BRPI1007230B1 - polypeptide showing stx2 antigenicity, uses thereof, composition comprising stx2 and host cell - Google Patents

Abstract

polypeptide showing the antigenicity of stx2, its uses, composition comprising it and host cell The invention relates to the discovery of epitope on stx2 protein for antibody 11e10. The invention provides compositions containing non-complete stx2 polypeptides which include the epitope of monoclonal antibody 11e10. The invention also provides methods for producing anti-stx2 antibodies specific for stx2 protein epitope 11e10. Additionally, the invention provides methods for treating an individual with or at risk of developing shiga toxin-associated disease (e.g., hemolytic uremic syndrome and diseases associated with E. coli and S. dysenteriae infection) with a polypeptide that includes the epitope 11e10 or with an anti-stx2 antibody developed using the methods of the invention. In addition, the invention features detection of stx2 in a sample using antibodies developed using the methods of the invention.

Description

DESCRIPTION REPORT OF THE INVENTION PATENT FOR POLYPEPTIDE SHOWING THE ANTIGENICITY OF STX2, ITS USES, COMPOSITION UNDERSTANDING THE SAME AND HOST CELL.

Background of the Invention

In general, the invention relates to the field of treatment and prevention of diseases associated with Shiga toxin.

In the United States, Escherichia coli producing Shiga toxin (Stx) (STEC) accounts for about 110,000 infections per year. Entero-hemorrhagic E. coli (EHEC), mainly serotype O157: H7, is a subset of STEC that is known to produce Stx-mediated disease. A possible complication of an infection with an organism producing Stx is the hemolytic-uremic syndrome (HUS), which is characterized by hemolytic anemia, thrombotic thrombocytopenia and renal failure. There is a mortality rate of approximately 50-10% for those with HUS and survivors may have long-term kidney damage. Currently, there are no FDA-approved therapies or vaccines to fight or prevent disease from a Stx-mediated disease, but several promising options for the future include: a humanized monoclonal antibody that binds and neutralizes Stx2 and a chimeric StxA2 / StxB1 toxoid that causes a neutralization response and provides protection against a lethal challenge by Stx1 or Stx2 or Stx1 and Stx2.

There are essentially two main types of Stxs: Stx / Stx1 and Stx2. Stx is produced from Shigelladysenteriae type 1, while Stx1 and Stx2 are produced from Escherichia coli. Stx and Stx1 are practically identical, with only one amino acid difference in subunit A. The mature subunits A and B of Stx1 and Stx2 have 68 and 73% similarity, respectively. Despite the differences in the amino acid sequence, the crystal structures of Stx and Stx2 are very similar (figure 1). These toxins can be differentiated by polyclonal antisera: polyclonal antisera developed against Stx1 do not neutralize Stx2 and vice versa. Variants of Stx1 and Stx2 exist and include Stx1c, Stx1d, Stx2c, Stx2d, Stx2d-activable (Stx2-act), Stx2e and Stx2f.

Petition 870190087704, of 09/06/2019, p. 6/14

2/58

Shiga toxins are complex holotoxins with an AB ₅ structure. The active domain (A) contains a / V-glycosidase that purifies 28S rRNA from the 60S ribosomal subunit, which interrupts protein synthesis and eventually leads to cell death. The A subunit is ~ 32 kDa and is proteolytically cleaved by trypsin or furin into an At subunit of ~ 28 kDa and an A ₂ peptide of ~ 5 kDa, which are connected via a single disulfide bond. The Ai subunit contains the active domain and peptide A ₂ does not covalently link the active domain to the binding domain (B). Domain (B) is composed of five identical monomers of ~ 7.7 kDa, which form a pentamer through which the C-terminal end of the A ₂ peptide crosses. Each of the B subunit monomers has two cysteine residues that form a disulfide bond within each monomer. Pentamer B binds to eukaryotic receptor (Gbs) globotriaosyl ceramide (or Gb4 as is the case with Stx2e).

Despite the known results of exposure to these toxins, there is currently no known cure or vaccine for Stx-mediated diseases. The use of antibiotics can aggravate the situation, increasing the release of the toxin from bacteria. Thus, there is a need for a compound to prevent or treat the complications of EHEC infection produced by the Shiga toxin. This compound could be used to treat infected individuals and decrease the systemic effects of the toxin on the CNS, blood and kidneys. In addition, if the toxin could be neutralized, antibiotics could be safely given to kill bacteria in the GI tract. Antibiotic treatment for STEC infection is contraindicated due to the potential for increased production of the toxin by the antibiotic by induction of the phage that carries the toxin gene. This compound could also be used to prevent complications from infection by treating exposed or high-risk individuals before they acquire EHEC infection. Such individuals would include children in daycare centers or elderly people in nursing homes, where a case of EHEC diarrhea was identified. These individuals are at greater risk of developing EHEC infection, often with serious complications and the spread of EHEC in these environments is not

3/58 unusual.

SUMMARY OF THE INVENTION

The monoclonal antibody 11E10 recognizes the A subunit of Stx2 and neutralizes its cytotoxicity. Despite the 68% amino acid sequence (aa) similarity between StxA1 and StxA2, monoclonal antibody 11E10 does not bind to StxA1. The 11E10 epitope was found to contain a discontinuous, or conformational, epitope that spans three regions in the StxA2 monomer. The three regions of dissimilarity, which include aa 4249 (SEQ ID NO: 1), 96-100 (SEQ ID NO: 2) and 244-259 (SEQ ID NO: 3), are located close to each other in the structure crystal of the A subunit of Stx2. Therefore, the 11E10 epitope was found to include at least one, two, or all three sequences set out in SEQ ID NOs: 1.2e3.

Consequently, the invention features a polypeptide that includes at least one, two or three of the amino acid sequences set out in SEQ ID NOs: 1, 2 and 3, where the polypeptide is not the complete Stx2. The polypeptide includes at least the amino acid sequence set forth in SEQ ID NO: 1. It is desired that the polypeptide include the amino acid sequences set out in SEQ ID NOs: 1 and 2, or, more desirably, SEQ ID NOs: 1, 2 and 3. In one embodiment, one or more of the sequences presented as SEQ ID NOs: 1, 2 and 3 are inserted into a non-Stx2 protein structure. In certain embodiments, the protein structure is a protein that has considerable identity with Stx1 or its fragment, for example, at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97% , 98%, 99% or 100% identity. In one embodiment, the protein structure is Stx1, Stx or Stx1 carrying one or more conservative point mutations. In another embodiment, the polypeptide of the invention includes an amino acid sequence that has considerable identity with the amino acid sequence shown as SEQ ID NO: 8. In yet another embodiment, the polypeptide can include fragments of stx2 that include SEQ ID NOs: 1 , 2 or 3; SEQ ID NOs: 1 and 2; or SEQ ID NOs: 1, 2 and 3, p. e.g., amino acids 29-297, amino acids 1-158, or amino acids 29-128 of the polypeptide sequence of Stx2, where the fragment is not the complete Stx2. In some embodiments, the fragment is inserted into a protein structure, for example, from Stx or Stx1.

The invention also features a polypeptide that includes an amino acid sequence that has considerable identity with a fragment of the amino acid sequence shown as SEQ ID NO: 8. In one embodiment, the fragment includes a sequence that has at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identity to amino acids 64-122 of SEQ ID NO: 8 and further includes at least the amino acid sequence shown as SEQ ID NO: 1. Preferably, the fragment still comprises the amino acid sequence (s) shown as SEQ ID NO: 2 or SEQ ID NOs: 2 and 3. The fragment it can be, for example, 20, 40, 59, 60, 150, 200, 219, 236, 250, 300 or 314 amino acids in length. In certain embodiments, the polypeptide is detoxified. All of the polypeptides mentioned above are covered by the term polypeptides of the invention.

The invention also includes nucleic acid molecules, including when the nucleic acid is linked to an expression construct in a vector and when this vector is inserted into a host cell, encoding any of the polypeptides of the invention.

In a related aspect, the invention features a composition to stimulate an immune response against Stx2 using any of the polypeptides of the invention. It is desired that the polypeptide include the sequences presented as SEQ ID NOs: 1 and 2 or, more desirably, 1, 2 and 3. In any of these embodiments, the composition may further include an adjuvant. In certain embodiments, the composition does not stimulate an immune response against Stx1.

The invention also features the use of any of the polypeptides of the invention (e.g., a protein structure such as Stx1 in which the amino acid sequences shown in at least one, two or three of SEQ ID NOs: 1, 2 or 3 are inserted). Such peptides may be useful for immunizing against or treating any associated disease

5/58 to Shiga toxin, including hemolytic-uremic syndrome and diseases associated with infection by E. coli and S. dysenteríae. In one embodiment, the peptide is at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% of sequence identity with the amino acid sequence presented as SEQ ID NO: 8. In another aspect, the invention features a method of producing an antiStx2 antibody (for example, monoclonal and polyclonal antibodies) or fragments that specifically bind to the epitope 11E10 from Stx2. These antibodies or fragments bind specifically to Stx2 and not to Stx1. This method includes immunizing a mammal with a polypeptide that includes a fragment of Stx2 (that is, not the complete Stx2) that includes at least one, two or three of the sequences presented as SEQ ID NOs: 1, 2 and 3, where this polypeptide does not include the complete Stx2. Preferably, the method includes the use of a polypeptide containing at least the sequence shown as SEQ ID NOs: 1, more preferably the sequences shown as SEQ ID NOs: 1 and 2 and even more preferably the sequences shown as SEQ ID NOs: 1 , 2 and 3. In one embodiment, the peptide includes a protein structure, for example, a protein with considerable identity to Stx1, in which one or more of the amino acid sequences presented as SEQ ID NOs: 1, 2 and 3 are inserted . The method may include immunizing the mammal with a polypeptide containing the 11E10 epitope, for example, as described herein, when the polypeptide does not include the complete Stx2. In one embodiment, a mammal is immunized with a polypeptide containing an amino acid sequence with considerable identity to the amino acid sequence shown in SEQ ID NO: 8. Anti-Stx2 antibodies produced by the above methods can be selected using standard methods known in the art or described in this document, including, for example, the in vitro neutralization assay, to identify antibodies that specifically bind to Stx2 and not to Stx1. The immunogenic polypeptide and methods of preparing this polypeptide, together with the nucleic acid molecule encoding this polypeptide (including when this nucleic acid is attached to a construct

6/58 of expression in a vector and when this vector is inserted into a host cell), are also included as related aspects of the invention.

The invention also features anti-Stx2 antibodies or fragments that specifically bind to the 11x10 epitope of Stx2, where the antibodies or their fragments specifically bind to Stx2 and not to Stx1. Preferred antibodies of the invention bind to an epitope that includes at least one, two or three sequences presented as SEQ ID NOs: 1, 2 and 3, desirably including at least SEQ ID NO: 1, most desirably including at least the SEQ ID NOs: 1 and 2 and most desirably containing SEQ ID NOs: 1, 2 and 3. The antibody epitope can be a conformational epitope, where the amino acid sequences are in proximity based on the conformation of the protein structure, for example, as in the chimeric proteins described in this document, where one or more of the sequences of Stx2 presented as SEQ ID NOs: 1, 2 and 3 are inserted into a protein structure considerably identical to Stx1. The antibodies can be IgG, IgM, IgE, IgD, IgA, Fab, Fv, monoclonal and polyclonal antibodies, or antibody fragments and can be developed using the methods described in this document. Antibodies preferably bind to Stx2 with a Ka of less than 100 nM, 50 nM, 10 nM, 1 nM, 100 pM or 1 pM or less. In one example, the antibody of the invention inhibits binding of the 11E10 antibody to Stx2 or to a chimeric protein containing the 11E10 epitope, including an inhibition with a Ka value between 100 nM and 1 pM. An antibody of the invention can inhibit the binding of Stx2 to the eukaryotic globotriaosyl ceramide (Gb3) receptor. The anti-Stx2 antibodies of the invention specifically exclude any mouse, humanized, or chimeric forms of the following 11E10, TMA-15, VTM1.1, 5C12 antibodies (including human monoclonal antibody 5C12 and r5C12), 6G3, 5H8, 11F11, 11G10 , 2E1, 10E10, IG3, 2F10, 3E9, 4H9, 5A4, 5F3, 5C11, 1A4, 1A5, BC5 BB12, DC1 EH5, EA5 BA3, ED5 DF3, GB6, BA4 and cüStx2 antibodies. The invention further includes a hybridoma cell line that produces any of the antibodies of the invention.

7/58

Yet another aspect of the invention features a method of detecting Stx2 in a biological sample (e.g., tissue, cell, cell extract, body fluid and biopsy sample) using any of the anti-Stx2 antibodies of the invention. Detection methods of the invention include, without limitation, ELISA, RIA, Western blotting, immunoprecipitation and flow cytometry. The invention includes the diagnosis of a disease associated with Shiga toxin based on the identification of Stx2 in a sample. The invention also features an immunological test kit for detecting a disease associated with Shiga toxin, the kit including an antibody of the invention and a means for detecting an interaction between the antibody and the Stx2 present in the sample.

Yet another aspect of the invention features a method of treating a disease associated with Shiga toxin using an antibody as provided herein or as produced by any of the foregoing methods. Examples of diseases associated with Shiga toxin include hemolytic-uremic syndrome (HUS) and diseases associated with infection by E. coli and S. dysenteriae. These antibodies can be administered in combination with other therapies, including, but not limited to, antibodies that specifically bind to other proteins associated with Shiga toxin (eg, Stx1).

By epitope 11E10 is meant an amino acid sequence that, either as a result of the linear structure or as a three-dimensional conformation, forms the binding site for the 11E10 antibody. This term can include any non-complete Stx2 protein that includes identical sequences or with considerable identity with one, two or three of the sequences presented as SEQ ID NOs: 1, 2 and 3 (for example, SEQ ID NOs: 1 and 2 or SEQ ID NOs: 1, 2 and 3). In desired embodiments, the 11E10 epitope includes SEQ ID NOs: 1 and 2 or 1, 2 and 3. An example of a protein that includes an 11E10 epitope is a protein that includes an amino acid sequence with considerable identity to the amino acid sequence presented as SEQ ID NO: 8.

By the term antibody that specifically binds to the epitope

8/58

11E1O of Stx2 or 11E10 epitope specific antibody is understood to be an antibody that binds a Ka value between 100 nM-1 pM to a protein that includes the 11E10 epitope. Such antibodies are also characterized by little or no detectable binding to the Stx1 protein (for example, with a Ka value greater than 100 nM, 200 nM, 500 nM, 1 ΠΜ, 10 üM, 100 ΠΜ, 1 mM or greater for Stx1) . Antibody affinities can be determined using any of the assays known in the art, including, but not limited to, assay based on surface plasmon resonance, enzyme binding immunoabsorbent assay (ELISA) and competition assays (for example, RIA ). In addition, the antibody can be subjected to an in vitro neutralization assay, as described in this document. An antibody that specifically binds to the 11E10 epitope can neutralize the cytotoxic effect of Stx2 by at least 10%, 20%, 30%, 40%, 50%, 75%, or more, using the assays described in this document or known in the art . The term specifically excludes the following mouse, chimeric, humanized or human forms of the following antiStx2 antibodies: 11E10, TMA-15, VTM1.1, 5C12 (including human monoclonal antibody 5C12 and r5C12 (Akiyoshi and Tzipori (2005) Infect. Immun. Immun. 73: 40544061), 6G3, 5H8, 11F11, 11G10, 2E1, 10E10 (Perera et al. (1988) J. Clin. Microbiol. 26: 2127-2131), IG3, 2F10, 3E9, 4H9, 5A4, 5F3, 5C11, 1A4, 1A5 (Ma et al. (2008) Immunol. Lett. 121: 110-115 (2008), BB12 BC5, DC1 EH5, EA5 BA3, ED5 DF3, GB6, BA4 (Downes et al. (1988) Infect Immun. 56: 1926-1933), caStx2 antibodies; antibodies described in Smith et al. ((2006) Vaccine 24: 4122-4129), antibodies described in Donohue Rolfe et al. ((1999) Infect Immun. 67: 3645 -364) and the antibodies described in Sheoran et al. ((2003) Infect Immun. 71: 3125-3130).

By inhibiting binding is meant to cause a decrease in protein binding to another protein of at least 50%, preferably 60%, 70%, 80%, 90%, or more, as measured, for example, by transfer Western as described herein either by ELISA or by Gb ₃ receptor binding assays known in the art.

The term antibody is used in the broadest sense and includes anti

9/58 monoclonal bodies (including full-length monoclonal antibodies), polyclonal antibodies, multispecific antibodies (eg bispecific antibodies), or antibody fragments, provided that such molecules have a desired biological activity (eg neutralization of the Stx2 toxin as herein described).

As used herein, purified or isolated refers to a protein that has been identified and separated and / or recovered from a component of its natural environment. Contaminating components of their natural environment are materials that typically interfere with the diagnosis or therapeutic uses of the protein and may include enzymes, hormones and other proteinaceous or non-proteinaceous solutes.

Detoxified (a) means changed, for example, by mutation, conjugation or cross-linking, in order to decrease cytotoxicity, while maintaining antigenicity. Detoxified versions of Stx2 include Stx2 treated with formaldehyde and glutaraldehyde and Stx2 with a Y77S mutation. Other non-limiting examples of detoxified Stx proteins are Stx2, therefore, the Y77S and E167Q mutations (Wen etal. (2006) Vaccine 24: 1142-1148), Stx2, therefore, an E167D and 6 histidine marker (Robinson et al. ( 2006) Proc. Natl. Acad. Sci. US A 103: 9667-9672), the toxoid StxA2 / StxB1 carrying the Y77S, E167Q and R170L mutations (Smith et al, Vaccine 24: 4122-4129 (2006)). Other examples are described in Gordon et al. (1992) Infect. Immunol. 60 (2): 485-490).

By not complete Stx2 is meant a protein that contains less than 90%, 85%, 80%, 75%, 70%, 65%, 60% or less of the amino acids of the complete Stx2 polypeptide. Examples of incomplete Stx2 include, but are not limited to, the amino acid sequences presented as SEQ ID NOs: 4-8. Other examples include polypeptides that include or consist of the amino acids 29-297, 1-158, or 29-128 of Stx2, including, for example, the chimeric polypeptides provided in figure 1 A. The A subunit of the wild Stx1 or Stx2 or the toxins chimerics described in this patent application, all have a leader sequence of 22 amino acids that is removed, thus generating the mature A subunit protein.

10/58

For the purposes of this specification, the term Stx2 complete and amino acid numbering of the Stx2 fragments refer to the complete mature StxA2 subunit. This mature A subunit is subsequently cleaved asymmetrically by trypsin or furin into an A1 fragment (N-terminal ~ 248 amino acids) and an A2 peptide (C-terminal ~ 50 aas). The A subunit, in native or chimeric form, is usually present in the context of holotoxin; however, expressed in isolation (for example, without the B subunit), an A subunit or its fragment could elicit an immune response against the 11E10 epitope.

As used herein, the term protein structure or structure refers to a protein structure that has one or more amino acid sequences of a heterologous protein, e.g. a sequence of Stx2 amino acids presented as SEQ ID NOs: 1, 2, or 3. Preferably, the three-dimensional structure of a protein structure is known and fragments of the heterologous protein are inserted at strategic locations, for example, in loops exposed on the surface or in regions of structural homology between the protein structure and the heterologous protein. The insertion of a fragment of Stx2 can be accompanied by the selective deletion of certain sequences of the protein structure, for example, a sequence with structural homology to the sequence to be inserted. In this case, the undeleted sequences of the protein structure can be used to determine the percentage of sequence identity with another protein, e.g. e.g., Stx1. Exemplary proteins that were used as protein structures are Stx or Stx1 (described in this document), green fluorescent protein (Abedi et al. (1998) Nucleic Acids Res. 26: 623630) and antigen 4 associated with cytotoxic T lymphocyte (CTLA-4 ) (Hufton et al. (2000) FEBS lett. 475: 225-231). Protein structures specifically exclude a protein marker, for example, the FI_AG epitope or glutathione-S-transferase, at the end of which a heterologous protein sequence is fused.

Considerable identity means a sequence of nucleic acids or amino acids that, when perfectly aligned, by and

11/58 example, using the methods described below, shares at least 75, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99 % or 100% sequence identity with a second nucleic acid or amino acid sequence, for example, a Stx2, Stx1, or chimeric protein, such as that presented as SEQ ID NO: 8. Considerable identity can be used to refer to various sequence types and lengths, such as a complete sequence, immunogenic epitopes or peptides, functional domains, coding and / or regulatory sequences, exons, introns, promoters and genomic sequences. The percentage of identity between two polypeptide or nucleic acid sequences is determined in various ways that are within the skill of the art, for example, using publicly available computer programs, such as Smith and Waterman alignment (Smith, TF and MS Waterman (1981) J. Mol, Biol. 147: 195-7); Best Fit (Smith and Waterman (1981) Advances in Ap15 plied Mathematics, 482-489) as incorporated in GeneMatcher Plus® (Schwarz and Dayhof (1979) Atlas of Protein Sequence and Structure, Dayhoff, M.O., Ed pp 353-358); the BLAST program (Basic Local Search and Alignment Tool (Altschul, SF, W. Gish, et al. (1990) J. Mol. Biol. 215: 403-10), BLAST-2, BLAST-P, BLAST-N , BLAST-X, WU-BLAST-2,

ALIGN, ALIGN-2, CLUSTAL, or Megalign (DNASTAR). In addition, those skilled in the art can determine appropriate parameters for measuring alignment, including any algorithms necessary to achieve maximum alignment over the length of the sequences to be compared. In general, for proteins, the length of sequences in comparison may be at least 5 amino acids, preferably 10, 25, 50, 100, 150, 200, 300 or 315 amino acids or more to the full extent of the protein. For nucleic acids, the length of the sequences in comparison can generally be at least 15, 75, 150, 300, 450, 600, 900, or 945 nucleotides or more to the entire length of the nucleic acid molecule. It is understood that, for the purpose of determining sequence identity when comparing a DNA sequence to an RNA sequence, a thymine nucleotide is equivalent to a uracil nucleotide. In a hand

12/58 quality, the sequence identity of a protein, for example, the mature A subunit of a Shiga toxin protein, can be measured along the length of a fragment of SEQ ID NO: 8, for example. from amino acids 64 to 122 or 64 to 282 of SEQ ID NO: 8. For amino acid sequences, conservative substitutions typically include substitutions within the following groups: glycine, alanine; valine, isoleucine, leucine; aspartic acid, glutamic acid, asparagine, glutamine; serine, threonine; lysine, arginine; phenylalanine, tyrosine.

Fragment means a part of a nucleic acid or polypeptide molecule that contains less than 100% of the entire length of the reference nucleic acid or polypeptide molecule, preferably at least 2%, 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%. A fragment can contain, for example, 10, 15, 75, 150, 300, 450, 600, 900, or 945 or more nucleotides or 4, 5, 10, 25, 50, 100, 150, 200, 300, 315 amino acids or more. Fragments of the Shiga toxin type 1 protein or Shiga toxin type 2 may include any part that is less than the complete protein, for example, a fragment of 4, 5, 8, 10, 25, 50, 100, 150, 200, 300, 315 or more amino acids in length. In one example, a fragment includes amino acids 64 to 122 or 64 to 282 of SEQ ID NO: 8.

A disease associated with Shiga toxin means any disease resulting from a pathogen expressing a Shiga toxin. The term disease associated with Shiga toxin is intended to include hemolytic-eremic syndrome, shigellosis and diseases resulting from infection by S. dysenteríae and Shiga toxin-producing Escherichia coli.

BRIEF DESCRIPTION OF THE DRAWINGS

Figure 1A illustrates A subunits of the initial hybrid Stx1 / Stx2. Stx1 is shown in black, Stx2 is represented in white. The names of the chimeric toxins are shown to the left of the respective chimeric proteins and the Stx2 regions are listed under the chimeric A subunits.

Figure 1B shows Western blot analysis

13/58 deStxl, Stx2 and the initial chimeric toxins probed with monoclonal (lower panel) or polyclonal (upper panel) anti-Stx1 and anti-Stx2 rabbit. Lanes 1 and 2 contain 25 ng of purified Stx1 or Stx2, respectively. Lanes 3 to 8 contain the following chimeric toxins: lane 3, Stx1 (2A29-297); lane 4, Stx1 (2A-M58); lane 5, Stx1 (2A29-128); lane 6, Stx1 (2A ₂ 9-76); lane 7, Stx1 (2A4 ₂ .7 ₆ ); lane 8, Stx1 (2A42.49).

Figure 1C shows the percentage of neutralization of the initial chimeric toxins with monoclonal antibody 11E10. The neutralization data were normalized such that the% neutralization of the complete Stx2 was defined as 100% (% real neutralization = 65%) and the neutralization levels for the rest of the toxins are given as a percentage of the normalized complete Stx2 neutralization . The error bars represent the standard error of the normalized values.

Figure 2A shows the amino acid alignment of StxA1 and StxA2 in the three regions that make up the 11E10 monoclonal antibody epitope. The black and gray amino acids represent conserved and non-conserved amino acids, respectively; the dots represent identical residues. The three regions of the 11E10 monoclonal antibody epitope are as follows: region A (StxA2 residues 42-49), region B (StxA2 residues 96-100); region C (StxA2 residues 244-259). The number of amino acids shown in the alignments is in relation to the mature protein StxA1. StxA1 has an extra amino acid at position 185; this addition causes the epitope of region C in StxA2 to be of a different number than that of the corresponding region of Stx1.

Figure 2B shows a ribbon diagram of the crystal structure of Stx2 showing Stx2 A-ι and B subunits in light gray, with the exception of three regions of the 11E10 monoclonal antibody epitope. Regions A (green), B (blue) and C (cyan) are marked with black, gray and white arrows, respectively. The A ₂ peptide is represented in black and the active site (red) is marked with an asterisk.

Figure 2C shows a spatial representation of the crystal structure of Stx2. Regions A, B and C are indicated with arrows.

14/58

Figure 3A illustrates second generation chimeric toxins that contain chimeric A subunits. Stx1 is shown in black, while Stx2 is represented in white. The names of the chimeric toxins are shown to the left of the respective chimeric proteins and the Stx2 regions are listed under the chimeric A subunits. Regions A, B and C refer to amino acids 42-49 (SEQ ID NO: 1), 96-100 (SEQ ID NO: 2) and 244-259 (SEQ ID NO: 3), respectively of StxA2.

Figure 3B depicts Western blot analyzes of Stx1, Stx2 and the five second generation chimeric toxins probed with monoclonal antibody 11E10 (lower panel) or anti-Stx1 (upper panel) of rabbit. Lane 1 contains 25 ng of purified Stx2. Lanes 2 to 6 contain the following chimeric toxins: lane 2, Stx1 + A; lane 3, Stx1 + AB; lane 4, Stx1 + AC; lane 5, Stx1 + BC; lane 6, Stx1 + ABC.

Figure 3C shows the neutralization of second generation hybrid toxins by monoclonal antibody 11E10. The level of Stx2 neutralization was normalized to 100% as in figure 1C. The error bars represent the standard error of the normalized values.

Figure 4A shows Western blot analyzes of Stx2 and variants of Stx2 with monoclonal antibody 11E10. Lane 1 contains 25 ng of purified Stx2. Lanes 2 through 5 contain the following toxins: lane 2, Stx2c; lane 3, Stx2d; lane 4, Stx2d _ac t; lane 5, Stx2e. Western blots were probed with polyclonal rabbit anti-Stx2 antibodies (upper panel) or monoclonal antibody 11E10 (lower panel).

Figure 4B represents the percentage of 11E10 neutralization of the Stx2 variants. The level of Stx2 neutralization was normalized to 100% as in figure 1C. The error bars represent the standard error of the normalized values.

Figure 5 represents the inhibition of protein synthesis measured by the translation of luciferase mRNA into rabbit reticulocyte lysate. A 0.2 ng aliquot of purified Stx2 was mixed with 0, 0.2, or 2 ng of 11E10e added to reticulocyte lysates. Inhibition of protein synthesis was indicated by a reduction in luciferase mRNA translation

15/58 and was measured by bioluminescence after adding the toxin-treated lysate to the luciferin substrate. A 2 ng sample of the irrelevant isotype 13C4 antibody was mixed with 2 ng Stx2 as a negative control. Error bars represent the 95% confidence interval calculated from the standard error of the average proportion. The probability values derived from a two-tailed Student's t test indicate a significant difference in the bioluminescence signal between samples with and without antibody (p □ 0.005).

Figures 6A-6J show that monoclonal antibody 11E10 alters the global cellular distribution of Stx2 in Vero cells. Stx2 was mixed with PBS (A, H-J) or 11E10 (B, Ce E-G) and then added to Vero cells for 6h. As a control, 11E10 was added to Vero cells in the absence of Stx2 (D). The toxin was detected with polyclonal antibodies against Stx2 followed by a secondary antibody conjugated to AlexaFluor 488 (A and B), while 1ΊΕ10 was detected with anti-mouse IgG conjugated to AlexaFluor 488 (C and D). The co-localization of Stx2 with the early endosome marker EEA1 was assessed by double-marking intoxicated cells. The distribution of Stx2 in the presence (Panel E) and absence (Panel H) of antibody 11E10 was visualized with monoclonal antiStx2 and fluorescent green secondary 11F11. The distribution of the EEA1 endosome marker was visualized with secondary goat anti-EEA1 and fluorescent red antibodies (panels F and I). These marking patterns were superimposed (Panels G and J) and the colocalization of the toxin with endosomes was indicated by a yellow-orange color, indicated by arrows.

Figures 7A-7D show the amino acid sequence of Stx2 Region A (SEQ ID NO: 1) (figure 7A), Stx2 Region B (SEQ ID NO: 1) (figure 7A), Stx2 Region C (SEQ ID NO: 3) (figure 7C) and Stx2e Region B (SEQ ID NO: 19) (figure 7D).

Figure 8A shows the amino acid sequence of the chimera Stx1 + A (SEQ ID NO: 4). The processed leader sequence is underlined and the Stx2 region A is underlined in bold. The unprocessed protein contains 315 amino acids in length; the mature protein contains 293 ami16 / 58 noacids in length.

Figure 8B shows the amino acid sequence of the chimera Stx1 + AB (SEQ ID NO: 5). The processed leader sequence is underlined and Stx2 regions A and B are underlined in bold. The unprocessed protein contains 315 amino acids in length; the mature protein contains 293 amino acids in length.

Figure 8C shows the amino acid sequence of the chimera Stx1 + AC (SEQ ID NO: 6). The processed leader sequence is underlined and Stx2 regions A and C are underlined in bold. The unprocessed protein contains 315 amino acids in length; the mature protein contains 293 amino acids in length.

Figure 8D shows the amino acid sequence of the chimera Stx1 + BC (SEQ ID NO: 7). The processed leader sequence is underlined and Stx2 regions B and C are underlined in bold. The unprocessed protein contains 315 amino acids in length; the mature protein contains 293 amino acids in length.

Figure 8E shows the amino acid sequence of the chimera Stx1 + ABC (SEQ ID NO: 8). The processed leader sequence is underlined and Stx2 regions A, B and C are underlined in bold. The unprocessed protein contains 315 amino acids in length; the mature protein is 293 amino acids long.

Figure 9A shows the DNA sequence of the Stx1 operon (SEQ ID NO: 9) starting at the start codon of StxAI and ending at the stop codon of StxBI.

Figure 9B shows the DNA sequence of StxAI (SEQ ID NO:

10) starting at the start codon of StxAI and ending at the stop codon of StxAI.

Figure 9C shows the DNA sequence of StxBI (SEQ ID NO:

11) starting at the start codon of StxBI and ending at the stop codon of StxBI.

Figure 10A shows the amino acid sequence of StxAI (SEQ ID NO: 12). The processed leader string is underlined. Protein not pro

17/58 ceased contains 315 amino acids in length; the mature protein contains 293 amino acids in length.

Figure 10B shows the amino acid sequence of StxBI (SEQ ID NO: 13). The processed leader string is underlined. The unprocessed protein contains 89 amino acids in length; the mature protein contains 69 amino acids in length.

Figure 11A shows the DNA sequence of the Stx2 operon (SEQ ID NO: 14) starting at the start codon of StxA2 and ending at the stop codon of StxB2.

Figure 11B shows the DNA sequence of StxA2 (SEQ ID NO: 15) starting at the start codon of StxA2 and ending at the stop codon of StxA2.

Figure 11C shows the DNA sequence of StxB2 (SEQ ID NO: 16) starting at the start codon of StxB2 and ending at the stop codon of StxB2.

Figure 12A shows the amino acid sequence of StxA2 (SEQ ID NO: 17). The processed leader string is underlined. The unprocessed protein is 319 amino acids long; the mature protein is 297 amino acids long.

Figure 12B shows the amino acid sequence of StxB2 (SEQ ID NO: 18). The processed leader sequence is underlined. The unprocessed protein contains 89 amino acids in length; the mature protein contains 70 amino acids in length.

DETAILED DESCRIPTION OF THE INVENTION

In general, the invention features compositions and methods related to the discovery of the 11E10 epitope of the Stx2 protein. It has been found that the 11E10 epitope includes at least one, two or three of the sequences presented as SEQ ID NOs: 1, 2 and 3. The compositions and methods of the invention can be useful for the detection, treatment or prevention of diseases associated with Shiga toxin . For example, an individual with, or at risk of developing, a disease associated with Shiga toxin (for example, hemolytic-uremic syndrome and diseases associated with infection by E.

18/58 coli and S. dysenteríae) can be treated with a peptide containing the 11E10 epitope or with antibodies that specifically bind to the 11x10 epitope of the Stx2 protein.

I. INDICATIONS

Diseases associated with Shiga toxin include those resulting from infection with S. dysenteríae or entero-hemorrhagic E. coli (EHEC) producing Shiga toxin, mainly serotype O157: H7. These infections often result in hemolytic-uremic syndrome (HUS), which is characterized by hemolytic anemia, thrombotic thrombocytopenia and renal failure.

The compounds and methods of the invention are useful for the treatment of individuals who have, or are at risk for, developing a disease associated with Shiga toxin. Such individuals would include children in day care centers or elderly people in nursing homes. In one example, the individual is in a daycare or nursing home, where a case of EHEC diarrhea has been detected. In this example, the individual may or may not have developed the disease. The methods and compositions of the invention can be used to treat infection in the individual infected with EHEC, to detect other infected individuals and to prevent the spread of EHEC in the nursery or asylum.

II. ANTIBODIES

The invention includes the production of antibodies that specifically bind to the 11E10 epitope of Shiga toxin type 2 protein (Stx2) and the antibodies themselves. It is desired that such an antibody does not detectably bind to Stx1. The unique ability of antibodies to recognize and specifically bind to target proteins provides approaches to both diagnosing and treating diseases related to Shiga toxin-producing Escherichia (STEC). The invention provides for the production of antibodies, including, but not limited to, polyclonal and monoclonal antibodies, antiidiotypic antibodies, murine and other mammalian antibodies, antibody fragments, bispecific antibodies, antibody dimers or tetramers, single chain antibodies (e.g. scFv antibody and antigen-binding fragments, such as Fabs, diabodies and Fab 'fragments), binding regions

19/58 recombinant based on antibody binding regions, chimeric antibodies, primatized antibodies, humanized and fully human antibodies, excluded domain antibodies and antibodies labeled with a detectable marker, or coupled to a toxin or radionuclide. Such antibodies are produced by conventional methods known in the art. In one aspect, the invention includes the preparation of monoclonal antibodies or antibody fragments that specifically bind to the 11x10 epitope of Stx2, where the preparation includes the use of a polypeptide containing at least one, two or three sequences selected from sequences shown as SEQ ID NOs: 1, 2, or 3. An example is the protein shown as SEQ ID NO: 8.

Polyclonal antibodies

Polyclonal antibodies can be prepared by immunizing rabbits or other animals by injecting antigen followed by subsequent boosters at appropriate intervals. The animals are bled and the sera are measured against the protein purified normally by ELISA.

Polyclonal antibodies that specifically bind to the 11E10 epitope can be developed in animals by multiple subcutaneous (sc) or intraperitoneal (ip) injections of the antigen and an adjuvant. It may be useful to conjugate the peptide containing the 11E10 epitope to a protein that is immunogenic in the species to be immunized (for example, hemocyanin of the snail Megathura crenulata, serum albumin, bovine thyroglobulin or soybean trypsin inhibitor), using a bifunctional agent or derivation (eg maleimidobenzoyl sulfosuccinimide ester (conjugation via cysteine residues), N-hydroxysuccinimide (via lysine residues), glutaraldehyde or succinic anhydride).

For example, animals can be immunized against the 11E10 epitope, immunogenic conjugates or derivatives by combining 1 üg to 1 mg of the peptide or conjugate (for rabbits or mice, respectively) with 3 volumes of Freund's complete adjuvant and injection of the solution of intradermally in several locations. One month later, the animals are boosted with 1/5 to 1/10 of the original amount of peptide

20/58 ♦

«Or conjugated in complete Freund's adjuvant by subcutaneous injection in several locations. Seven to 14 days later, the animals are bled and the serum is assayed for antibody titers against the antigen or its fragment. The animals are subjected to reinforcement until the titer stabilizes. Preferably, the animal is boosted with the conjugate of the same polypeptide, but conjugated to a different protein and / or by means of a different cross-linking reagent. Conjugates can also be made in recombinant cell culture as protein fusions. In addition, aggregating agents such as alum are suitably used to enhance the immune response.

Completely human, humanized or chimeric polyclonals can be produced in animals transgenic for human immunoglobulin genes, or by isolating two or more Stx2 reactive B lymphocytes from an individual for starting material.

Polyclonals can also be purified and selected (such as by affinity for a conformationally restricted antigen peptide), iteratively, if necessary, to provide a monoclonal antibody. Alternatively or additionally, cloning the nucleic acid encoding a single antibody to a lymphocyte can be employed.

Monoclonal antibodies

In another embodiment of the invention, monoclonal antibodies are obtained from a population of substantially homogeneous antibodies (i.e., the individual antibodies, including the population, are identical, except for possible naturally occurring mutations that may be present in smaller amounts). Thus, the term monoclonal indicates the character of the antibody as not being a discrete mixture of antibodies.

Monoclonal antibodies can be prepared by methods known in the art, such as the Kohler and Milstein hybridoma method by 30 fusion splenocytes from mice immunized with tumor cells that replicate continuously, such as myeloma or lymphoma cells. (Kohler and Milstein (1975) Nature 256: 495 - 497; Gulfre and Milstein (1981) Me

21/58 thods in Enzymology: Immunochemical Techniques 73: 1 - 46, Langone and Banatis eds., Academic Press). The hybridoma cells are then cloned by limiting the dilution methods and the supernatants evaluated for antibody production by ELISA, RIA or bioassay. In another embodiment, monoclonal antibodies can be made by recombinant DNA methods.

For the preparation of monoclonal antibodies (Mabs) that specifically bind to the 11E10 epitope, any technique that provides for the production of antibody molecules by continuous cell lines in the culture can be used. For example, the hybridoma technique originally developed by Kohler and Milstein ((1975) supra, as well as in Kohler and Milstein (1976) EurJ Immunol. 6: 511 - 519; Kohler et al. (1976) EurJ Immunol. 6: 292 -295; Hammerling et al. (1981) in: Monoclonal Antibodies and TCell Hybridomas, Elsevier, NY, pp. 563 - 681) and the trioma technique, the human B cell hybridoma technique (Kozbor et al. (1983) Immunol Today 4: Ί2. - 79) and the EBV-hybridoma technique to produce human monoclonal antibodies (Cole et al. (1985) in Monoclonal Antibodies and Cancer Therapy, Alan R. Liss, Inc., pp. 77 - 96) . Such antibodies can be of any class of immunoglobulin, including IgG, IgM, IgE, IgA, IgD and any subclass thereof. The hybridoma that produces the Mabs in the invention can be cultured in vitro or in vivo. In a further embodiment of the invention, monoclonal antibodies can be produced in germ-free animals, using technology known in the art.

In general, a mouse or other appropriate host animal, such as a hamster, is immunized with a polypeptide that includes the 11E10 epitope to induce lymphocytes that produce or are capable of producing antibodies that can specifically bind to the antigen or fragment thereof used for immunization. Alternatively, lymphocytes are immunized in vitro.

The splenocytes of the immunized host animal (for example, a mouse) are extracted and fused with a suitable cell line, for example, a myeloma cell line, using a

22/58 suitable fusion agent, such as polyethylene glycol, to form a hybridoma cell (Goding (1986) Monoclonal Antibodies: Principles and Practice, pp. 59 - 103, Academic Press). Any suitable myeloma cell line can be employed in accordance with the present invention; however, preferred myeloma cells are those that fuse efficiently, support high-level and stable antibody production by selected antibody-producing cells, and are sensitive to a medium, such as HAT medium. Among these, the preferred myeloma cell lines are murine myeloma lines, such as those derived from MOPC-21 and MPC-11 mouse tumors, available from the Salk Institute Cell Distribution Center, San Diego, California. USA, and SP-2 cells available from the American Type Culture Collection, Rockville, MD. USA.

The hybridoma cells thus prepared can be seeded and grown in a suitable culture medium, which preferably contains one or more substances that inhibit the growth or survival of unfused parental myeloma cells. Hybridoma cells obtained through a selection and / or culture medium in which the hybridoma cells are being maintained can be analyzed to identify the production of monoclonal antibodies that specifically bind to the 11E10 epitope. Preferably, the binding specificity of monoclonal antibodies produced by hybridoma cells is determined by immunoprecipitation or by an in vitro binding assay, such as radioimmunoassay (RIA), or enzyme-linked immunosorbent assay (ELISA), or using an Biacore instrument. The binding affinity of the monoclonal antibody can, for example, be determined by the Scatchard analysis of Munson and Rodbard ((1980) Anal Biochem. 107: 220-239).

After hybridoma cells have been identified that produce antibodies of the specificity, affinity and / or desired activity, the clones can be subcloned by limiting dilution procedures and cultured by standard methods (Goding, supra). In addition, hybridoma cells can be cultured in vivo as ascites tumors in an animal. The monoclonal antibodies secreted by the subclones are

23/58 te separated from the culture medium, ascites fluid, or serum, by means of conventional immunoglobulin purification processes, such as, for example, protein A Sepharose, hydroxyapatite chromatography, gel electrophoresis, dialysis or affinity chromatography .

The DNA encoding the monoclonal antibodies of the invention is readily isolated and sequenced using conventional procedures (for example, using oligonucleotide probes that are able to specifically bind to genes encoding murine antibody heavy and light chains). The hybridoma cells of the invention serve as a preferred source of this DNA. Once isolated, DNA can be placed into expression vectors, which are then transfected into host cells, such as E. coli cells, COS cells, Chinese hamster ovary (CHO) cells or myeloma cells that do not produce immunoglobulin protein. , to obtain the synthesis of monoclonal antibodies in recombinant host cells (see, for example, Skerra et al. (1993) CurrOpin Immunol. 5: 256 - 262 and Pluckthun (1992) Immunol Rev. 130: 151 - 188).

DNA can also be modified, for example, by replacing all or part of the coding sequence for light and heavy chain constant domains in place of murine homologous sequences (Morrison et al. (1984) Proc Natl Acad Sei. USA. 81: 6851 6855) or by covalently linking the coding sequence of all or part of the immunoglobulin coding sequence to a non-immunoglobulin polypeptide. In this way, chimeric or hybrid antibodies are prepared that have the binding specificity of a monoclonal antibody of the anti-11E10 epitope. Usually such non-immunoglobulin polypeptides are replaced by the constant domains of an antibody of the invention, or they are replaced by the variable domains of an antigen combining site of an antibody of the invention to create a bivalent chimeric antibody, including an antigen combining site. with specificity for the 11E10 epitope according to the invention and another antigen combination site with specificity for a different antigen.

24/58

Modified antibodies

The modified antibodies of the invention include, but are not limited to, chimeric monoclonal antibodies (e.g., human mouse chimeras), human monoclonal antibodies and humanized monoclonal antibodies. A chimeric antibody is a molecule in which different portions are derived from different animal species, such as those that have a constant human immunoglobulin region and a variable region derived from a murine mAb (see, for example, US Patent 4816567 and 4816397). Humanized forms of non-human antibodies (e.g., murine) are chimeric immunoglobulins, immunoglobulin chains or fragments thereof (such as Fv, Fab, Fab ', F (ab') 2 or other antibody antigen binding substrates) that contain the minimal sequence derived from non-human immunoglobulin, such as one or more complementarity determining regions (CDRs) of non-human species and a framework region of a human immunoglobulin molecule (see, for example, US Patent 5585089).

Humanized antibodies include human immunoglobulins (receptor antibodies) in which residues from a complementary determined region (CDR) of receptors are replaced by residues from a CDR of a non-human species (donor antibody), such as rats, mice or rabbits having the specificity, affinity and desired capacity. In some cases, the Fv structure residues of human immunoglobulin are replaced by corresponding non-human residues. Humanized antibodies can also include residues that are found neither in the recipient antibody nor in the imported framework or CDR sequences. In general, the humanized antibody will include substantially all of at least one, and usually two, variable domains, where all or almost all of the CDR regions correspond to those of a non-human immunoglobulin, and all or substantially all of the FR regions are those of one consensus sequence of human immunoglobulin. The ideal humanized antibody will also include at least a portion of a constant immunoglobulin (Fc) region, typically that of a human immunoglobulin

25/58 mana.

Chimeric and humanized monoclonal antibodies can be produced by recombinant DNA techniques known in the art, for example, using methods described in WO 87/02671, EP 184187; EP 171496; EP 173494; WO 86/01533; US 4,816,567; EP 125,023; Better et al. (1988) Science 240: 1041-1043; Liu et al. ((1987) Proc Natl Acad Sci. U.S.A 84: 3439-3443); Liu et al. ((1987) J Immunol 139: 3521-3526.); Sun et al. ((1987) Proc Natl Acad Sci. U.S.A 84: 214-218); Nishimura et al. ((1987) Cancer Res 47: 999-1005.); Wood et al. ((1985) Nature 314: 446-449); Shaw et al. ((1988) J Natl Cancer Inst 80: 1553-1559.); Morrison ((1985) Science 229: 1202-1207); Oi et al. ((1986) Biotechniques. 4: 214.); US 5,225,539; Jones et al. ((1986) Nature 321: 552-525); Verhoeyan et al. ((1988) Science 239: 1534); and Beidler et al. ((1988) J Immunol 141: 4053-4060). See below for a more in-depth discussion of humanized antibodies and related methods.

Another very efficient means for the generation of recombinant antibodies is disclosed by Newman ((1992) Biotechnology 10: 1455-1460). See also US Patents 5,756,096; 5,750,105; 5,693,780; 5,681,722 and 5,658,570.

Methods for humanizing non-human antibodies are well known in the art. Humanization can essentially be performed following the method of Winter et al., As described above (including Jones et al.O ((1986) Nature 321: 522-525); Riechmann et al ((1988) Nature 332: 323-327) ; Verhoeyen et al ((1988) Science 239: 15341536), substituting rodent CDRs or CDR sequences for the corresponding sequences of a human antibody, so such humanized antibodies are chimeric antibodies (see US Patent 4,816,567 and 6,331,415) In practice, humanized antibodies are typically human antibodies in which some CDR residues and possibly some FR residues are replaced by residues from analogous sites in rodent antibodies.

The choice of human variable domains, both light and

26/58 heavy, to be used in the production of humanized antibodies is very important to reduce antigenicity. According to the so-called best-fit method, the variable domain sequence of a rodent antibody is tested against the entire library of known human variable domain sequences. The human sequence, which is the closest to that of the rodent, is then accepted as the human structure (FR) for the humanized antibody (Sims et al (1993) J Immunol. 151: 2296-2308; Chothia and Lesk (1987) J Mol Biol. 196: 901-917). Another method uses a special structure derived from the consensus sequence of all human antibodies in a particular subgroup of light or heavy chains. The same structure can be used for several different humanized antibodies (Carter et al (1992) Proc Natl Acad Sci U.S.A 89: 4285-4289; Presta et al (1993) J Immunol. 151: 2623-2632).

It is also desired that the antibodies are humanized with high affinity retention for the antigen (i.e., the 11x10 epitope of Stx2) and other favorable biological properties. To achieve this goal, humanized antibodies are prepared by analyzing parental sequences and various humanized conceptual products using three-dimensional models of parental and humanized sequences. Three-dimensional models of immunoglobulin are commonly available and are familiar to those skilled in the art. Available computer programs illustrate and display likely conformational three-dimensional structures of selected candidate immunoglobulin sequences. Inspection of these displays allows the analysis of the possible role of residues in the functioning of the candidate immunoglobulin sequence, that is, the analysis of residues that influence the candidate immunoglobulin's ability to bind to its antigen. In this way, FR residues can be selected and combined from the import and consensus sequences so that the desired characteristic of the antibody, such as increased affinity for the target antigen (s), is achieved. In general, CDR residues are directly and most substantially involved in influencing antigen binding.

Fully human antibodies are useful for treating

27/58 therapeutic treatment of human beings. Such antibodies can be produced, for example, using transgenic mice, which are unable to express endogenous immunoglobulin heavy and light chain genes, but which can express human heavy and light chain genes. Transgenic mice can be immunized in the normal way with a selected antigen, for example, a polypeptide that includes the 11E10 epitope. For example, see PCT Publications numbers WO 94/02602, WO 00/76310; US patent 5,545,806; 5,545,807; 5,569,825; 6,150,584; 6,512,097 and 6,657,103; Jakobovits et al. ((1993) Proc Natl Acad Sci U.S.A. 90: 2551); Jakobovits et al. ((1993) Nature 362: 255-258); Bruggemann et al. (year (1993) in Immunol. 7: 33-40.); Mendez et al. ((1997) Nat Gene. 15: 146156) and Green and Jakobovits ((1998) J Exp Med. 188: 483-495).

Human monoclonal antibodies can also be made by the hybridoma method. Human myeloma and rat-human heteromyeloma cell lines for the production of human monoclonal antibodies have been described, for example, by Kozbor ((1984) J Immunol. 133: 30013005); Brodeur et al. ((1987) Monoclonal Antibody Production Techniques and Applications, pages 51-63, Marcel Dekker, Inc., New York), and Boerner et al. ((1991) J Immunol. 147: 86-95).

Fully human antibodies that recognize a selected epitope can also be generated using a technique called guided selection. In this approach, a selected non-human monoclonal antibody, for example, a mouse antibody, is used to guide the selection of a fully human antibody, recognizing the same epitope (Jespers et al (1994) Biotechnology 12: 899-903).

Examples of techniques that can be used to produce single chain FVS and antibodies include those described in US Patent 4,946,778 and 5,258. 498; Huston et al. ((1991) Meth EnzymoL 203: 46-88.); Shu et al. ((1993) Proc Natl Acad Sci. U.S.A 90: 7995-7999.) And Skerra et al. ((1988) Science 240: 1038-1040). Alternatively, phage display technology (McCafferty et al (1990) Nature 348: 552-553) can be used to produce human antibodies and antibody fragments in

28/58 in vitro, from repertoires of the variable immunoglobulin gene domain (V) from non-immunized donors. Phage display technology can be realized in a variety of formats. See, for example, Johnson and Chiswell ((1993) Curr Opin Struct Biol. 3: 564-571). Various sources of V gene segments can be used for phage display technology. Clackson et al. ((1991) Nature 352: 624-628) isolated a diverse array of anti-oxazolone antibodies from a small random combinatorial library of V genes derived from the spleen of immunized mice. A repertoire of V genes from unimmunized human donors can be constructed, and antibodies to a diverse array of antigens (including autoantigens) can be isolated, essentially, following the techniques described by Marks et al. ((1991) J Mol Biol. 222: 581597.) or Griffith et al. ((1993) EMBO J. 12: 725-734).

The invention provides derivatives or analogs of functionally activated fragments of immunoglobulin molecules that specifically bind to a protein that includes the 11E10 epitope. “Functionally active in this context, it means that the fragment, derivative or analog is capable of inducing anti-anti-idiotype antibodies (that is, tertiary antibodies) that recognize the same antigen that is recognized by the antibody, whose fragment, derivative or analog is derived . Specifically, in a preferred embodiment, the antigenicity of the immunoglobulin molecule idiotype can be improved by excluding the structure and CDR sequences that are Cterminal to the CDR sequence, which specifically recognizes the antigen. To determine which CDR sequences bind the antigens, synthetic peptides containing the CDR sequences can be used in binding assays with the antigen by any method of binding assay known in the art.

The present invention provides antibody fragments, such as, but not limited to, F (ab ') 2, F (ab) 2, Fab', Fab and scFvs. Antibody fragments that recognize specific epitopes can be generated using known techniques, for example, by dividing mediated by pepsin or papain.

29/58

The invention also provides heavy chain and light chain dimers of antibodies of the invention, or any minimal fragment thereof, such as single chain antibodies or FVS (SCAs) (for example, as described in US Patent 4946778; Bird ((1988 ) Science 242: 423-42); Huston et al. ((1988) Proc Natl Acad Sci USA 85: 5879-5883) and Ward et al. ((1989) Nature 334: 544-54), or any other molecule with the same specificity as that of the antibody of the invention. Single chain antibodies are formed by linking the light and heavy chain fragments of the Fv region, through an amino acid bridge, resulting in a single polypeptide chain. in E. coli can be used (Skerra et al (1988) Science 242: 1038-1041).

Alternatively, a clone encoding at least the Fab portion of the antibody can be obtained by screening Fab expression libraries (for example, as described in Huse et al. ((1989) Science 246: 1275-1281)) for clones of Fab fragments that bind to the specific antigen, or by screening antibody libraries (see, for example, Clackson et al ((1991) Nature 352: 624-628) and Hanes and Pluckthun ((1997) Proc Natl Acad Sci USA 94: 4937-4942)).

In other embodiments, the invention provides immunoglobulin fusion proteins of the invention or functionally active fragments thereof. In one example, the immunoglobulin is fused via a covalent bond (for example, a peptide bond) at the N-terminal or C-terminal in an amino acid sequence of another protein (or part of it, preferably at least a portion of 10, 20 or 50 amino acids of the protein) that is not immunoglobulin. Preferably, the immunoglobulin or fragment thereof is covalently linked to another protein at the N-terminal of the constant domain. As stated above, such fusion proteins can facilitate purification, increase half-life in vivo and improve delivery of an antigen through an epithelial barrier to the immune system.

In another embodiment, the invention provides the compositions and use of combined antibodies, antibody fragments and the antibody variants described herein. For example, two or more monoclonal

30/58 be combined for use. In a particular embodiment, an antibody of the invention is combined with an antibody that specifically binds to Stx or Stx1.

Therapeutic administration

The invention also features administration of antibodies developed using the above methods (for example, antibodies that specifically bind to the Stx2 11E10 epitope) to individuals who have, or are at risk of developing, a disease associated with Shiga toxin.

The antibodies of the invention will be formulated, dosed and administered in a manner consistent with good medical practice. Factors for consideration in this context include the specific disorder to be treated, the specific individual to be treated, the individual's clinical condition, the cause of the disorder, the agent's delivery site, the method of administration, the schedule of administration and other factors known to doctors. The therapeutically effective amount of antibody that specifically binds to the 11E10 epitope of Stx2 to be administered will be governed by such considerations, and is the minimum amount necessary to prevent, ameliorate, treat or stabilize a disease associated with Shiga toxin, or symptoms associated with she. The antibody specific for the 11E10 epitope does not need to be, but is optionally formulated with one or more agents currently used to prevent or treat diseases associated with the Shiga toxin (for example, antibodies specific to Stx1, including 13C4, or humanized chimeric derivatives thereof). The effective amount of these other agents depends on the amount of antibodies specific for the 11x10 epitope of Stx2 present in the formulation, the type of disorder or treatment and other factors discussed above.

The antibody is administered by any suitable means, including parenteral, subcutaneous, intraperitoneal, intrapulmonary and intranasal. Parenteral infusions include intramuscular, intravenous, intraarterial, intraperitoneal or subcutaneous administration. In addition, the antibody is properly administered by pulse infusion, particularly with declining doses of the antibody. Preferably the dose is given by injections, more preferably

31/58 intravenous or subcutaneous injections, depending, in part, on whether the administration is brief or chronic.

III. VACCINES

The invention features compositions to stimulate an immune response against the Stx2 protein.

Individuals having or at risk of developing a disease associated with Shiga toxin can be treated by administering a composition (for example, a vaccine), containing the 11E10 epitope of the invention, where the polypeptide does not include the full-length Stx2 polypeptide or the subunit of processed StxA2, preferably in an immunogenically effective amount. The composition can be administered prophylactically and / or therapeutically.

Different types of vaccines can be developed according to standard procedures known in the art. For example, a vaccine can be based on peptide (see, for example, Smith et al. ((2006) Vaccine 24: 4122-4129)), nucleic acid-based vaccines (for example, see Bentacor et al., DNA vaccine encoding the enterohemorragic Escherichia coli 1 (EHEC) Shiga-like toxin 2 (Stx2) A2 and B subunits confers protective immunity to Stx challenge in the murine model Clin. Vaccine Immunol, (epublication ahead of print, PMID 19176691)), bacterial vaccines or the virus base. The vaccine formulation containing a polypeptide or nucleic acid encoding the polypeptide that includes the 11E10 epitope can contain a variety of other components, including stabilizers. The vaccine can also include or be co-administered with one or more suitable adjuvants. The adjuvant ratio for the polypeptide that includes the 11E10 epitope in the vaccine can be determined by standard methods by a person skilled in the art.

In another embodiment, peptide vaccines can use peptides including the 11E10 epitope or functional derivatives thereof as a prophylactic or therapeutic vaccine in several ways, including: 1) as monomers or multimers of the same sequence, 2) combined contiguously or not contiguous with additional strings that can facilitate

32/58 perform aggregation, promote presentation or processing of the epitope (eg, class l / ll targeting sequences) and / or additional antibodies, T helper or CTL epitopes to increase the immunogenicity of the chemically modified epitope 11E10, 3) or conjugated with agents that increase immunogenicity or vaccine delivery (eg, fatty acid or acyl chains, KLH, tetanus toxoid, or cholera toxin), 4) any combination of the above, 5) any of the above in combination with adjuvants, including, but not limited to inorganic gels, such as aluminum hydroxide, and water-in-oil emulsions, as incomplete Freund's adjuvant, aluminum salts, saponins or triterpenes, MPL, cholera toxin, ISCOM'S®, PROVAX®, DETOX®, SAF, Freund's adjuvant, Alum®, Saponin®, among others, and in particular those described in US Patent Nos. 5,709,860; 5,695,770 and 5,585,103, and / or in combination with delivery vehicles, including but not limited to liposomes, NPVs or virus-like particles, microemulsions, attenuated or killed viral or bacterial vectors, and biodegradable microspheres (see, for example) , Kersten and Hirschberg ((2004) Expert Rev of Vaccines. 3.453 - 462); Sheikh et al. ((2000) Curr Opin Mol Ther. 2: 37-54)), and 6) administered by either route or as a means of loading cells with antigen ex vivo.

The doses of a polypeptide, which includes an 11E10 epitope, where the polypeptide is not the full-length Stx2, administered to the individual either as prophylactic therapy or therapy against a disease associated with Shiga toxin can be determined by a person skilled in the art. Generally, doses will contain between about 10 mg □ to 1000 mg, preferably between about 10 mg and 500 mg, more preferably between about 30 mg and 120 mg, more preferably between about 40 mg and 70 mg, more preferably between about 60 mg of the polypeptide that includes the 11E10 epitope.

At least one dose of the polypeptide that includes the 11E10 epitope will be administered to the subject, preferably at least two doses, more preferably four doses, with up to six or more total doses administered. It may be desirable to administer booster doses of the polypeptide

33/58 deo that includes the 11E10 epitope at intervals of one or two weeks after the last immunization, usually a booster dose containing less than or the same amount of the 11E10 epitope as the initial administered dose. In one example, the immunization regimen will be administered in four doses at one week intervals. Since a polypeptide or nucleic acid can be broken down in the stomach, immunization is preferably administered parenterally (for example, subcutaneous, intramuscular, intravenous or intradermal injection). The progress of immunized individuals can be followed by a general medical evaluation, screening for infection by serology and / or gastroscopic examination.

IV. EXAMPLES

Example 1

Monoclonal antibody 11E10 recognizes the A ₁ subunit of Stx2. The binding of 11E10 to Stx2 neutralizes both the cytotoxic and lethal activities of Stx2, but the monoclonal antibody does not bind or neutralize Stx1 despite the 55% identity and 68% similarity in the amino acids of the mature A subunits. In this study, we sought to identify the segment (s) in Stx2 that constitutes the 11E10 epitope and to determine how the recognition of that region by 11E10 leads to toxin inactivation. Towards these goals, we generated a set of chimeric Stx1 / Stx2 molecules and then evaluated the ability of 11E10 to recognize those hybrid toxins by means of Western blot analyzes and neutralize them in Vero cell cytotoxicity assays. The amino acid sequences and crystal structures of Stx1 and Stx2 were also compared for dissimilarity stretches that can predict a binding epitope in Stx2 for 11E10. Through these evaluations, it was concluded that the 11E10 epitope is composed of three non-contiguous regions around the active site of Stx2. To ask how 11E10 neutralizes Stx2, we examined the ability of 11E10 / Stx2 complexes to reach ribosomes. The binding of 11E10 to Stx2 was found to prevent the toxin from inhibiting protein synthesis in an in vitro assay, but also to alter the overall cellular distribution of Stx2 in Vero cells. It has been proposed that the binding of monoclonal antibody 11E10 to Stx2 neu

34/58 tralizes at least some, if not all, of the toxin's effects and can do so by preventing the toxin from reaching or inactivating ribosomes.

Passive immunization strategies to neutralize Stxs associated with STEC infections (Dowling et al. (2005) Antimicrob. AgentsChemother. 49: 1808-1812, Edwards et al. (1998) In JB Kaper and AD O'Brien (ed .), Escherichia coli O157: H7 and other Shiga toxinproducing E. coli strains. ASM Press, Washington, DC., Kimura et al. (2002) Hybrid. Hybridomics. 21: 161-168, Ma et al. (2008) Immunol Lett. 121: 110115, Mukherjee et al. (2002) Infect. Immun. 70: 612-619, Mukherjee et al. (2002) Infect. Immun. 70: 5896-5899.). The passive immunization strategy is based on monoclonal antibodies from murines developed in this laboratory that specifically bind and neutralize Stx / Stx1 or Stx2 (Strockbine et al. (1985) Infect. Immun. 50: 695-700, Perera et al. (1988 ) J Clin Microbiol 26: 2127-2131). Monoclonal antibody 11E10 was generated by immunizing BALB / c mice with detoxified Stx2 by treatment with formaldehyde (Perera et al., Supra). By Western blot analysis, monoclonal antibody 11E10 specifically recognizes the Ai fragment of Stx2 and neutralizes Stx2 for Vero cells and mice, but does not bind or neutralize Stx / Stx1 (Edwards et al, supra; Perera et al. Supra. The antibody monoclonal murine 11E10 has been modified to contain a constant human region to reduce the potential for an antibody receptor to generate an anti-mouse antibody response.This chimeric human / mouse antibody, called cüStx2, has successfully passed the Phase I clinical test (Dowling et al., supra) In this report, the epitope was defined in the A subunit of stx2 recognized by the murine monoclonal antibody 11E10 (and therefore also by cüStx2) in the A subunit of Stx2, and evidence was presented that the Monoclonal antibody blocks the enzymatic action of the toxin in vitro and also alters toxin trafficking in Vero cells.

Materials and methods

Strains of purified bacteria, plasmids, Stx1 and Stx2, and monoclonal antibodies 11E10 and 13C4.

Bacteria were grown in Luria-Bertani broth (LB) or in

35/58 LB agar (Becton Dickinson and Company, Sparks, MD) supplemented with 100 g / ml ampicillin, as needed for selection of recombinant plasmids. The strains of bacteria and plasmids used in this study are listed in Table 1. Stx1 and Stx2 were purified by affinity chromatography 5, as previously described (Melton-Celsa and O'Brien (2000) pp. 385-406. In Handbook of Experimental Pharmacology, vol. 145. SpringerVerlag, Berlin) and monoclonal antibodies 11E10, 11F11 (specific for Stx2 (Perera et al., Supra) and 13C4 [specific for Stx1 (Strockbine et al. (1985) Infect. Immun. 50: 695 -700)] were produced in this laboratory and 10 were approved with EIB resources (Manassas, VA).

Table 1. Strains of bacteria and plasmids used in this study.

Strain or plasmid Relevant characteristics Source or reference E. coli strains Dh5ü F-80 dlacZ_M15 _ (lacZYA-argF) U1Q9 endA1 re- cA1hsdR17 (rK-mK +) deoR thi-1 phoA supE44 _-gyrA96 relA1 Gibco BRL XL10 Gold Tetr A (mcrA) 183 A (mcrCB-hsdSMRmrr) 173 endA1 supE44 thi-1 recA1 gyrA96 relA1 lac Hte [F 'proAB laclqZAM15 Tn10 (Tetr) Amy Camr] Stratagene BI21 (DE3) FompT hsdS _B (rB-m _b ) gal dem (DE3) Novagen EH250 E .coli Ount isolate: H12; Stx2d producer Pierard et al. (1998) J Clin Microbiol 36: 3317-3322 Cloning Vectors pBluescript II KS (-) E. coli cloning vector (Amp ^r ) Stratagene pTRCHIS2c Expression Vector Invitrogen

36/58

Strain or plasmid Relevant characteristics Source or reference E. coli (Amp ^r ) Plasmids Re- combining pCKS120 Stx _2c p- BR328 toxin clone Lindgren et al. (1994) Infect. Immun. 62: 623-631 pJES1O1 Stx _2e pKS toxin (-) clone Samuel et al. (1990) Infect. Immun. 58: 611-618 pSQ543 StX ₂ dact pSK toxin (-) clone Lindgren et al. (1994) Infect. Immun. 62: 623-631 pMJS1 PBluescript II toxin clone KS (-) from stx-i Smith et al. (2006) Vaccine 24: 4122-4129 pMJS2 StBl ₂ pBluescript II toxin clone (-) Smith et al. (2006) Vaccine 24: 4122-4129 pMJS9 PBluescript II KS toxin clone (-), chimeric stxAi-stxA ₂ gene (StxA2 = amino acids 29-297 + StxB2) This study pMJSIO KBl pBluescript II toxin clone (-), chimeric stxAi-stxA ₂ gene (StxA2 = amino acids 1-158) This study pMJS11 Toxin clone pTrcHis2 C, chimeric stxAistxA ₂ gene (StxA2 = 1158 amino acids) This study pMJS13 PBluescript II toxin clone KS (-), chimeric stxAi-stxA ₂ gene (StxA2 = amino acids 29-128) This study pMJS15 KBl pBluescript II toxin clone (-), chimeric stxA-i-stxA ₂ gene (StxA2 = aa 29-76) This study

37/58

Strain or plasmid Relevant characteristics Source or reference pMJS16 toxin clone pBluescript II KS (-), chimeric stxAi ~ stxA ₂ gene (StxA2 = amino acids 42-76) This study pMJS28 toxin clone pBluescript II KS (-), chimeric stxAi ~ stxA ₂ gene (StxA2 = amino acids 42-49) This study pMJS49 stxi pTrcHis2 C toxin clone This study pMJS49A toxin clone pTrcHis2 C, chimeric stxAistxA ₂ gene (StxA2 = amino acids 42-49) This study pMJS49AB toxin clone pTrcHis2 C, chimeric stxA-istxA ₂ gene (StxA2 = amino acids 42-49, 96-100) This study pMJS49AC toxin clone pTrcHis2 C, chimeric sfxAjstxA ₂ gene (StxA2 = amino acids 42-49, 244-259) This study pMJS49BC toxin clone pTrcHis2 C, chimeric stxAistxA ₂ gene (StxA2 = amino acids 96-100, 244-259) This study pMJS49ABC toxin clone pTrcHis2 C, chimeric stxAistxA ₂ gene (StxA2 = amino acids 42-49, 96-100, 244259) This study pMJS50 stx ₂ pTrcHis2 C toxin clone Robinson et al. (2006) PNAS 103: 9667-9672 pMJS52 stx _2c pTrcHis2 C toxin clone This study pMJS59 pTr- toxin clone This study

38/58

Strain or plasmid Relevant characteristics Source or reference stx _2d cHis2 C pMJS49ABC * pMJS49ABC with Y77S mutation This study

Construction of chimeric toxin plasmids.

Six chimeric toxin genes that contained portions of both stxA1 and stxA2 were generated by PCR with the junction by the overlap extension protocol (SOE) (Higuchi (1989) p. 61-70. In HA Erlich 5 (ed.), PCR Stockton Press, New York), and PCR products were linked in pBluescript II KS (-) (Stratagene, La Jolla, CA). The chimeric toxin genes contained the native promoters and ShineDalgarno sequences, and the toxin expression levels of five of the clones were sufficient under these conditions. To increase the expression level of subunit A from a clone (pMJS11), the toxin operon was amplified by

PCR a second time and an optimized Shine-Dalgarno sequence [TAAGGAGGACAGCTATG (the optimized Shine-Dalgarno sequence is underlined and the translation start site for StxA2 is in bold) SEQ ID NO: 20] has been added upstream of stxA ₂ . This latter PCR product was ligated into the pTrcHis2 C expression vector (Invitrogen, Carlsbad, CA) which has an isopropyl-pD-thiogalactopyranoside (IPTG) inducible promoter. All primers used in this study are listed in Table 2.

Table 2. Synthetic oligonucleotide primers used in this study

Initiator String (5'-3 ') ^a ' ^b Purpose / Homology Region MJS1 GATCCT GATCCCCCTGTAACGAAGI I IGCGTAACAGC (SEQ ID NO: 21) Upstream initiator sx-ι, used to generate pMJS9, pMJS13, pMJS15, pMJS16 and pMJS28 MJS2 GATCGAATTCTCGCTTACGATCATCAAAGAGATCATACC (SEQ ID NO: 22) downstream initiator stx-i, used to generate pMJSIO, pMJS11, pMJS13, pMJS15, pMJS16 and pMJS28 MJS5 GATCGGATCCAGCAAGGGCCACCA- upstream initiator stx ₂ , used to generate pMJSIO

39/58

Initiator String (5'-3 ') ^a ' ^b Purpose / Homology Region TATCACA- TACCGCC (SEQ ID NO: 23) MJS6 CAGGGGAATTCACCATGCGAA- Al I I I I I IAACAAATGC (SEQ ID NO: 24) downstream initiator stx ₂ , used to generate pMJS9 2A29F GAACATATATCTCAGGGGACCAC (SEQ ID NO: 25) Used with 1A28R to generate pMJS9, pMJS13epMJS15 1A28R GTGGTCCCCTGAGA TATATGTTCTAATGGAGTACCTATTGCAGAGCG (SEQ ID NO: 26) Used with 2A29F to generate pMJS9, pMJS13epMJS15 1A159F TTACGGI I IGI TACTGTGACAGCTGAAGC (SEQ ID NO: 27) Used with 2A158R to generate pMJSIO and pMJS11 2A158R GCTTCAGCTGTCAC AGTAACAAACCGTAAAACTGCTCTGGATGCATCTCTGGT (SEQ ID NO: 28) Used with 1A159F to generate pMJSIO and pMJS11 1A129F CAGATAAATCGCCATTCGT TGA (SEQ ID NO: 29) Used with 2A128R to generate pMJS13 2A128R TCAACGAATGGCGAI I IATCTGCATTCCGGAACGTTCCAG CGC (SEQ ID NO: 30) Used with 1A129F to generate pMJS13 2A42F GGTACGTCI I I AC IG ATGATTAACCACACCCCACCGGGCAGTTAI I I IGC (SEQ ID NO: 31) Used with 1A41R to generate pMJS16 1A41R GCAAAATAACTGCC CGGTGGGGTGTGGT TAATCATCAGTAAAGACGTACC (SEQ ID Used with 2A42F to generate pMJS16

40/58

Initiator String (5'-3 ') ^a ' ^b Purpose / Homology Region NO: 32) 1A77F TATGTGACAGGA I I IGTTAACAGGAC (SEQ ID NO: 33) Used with 2A76R to generate pMJS15 2A76R GTCCTGTTAACAAATCCTGTCACATATAAAT- TA I I I IGCT CAA- TAATCAGACGAAGATGG (SEQ ID NO: 34) Used with 1A77F to generate pMJS15 1A51 AGGAGGACAGCTATGAAAATAATTAI I I I IAGAGTGCTA (SEQ ID NO: 35) upstream primer stxA-ι # 1 with optimized Shine-Dalgarno sequence, used to generate pMJS49 1A52 GATCGGATCCTAAGGAGGACAGCTATGAAAATAATT (SEQ ID NO: 36) upstream stxAi # 2 primer with optimized Shine-Dalgarno sequence, used to generate pMJS49 1BC1 GGTGGTGGTGACGAAAAATAACTTCGCTGAATCC (SEQ ID NO: 37) Downstream initiator with His stxBi # 1 marker, used to generate pMJS49 1BC2 CAGTGGTGGTGGTG GTGGTGACGAAAAATAAC (SEQ ID NO: 38) Downstream initiator with His stxB-i # 2 marker, used to generate pMJS49 BC3 GATCGAATTCTCAGTGGTGGTGGTG GTGGTG (SEQ ID NO: 39) Downstream initiator with His stxB-ι # 3 marker, used to generate pMJS49 and pMJS52 MSAF AACCACACCCCACC GGGCAGTTAI I I IGCAGTTGATGTCAGAGGG (SEQ ID NO: 40) Used with MSAR to generate pMJS28, pMJS49A, pMJS49AB, pMJS49AC and pMJS49ABC MSAR ATAACTGCCCGGTG GGGTGTGGTTAATCATCAGTAAAGACGTACC (SEQ ID NO: 41) Used with MSAF to generate pMJS28, pMJS49A, PMJS49AB, pMJS49AC and pMJS49ABC 961OOF ACACATATATCAGTG CCAGGTACAA- Used with 96100R to generate pMJS49AB, pMJS49BC and

Initiator String (5'-3 ') ^a ' ^b Purpose / Homology Region CAGCGGTTACATTGTCTGG (SEQ ID NO: 42) pMJS49ABC 96100R ACCTGGCACTGATA TATGTGTAAAATCAGCAAAGCGATAAAAAACA (SEQ ID NO: 43) Used with 961 OOF to generate pMJS49AB, pMJS49BC and pMJS49ABC JCT1F GTGAATGAAGAGAG TCAACCAGAATGTCCGGCAGATGGAAGAGTCCG (SEQ ID NO: 44) C # 1 region primer, used with JCT1R to generate pMJS49AC, pMJS49BC and pMJS49ABC JCT1R TTCTGGTTGACTCTCTTCATTCAC (SEQ ID NO: 45) C # 1 region primer, used with JCT1F to generate pMJS49AC, pMJS49BC and pMJS49ABC JCT2F GGCATTAATACTGAA TTGTCATCATCAGGGGGCGCGTTC TGTTCGC (SEQ ID NO: 46) C # 2 region primer, used with JCT2R to generate pMJS49AC, pMJS49BC and pMJS49ABC JCT2R ATGATGACAATTCAGTATTAATGCC (SEQ ID NO: 47) C # 2 region primer, used with JCT2F to generate pMJS49AC, pMJS49BC and pMJS49ABC 2A51 AGGAGGACAGCTATGAAGTGTATATTAI I IAAATGGGT (SEQ ID NO: 48) upstream stxA ₂ # 1 primer with optimized Shine-Dalgarno sequence, used to generate pMJS11 and pMJS52 2A52 GATCGGATCCTAAGGAGGACAGCTATGAAGTGTA (SEQ ID NO: 49) upstream stxA ₂ # 2 primer with optimized Shine-Dalgarno sequence, used to generate pMJS11 and pMJS52 C12B GGTGGTGGTGGTCATTATTAAACTGCACTTC (SEQ ID NO: 50) Downstream initiator with His stxB ₂ # 1 marker, used to generate pMJS52 C22B CAGTGGTGGTGGTG GTGGTGGTCATTATTAAA (SEQ ID NO: 51) Downstream initiator with His stxB ₂ # 2 marker, used to generate pMJS52 2dF GATCGGATCCCTGGGATCCCTGGTATCGTATTACTT- Used with 2dR to generate pMJS59

42/58

initiator Sequence (5'-3 ') ^{a, b} Purpose / Homology Region CAGCC (SEQ ID NO: 52) 2dR GATCGAATTCCTGCACACTACGAAACCAGC (SEQ ID NO: 53) Used with 2dF to generate pMJS59 1Y77SF TCAGTGACAGGATTTGTTAACAGGAC (SEQ ID NO: 54) Used with 1Y77SR to generate pMJS49ABC * 1Y77SR GTCCTGTTAACAAATCCTGTCACTGATAAAT- TAI I ICGTTCAACAATAAGCCG (SEQ ID NO: 55) Used with 1Y77SF to generate pMJS49ABC *

^a Restriction enzyme sites are underlined. ^b Mutagenic codon sites are in bold.

Five additional His-tagged chimeric toxins were generated from a stxi clone that contained six histidine codons immediately downstream of the B gene (figure 2A). The toxins produced by these chimeras contain one, two or three regions from the subunit Stx2 A (hereinafter referred to as regions A, B and C) comprising the putative 11E10 monoclonal antibody epitope in place of the comparable sequence in Stx1. Regions A, B, and C refer to amino acids 42-49 (SEQ ID NO: 1), 96-100 (SEQ ID NO: 2), and 244-259 (SEQ ID NO: 3), respectively , of the Stx2 A subunit. The five chimeric toxins made were named: Stx1 + A (containing the chimeric sequence Stx2 A determined in SEQ ID No.: 4), Stx1 + AB (containing the chimeric sequence Stx2 A determined in SEQ ID No. : 5), Stx1 + AC (containing the chimeric sequence Stx2 A determined in SEQ ID NO: 6), Stx1 + BC (containing the chimeric sequence Stx2 A determined in SEQ ID NO: 7), or Stx1 + ABC (containing the chimeric sequence Stx2 A determined in SEQ ID NO: 8).

Generation and purification of partially toxoided Stx1 + ABC.

The toxin Stx1 + ABC was partially toxoidized altering the residue

43/58 tyrosine duo at position 77 of subunit A for a serine residue by the SOE protocol. The Y77S mutation decreased the cytotoxic dose by 50% (CD ₅ o) for Vero cells from 10 ⁶ to 10 ² CD ₅₀ s per ml of induced culture. This 4 log reduction in cytotoxicity after the Y77S mutation has been introduced is similar to that previously reported for the Y77S mutation in Stx1 (Deresiewicz et al. (1992) Biochemistry 31: 3272-3280).

The toxoid Stx1 + ABC was purified with a nickel affinity column as described previously (Smith et al. (2006) Infect. Immun. 74: 6992-6998). The concentration of the toxoid was determined by analysis of bicinconinic acid (Pierce, Rockford, IL). A silver marking of a dodecyl sulfate-polyacrylamide gel revealed that the chimeric toxoid subunits A and B were the two largest bands present, although other smaller bands were observed (data not shown).

Construction of Stx2c and Stx2d variant clones.

A clone that expressed His-tagged Stx2c was created by PCR as previously described for Stx2 (Robinson et al. (2006) Proc. Natl. Acad. Sci. USA 103: 9667-9672). The stx ₂ d clone was generated by PCR from E. coli EH250 with primers 2DF and 2DR (Pierard et al. (1998) J. Clin. Microbiol. 36: 3317-3322). The PCR product was ligated into the pTrcHis2 C expression vector. The correct amplification of stx _2c and stx _2d was confirmed by sequence analysis.

Western blot analysis

Purified Stx1 and Stx2 or sonic lysates from bacteria that expressed chimeric Stx1 / Stx2 toxins were subjected to sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) and then examined by Western blot analysis as previously described (Smith et al. , supra). The concentrations of A subunits in sonic lysates that contained Stx1, Stx2, or chimeric toxins were estimated as follows. First, specific dilutions of rabbit polyclonal anti-Stx1 and anti-Stx2 antibodies that detected the purified A subunits of Stx1 or Stx2, respectively, to relatively equivalent levels were determined using the NIH Image J software,

44/58 http://rsb.info.nih.gov/nih-image. Second, the sonic lysates containing chimeras were separated by SDS-PAGE, the resulting gels were then transferred to nitrocellulose and those blots were then probed with a mixture of diluted rabbit anti-Stx1 and anti-Stx2 polyclonal antibodies as determined above. Third, the bands that corresponded to the chimeric A subunits in each row were quantified with the NIH Image J program to determine the concentration of toxin in each lysate sample. Finally, two additional polyacrylamide gels were loaded with purified Stx1 and Stx2 or samples of the lysates containing standard chimeras to contain equivalent concentrations (as determined from step 3). The toxin preparations were then subjected to SDS-PAGE followed by Western blot analysis with a mixture of rabbit polyclonal antibodies anti-Stx1 and anti-Stx2 (figure 1B, upper panel) (blot 1) or monoclonal antibody 11E10 (figure 1B , bottom panel) (blot 2). Secondary antibodies used in these Western analyzes were goat anti-rabbit immunoglobulin G (IgG) conjugated to horseradish peroxidase [(HRP) Bio-Rad, Hercules, CA] at a dilution of 1: 15,000 for blot 1 (figure 1B , upper panel) and goat anti-mouse IgG conjugated to HRP (Bio-RAD, Hercules, CA) at a dilution of 1: 3,000 for blot 2 (figure 1B, lower panel). Bound secondary antibodies were detected by chemiluminescence with the ECL-Plus Western blotting detection kit (Amersham Bioscience, Little Chalfont, Buckinghamshire, England).

Western blot analyzes were also performed on sonic lysates that expressed Stx2, Stx2c, Stx2d, Stx2d _act or Stx2e. First, the concentration of A subunits from these toxin samples was determined as described above, with the exception that only rabbit polyclonal anti-Stx2 antibodies were used as a probe. Then, two additional polyacrylamide gels were loaded with equivalent amounts of the standard samples, and Western blot analyzes were conducted with rabbit polyclonal anti-Stx2 antibodies or with monoclonal antibody 11E10 as the primary antibodies. Antibodies

45/58 and the detection method were the same as described above.

In vitro neutralization analyzes in Vero cells.

In vitro neutralization analyzes of sonic lysates from bacteria containing Stx1, Stx2, chimeric toxins Stx1 / Stx2, Stx2c, Stx2d, Stx2dact, or Stx2e were performed with 11E10 in Vero cells (ATCC, Manassas, VA) as previously described (Marques et al. (1986) J Infect. Dis. 154: 338-341; Smith et al., Supra). In summary, equal volumes of samples containing the toxin (one to three CD ₅₀ s) in Eagle's Minimum Essential Medium (EMEM) and purified monoclonal antibody 11E10 (0.5 mg / ml) in EMEM were mixed and incubated for 2 hours at 37 üC and 5% CO ₂ . The toxin and antibody mixture was then superimposed on subconfluent Vero cells in 96-well plates and incubated for 48 hours. Vero cells were then fixed, labeled and the optical density at 600 nm (OD ₆₀ o) was determined. These neutralization experiments were performed at least twice. The ability of monoclonal antibody 11E10 to neutralize the cytotoxic effect of the toxin on sonic lysates was determined by comparing cell viability in wells where the toxin alone or toxin and antibody were added. The percentage of neutralization of toxins by the antibody was calculated using the following formula. Neutralization percentage: [(OD ₆ oo Average toxin + Antibody wells - OD ₆ oo Average toxin only wells) / (OD ₆ oo average cells only cells -OD ₆ oo Average toxin only wells)] x 100. Monoclonal antibody 11E10 neutralized Stx2 to about 65% of wild-type activity. To make it easier to compare the percentage of neutralization levels of the toxin derivatives by monoclonal antibody 11E10, the data were normalized so that the amount of Stx2 neutralization by 11E10 was set at 100%, and the neutralization levels of the other toxins were calculated in relation to Stx2.

Immunization and challenge of mice

Preimmune sera were collected from male CD-1 mice weighing 14 to 16 g (Charles River Laboratories, Boston, MA). These serum samples were used in immunosorbent assays

46/58 enzyme-linked tests (ELISA) to determine whether mice had pre-existing titers to Stx1 or Stx2. None of the mice showed an immune response to any toxins at the start of the study. The mice were then divided into two groups: a simulated inoculated group (hereinafter referred to as a negative control group) and a group that was immunized with the chimeric toxoid. The mice in the negative control group were immunized intraperitoneally with a mixture of PBS and TiterMax, in water-in-oil adjuvant (TiterMax, USA Inc., Norcross, GA). The second group of mice was immunized intraperitoneally with 1 µg of toxoid mixed with TiterMax. The mice were boosted at 3-week intervals for a total of four enhancements. Two weeks after the last potentiation, five negative control mice and five toxoid-immunized mice were challenged intraperitoneally with 10 times the 50% (LD ₅₀ ) lethal dose of Stx1 (1,250 ng), and 29 negative control mice and 34 mice toxoid immunized were challenged with 5 LD ₅₀ s of Stx2 (5 ng).

In vitro protein synthesis inhibition analyzes.

Rabbit reticulocyte lysate, firefly mRNA luciferase and luciferin substrate were purchased from Promega Corporation (Madison, Wl). Stx2 (4 ng / μΙ) was combined with an equal volume of antibody (at 4 or 40 ng / μΙ), and 1 μΙ of the toxin / antibody mixture was combined with 9 μΙ of reticulocyte lysate. The mixture was incubated at 30 ⁰ C to allow the toxin to inactivate ribosomes lysate. After 1 hour, an aliquot of mRNA luciferase and amino acids that had been heated to 70 ° C for 2 minutes was added, and the solution was incubated for another 90 minutes to allow protein synthesis in vitro. All analyzes were performed in triplicate. Luciferase activity was measured by adding 1 μΙ of the listed mixture to 20 μΙ of luciferin substrate in clean 96-well plates (Fisher Scientific, Pittsburgh, PA). Emission of bioluminescent light was detected with Kodak Image Station 440CF in a 10-minute exposure. The luminescent signal was analyzed by the sum of the total intensity of signals within a circular area that corresponded to a single well.

47/58

Localization of 11E10 in intoxicated cells

Vero cells were seeded on 8-well tissue culture slides (Thermo Fisher Scientific, Rochester, NY) at a concentration of 1 X 10 ⁵ cells / ml and were able to adhere for 24 hours at 37 ° C in an atmosphere of 5% CO2. Stx2 (0.2 ml of 10 ng / ml) was mixed with 10 ng of purified monoclonal antibody 11E10 or with PBS as a negative control. The antibody / toxin or PBS / toxin solutions were incubated with Vero cells for 6 hours, and then the cells were fixed with buffered formalin (Formalde-Fresh, Fisher Scientific, Pittsburgh, PA) and permeabilized with 0.001% Triton-X100 (Pierce, Rockford, IL) in PBS. All immunostaining procedures were performed in PBS with 3% bovine serum albumin (BSA, Sigma, St. Louis MO). The presence of monoclonal antibody 11E10 inside the cells was detected with Alexa-Fluor 488-labeled donkey anti-mouse IgG (Invitrogen, Carlsbad, CA). The total Stx2 within the intoxicated cells was marked with polyclonal rabbit anti-Stx2 antibodies, and donkey anti-rabbit IgG conjugated to AlexaFluor was used as the secondary antibody (Invitrogen, Carlsbad, CA). Stx2 and double endosome labeling was performed with monoclonal anti-Stx2 antibody 11F11 (Perera et al., Supra), BEI Resources, Manassas, VA) and polyclonal goat anti-EEA1 (C-15) antibodies (Santa Cruz Biotechnology, Santa Cruz, CA), respectively, and secondary antibodies labeled with Alexa-Fluor. After incubation with the appropriate primary and secondary antibodies, the cells were fixed with formalin for 20 minutes at 37 üC, and the slides were mounted with SlowFade medium (Invitrogen, Carlsbad, CA). The 40x magnification images of the attached fluorophore-labeled secondary antibodies were obtained using an Olympus microscope with reflected light fluorescence binding and a Spot CCD digital camera (Diagnostic Instrument Products, Sterling Heights, Ml). The fluorescence images were processed and overlaid with Adobe Photoshop (Adobe Systems, San Jose, CA).

48/58

Results

Interaction of initial chimeric toxins with monoclonal antibody 11E10.

To determine the portion of Stx2 that interacts with monoclonal antibody 11E10, an initial set of six chimeric toxin operons was constructed that contained different regions of the stxA ₂ gene inserted in place of the corresponding region of stxAi (figure 1A). Western blot analyzes of Stx1, Stx2, or purified E. coli DH5a lysates that express one of six different chimeric Stx1 / Stx2 toxins were probed with the 11E10 monoclonal antibody. The antibody reacted strongly with Stx2 and the chimeric toxins that contained the amino acids from the following regions of the Stx2 A subunit: 29 to 297, 1 to 158, and 29 to 128 (figure 1B). The chimeric toxin with the minimal portion of Stx2 that was still recognized by 11E10, although weak, contained only eight amino acids of StxA2, region 42 to 49.

Then, the ability of monoclonal antibody 11E10 to neutralize the toxicity of bacterial lysates that contained Stx1, Stx2 or one of the six initial chimeric toxins for Vero cells was examined. As expected, monoclonal antibody 11E10 neutralized Stx2, but did not neutralize Stx1 (figure 1C). However, hybrid toxins with StxA2 region 1 to 158 or 29 to 297 were about 85% neutralized by 11E10 compared to Stx2, a result that suggested that important components of the 11E10 epitope are among residues 29 to 158 of Stx2 . In contrast, the chimeric toxin with amino acids 29 to 128 of Stx2 was recognized strongly in the immunoblot, but was neutralized only at about 32% of the level of Stx2. Together, these findings suggest that the 11E10 neutralizing epitope comprises a greater number of amino acids than required for binding 11E10 to Stx1 (2A ₂₉ .i ₂₈ ) in a Western blot analysis and, therefore, that a portion of the neutralizing epitope is missing from this hybrid. The other three chimeric toxins that were weakly detected by monoclonal antibody 11E10 in Western blot analysis were not appreciably neutralized by 11E10 (less than 15%) compared to the normalized level of Stx2 neutralization. Taken together, these results

49/58 show that one or more important components of the neutralizing epitope 11E10 in Stx2 exist outside amino acids 29 to 76.

Analysis of differences between the amino acid sequences of subunit A Stx1 and Stx2 A and crystal structures.

Western blot and neutralization analyzes of the first set of chimeric toxins indicated that the 11E10 epitope required at least amino acids 42-49 of the Stx2 A subunit (SEQ ID NO: 1) for the detection of toxin, but also revealed that additional amino acids were necessary for the full recognition and neutralization of toxins. Therefore, the amino acid sequences of the mature A subunits of Stx1 and Stx2 have been aligned to identify additional unique stretches of amino acids that may be involved in the recognition and neutralization of Stx2 by 11E10. Then, the crystalline structures of Stx (Fraser et al. (1994), supra) and Stx2 (Fraser et al. (2004), supra) (Protein Database, accession numbers 1RQ4 and 1R4P, respectively) were compared through the Deep View / Swiss-PDB viewer to assess the location of regions of sequence differences between toxins in three-dimensional structures and the proximity of these regions to each other. As previously stated, the eight amino acids that comprise residues 42-49 in the Stx2 A subunit form part of the 11E10 binding site and are hereinafter referred to as region A or SEQ ID NO: 1 (figure 2A; marked amino acids from Region A). When the eight amino acids in region A were visualized in the context of the crystal structure Stx2, they appeared to form a larger fold in the structure of the toxin (as indicated in green and by a black arrow in figure 2B and also as indicated in figure 2C) and, in addition In addition, they were found on the outer face of Stx2, close to the active site gap around amino acid 167.

A second dissimilar area between the A subunits of Stx1 and Stx2 was identified when the amino acid sequences and crystalline structures of these two toxins were compared, a segment we call region B or SEQ ID NO: 2 (see figure 2A; marked amino acids Region Β). Region B covers five residues in the A subunit of Stx2

50/58 (96THISV100) (SEQ ID NO: 2) and four of the five amino acids in this region differ between Stx1 and Stx2 (figure 2A). Although region B is approximately 50 amino acids away from region A, that portion of amino acids extends towards region A in the crystal structure Stx2 (region B is indicated in blue and by a gray arrow in figure 2B). The proximity of region A to region B in a three-dimensional structure is even more evident in a space filling model (figure 2C).

The third dissimilar area between the A subunits of Stx1 and Stx2, which was called region C or SEQ ID NO: 3, overlaps the furin dividing site around residue 246 of Stx2 (see figure 2A; marked amino acids from region C). Region C was identified not only because of the differences in amino acid sequence between Stx1 and Stx2 at that location, but also because the comparison of the crystalline structures of Stx and Stx2 indicated that region C (as indicated in cyan and by a white arrow in the figure 2C) was in spatial proximity to regions A and B. From the analysis of crystal structures Stx and Stx2 it was concluded that regions A, B and C are grouped on the same face as Stx2, relatively close to the active catalytic site (as seen best in figure 2C).

Interaction of second generation chimeric toxins with monoclonal antibody 11E10.

To determine whether regions B and C were part of the 11E10 epitope, a second set of chimeric toxins was produced which contained various combinations of regions A, B or C of Stx2 in place of the corresponding regions in Stx1 (figure 3A). Then, Western blots of Stx1, Stx2 or chimeric toxins were probed with 11E10 (figure 3B, bottom panel). Monoclonal antibody 11E10 detected all toxins that contained region A (Stx2, Stx1 + A, Stx1 + AB, Stx1 + AC and Stx1 + ABC) (figure 3B, bottom panel). Toxins without region A were not detected by monoclonal antibody 11E10 (Stx1 and Stx1 + BC), a finding that confirms that region A is an essential component of the 11E10 epitope. However, the two chimeric toxins that incorporated regions A and B (Stx1 + AB or Stx1 + ABC) appeared to be more strongly detected by the antibody

51/58 monoclonal powder 11E10 than chimeric toxins that included region A alone or combined with region C (figure 3B, bottom panel). Collectively, these results indicate that both regions A and B are important for the full recognition of 11E10 of the toxin.

Next, sonicated lysates from each of the five second generation chimeric toxins (figure 3A) were analyzed for in vitro neutralization by monoclonal antibody 11E10. The antibody neutralized the chimeric toxin that contained regions A, B and C (Stx1 + ABC) to approximately 65% of the level of neutralization of Stx2. In contrast, chimeric toxins that contained only regions A and B (Stx1 + AB) or A and C (Stx1 + AC) were neutralized to about half the level of neutralization of the chimera Stx1 + ABC (figure 3C). No appreciable neutralization by 11E10 was observed against the chimeric toxins Stx1 + A or Stx1 + BC (approximately 6.9 and 4.3% respectively). As the more extensive neutralization (> 50%) of the chimeric toxins required Stx2 regions A, B and C, we concluded that all three regions (A, B and C) are necessary for neutralization> 50% by 11E10.

Western blot and results of the in vitro neutralization assay with Stx2 and variants of Stx2 and monoclonal antibody 11E10.

To determine which variants of Stx2 could be recognized and / or neutralized by 11E10, Stx1, Stx2, or the variants of Stx2 (Stx2c, Stx2d, Stx2dact and Stx2e) were analyzed by Western blot. Stx2 and all variants of Stx2 were recognized by 11E10, although Stx2e was detected to a much lesser extent (figure 4A, bottom panel). This weak detection of Stx2e by 11E10 in the Western blot format is consistent with the previous report that 11E10 was unable to detect the Stx2e producing strains by colony blot (Perera et al., Supra). Stx2e has two differences in conservative amino acids in region B compared to Stx2 (AHISL (SEQ ID N °: 19) instead of THISV (SEQ ID N °: 2)). There are also several differences in the amino acid sequence immediately adjacent to region A. (not shown) It has been conjectured that these differences may be responsible for the reduced recognition of Stx2e by 11E10 in

52/58

Western blot.

When the neutralizing ability of monoclonal antibody 11E10 to the variant toxins of Stx2 was assessed, it was found that 11E10 neutralized all variant toxins of Stx2 to more than or 60% of the level of neutralization of Stx2 (figure 4B). We were surprised by the level of neutralization observed by 11E10 of Stx2e due to the limited recognition of Stx2e by 11E10 in the Western blot format (figure 4A, bottom panel). However, the neutralization of Stx2e by 11E10 in this study is in agreement with the previous result, which showed that 11E10 partially neutralizes Stx2e (Perera et al., Supra).

Immune and protective response of Stx1 + ABC toxoid in mice.

Next, we sought to determine whether a toxoid derivative of the hybrid molecule Stx1 + ABC could cause a seroneutralizing or protective response to Stx2 in mice. Groups of mice were immunized with the chimeric toxoid or PBS as a control. Serum from five toxoid-immunized mice and five mice immunized with PBS were then evaluated by a neutralizing anti-Stx1 response. None of the mice sera immunized with PBS contained neutralizing activity of Stx1. As expected from previous studies, all five mice immunized with toxoid had neutralizing antibodies directed against Stx1 (Smith et al. (2006) Vaccine 24: 4122-4129, Wen et al., Supra). The mean anti-Stx1 neutralization titer for the serum of these five mice was 4.0 ± 0.9 log above the bottom. Eleven of the sera from the 34 remaining toxoid-immunized mice had some neutralizing response to Stx2, while none of the sera from the 29 PBS-immunized mice exhibited any anti-Stx2 response (data not shown).

Two weeks after the final impulse, five negative control mice and five toxoid-immunized mice were challenged intraperitoneally with 10 LD50s of Stx1. All the negative control mice died, while all the mice immunized

53/58 of toxoids survived the lethal challenge (Table 3), as predicted from the results of a previous study (Smith et al. Supra, Wen et al., Supra). In addition, the survival of mice immunized with toxoid that were challenged with Stx1 was directly correlated with the in vitro neutralization titers of those mice.

Table 3. Protection of immunized mice against a lethal challenge with Stx1 or Stx2.

Group Mice immunized with: Camundon- Number of surviving mice / total number of mice (percentage survival) los ₅₀ · challenge 10 ^sb from: THE PBS Stx1 0/5 B toxoid Stx1 + ABC Stx1 5/5 Ç PBS Stx2 6/29 (20.7%) D toxoid Stx1 + ABC Stx2 12/34 (35.3%) ^c

^a LD ₅ o was previously determined to be 125 and 1 ng / mouse for Stx1 and Stx2 respectively.

^b The average weight of the mice when challenged was 47.1 g.

^c Fisher's exact test was used to compare the proportions that survived in groups C and D and the p-value was 0.2667.

As low neutralizing antibody titers of Stx2 were observed in the toxoid-immunized group, we opted to challenge the rest of the mice with only 5 LD50s of stx2. Six of the 29 negative control mice (20.7%) survived the challenge with Stx2, while 12 of the 34 toxoid-immunized mice (35.3%) survived (Table 3), a finding that, although not statistically significant, suggests that the chimeric toxoid may have provided some protection against Stx2.

In vitro protein synthesis inhibition assay.

The conclusion that the 11E10 epitope appeared to consist of surface loops around the crack in the Stx2 active site led us to assume that 11E10 can neutralize Stx2 by blocking the toxin's ability to inhibit protein synthesis. Therefore, it was evaluated whether the monoclonal antibody 11E10

54/58 could counteract the effects of Stx2 ribosome inactivation in a rabbit reticulocyte protein synthesis assay to which luciferase mRNA has been added. A toxin concentration was chosen which decreased the signal from the luciferase reporter protein by approximately 60% compared to the signal measured when no toxins were added (figure 5). The addition of 11E10 to the assay allowed protein synthesis to occur in rabbit reticulocyte lysate even when Stx2 was present, whereas irrelevant isotype-matched antibody was not (figure 5).

Monoclonal antibody 11E10 alters the global distribution of Stx2 in Vero cells

Although it was concluded that the monoclonal antibody 11E10 prevented inhibition of protein synthesis by Stx2 in the in vitro protein synthesis assay, there is still the hypothesis that 11E10 may prevent Stx2 from reaching the ribosomes in the cytoplasm of intoxicated Vero cells. Therefore, we sought to determine whether the monoclonal antibody 11E10 changes the location of Stx2 in target cells. (We had previously discovered that Stx2 linked to 11E10 could bind to Vero cells and that 11E10 could attach to Stx2 linked to Vero cells (data not shown)). Stx2 was mixed with 11E10 or PBS and the antibody / toxin or PBS / toxin mixture was incubated with Vero cells. The distribution of Stx2 in the target cells was then visualized with rabbit polyclonal anti-Stx2 antibodies and a secondary fluorophore-labeled rabbit anti-IgG antibody (figure 6). Stx2 appeared to be distributed throughout the cytoplasm in the absence of 11E10 (figure 6A), but appeared to remain concentrated in a large part of perinuclear bodies in the presence of 11E10 (figure 6B). When the cells incubated with the toxin / 11E10 mixture were stained with anti-mouse IgG, 11E10 was observed in the same perinuclear punctate structures as Stx2 (figure 6C). Monoclonal antibody 11E10 was unable to enter cells in the absence of the toxin (Figure 6D). The location of 11x10-linked Stx2 within punctate bodies around the nucleus suggested that the antibody-toxin complex entered the cell, but did not travel to the cytoplasm. So we ask

55/58 if Stx2 or Stx2 linked to 11E10 was located in new endosomes by immunostaining the cells intoxicated with the EEE-1 endosome marker early monoclonal antibody. Most Stx2 in cells intoxicated with 11E10-linked Stx2 was found to be co-localized with the early endosome marker (Figure 6E-G), as shown by a yellow-orange stain when the staining patterns overlapped. In contrast, when Vero cells were incubated with Stx2 alone, the toxin was found throughout the cytoplasm and only a small amount was co-located with the early endosome marker (figure 6H-J).

Discussion

The results demonstrate that the 11E10 monoclonal antibody epitope is conformational and includes three non-linear regions in the A Stx2 subunit that appear close to the active toxin site in the crystalline structure (see figure 2C). The strategy to identify the 11E10 epitope involved the generation of chimeric Stx1 / Stx2 toxins and was based on the assumption that the placement of Stx2 sequences in the Stx1 backbone would maintain the tertiary three-dimensional structure of the antibody epitope and allow recognition by the 11E10 monoclonal antibody . The minimal StxA2 region that allowed recognition by 11E10 in the Western analysis was found to consist of only eight Stx2 amino acids (42NHTPPGSY49) (SEQ ID NO: 1). However, chimeric Stx1 / Stx2 with only these 8 Stx2 amino acids (region A) were not neutralized by monoclonal antibody 11E10. As 11E10 neutralizes Stx2, we consider that the 8 amino acids that had been identified consisted of a critical region of the 11E10 epitope, but do not comprise the complete neutralization epitope. Differences in the amino acid sequences and crystal structures of Stx1 and Stx2 were also analyzed to try to identify additional regions in Stx2 that may be involved in the recognition and neutralization of 11E10. Through these comparisons, two more Stx2 segments were identified that could potentially contribute to the 11E10 epitope. In fact, it turned out that all three regions were necessary for the recognition

56/58 and more complete neutralization by 11E10 when these regions were used to replace the corresponding segments in Stx1.

The conclusion that the complete 11E10 neutralization epitope comprises three non-continuous regions in Stx2 is perhaps surprising, because the monoclonal antibody recognizes Stx2 under conditions of denaturation of a Western blot. Several explanations for this latter observation are conceivable. These possibilities include that a Western reactivity is mainly due to the interaction of 11E10 with region A (42NHTPPGSY49) or that partial refolding of subunit A occurs during the Western blot process, as was observed for monoclonal antibody 13C4 in another study ( Smith et al. (2006) Infect. Immun. 74: 6992-6998).

The sequences of the handles of three surfaces that form the neutralizing epitope of monoclonal antibody 11E10 monoclonal in Stx2 are conserved among the variants of Stx2. There are some amino acids that differ between those regions in Stx2d and Stx2e, two toxins that are rarely found in human isolates (Melton-Celsa et al. (2005), supra). However, monoclonal antibody 11E10 did not detect and partially neutralized the cytotoxicity activity of Stx2 and all variants of Stx2 analyzed in this report (Stx2c, Stx2d, Stx2dact, and Stx2e). The discovery that Stx2e is neutralized by 11E10 in Vero cells, but little recognized in Western format compared to Stx2, may indicate that sequences in region B that are different between Stx2 and Stx2e are more important by recognition in Western blot than by neutralization . However, the fact that 11E10 has the ability to neutralize all of these variant toxins suggests that it may be a good candidate for the treatment of Stx2-mediated disease and Stx2-related toxins in humans. In fact, 11E10 was found to be protective in a model of toxemia disease (Stx2) (Sauter et al. (2008) Infect. Immun. 76: 4469-4478) and a mouse model of the disease fed orally with a strain that produces Stx2d _ac t (Edwards et al., supra). Currently involved in an ongoing laboratory evaluation of the version

57/58 humanized 11E10, caStx2, in which Phase I of the safety tests has been completed (Dowling et al., Supra). We attempted to protect mice from the challenge with Stx2 by immunization with the chimeric toxoid Stx1 molecule that contained only the 29 amino acids of Stx2 that comprise the 11E10 epitope. It was found that although the immunized mice increased a protective response against Stx1, only a few of the mice generated neutralizing antibodies to Stx2, and these were of low titre. The response to Stx2 may have been improved with additional boosters of chimeric toxoid.

11E10 was found to block Stx2 enzymatic activity in vitro, a fact that was predicted based on the proximity of the 11E10 epitope to the active toxin site. It was also observed that 11E10 altered the overall distribution of toxin within the cell, a finding that is similar to the data on neutralizing Stx2 by a different StxA2 monoclonal antibody, 5C12, as reported by Krautz-Peterson et al. ((2008) Infect. Immun. 76: 1931-1939). These researchers concluded that when the 5C12 monoclonal antibody binds to StxA2 it alters the pattern of intracellular trafficking of the toxin (Krautz-Peterson et al, supra). The data indicate that once the 11E10 / Stx2 complex binds to enter the host cell, the antibody can prevent the trafficking of toxins to the target ribosomes in the cytosol. However, since 11E10 was shown to prevent the enzyme function of the toxin in vitro, it was predicted that if the 11x10-complexed Stx2 subunit reached its enzymatic target in the cytosol, the toxin would not be able to kill the cell.

Other Modalities

Various modifications and variations of the described methods and compositions of the invention will be evident to persons skilled in the art without departing from the scope and principles of the invention. Although the invention is described in connection with the specific desired embodiments, it should be understood that the invention, as claimed, should not be unduly limited to such specific embodiments.

All patents, patent applications and publications mention

58/58 in this report are incorporated by reference, to the same extent, as if each independent publication were specifically and individually incorporated by reference.

1/2

Claims (11)

1. Purified polypeptide, characterized by the fact that it comprises: (i) SEQ ID NO: 1; (ii) SEQ ID NOs: 1 and 2; or (iii) SEQ ID NOs: 1,2, and 3; and a non-Stx2 protein structure, wherein said SEQ ID NO: 1, SEQ ID NOs: 1 and 2, or SEQ ID NOs: 1, 2, and 3 are inserted into such a non-Stx2 protein structure, and where such polypeptide has the antigenicity of Stx2. 2. Purified polypeptide according to claim 1, characterized in that said structure is the A subunit of Stx1. Purified polypeptide according to claim 1 or 2, characterized in that it comprises an amino acid sequence having the amino acid sequence established in SEQ ID NO: 8. Purified polypeptide according to any one of claims 1 to 3, characterized in that it is toxoided. 5. Host cell, characterized by the fact that it expresses the polypeptide as defined in any of claims 1 to 4, wherein the host cell is a microorganism. Use of a polypeptide as defined in any of claims 1 to 4, characterized in that it is in a method for the production of an anti-Stx2 antibody that specifically binds to the toxin type 2 (Stx2) 11E10 epitope of the toxin Shiga, the referred method comprising the steps of: a) immunization of mammals with one of the polypeptides as defined in any one of claims 1 to 4; and b) purifying said anti-Stx2 antibody that specifically binds the 11x10 epitope of the Stx2 protein from mammalian tissue or a hybridoma made using such tissue; and optionally, c) screening of said antibody against Stx2 and Stx1 in an in vitro neutralization assay, in which an antibody that neutralizes at least 50% Petition 870190087704, of 09/06/2019, p. 7/14 2/2 of the cytotoxic effect of Stx2 is an anti-Stx2 antibody that specifically binds to the 11E10 epitope of the Stx2 protein. 7. Polypeptide according to any one of claims 1 to 3, characterized in that it is for use as a medicine. 5 8. Polypeptide according to any one of the claims 1 to 4, characterized by the fact that it is to treat or prevent a disease associated with Shiga toxin in an individual. 9. Polypeptide according to claim 8, characterized by the fact that said disease associated with the Shiga toxin is an infection 10 by E. coli or S. dysenteriae. 10. Composition for stimulating an immune response against Stx2, characterized in that it comprises a pharmaceutically acceptable carrier and at least one purified polypeptide as defined in any one of claims 1 to 4. 11. Use of a polypeptide as defined in any of claims 1 to 4, characterized by the fact that it is for the preparation of a composition for the treatment or prevention of a disease associated with Shiga toxin.