CA1268173A

CA1268173A - Preparation of nucleoside phosphoramidite intermediates

Info

Publication number: CA1268173A
Application number: CA000473048A
Authority: CA
Inventors: Serge L. Beaucage
Original assignee: Beckman Instruments Inc
Current assignee: Beckman Coulter Inc
Priority date: 1985-01-29
Filing date: 1985-01-29
Publication date: 1990-04-24

Abstract

NOVEL PREPARATION OF
NUCLEOSIDE PHOSPHORAMIDITE
INTERMEDIATES
Abstract Nucleoside phosphoramidite intermediates are prepared by a chemical reaction represented by a formula:

X-O-?-Y + weak acid +
(I) (II) (III) (IV) In addition, nucleoside phosphoramidite inter-mediates are prepared by a chemical reaction represented by the following formula:

X-O-?-Y + weak acid solvent , intermediate (I) (II) intermediate + (III) (IV) In both of the above chemical reaction formulas, X is a phosphate protecting group; each Y is a secondary amino group; ; Z is a hydroxy protecting group; the weak acid is capable of selectively protonating only one amine of the secondary amino groups; each A is selected from a group consisting of -H, -OH, and -OZ; B is selected from a group consisting of natural and unnatural purine and pyrimidine bases: G is a heterocyclic base protecting group; each D is selected from a group consisting of -H
and -OZ; E is selected from a group consisting of -OR and -OZ, provided that (a) when both As are the same and are -H or -OZ, then E is -OH and (b) both As and E cannot all simultaneously be equal; n is a number from 0-2; r, s, and t are each 0 or 1, provided that r + s + t = 2; the solvent is capable of (a) solubilizing I, II, and III and (b) allowing the reaction to proceed; and III is present in a molar concentration at least equal to the molar concentration of reactable I.

The present invention provides a simplified methodology which is readily accessible to automation and, if a manual solid-phase deoxynucleotide (DNA) and/or ribonucleotide (RNA) synthesis is preferred, to use by a non-chemist. More particularly, the present invention encompasses a convenient method for preparing deoxy-nucleoside and ribonucleoside phosphoramidite inter-mediates in situ from corresponding natural and unnatural nucleosides.

Description

~268~73 8D-420 Canad~

NOVEL PREPARATION OF
N~CLEOSIDE PHOSP~ORAMIDITE
INTE~MEDIATES

~ackground of the Invention 1. Field of the Invention This invention relates to a method for prepar-ing nucleoside phosphoramidite intermediates.

2 Descri tion of the Prior Art . P
A recent, key innovation in oligonucleotide synthesis was the introduction of the phosphite coupling approach by Letsinger and coworkers (1-3). This approach has been adapted to the synthesis of deoxyoligonucleo-tides (4-8), oligoribonucleotides (9-12), and nucleic acid analogs (13-15). Generally the approach involves the reaction of a suitably protected nucleoside, a bi-functional phosphitylating agent such as methoxydichloro-phosphine, and a second protected nucleoside. Mild oxi-dation using iodine in tetrahydrofuran, lutidine and water generates the natural internucleotide bond. By varying the oxidation procedure, phosphorus analogs suc;
as selenophosphates (14), imidophosphates (14) and thio-phosphates (14, 15) can be generated. A serious limita-tion of this methodoiogy, however, has been the insta-bility of the reactive intermediates (nucleoside phospho-monochloridites or monotetrazolides) towards hydrolysis and air oxidation. This problem has been circumvented by either preparing the reactive species immediately prior to use or storing the active phosphite as a precipitate in hexanes at -20C.

The synthesis of a new class of nucleoside phosphites has been proposed in attempt to solve this problem (16). These intermediates have the following formula (16, 17):

i268173 8D-420 Canada [ I B
y wherein X is a phosphate protecting group; Y is a certain type of secondary amino group; Z is a hydroxy protec~ing group; A is selected from a group consisting of -H, -OH, and -OZ; and B is selected from a group consisting of purine and pyrimidine bases.

More particularly, Y is a saturated secondary amino group, i.e., one in which no double bond is present in the secondary amino radical. More particularly, Y is NRlR2, wherein Rl and R2 taken separately each represents alkyl, aralkyl, cycloal~yl and cycloalkylalkyl containing up to 10 carbon atoms; Rl and R2 when taken together form an alkylene chain containing up to 5 carbon atoms in the principal chain and a total of up to 10 carbon atoms with ~oth terminal valence bonds of said chain beinq attached to the nitrogen atom to which Rl and R2 are attached; and Rl and R2 when taken together with the nitrogen atom to which they are attached form a saturated nitrogen hetero-cycle including at least one additional heteroatom from the group consisting of nitrogen, oxygen and sulfur.

Amines from which the group NRlR2 can be de-rived include a wide variety of saturated secondary amines such as dimethylamine, diethylamine, diisopropyl-amine, dibutylamine, methylpropylamine, methylhexylamine, methylcyclopropylamine, ethylcyclohexylamine, methylben-zylamine, methycyclohexylmethylamine, butylcyclohexyl-amine, morpholine, thiomorpholine, pyrrolidine, piperi-dine, 2,6-dimethylpiperidine, piperazine and similar saturated monocyclic nitrogen heterocycles.

8~-420 Canada _3_ The ribonucleoside and deoxynucleoside bases represented by ~ in the above formula are well known and include purine derivatives, e.g., adenine, hypoxanthine and guanine, and pyrimidine derivatives, e.g. cytosine, uracil and thymine.

The blocking groups represented by Z in the above formula include trityl, methoxytrityl, dimethoxy-trityl, dialkylphosphite, pivalyl, isobutyloxycarbonyl, t-butyl dimethylsilyl, and similar such blocking groups.

These phosphate protecting groups represented by X include, but are not limited to, a wide variety of hydrocarbyl radicals including alkyl, alkenyl, aryl, aralkyl and cycloalkyl containing up to ahout 10 carbon atoms. Representative radicals are methyl, butyl, hexyl, phenethyl, benzyl, cyclohexyl, phenyl, naphthyl, allyl and cyclobutyl. Of these the preferred are lower alkyl, especially methyl and ethyl.

These compounds were reported to be not as reactive and not as unstable as prior art compounds. It was noted ~hat these compounds do react readily ~ith unblocked 3'-OH or 5'-OH of nucleosides under normal conditions. In addition, these phosphoramidites were said to be stable under normal laboratory conditions to hydrolysis and air oxidation, and to be storable as dry, stable powders.

Recently, the stability of these nucleoside phosphoramidites in acetonitrile solutions has been ques-tioned (18, 19). Additionally, it has been pointed out that access to these nucleoside phosphoramidites is dif-ficult because their isolation is uneasy and time consum-ing (20, 21). Furthermore, their prohibitive expense contributes to restricting their use to mainly skilled personnel.

~ 8n-420 Canada In order to alleviate these drawbacks, a few approaches to deoxynucleotide (DNA) solid-state synthesis using phosphite chemistry has been proposed ~20, 21).
T~e key features of these procedures involve the phos-phitylation of the solid support with bifunctional phos-phitylating agents such as methoxydichlorophosphine or bis-(tetrazolyl)methoxyphosphine. However, these ap-proaches to DNA synthesis appear prone to reproducibility problems because a minute amount of moisture could hydro-lyze the very reactive phosphorous moiety immobilized on the solid support either prior to or during the chain elongation step.

Other problems include a problematic aqueous work-up required to remove hygroscopic amine hydrochlor-ides and destroy unwanted phosphitylations of the hetero-cyclic rings generated during the preparation of deoxy-nucleoside phosphoramidites (16); a difficult isolation procedure consisting of the precipitation of toluene or ethyl acetate solutions of the above deoxynucleoside phosphoramidites in cold hexanes (-70 C.) (16); stabil-ity problems created by extended storage of these deoxy-nucleoside phosphoramidites in acetonitrile solution; and the use of pyrophoric and/or reactive phosphitylating agents such as chloro-(N,N-dimethylamino)methoxyphosphine (16), chloro-~N,N-diisopropylamino)methoxyphosphine (1~), methoxydichlorophosphine (20, 21), bis-(tetrazolyl)meth-~xyphosphine (21) which are difficult to handle and ex-tremely sensitive to atmosphere moisture.

Accordingly, there exists a need for a simpli-fied methodology.

~ .

`` 1268~73 8D-420 Canada Summary of the Invention In accordance with the present invention, there is provided a simplified methodology which is readily accessible to automation and, if a manual solid-phase deoxynucleotide (DNA) and/or ribonucleotide (RNA) synthe-sis is preferred, to use by a non-chemist. More particu-larly, the present invention encompasses a convenient method for preparing deoxynucleoside and ribonucleoside phosphoramidite intermediates in situ from corresponding natural and unnatural nucleosides. The nucleoside phos-phoramidite intermediates prepared in this manner can then be activated with a suitable agent and the activated nucleoside phosphoramidite intermediates can be used in excess during a coupling reaction with a suitably pro-tected nucleoside, thus ensuring a favorable competition against trace amounts of moisture from both the solvent and the surrounding environment.
.
In one embodiment of the present invention~ the nucleoside phosphoramidite intermediate is prepared by a chemical reaction represented by a formula:
¦ X-O-I-Y + wea~ acid +
(I) Y (II) A~

(III) ~D-420 Canada lZ68173 ~S~-Z)r ~ O ~ B-Gn (31-D)s. ~ ~ Y OP-OX

~2'-D)t L
(IV) In another embodiment of the present invention, the nucleoside phosphoramidite intermediate is prepared by a chemical reaction represented by the following formula:

X-O-~-Y + weak acid solvent , intermediate Y (I) (II) in~ermediate + 3~ solvene , (III) (~ ~Z)r ~ ~ ~Gn (2'-D)~ ~ OP-OX
y (IV) I In both of the above chemiczl reaction formulas, X is a phosphate protecting group; each Y is a secondary amino group; Z is a hydroxy protecting group; the weak acid is capable of selectively protonating only one amine of the `
1, 12~;8~73 8~-420 Canada secondary amino groups; each A is selected from a group consisting of -H~ -OH, and -02; B is selected from a group consisting of natural and unnatural purine and pyrimidine bases; G is a heterocyclic base protecting group; each D is selected from a group consisting of -H
and -oz; E is selected from a group consisting of -OH and -OZ, provided that (a) when both As are the same and are -H or -OZ, then E is -OH and (b) both As and E cannot all simultaneously be equal; n is a number from 0-2; r, s, and t are each O or 1, provided that r + s + t = 2; the solvent is capable of (a) solubilizing I, II, and III and (b) allowing the reaction to proceed; and III is present in a molar concentration at least equal to the molar concentration of reactable I (i.e., some of I can be destroyed by moisture or other contaminants in the reaction medium and the portion so lost is not included in this ratio).
" ~
Also within the scope of the present invention is a novel compound having a formula X-O-P ~ I )2 wherein X is methyl.

Description of the Preferred Embodiments ~ X can be virtually any phosphate protecting ! group. Many phosphate protecting groups are known to those skilled in the art (31-39). Preferably, X is selected from a group consisting of alkyl, haloalkyl, I cyanoalkyl, alkyldiarylsilylalkyl, trialkylsilylalkyl, i arylsulphonylalkyl, alkylthioalkyl, arylthioalkyl, alkenyl, haloalkenyl, aryl, haloaryl, aralkyl, halo-aralkyl, cycloalkyl, halocycloalkyl, branched alkyl, and branched haloalkyl containing up to 10 carbon atoms.
More preferably, X is methyl.

8D-420 Canada ~ ach Y is preferably Rl-N-R2, wherein each and R2, when taken separately, represents alkyl, halo-alkyl, alkenyl, aralkyl, haloaralkyl, cycloalkyl, halo-cycloalkyl, cycloalkylalkyl, halocycloalkylalkyl, cyclo-alkenylyl, halocycloalkenylyl containing up to 10 carbon atoms, wherein each halogen substitution is at least three carbon atoms removed from the nitrogen atom and each unsaturation is at least C2-C3 bonds removed from the nitrogen atom (i.e., the halogen substitution and/or unsaturation should not significantly decrease the basic-ity of the amino functionality); Rl and R2, when taken together, form a chain selected from a group consisting of alkylene, haloalkylene, alkenylene, and haloalkenylene chains containing up to 5 carbon atoms in the principal chain and a total of up to 10 carbon atoms with both terminal valence bonds of said chain being attached to the nitrogen atom to which Rl and R2 are attached and wherein each halogen substitution atom is at least three carbon atoms removed from the nitrogen atom and each unsaturation is at least C2-C3 bonds removed from the nitrogen atom; Rl and R2, when taken together with the nitrogen atom to which they are attached, form a satur-ated nitrogen heterocycle including at least one addi-tional heteroatom selected from a group consisting of N, O, and S. More preferably, each Y is selected from a group consisting of dimethylamine, diethylamine, diiso-propylamine, dibutylamine, methylpropylam ne, methyl-hexylamine, methylcyclopropylamine, ethylcyclohexylamine, ~ethylbenzylamine, methycyclohexylmethylamine, butylcy-clohexylamine, morpholine, thiomorpholine, pyrrolidine, piperidine, and 2,6-dimethylpiperidine. Optimally, Y is pyrrolidine.

Z can be virtually any hydroxy protecting group. Many hydroxy protecting groups are known to those ~26E~173 8D-4~0 Canada skilled in the art ~31~33, 38-46). Preferably, Z is selected from a group consisting of pixyl groups, (e.g., 9-arylxanthen-9-yl~, triarylmethyl aroups (e.g., trityl, methoxytrityl, trimethoxytrityl, di-p-anisylphenylmethyl, p-fluorophenyl-l-naphthylphenylmethyl, p-anisyl-l-maphthylphenylmethyl, di-o-anisyl-l-naphthylmethyl, di-o-anisylphenylmethyl, and p-tolyldiphenylmethyl), dialkyl phosphite groups, alkylcarbonyl groups (e.g., acetyl, pivaloyl), arylcarbonyl groups (e.g., benzoyl), trialkyl-silyalkyloxycarbonyl groups, aryloxycarbonyl groups, alkoxycarbonyl groups (e.g., isobutyloxycarbonyl), aryl-sulphonylalkoxycarbonyl groups, arylthioalkyloxycarbonyl groups, aralkyl groups, alkyl groups, alkenyl groups, trialkylsilyl groups, ketal functions (e.g., tetrahydro-pyranyl, 4-methoxytetrahydropyran-4-yl), and acetal functions.
.

Various nucleosides capable of being employed in the instant invention include those set forth in Table I.

~2~8i73 , ` 8D-420 Canada TAsLr I
~ ~ \,~B~Gn . . _ . .
Nucleoside 2 _ 3~-A 5~-E

3 -H -OH -OZ

4 -OH -H -OH

5 -OH -H -02

6 -H -OZ -OH

7 -H -OZ -08

8 -oz -H -OH

9 -OZ -H -OZ

10 -OH -OH -OZ
; 11 -OH -OZ -OH

lS -OZ -OZ -OH

~:~ Preferably, when 2'-A = 3'-A, 2'-A and 3'-A are not -0~. More preferably, the nucleoside has the formula represented by nucleosides 3, 5, 12, and 14 of Table I.
-When the nucleoside contains two -OZ substitu-ents, it is essential that one Z protecting groups be capable of deprotection without deprotecting the other.
This can be accomplished by any technique known to those skilled in the art. For example, if one Z is trityl and the second Z is selected from a group consisting of ben-zoyl, trialkylsilyl, tetrahydropyranyl, or other ketal or acetal functions, the trityl can be removed by a mild ; ~ acid or Lewis acid ~e.g., zinc bromide) without removing : ::
. :: ' ~ :
. . .
, .

8D-420 Canada ~26~73 the other protecting group. Similarly, if one protecting group is trityl and the other is benzoyl, the benzoyl group can be removed under basic conditions without removing the trityl group. In like fashion, if one protecting group is trityl and the other is trialkyl-silyl, the trialkylsilyl group can be removed by treat-ment with fluoride ions without removing the trityl group.

~ can be virtually any natural or unnatural ribonucleoside or deoxynucleoside base. Such bases in- -clude, but are not limited to, purine derivatives, e.g., adenine, hypoxanthine and guanine, pyrimidine deriva-tives, e.g., cytosine, uracil, and thymine, as well as homologues and analogues thereof.

G can be virtually any heterocyclic base protecting group. Many heterocyclic base protecting groups are known to those skilled in the art (23-33).
Preferably, G is selected from a group consisting of amino, imide, and amide protecting groups of the corresponding heterocyclic base. Such amino, imide, and amide protecting groups include, but are not limited to triarymethyl, trialkylsilylalkyl, arylthioalkyl, arylalkyl, cyanoalkyl, phthaloyl, aryl, aryloxycarbonyl, alkoxycarbonyl, arylcarbonyl, alkylcarbonyl, and N-dialkylaminomethylene.

The number n is selected such that one or more of the reactive functionalities on the heterocyclic ring are protected. An illustration of this point is set forth in Table II.

- 8D-420 Canada 1268173 TAsLE II

Hetero- Maximum Preferred cyclic Reactive Range of Range of Rin~ Functionalities n n thymine 1 0-1 0 cystosine 1 0-~ 1 adenine 1 0-1 1 guanine 2 0-2 1-2 hypoxanthine 1 0-1 ` 0 uracil 1 0-1 Preferably, r is 1.

Preferably, the weak acid has a pK at about 25 C. in ~2 of about 7.5 to about 11, more preferably from about 8 to about 10.5, even more preferably from about 8 to about 9, and optimally about 8.2 to about 8.5. In addition, the weak acid is preferably selected from a group consisting of 1,2,4-triazole; 1,2,3-triazole 4,~-dichloroimidazole; 4-nitroimidazole; 3-chlorotriazole benzotriazole and mixtures thereof. More preferably, the weak acid is selected from said group consisting of 4,5-dichloroimidazole, benzotriazole, and mixtures there-of. Optimally, the weak acid is 4,5-dichloroimidazole.

Preferably, the solvent is selected from a group consisting of tetramethyl urea, N,N-dimethylace-tamide, l-methyl-2-pyrrolidinone, N,N-dimethylformamide (DMF), dioxane, tetrahydrofuran (THF), ethyl acetate, chloroform, 1,3-dimethyl-2-imidazolidinone, N,N'-dimethyl-N,N'-propyleneureà, homologues and analogues thereof, and mixtures thereof. More preferably, the solvent is selected from a group consisting of tetra-methyl urea, 1,3-dimethyl-2-imidazolidinone, 1-methyl-2-pyrrolidinone, and mixtures thereof. In addition, it is ~D-420 Canada also preferred that the solvent be anhydrous ~i.e., contain less than 0.06% water).

The chemical reaction can proceed at any con-venient temperature. This temperature can range from the freezing point to the boiling point of the reaction mix-ture. Preferably, the chemical reaction takes place at about room temperature.

Any convenient time can be employed in conduct-ing the chemical reaction. For example, the reaction time can be from a few seconds to over a day. However, it is preferred to conclude the reaction as soon as pos-sible (in a time span typically from about 5 to about 15 minutes, and more preferably about 10 minutes).

Preferably, III is present in a molar concen-tration greater than reactable I. More preferably, the molar ratio of III:reactable I is 1.2:1.

The relative molar concentration of I and II is not critical. However, it is preferred that the molar concentration of II be at least twice the molar concen-tration of I. More preferably the molar concentration of II is from about 2 to about 5 times the molar con-centration of I. Optimally, the molar concentration of II is approximately quadruple that of I.
.

The reactants can be added in any convenient sequence. However, with respect to the one-step rotation embodiment of the present invention it is preferred to add I to a solution containing III. This preferred se-quence appears to generate less side products during the course of the re$action.

` ~268~73 8D-420 Canada The nucleoside can be phosphorylated at either the 2', 3' or 5' position and is preferably phosphory-lated at the 3' or 5' position. More preferably, the nucleoside is phosphorylated at the 3' position.

The thus formed nucleoside phosphoramidite intermediates can be activated with a suitable agent, for example, l~-tetrazole and an excess of the activated nucleoside phosphoramidite intermediate can be used dur-ing a coupling reaction with a suitably protected nucle-oside in either any liquid or solid phase methodology known to those skilled in the art (16, 22). This pro-cedure thus ensures a favorable competition against trace amounts of moisture from the solvent as well as from the surrounding environment.

It is preferred that the eoupling reaction be performed in a solid phase procedure.

The following examples are provided for the purpose of further illustration only and are not intended to be limitations on the disclosed invention.

Exam~le 1 Preparation of bis-(~,N-dimethylamino) methoxyphosphine To 0.1 mole of methoxydichlorophosphine cooled at -15 C. in a 100 ml round bottom flask, was added under a nitrogen atmosphere dropwise over a period of about 30 minutes N,N-dimethylaminotrimethylsilane (0.21 mole). The reaction mixture was then removed from the cold bath and allowed to stir at ambient temperature for about 1 hour, The chlorotrimethylsilane generated during the course of the reaction was removed under reduced pressure (water aspirator). The material left distilled at 38-40 C. at 13 mm Hg. The cloudy liquid was filtered ` 1268173 8D-420 Canada through a medium porosity glass sintered funnel. The yield was 68%. Physical characteristics were identified as follows:

1H NMR (CDC13) = 3.5 ppm (d, -OCH3, 3H) Jp_H = 13 Hz 2.7 ppm (d, -N(CH3)2, 12H) Jp_H 9 Hz The spectrum was recorded with respect to external TMS
reference.

31p NMR (CDC13): -138.18 ppm with respect to external 85%
H3PO4 reference.

The density of the clear liquid at 25 C. was found to be 0.936 g/ml.

Example 2 -Preparation of bis(pyrrolidino)methoxyphosphine To 0.1 mole of methoxydichlorophosphine cooled at -15 C. in a 100 ml round bottom flask, was added under a nitrogen atmosphere, dropwise over a period of about 30 minutes N-trimethylsilylpyrrolidine (0.21 mole). The reaction mixture was then removed from the cold bath and allowed to stir at ambient temperature for about 1 hour. The chlorotrimethylsilane generated during the course of the reaction was removed under reduced pressure (water aspirator). The material left distilled "
at 66-68 C. at 0.16 mm Hg. The cloudy liquid was fil-tered through a medium porosity glass sintered funnel.
The yield was 82~. Physical characteristics were identi-fied as follows:

H NMR (CDC13): 3.4 ppm (d, OCH3) Jp_H = 13 Hz 3.1 ppm (m, -N-CH2) 1.8 ppm (m, -CH2-CH2-) % D-4 20 Canada The spectrum was recorded with respect to external TMS
reference.

31p NMR (CDC13): -134.01 ppm with respect to 85~ H3PO4 reference.

The density of the clear liquid at 25 C. was found to be 1.037 g/ml.

Example 3 Preparation of bis-(N,N-diisopropyl) methoxyphosphine To methoxydichlorophosphine (159, 0.11 mole) in 100 ml of anhydrous ethyl ether was added, dropwise at -15 C. under a nitrogen atmosphere over a period of about 30 minutes, N,N-diisopropylamine (44.59, 0.44 mole) in 100 ml of anhydrous ethyl ether. The suspension was then removed from the cold bath and allowed to stir at ambient temperature for about 1 hour. The amine hydro-chloride was then filtered and washed with 100 ml of anhydrous ether. Excess ether from the filtrate was distilled off at atmospheric pressure. The material left was freed from residual amine hydrochloride by filtration and was then distilled under high vacuum to afford a fraction boiling at 59~61 C. at 0.2 mm Hg. The yield was 79%. Physical characteristics were identifed as follows:

H NMR (CDC13): 3.3 ppm (d, -OCH3) Jp_H = 14 Hz 3.4 ppm (m, -N(CH)2) 1.0 ppm (d, -CH(CH3)2) 31p NMR (CDC13): -131.8 ppm with respect to external 85~ H3PO4 reference.

i268~73 8D-420 Canada The density of the clear liquid at 26 C. was found to be 0.911 g/ml.
Exa~ple 4 .

N -Cl ~/~
\ N / Cl H +
II

V \l CH30-P-(Y)2 ~ ~ solvent OH

~ I .
I a, Y = N
III, B = 1-Thyminyl dmt = di-p-anisylphenylmethyl ~681~3 8~-420 Canada -lB-dmtO~ + ~mtO ~ B

1 o C~3o-~-y -OCH3 dmtoJ \ o ~ B
IV a V

The bis-(pyrrolidino)methoxyphosphine (Ia; 0.25 mmol) prepared in Example 2 was syringed into a solution of the 5'-protected deoxynucleoside (III; 0.28 mmol) and 4,5-dichloroimidazole (II; 1.00 mmol) in 0.5 ml of dry 1-methyl-2-pyrrolidinone, 31p NMR displayed a nearly quantitative yield of the nucleoside phosphorimidite IVa (-143.7, -143.4 ppm; 91.2% yield) along with a small amount of the symmetrical dinucleoside monophosphite (-139.7 ppm; 8.8~ byproduct).

Example 5 Oligomer Preparation In order to test the new synthetic methology toward polynucleotides synthesis, the following experi-ment was undertaken. To a solution of the 5'-protected nucleoside Ia (153 mg, 0.28 mmol) and 4,5-dichloroimid-azole (II, 136 mg, 1.00 mmol) in dry 1-methyl-2-pyrroli-dinone ~0.5 ml) was added under a nitrogen atmosphere at ambient temperature, 50 ~1 of bis-(pyrrolidino) methoxy-phosphine, (Ia 0.25 mmol). ~fter about 10 minutes, 70 ~1 (25 mmol) of the stock solution was syringed into a 4 ml vial containing 30 mg of solid support derivatized with 1 ~mole of deoxythymidine suspended in 250 ~1 of a ~26817:3 8D-420 Canada 0.5M acetonitrile solution of lH-tetrazole. The reaction mixture was shaken for about 5 minutes at ambient temper-ature, quenched with 1.5 ml of a solution of THF: 2,6-Lutidine: H20(2:1:2) and oxidized according to the usual procedure. After the standard deprotection, the reaction products were analyzed by high performance liquid chroma-tography (HPLC). A high yield of d(TpT) (>95%) and some unreacted deoxythymidine (<5%) were observed. d!CpT), d~ApT) and d(GpT) were also produced in yields exceeding 95%. These products were rigorously identical to authen-tic samples commercially available.

Example 6 According to the procedure set forth in Example 5 the following oligonucleotide has been successfully prepared:
d(GCATCGCCAGTCACTATGGCGT) I
The overall yield was about 30%, implyin~ that an average yield of 94.4~ was obtained at each step (as measured spectrometrically from the dimethoxytrityl cation using an extinction of 7 x 104 at 498 nm).

The synthetic approach disclosed herein, using a selective activation of compounds of formula I for the preparation of nucleoside phosphoramidites in situ is an improved route for automated solid-phase DNA and RNA
synthesis. Some of the advantages of this methodology over the existing ones are as follows:

The elimination of the aqueous work-up required to remove hygroscopic amine hydrochlorides and destroy unwanted phosphitylations of the heterocyclic rings gen-erated during preparation of deoxynucleoside phosphor-amidites. (16).

126E~7:~
8D-420 Canada Elimination of difficult isolation procedure consisting in the precipitation of toluene or ethyl ace-tate solutions of the deoxynucleoside phosphoramidites in hexanes (-70 C.) (16).

Elimination of stability problems created by extended standing of the deoxynucleoside phosphoramidites in acetonitrile solutions because the deoxynucleoside phosphoramidite intermediates made in situ will generally be consumed within a relatively short period of time.

The elimination of pyrrophoric and/or reactive phosphitylating agents such as chloro-(N,N-dimethyl-amino)methoxyphosphine (16), chloro(N,N-diisopropyl-amino)methoxyphosphine (18), methoxydichlorophosphine (20, 21), bis-(tetrazolyl)methoxyphosphine (21), which are difficult to handle and extremely sensitive to atmos-pheric moisture.

Compounds of formula I are easily prepared andsafe to handle, because they are extremely stable toward atmospheric moisture relative to the corresponding chlor-ophosphines.

Accordingly, the use of stable protected nucle-osides which are transformed into nucleoside phosphor-amidite intermediates in high yield via a selective activation of compounds of formula I, combined with a high coupling yield through efficient activation of the in situ generated nucleoside phosphoramidite intermedi- ~ -ates by an appropriate activating agent makes the meth-ology of the present invention accessible to automation and, if a manual solid-phase or liquid phase D~A and/or ~NA synthesis is preferred, to the non-chemist.

,,. ~.... .

~268~7~
8D-420 Canada Based upon this disclosure, many other modifi-cations and rami~ications will naturally suggest them-selves to those skilled in the art. These are intended to be comprehended as within the scope of this invention.

lZ68~73 8~-420 Can~da -22-References 1. Letsinyer et al., J. Am Chem. Soc., 97, 3278-3279 (1975).
2. Ietsinger et al., J. Am. Chem. Soc, 98, 3655-3661 (1976).
3. Letsinger et al. Proc. Int. Conf. Transfer RNA, Poznan, Poland, October 1976, pp. 145-155.
4. Matteucci et al., Tetrahedron Lett., 21, 719-722 (1980).
5. Finnan et al., Nucl. Acids Res. Symposium Series No.
7, 133-145 (1980).
6. Caruthers, Proc. of IUPAC International Symposium on Macromolecules, Florence, Italy, September 1980, Pergamon press, Oxford, England.
7. Caruthers et aL., Nucl. Acids Res. Symposium Series No. 7, 215,223 (1980).
8. Matteucci et al., J. Am. Chem. Soc., 103, 3185-3191 (1981).
9. Daub et al., J. Am. Chem. Soc. 99, 3526-3528 (1977).
10. Ogilvie et al., Can. J. Chem. 58, 1389-1397 (1980)-See also ogilvie et al., Can. J. Chem., 58, 2686-2693 (1980).

11. Ogilvie et al., Nucl. Acids Res. Symposium Series No. 7, 147-150 (1980).

12. Ogilvie et al., Tetrahedron Lett., 21, 4159-4162 (1980).

13. Melnick et al., J. Org. Chem., 45, 2715-2716 (1980).

14. Ogilvie, Tetrahedron Lett., 21, 4145-4848 (1980);
ibid., 4149-4152 (1980); 4153-4154 (1980).

15. Burgers et al., Tetrahedron Lett., 3835-3838 (1978).

16. Beaucage et al., Tetrahedron Lett., 22, 1859-1862 (1981).

17. U.S. Patent 4,415,732

18. McBride et al., Tetrahedron Lett., 24, 245-2486 (1983) ! 12 ~81 73 8D--420 Canada

19. Adams et al., J. Am. Chem. Soc., 1 , 661-663 (1983).

20. Jayaraman et al., Tetrahedron ~ett_, 23, 5377-5380 (1982).

21. Cao et al., Tetrahedron Lett., 24, 1019-1020 (1983).

22. Caruthers et al., Genetic Engineerin~, eds. Setlow et al., Phenum Press, N.Y. (1982) pp. 1-17.

23. Sekine et al., J. Org. Chem., 47, 571-573 (1982).

24. Kume et al., Tetrahedron Lett., 23, 4365-4368 (1982).

25. Trichtinger et al., Tetrahedron Lett., 24, 711-714 (1983).

26. Gaffney et al., Tetrahedron Lett., 23, 2257-2260 (1982).

27. Hata et al., Bull. Chem. Soc. Japan, 55, 2949-2955 ~1982).

28. Reese et al., _etrahedron Lett., 22, 4755-4758 (1981).

29. Rappoport et al., ~. Am. Chem. Soc., 104, 5702-5708 (1982).

30. Sekine et al., Tetrahedron Lett., _ , 5287-5290 (1982).

31. Reese, Tetrahedron, 34, 3143-3179 (1978).

32. Othsuka et al., Nucl. Acids Res., 10, 6553-6570 -(1982).

33. Amarnath et al., Chem. Rev., 77, 183-217 (1977).

34. Josephson et al., Chem. Scripta, 18, 184-188 (1981).

35. Charubala et al., Tetrahedron Lett., 23, 4789-4792 (1982).

36. Reese et al., Tetrahedron Lett., 24, 951-954 (1983).

37. Kraszwoski et al., Nucl. Acids Res. Symposium Series No. 9, 135-139 (1981).

38. Ikehara et al., Adv. Carb. Chem. Biochem., 36, 135-213 (1979).

39. Kossel et al., Fortschr. Chem. Org. Natur., 32, 297-508 (1975).

~26 !3~7~
8D-420 Canada

40. Reese et al., J.C.S. Chem. Comm., 987-988 ~1979).

41. Hayakawa et al., Tetrahedron Lett., 24 1165-1168 (lg83).

42. Takaku et al., Chem. Lett., 189-192 (1982).

43. Chattopadhyaya et al., J.C.S. Chem. Comm., 639 (1978).

44. Balgobin et al., Tetrahedron Lett., 3667 (1981).

45. Josephsor et al., Tetrahedron Lett., 4537 (1981).

46. Fisher et al,, Nucl. Acids Res., 11, 1589-1599 ~1983).

Claims

THE EMBODIMENTS OF THE INVENTION IN WHICH AN EXCLUSIVE
PROPERTY OR PRIVILEGE IS CLAIMED ARE DEFINED AS FOLLOWS:
1. A process for preparing a compound of formula IV
(IV) which process is of the type comprising reacting a phosphitylating agent with a compound of formula III

(III) in the presence of a solvent, the improvement comprising reacting a phosphitylating agent of formula I

X-O-?-Y (I) with said compound of formula III in the presence of a weak acid (II) and a solvent, said solvent being capable of (a) solubilizing I, II, and III and (b) allowing said reaction to proceed;
wherein:
X is a phosphate protecting group;

Claim 1 cont'd...

each Y is a secondary amino group having a formula R1-?-R2;
each R1 and R2, when taken separately, represents alkyl haloalkyl, alkenyl, haloalkenyl, aralkyl, haloaralkyl, cycloalkyl, halocycloalkyl, cycloalkylalkyl, halocycloalkylalkyl, cycloalkenylyl, halocycloalkenylyl containing up to 10 carbon atoms, wherein each halogen substitution is at least three carbon atoms removed from the -nitrogen atom and each unsaturation is at least C2-C3 bonds removed from the nitrogen atom;
R1 and R2, when taken together, form a chain selected from a group consisting of alkylene, haloalkylene, alkenylene, and haloalkenylene chains containing up to 5 carbon atoms in the principal chain and a total of up to 10 carbon atoms with both terminal valence bonds of said chain being attached to said N atom to which R1 and R2 are attached and wherein each halogen substitution atom is at least three carbon atoms removed from the nitrogen atom and each unsaturation is at least C2-C3 bonds removed from the nitrogen atom;
R1 and R2, when taken together with said N atom to which they are attached, form a saturated nitrogen heterocycle including at least one addition heteroatom selected from a group consisting of N, O, and S;
Z is a hydroxy protecting group;
said weak acid is capable of selectively protonating only one amine of said secondary amino groups;
each A is selected from a group consisting of -H, -OH, and -OZ;

B is selected from a group consisting of natural and unnatural purine and pyrimidine bases;
G is a heterocyclic base protecting group;
each D is selected from a group consisting of -H and -OZ;
E is selected from a group consisting of -OH
and -OZ, provided that when (a) both As are the same and are -OH, then E is -OZ;
n is number from 0-2;
r, 8, and t are each O or 1, provided that r + s + t = 2: and III is present in a molar concentration at least equal to the molar concentration of reactable I.
2. The process reaction of claim 1 wherein III is present in a molar concentration greater than reactable I; and II is present in a molar concentration at least twice the molar concentration of I.
3. The process of claim 2 wherein II is present in a molar concentration from about 2 to about 5 times the molar concentration of I.
4. The process of claim 3 wherein the molar ratio of III:reactable I is about 1.2:1 and the molar ratio of II:I is about 4:1.
5. The process of claim 1 wherein said weak acid has a pK at about 25° C. in H2O of about 7.5 to about 11.
6. The process of claim 5 wherein said pK of said weak acid is about 8 to about 10.5.
7. The process of claim 6 wherein said pK of said weak acid is about 8 to about 9.
8. The process of claim 7 wherein said pK of said weak acid is about 8.2 to about 8.5.
9. The process of claim 1 wherein said weak acid has a pK at 25°C. in H2O of about 7.5 to about 11;
said solvent is selected from a group consisting of tetramethyl urea, N,N-dimethylacetamide, 1-methyl-2-pyrrolidinone, N,N-dimethylformamide, dioxane, tetrahydrofuran, ethyl acetate, chloroform, 1,3-dimethyl-2-imidazolidinone, N,N'-dimethyl-N,N'-propylene urea, homologues and analogues thereof, and mixtures thereof;
III is present in a molar concentration greater than reactable I; and II is present in a molar concentration at least twice the molar concentration of I.
10. The process of claim 9 wherein each Y is selected from a group consisting of dimethylamine, diethylamine, diisopropylamine, dibutylamine, methylpropylamine, methylhexylamine, methylcyclopropylamine, ethylcyclohexylamine, methylbenzylamine, methycyclohexylmethylamine butylcyclohexylamine, morpholine, thiomorpholine, pyrolidine, piperidine, and 2,6-dimethylpiperidine;

said pk of said acid is about 8 to about 10.5:
and II is present in a molar concentration from about 2 to about 5 times the molar concentration of I.
11. The process of claim 10 wherein said pK of said weak acid is about 8 to about 9.
12. The process of claim 11 wherein said pK of said weak acid is about 8.2 to about 8.5.
13. The process of claim 12 wherein said weak acid is selected from a group consisting of 1,2,4-triazole: 1,2,3-triazole; 4,5-dichloroimidazole; 4-nitroimidazole; 3-chlorotriazole; benzotriazole; and mixtures thereof.
14. The process of claim 13 wherein said weak acid is selected from said group consiting of 4,5-dichloroimidazole, benzotriazole, and mixtures thereof.
15. The process of claim 6 wherein said weak acid is 4,5-dichloroimidazole;
said solvent is selected from a group consisting of tetramethyl urea, 1,3-dimethyl-2-imidazolidinone, l-methyl-2-pyrrolidinone, and mixtures thereof;
the molar ratio of III: reactable I is about 1.2:1 and the molar ratio of II:I is about 4:1.
16. A process comprising:
(a) reacting a phosphitylating agent of formula (I) X-O-?-Y (I) (claim 16 continued) with a weak acid (II) in the presence of a solvent to form an intermediate: and (b) reacting said intermediate with a compound of formula III

(III) in the presence of said solvent to form a compound of formula IV
(IV) wherein:

(claim 16 continued) X is a phosphate protecting group;
each Y is a secondary amino group having a formula R1-NR2;
each R1 and R2, when taken separately, represents alkyl, haloalkyl, alkenyl, haloalkenyl, aralkyl, haloaralkyl, cycloalkyl, halocycloalkyl, cycloalkylalkyl, halocycloalkylalkyl, cycloalkenyl, halocycloalkenyl containing up to 10 carbon atoms, wherein each halogen substitution is at least three carbon atoms removed from the nitrogen atom and each unsaturation is at least C2-C3 bonds removed from the nitrogen atom;
R1 and R2, when taken together, form a chain selected from a group consisting of alkylene, haloalkylene, alkenylene, and haloalkenylene chains containing up to S carbon atoms in the principal chain and a total of up to 10 carbon atoms with both terminal valence bonds of said chain being attached to said N atom to which R1 and R2 are attached and wherein each halogen substitution atom is at least three carbon atoms removed from the nitrogen atom and each unsaturation is at least C2-C3 bonds removed from the nitrogen atom;
R1 and R2, when taken together with said N atom to which they are attached, form a saturated nitrogen heterocycle including at least one additional heteroatom selected from a group consisting of N, O, and S;
Z is a hydroxy protecting group;
said weak acid is capable of selectively protonating (claim 16 continued) only one amine of said secondary amino groups;
each A is selected from a group consisting of -H, -OH, and -OZ;
B is selected from a group consisting of natural and unnatural purine and pyrimidine bases;
G is a heterocyclic base protecting group;
each D is selected from a group consisting of -H and -OZ;
E is selected from a group consisting of -OH
and -OZ, provided that when (a) both As are the same and are -H or -OZ, then E is -OH and (b) both As are the same and are -OH, then E is -OZ;
n is a number from 0-2:
r, s, and t are each 0 or 1, provided that r + s + t = 2;
said solvent is capable of (a) solubilizing I, II, and III and (b) allowing said reaction of proceed;
and III is present in a molar concentration at least equal to the molar concentration of reactable I.
17. The process of claim 16 wherein III is present in a molar concentration greater than reactable I; and II is present in a molar concentration at least twice the molar concentration of I.
18. The process of claim 17 wherein II is present in a molar concentration from about 2 to about 5 times the molar concentration of I.
19. The process of claim 18 wherein the molar ratio of III: reactable I is about 1.2:1 and the molar ratio of II:I is about 4:1.
20. The process of claim 16 wherein said weak acid has a pK at about 25° C. in H2O of about 7.5 to about 11.
21. The process of claim 20 wherein said weak acid has said pK of about 8 to about 10.5.
22. The process of claim 21 wherein said weak acid has said pK of about 8 to about 9.
23. The process of claim 22 wherein said weak acid has said pK of about 8.2 to about 8.5
24. The process of claim 10 wherein said weak acid has a pK at 25°C. in H2O of about 7.5 to about 11:
said solvent is selected from a group consisting of tetramethyl urea, N,N-dimethylacetamide, 1-methyl-2-pyrrolidinone, N,N-dimethylformamide, dioxane, tetrahydrofuran, ethyl acetate, chloroform, 1,3-dimethyl-2-imidazolidinone, N,N'-dimethyl-N,N'-propylene urea, homologues and analogues thereof, and mixtures thereof;

III is present in a molar concentration greater than reactable I; and II is present in a molar concentration at least twice the molar concentration of I.
25. The process of claim 24 wherein each Y is selected from a group consisting of dimethylamine, diethylamine, diisopropylamine, dibutylamine, methylpropylamine, methylhexylamine, methylcyclopropylamine, ethylcyclohexylamine, methylbenzylamine, methycyclohexylmethyl-amine, butylcyclohexylamine, morpholine, thiomorpholine, pyrrolidine, piperidine, and 2,6-dimethylpiperidine;
said pK of said acid is about 8 to about 10.5;
II is present in a molar concentration from about 2 to about 5 times the molar concentration of I.
26. The process of claim 25 wherein said pK of said weak acid is about 8 to about 9.
27. The process of claim 26 wherein said pK of said weak acid is about 8.2 to about 8.5.
28. The process of claim 27 wherein said weak acid is selected from a group consisting of 1,2,4-triazole 1,2,3-triazole; 4,5-dichloroimidazole; 4-nitroimidazole;
3-chlorotriazole; benzotriazole, and mixtures thereof.
29. The process of claim 28 wherein said weak acid is selected from said group consisting of 4,5-dichloroimidazole, benzotriazole, and mixtures thereof.
30. The process of claim 29 wherein said weak acid is 4,5-dichloroimidazole;
said solvent is selected from a group consisting of tetramethyl urea, 1,3-dimethyl-2-imidazolidinone, 1-methyl-2-pryyolidinone, and mixtures thereof;
the molar ratio of III: reactable I is about 1.2:1 and the molar ratio of II:I i9 about 4:1.