompanying drawings, Figures lA, B
and C are restriction maps of, respectively, - Xp and Yg chromosome termini;
- cosmid CY29; and - expanded map of distal EcoRI fragments 29C;
Figures 2A, B and C are graphs of DNA from unrelated blood cells digested with three different enzymes, respectively, - EcoRI;
- HindIII; and - PstI;
and Figures 3A, B and C are a genetic profile produced using the probe of this invention with two different features.

The probe of the invention may be prepared as follows. A
cosmid CY29 was isolated from a cosmid library constructed from DNA of 3E7 [Markus, M. et. al., Nature, 262, 63-65, (1976)], a mouse-human hybrid with multiple Y-chromosome, during a screen for OpG-rich sequences on the human Y-chromosomes. Such sequences are frequently associated with genes. The restriction map of 29C (Fig. 1), a subclone of CY29, shows sites for HpaII and HhaI are clustered in the region of the SstII sites and this is consistent with a OpG-rich domain.

In greater detail, Fig. 1 shows restriction maps of:A. Xp and Yg chromosome termini;
B. Cosmid CY29 and, C. Expanded map of distal EcoRI fragments 29C.

Maps in B and C were generated by end-labelling and partial digestion. CY29 was selected from a cosmid library, Bl l;~95S~O

- 9a -constructed from a partial MboI digest of 3E7 DNA by standard tech-niques on the basis of hybridization to total human DNA, CY29 is free from detectable mouse repeated sequences. CY29 was linearised at the PvuI site, partially digested with the enzymes, indicated and transferred to nitrocellulose by bidirectional transfer. One filter was probed with the large PvuI-EcoRI fragment from the cosmid vector pJB8 and the other with the smaller EcoRI-PvuI vector fragment. Fragment sizes were measured and calculated according to the method of Southern and Elder ~Elder, J. ~ Southern, E.M.;
Analyt. Biochem. 128 227-321 (1981)]. The map for 29C, a subclone in pUC9, was generated by cleavage with BamHI, end-labelling with DNA polymerase I Klenow fragment followed by re-cleavage with HindIII (these sites occur in the vector polylinker) and partial digestion with the enzymes shown. Enzyme sites are marked ~1 as follows: B, BamHI; H, HindIII; Hh, HhaI: Hp, HpaII;
M, MboI; P, PstI; Pv, PvuI; R, EcoRI: S, SstII: and V, EcoRV.
A panel of somatic cell hybrid DNA's was used to confirm the chromosomal origin of this cosmid.
Reference is directed to Nature, Vol. 317, No. 6039, pp. 687-692 where full details of this confirmation are given. As well as confirming that the cosmid contains Y-chromosome sequences, these experiments also confirmed that this sequence is also present on the X-chromosome. As would be predicted, both male and female DNA's also contain sequences homologous to this probe. Further testing, also reported in the Nature paper referred to, confirmed that the probe sequence occurs only on the X and Y and not on any of the other chromosomes.
Further investigation has been carried out to establish that telomeric location of the probe sequence. The evidence from this investigation strongly supports the argument that the probe is indeed a chromosome end and details of the investigation are to be found in the Nature paper referred to above.
Reference is now directed to Fig. 2 which shows the results of an investigation of the extent of the polymorphisms in the probe region.
Fig. 2 shows DNA from nucleated blood cells of 22 unrelated randomly selected donors digested with three different enzymes, namely:
A EcoRI;
B HindIII; and, C PstI
Digestions were carried out under standard conditions and the digests were reprobed with 29Cl. Transfer, hybridization, and washing were as follows:

12~55~0 DNA was digested with an excess of restriction endonuclease (EcoRI in Fig. 2A; HindIII in Fig.
2B; and PstI in Fig. 2C) and the resulting fragments were separated by electrophoresis in 0.8% agarose and transferred to a nylon filter.
The filter was hybridized with approximately 0.1 microgram of the probe 29Cl in 5% SSC, 5%
Denhardt's solution, 10% dextran sulphate at 68C
for 18 hours then washed at 68C in 0.1% SSC, 0.05% SDS and autoradiographed with intensification. The size indicators in Fig. 2 are in kilobases.
It is clear from Fig. 2 that no two individuals have identical patterns. Because the polymorphisms are detected with different enzymes they cannot be due to point mutations in restriction sites it also seems to be unlikely that they represent variations in the number of mini-satellite repeats in a block because 29Cl does not hybridize in conditions of reduced stringency with two mini-satellite core sequences.
Since all the Pst fragments (Fig. 2C) detected by this probe (which is itself a Pst fragment) are polymorphic this probe cannot be flanking a polymorphic region but must itself be polymorphic. Measurement of the copy number of this sequence by titration gives an estimate of between three and ten copies per haploid genome.
There is uncertainty about this estimate because the nature of the sequence variability is unknown and could affect the estimate of the copy number. It would be necessary to clone this region from a number of individuals to establish the basis of this extreme polymorphism.
Sequences 29C4 and 29C2 which are immediately 5' to the probe 29Cl, detect polymorphic HindIII and EcoRI fragments as expected from the restriction map of the i ;~

cosmid (Fig. lB). These probes detect Pst fragments which are not polymorphic and which are identical in size in DNA's from both sexes. 29C3, in contrast, detects polymorphic fragments (data not shown). This suggests that 29Cl defines a boundary between hypervariable and non-variable regions of the X and Y
chromosomes.
Analysis of five families has revealed no examples of Y linkage of informative fragments in 25 meioses. In three families, however, one uninformative fragment was present in both father and mother. Fig. 3 presents the data of two of these fully informative families.
In Fig. 3 there is presented the genetic profile produced using the probe of this invention to show the inheritance of 29Cl in two families. DNA from blood samples were analyzed in the manner described in respect of Fig. 2.
A Family 1, Pst (individuals are shown in the same order as in Fig. 3B);
B Family l, EcoRI; and C Family 2, EcORI.
The results are presented schematically above the hybridization data with fragments assigned to halotypes. Fragments detected by this sequence are sufficiently polymorphic to provide a good check for paternity. In further experiments, the number of individuals analyzed with EcoRI was extended to 83 and it has been found that no two individuals had identical patterns. Family 2 is affected by X-linked retinitis pigmentosa (XLRP). 29Cl shows either one or three recombination in four meioses with this locus (the family is uninformative for RFLP's tightly linked to XLRP and so it is not possible to determine phase).
In Family I (Fig. 3A and B), X-linkage can be excluded for all paternal fragments and it can be .

demonstrated that two out of three daughters inherit a paternal Y-chromosome fragment. The only assumption can be that at least one copy of a sequence homologous to 29Cl is always present on both the X and the Y
chromosomes, as is suggested by the cell hybridization data. Considering only the second two generations in the Pst digest (Fig. 3A) of these DNA's, the largest fragment in the paternal sample is inherited by daughters 1 and 3 but not by daughter 2 and is therefore not X-linked. The next largest fragment is inherited only by daughter 2 and is therefore not X-linked and the smallest paternal fragment is not inherited by the first daughter and so is also not X-linked. Thus, although at least one of these fragments must be located on the X-chromosome, non behave genetically as if they were X-linked. In the EcoRI digest (Fig. 3B), although one fragment is uninformative in the second and third generations, one fragment can be assigned to the paternal Y-chromosome.
The second largest fragment (fragment b in Fig. 3B) in the grandfather is the only fragment inherited by the father and therefore must be on the father's Y-chromosome. Daughters 1 and 3 have inherited this fragment presumably as a consequence of an X/Y
recombination in the father.
In Family 2 (Fig. 3C), it cannot be determined which fragments are derived from the paternal Y
chromosome but no fragment is inherited by all the sons. In both families there are two independently segregating set of fragments in each individual which show a mendelian pattern of inheritance (shown schematically above the blots in Fig. 3). Fragments in both the Pst and the EcoRI digests for Family 1 can be fitted into the same sets which behave as haplotypes. Although the family sizes are small this supports the localization of these , lZ9~560 sequences to two loci, one on the X-chromosome and one on the Y. Thus two out of three daughters carry a paternal X-chromosome which is a product of an X/Y
recombination in the father of the Family l and three out of six sons in Family 2 carry a Y-chromosome which is an X/Y recombination product. This is consistent with there being an obligate recombination event.

Claims (25)

THE EMBODIMENTS OF THE INVENTION IN WHICH AN EXCLUSIVE
PROPERTY OR PRIVILEGE IS CLAIMED ARE DEFINED AS FOLLOWS:
1. An isolated DNA comprising a telomeric deoxynucleotide region of the short arm ends of X or Y
chromosomes, wherein said region is derived from the human DNA cloned into cosmid CY29.
2. The DNA of claim 1, comprising a restriction fragment of CY29 designated 29Cl.
3. The DNA of claim 2 wherein said fragment 29Cl has a nucleotide sequence comprising:

4. An isolated DNA sufficiently complementary to hybridize to the human DNA cloned in cosmid CY29.
5. The isolated DNA of claim 4 wherein said cloned DNA
comprises a restriction fragment of CY29 designated 29Cl.
6. The isolated DNA of claim 4 wherein said cloned DNA
comprises a 17-kb HindIII fragment.
7. The isolated DNA of claim 4 wherein said cloned DNA
comprises a 5.7-kb HindIII fragment.
8. The isolated DNA of claim 4 wherein said cloned DNA
comprises a 1.7-kb PstI restriction fragment of a 5.7-kb HindIII fragment.
9. Cosmid CY29 comprising 3E7 DNA having a telomeric deoxynucleotide sequence occurring in a polymorphic genetic region proximate the short arm ends of X or Y chromosomes.
10. A DNA probe prepared from the DNA of claim 1.
11. A DNA probe prepared from the DNA of any one of claims 2 to 9.
12. A transformed bacterium harboring the DNA of claim 1.
13. A transformed bacterium harboring the DNA of any one of claims 2 to 9.
14. The bacterium of claim 12, wherein the bacterium is E. coli.
15. The bacterium of claim 14 comprising Escherichia coli strain HB101 harboring cosmid CY29 wherein said strain is assigned accession number ATCC
67573.
16. A method of identifying individuals comprising, extracting DNA from a sample of DNA-containing cells of the individual, digesting said sample with a restriction endonuclease to produce a mixture of DNA fragments having a variety of lengths, separating the fragments in accordance with length, rendering the separated fragments single stranded, hybridizing the single-stranded fragments with a DNA probe of claim 10 and locating and enumerating said hybridized fragments.
17. The method of claim 16, wherein the single-stranded fragments are probed with at least one additional DNA probe.
18. The method of claim 16 comprising the further step of comparing the number and location of the hybridized fragments derived from samples taken from first and second individuals and noting similarities and dissimilarities therebetween in order to establish the presence or absence of a biological relationship between the individuals.
19. The method of claim 18, wherein the samples are taken from a child and a putative parent.
20. The method of claim 17 comprising the further step of comparing the number and location of the hybridized fragments derived from samples taken from first and second individuals and noting similarities and dissimilarities therebetween in order to establish the presence or absence of a biological relationship between the individuals.
21. The method of claim 20 wherein the samples are taken from a child and a putative parent.
22. The method of claim 16, wherein hybridized fragments derived from a first sample taken from an individual of known identity and a second or subsequent sample of unknown biological origin are compared to establish whether said second or subsequent sample originated from the known individual.
23. The method of claim 17, wherein hybridized fragments derived from a first sample taken from an individual of known identity and a second or subsequent sample of unknown biological origin are compared to establish whether said second or subsequent sample originated from the known individual.
24. A kit of components for the generation of a genetic profile, comprising a preparation containing at least one restriction endonuclease and a preparation containing a DNA probe of claim 10.
25. The kit of claim 24, wherein the preparation containing said DNA probe contains at least one additional DNA probe.
CA000526211A 1986-10-24 1986-12-23 Telomeric dna probe Expired - Lifetime CA1295560C (en)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US92252286A 1986-10-24 1986-10-24
US922,522 1986-10-24

Publications (1)

Publication Number Publication Date
CA1295560C true CA1295560C (en) 1992-02-11

Family

ID=25447157

Family Applications (1)

Application Number Title Priority Date Filing Date
CA000526211A Expired - Lifetime CA1295560C (en) 1986-10-24 1986-12-23 Telomeric dna probe

Country Status (1)

Country Link
CA (1) CA1295560C (en)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5698686A (en) * 1994-10-20 1997-12-16 Arch Development Corporation Yeast telomerase compositions

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5698686A (en) * 1994-10-20 1997-12-16 Arch Development Corporation Yeast telomerase compositions
US5916752A (en) * 1994-10-20 1999-06-29 Arch Development Corporation Telomerase screening methods
US6387619B1 (en) 1994-10-20 2002-05-14 Arch Development Telomerase compositions and methods

Similar Documents

Publication Publication Date Title
EP0186271B1 (en) Method of characterising a test sample of genomic dna
Casanova et al. A human Y-linked DNA polymorphism and its potential for estimating genetic and evolutionary distance
US5514547A (en) Molecular genetic identification using probes that recognize polymorphic loci
EP0672182A4 (en) GENOME MATCHING SEARCH.
JP2777170B2 (en) Method for selecting chromosome-specific repetitive DNA sequences using recombinant DNA clones
Jeffreys et al. Brief introduction to human DNA fingerprinting
Fries Mapping the bovine genome: methodological aspects and strategy
Green et al. The human genome project: Prospects and implications for clinical medicine
Nijman et al. Satellite DNA polymorphisms and AFLP correlate with Bos indicus‐taurus hybridization
Myerscough et al. Linkage of rheumatoid arthritis to insulin‐dependent diabetes mellitus loci: evidence supporting a hypothesis for the existence of common autoimmune susceptibility loci
JPH06504443A (en) DNA sequence related to isolated fragile X syndrome
Jeffreys et al. Principles and recent advances in DNA fingerprinting
Skuder et al. A polymorphism in mitochondrial DNA associated with IQ?
Ning et al. Isolation of the human chromosome 22q telomere and its application to detection of cryptic chromosomal abnormalities
Eanes et al. Restriction-map variation associated with the G6PD polymorphism in natural populations of Drosophila melanogaster.
Greig et al. Molecular cytogenetics of α satellite DNA from chromosome 12: fluorescence in situ hybridization and description of DNA and array length polymorphisms
JPH03130100A (en) Dna probe for vntr gene locus
CA1295560C (en) Telomeric dna probe
EP0342717A2 (en) Polynucleotide probes
Barnes et al. SINE insertion polymorphism on the X chromosome differentiates Anopheles gambiae molecular forms
Nekrutenko et al. Representational difference analysis to distinguish cryptic species.
US5084566A (en) DNA probe which reveals a hypervariable region on human chromosone 1
Rudin et al. DNA Based Identification
Akpan et al. Genetic Relationships and Population Structure among Nigerian Ethnic Groups (Ibibio, Igbo, Hausa, Tiv and Yoruba) Based on Nine DNA Loci
US5077400A (en) DNA probe which reveals a hypervariable region on human chromosome 17

Legal Events

Date Code Title Description
MKLA Lapsed
MKLA Lapsed

Effective date: 19950812