BRPI1006648A2 - Cloning of type 2 chickens gyrovirus dna - Google Patents

Abstract

Cloning of type 2 chicken gyrovirus DNA. Recombinant DNA or rna composed of type 2 chicken gyrovirus (cgv2) -specific nucleotide sequences and their use for vaccination, protein production, diagnosis or Recombinant cgv2 protein and its use for diagnosis, vaccination or production, use of specific anti-cgv2 antibodies, and the use of cgv2 recombinant proteins for anti-cancer therapy.

Description

DATA CLIPPING GYROVIRUS DNA CLONING TYPE 2 State of the Art Vaccines and Diagnostics icos.Η.M.NOTEBORN MATHIEÜ and BOER GF, CLONING OF CHICKEN ANEMIA VIRUS DNA, Publication Number: US2006073160 (Al) Date 2006-04-06, priority date: Sep. 12 1990, NL 9002008, Sep. 11 1991 PCT / NL91 00165. PJ SONDERMEIJER and JA CLAESSENS, CHICKEN ANEMIA VIRUS VACCINE AND DIAGNOSTIC REAGENT, Publication number: KR100204438 ( Bl), Date of publication: 1999-06-15. G. KOCH GUUS, M.H.M. NOTEBORN, CHICKEN ANEMIA VIRUS MUTANTS AND VACCINES BASED ON THE VIRAL PROTEIN VP3 OR SEQUENCES OF THAT VIRUS CODING THEREFORE. Patent Application: PT1253201 (E), Publication Date: 2008-10-27. [Also as WO9503414 (A2)] Anti-cancer therapy. S. PANIGRAHI and M. LOS, APOPTIN INDUCES INHIBITION OF BCR-ABL KINASE IN CML CELLS, Patent Application: W02009055907 (Al), date 2009-05-07.

Field of the Invention This invention is in the field of genetic engineering technology through recombinant DNA (and RNA), immunization / vaccination, cancer diagnosis and therapy. More specifically, the invention relates to the detection, cloning and sequence analysis of the type 2 chicken girovirus (CGV2) DNA genome and its applications. ■ Rationale DNA genomes of a new member of the Circoviridae family have been discovered in chickens with a brain disease of unknown cause. This new member was called girovirus type 2 chickens.

Circoviridae The members of a family of small circular DNA viruses that infect vertebrate hosts, named Circovirídae, are divided into two genera, Gyrovirus, which includes the infectious chicken anemia virus (CAV or type 1 chicken girovirus) and Circovirus, which includes porcine circoviruses (PCV). Negative-oriented circular DNA viruses such as human and porcine torsion virus (TTV) and torque-like mini-virus (TTMV) have been classified as a floating genus of the same family, called the Anellovirus. These Aneloviruses share sequence homology with other members of the Circoviridae family. [McNulty et al., 2000. McNulty, M., Dale, J., Lukert, P., Mankertz, A., Randles, J., Todd, D., 2000.

Circoviridae. In: van Regenmortel, CMEMΗV., Bishop, DHL, Carstens, EB, These, MK, Lemon, SM, Maniloff, J., Mayo, MA, McGeoch, DJ, Pringle, CR, Wickner, RB (Eds. ), Seventh Report of the International Committee on Taxonomy of Viruses, Academic Press, San Diego, pp. 299-303.] The encapsidated genomes of the Circoviridae family members consist of single strands of circular DNA. In infected cells, viral DNA is found in single and double stranded forms. Genomes range from 1.7 to 3.8 Kb and bioinformatics analysis revealed at least three open reading phase regions (ORFs, 0RF1, ORF2 and ORF3). In Gyrovirus (CAV) and Anellovirus (TTMV and TTV) these ORFs are on the same tape and it is the antisense tape that is encapsulated in the virions [Mankertz A, Hillenbrand B., Analysis of transcription of Porcine circovirus type J Gen Virol. 2002 Nov; 83 (Pt 11): 2743-51.] Circovirus proteins CAV proteins

To date, based on results from genomic sequencing and expression of CAV CRFs, three proteins encoded by this virus have been identified: VP1, VP2 and VP3 [SCHAT, K. A. Chicken Infectious Anemia. IN: SAIF, Y.M., et al. (eds). Diseases of poultry. llth. ed. Ames: Iowa State Press; 2003.]. These three proteins are produced by using alternative sites for single messenger RNA processing. CAV ORF3 is located within ORF2 and overlaps with ORF1. CAV VPl is the major component of the capsid and viral antigen and the only protein found in purified viral particles [Koch G, van Roozelaar DJ, Verschueren CA, van der Eb AJ, Noteborn MH., Immunogenic and protective properties of chicken anemia virus. proteins expressed by baculovirus. Vaccine. 1995; 13 (8): 763-70, Noteborn MH, Verschueren CA, Koch G, Van der Eb AJ., Simultaneous expression of recombinant baculovirus-encoded chicken anemia virus (CAV) proteins VPl and VP2 is required for formation of the CAV -specific neutralizing epitope. J Gen Virol. 1998 De c; 79 (Pt 12): 3073-7.] VP2 is a nonstructural protein that serves as a chaperone for VPl, shaping it into conformation suitable for exposure to viral epitopes [Koch G, van Roozelaar DJ, Verschueren CA, van der Eb AJ, Noteborn MH. , Imiriunogenic and protective properties of chicken anemia virus proteins expressed by baculovirus. Vaccine. 1995; 13 (8): 763-70, Noteborn MH, Verschueren CA, Koch G, Van der Eb AJ., Simultaneous expression of recombinant baculovirus-encoded chikken anemia virus (CAV) proteins VP1 and VP2 is required for formation of the CAV -specific neutralizing epitope. J Gen Virol. 1998 Dec; 79 (Pt 12): 3073-7.] VP2 also has phosphatase activity and affects viral multiplication and pathogenicity [Peters MA, Crabb BS, Washington EA, Browning GF. , Site-directed rautagenesis of the VP2 gene of Chicken anemia virus affects virus replication, cytopathology and host-cell MHC class I expression. J Gen Virol. 2006 Apr; 87 (Pt 4): 823-31]. VP3, on the other hand, is associated with the nucleus of infected cells and is not found in purified viral particles. It is the protein responsible for inducing apoptosis in infected cells [SCHAT, K. A. Chicken Infectious Anemia. IN: SAIF, Y.M., et al. (eds). Diseases of poultry. llth. ed. Ames: Iowa State Press; 2003.] as detailed below.

PCV proteins ORFl encodes two proteins essential for replication, Rep and Rep '2. [Cheung AK ,, The essential and nonessential transcription units for viral protein synthesis and DNA replication of porcine circovirus type 2.Virology. 2003 Sep 1/313 (2): 452-9.] The Rep protein has 312 amino acids, being the full translation of ORFl, whereas Rep 'has 168 amino acids and is the product of ORFl transcribed mRNA splitting [Mankertz A , Hillenbrand B., Analysis of transcription of Porcine circovirus type 1 J Gen Virol. 2002 Nov; 83 (Pt 11): 2743-51.]. PCV capsid protein (Cap) has a molecular mass of approximately 30 KDa and is encoded by ORF2. Studies have shown that expression of ORF2 recombinant protein produces virus-like particles, suggesting its ability to self-encapsulate. [Nawagitgul P, Morozov I, Bolin SR, Harms PA, Sorden SD, Paul PS., Open reading frame 2 of porcine circovirus type 2 encodes a major capsid protein. J Gen Virol. 2000 Sep; 81 (Pt 9): 2281-7.]. In addition, the protein coded for 0RF2 is immunodominant Lekcharoensuk P, Morozov I, Paul PS, Thangthumniyom N, Wajjawalku W, Meng XJ., Epitope mapping of the major capsid protein of porcine circovirus (PCV2) by using chimeric PCV1 and PCV2 . J Virol. 2004 Aug; 78 (15): 8135-45.] The protein encoded by 0RF3 is expressed predominantly in the nucleus and less frequently in the cytoplasm of cells. This PCV viral protein is involved in the process of inducing apoptosis by activating the caspase-8 primer and caspase-3 effector route [Liu J, Chen I, Kwang J., Characterization of a previously unidentified viral protein in porcine circovirus type 2- infected cells and its role in virus-induced apoptosis. J Virol. 2005 Jul; 79 (13): 8262-74.] TTV Proteins Compared to CAV and PCV proteins, much less is known about proteins encoded by TTVs. In analogy with CAV VP1, the TTV capsid protein is also encoded by ORF1. Similarly, the two proteins have a hydrophilic amino-terminal amino acid region with DNA binding affinity [Okamoto H, Mayumi Μ., TT virus: virological and genomic characteristics and disease associations. J Gastroenterol. 2001 Aug; 36 (8): 519-29]. However, TTV ORF 1 contains hypervariable regions that may have high genetic diversity, even between isolates of the same genotype and found in the same individual [Jelcic I, Hotz-Wagenblatt A, Hunziker A, Zur Hausen H, of Villiers EM. , Isolation of multiple TT virus genotypes from spleen biopsy tissue from a Hodgkin1s disease patient: genome reorganization and divergence in the hypervariable region. J Virol. 2004 Jul; 78 (14): 7498-507.J It has been shown that some of these variations generate termination codons, which leads to the synthesis of smaller proteins. However, the consequences on the antigenic or pathogenic variability of these variations are not known.

Although there are similarities between TTVs proteins and CAV proteins, the functions of proteins encoded by TTVs ORF 2 and 3 have yet to be elucidated [Hino S, Miyata H., .Teno teno virus (TTV): current status. Rev Med Virol. 2007 Jan-Feb; 17 (1): 45-57]. One of the few evidences about these functions shows that the cloned and expressed TTVs 0RF3 protein in hepatocarcinoma cell line is capable of inducing apoptosis [Kooistra K, Zhang YH, Henriquez NV, Weiss B, Mumberg D, Noteborn TT, TT virus- derived apoptosis-inducing protein induces apoptosis preferentially in hepatocellular carcinoma-derived cells. J Gen Virol. 2004 Jun; 85 (Pt 6): 1445-50].

Circoviruses are difficult to multiply under standard cell culture conditions, they depend on the host cell replication mechanism, but in cells transformed by oncogenic viruses or individual oncogenes, higher titers can be obtained. [Yuasa, 1983 N. Yuasa, Propagation and infectivity titration of the Gifu-1 strain of chicken anemia agent in a cell line (MDCC-MSB1) derived from Mareie's disease lymphorua, Natl. Inst. Animal Health Q (Tokyo) 23 (1983), p. 13-20]. CGV2 is a newly discovered virus belonging to the Circoviridae family and is implicated in hemorrhages in the brain of infected chickens [Roehe et al., Publication in preparation]. CGV2 has a circular genora of about 2.4 kb. Complete genome molecules were first isolated in 2008 in the state of Rio Grande do Sul, Brazil, from broiler sera with hemorrhagic brain lesions. Genome sequence analysis shows that CGV2 is related to other circoviruses, such as CAV [M.H. Noteborn, G.F. de Boer, D.J., van Roozelaar, C. Karreman, O. Kranenburg, J.G. Vos, S.H. Jeurissen, R.C. Hoeben, A. Zantema, G. Koch, et al. Characterization of cloned chicken anemia virus DNA that contains all elements for the infectious replication cycle, J, Virol. 65 (1991) 3131-3139.]. The overall similarity between amino acids d CGV2 and CAV is about 40%.

So far CGV2 has only been detected in commercially produced chickens in southern Brazil, but as with other circoviruses, the virus can spread to all countries of major chicken producers [Bulow, V., and KA Schat, 1997. Chicken Infectious Anemia. Pages 739-756 in: Diseases of Poultry. Chapter 30. Iowa State University Press; Ames, IA.]. On the other hand, as well as CAV, which has already been detected in other bird species [T. Farkas; K. Maeda; H. Sugiura; K. Kai; K. Hirai; K. Otsuki; T. Hayashi, 1998. A serological survey of chickens, Japanese quail, pigeons, ducks and crows for antibodies to chicken anemia virus (CAV) in Japan. Avian Pathology, Volume 27: 316 - 320], it is possible that CGV2 is also capable of infecting other species such as quails, pheasants or turkeys.

Considering that CGV2 has also been isolated from chickens originating from CAV vaccinated matrices, there is a need for the development of a specific anti-CGV2 vaccine.

Vaccines To protect chickens against CGV2 infection and disease, vaccination is the method of choice. The following types of vaccines are foreseen: Live attenuated vaccines. Live attenuated vaccines are attenuated CGV2 mutants. These mutants may be the products of virus multiplication in various heterologous cell lines. They have a reduced ability to cause disease and at the same time they induce an immune response. These vaccines contain live viruses that can infect and multiply in the host, which increases the intensity and duration of the immune response. But live attenuated vaccines can also be made up of mutants that are recombination products.

Recombinant vaccines. Recombinant CGV2 vaccines are produced by creating a mutation in a region of the virus genome that is not essential for virus multiplication. Another way of producing a recombinant vaccine is by developing a viral vector that expresses a part of the CGV2 genome that encodes one or more antigens that stimulate an immune response against CGV2. These vaccines also contain live viruses that are capable of infecting and multiplying in the host, which increases the intensity and duration of the immune response.

Dead (or inactivated) vaccines. Dead CGV2 vaccines are made up of high doses of dead CGV2. Killed vaccines usually result in a weaker immune response and are shorter than live vaccines due to their inability to infect and multiply in the host.

Sub unit vaccines. CGV2 subunit vaccines include doses of purified antigens extracted from the disease-causing microorganism. Alternatively, vectors expressing regions of the CGV2 genome that encode immunogenic proteins such as recombinant baculoviruses and herpesviruses (Marek and ITLV) are forms of subunit vaccines.

DNA vaccines. These vaccines contain purified DNA encoding CGV2 antigens that stimulate an immune response against CGV2.

Apoptosis An important part of the knowledge on circovirus pathogenicity comes from studies of natural and experimental chicken infection with CAV. Studies on the pathogenesis of infection caused by this virus have shown that an essential factor in the development of clinical disease is the induction of apoptosis in infected cells. This function is induced by one of the three viral proteins, VP3. VP3 protein has no sequence homologation with any known cellular protein and is an extremely interesting protein because it induces cellular apoptosis in tumor or transformed cells, but not in unprocessed cells, unlike other apoptosis-inducing viral proteins. Selective VP3 toxicity is mainly attributed to its cellular localization, because in unprocessed cells it accumulates in the cellular cytoplasm, unlike tumor cells, where the protein is located in the cell nucleus, inducing them to apoptosis. This aspect, combined with VP3's ability to act independently of p53, brings with it incredible pharmacological potential for use in tumor management.

Known as "programmed cell death", apoptosis is a type of cell death that occurs in an orderly manner and demands energy for its execution (unlike necrosis). It is related to the maintenance of homeostasis and physiological regulation of tissue size, but may also be caused by pathological stimulation (such as damage to cellular DNA). The term is derived from the Greek, which refers to the fall of tree leaves in the fall - an example of physiological programmed death that also implies renewal. Viruses are known to induce and / or block apoptosis processes [Teodoro JG, Branton PE., Regulation of apoptosis by viral gene products. J Virol. 1997 Mar; 71 (3): 17 39-46]. They may use this block or induction for their own benefit. This can occur depending on the phase of the multiplication cycle they are in, to keep the cells alive until the viral progeny have reached maximum levels or to facilitate the process of viral spread in the cells, altering the cell cycle and eventually leading to tumor production.

An example of apoptosis-inducing virus is CAV. The induction of apoptosis by CAV has been attributed to VP3, a 121 amino acid and 14 kDa nonstructural protein [M.H. Noteborn, D. Todd, C.A. Verschueren, H.W. de Gauw, W.L. Curran, S. Veldkamp, A.J. Douglas, M.S. McNulty, E.A. van der, G. Koch, A single chicken anemia virus protein induces apoptosis, J. Virol. 68 (1994) 346-351; M.H. Noteborn, Chicken anemia virus induced apoptosis: underlying molecular mechanisms, Vet. Microbiol. 98 (2004) 89-94]. This protein can induce apoptosis in a wide range of transformed cells, but not in unprocessed or primary cells [D.W. Heilman, J.G. Theodore, M.R. Green, Apoptin nucleocytoplasmic shuttling is required for cell-specific localization, apoptosis, and recruitment of the anaphase-promoting complex / cyclosome to PML bodies, J. Virol. 80 (2006) 7535-7545; I.K.H. Poon, C. Oro, M.M. Dias, J. Zhang, D.A. Jans, Apoptin nuclear accumulation is modulated by a CRMl-recognized nuclear export signal that is active in normal but not in tumor cells, Cancer Res. 65 (2005) 7059-7064.]. Recent data link their complex mode of action to various cellular proteins, which play a determining role in the cell proliferation and cell death cycle. VP3 protein has no sequence homology to any known cellular protein [M.H. Noteborn, G.F. de Boer, D.J. van Roozelaar, C. Karreman, O. Kranenburg, J.G. Vos, S.H. Jeurissen, R.C. Hoeben, A.-Zantema, G. Koch, et al. , Characterization of cloned chicken anemia virus DNA that contains all elements for the infectious replication cycle, J. Virol. 65 (1991) 3131-3139]. The VP3 C-terminal region contains a nuclear localization sequence (NLS) and a potential nuclear export signal (NES). These recognition sequences direct VP3 into and out of the cell nucleus. The biologically active form of VP3 can form multimers consisting of 30 to 40 monomers. The C-terminal region of each monomer contains an accessible phosphorylation site NLS, which allows its interaction with other proteins and modification by kinases. Microinjection of VP3 multimers into the tumor cell cytoplasm revealed that the complexes are translocated to the cell nucleus, resulting in apoptotic cell death [S.R. Leliveld, Y.H. Zhang, J.L. Rohn, M.H. Noteborn, J.P. Abrahams, Apoptin induces tumor-specific apoptosis as a globular multimer, J. Biol. Chem. 278 (2003) 9042-9051]. VP3 has been shown to induce apoptosis in several human tumor cells, including melanoma, hepatoma, lymphoma, cholangiocarcinoma, colon carcinoma, breast and lung tumor, and others [C. Backendorf, A.E. Visser, A.G. de Boer, R. Zimmerman, M. Visser, P. Voskamp, Y.H. Zhang, M. Noteborn, Apoptin: therapeutic potential of an early sensor of carcinogenic transformation, Annu. Rev. Pharmacol. Toxicol. 48 (2008) 143-169; M. Tavassoli, L.

Guelen, B.A. Luxon, J. Gäken, Apoptin: specific killer of tumor cells? Apoptosis 10 (2005) 717-72]. In fact, more than 70 tumor cell lines are currently susceptible to VP3 action, whereas it does not cause apoptosis in normal cells such as human endothelial cells, hepatocytes and hematopoietic stem cells. Thus, VP3 activity appears to be dependent on the transformed state of the cell [C. Backendorf, A.E. Visser, A.G. de Boer, R. Zimmerman, M. Visser, P. Voskamp, Y.H. Zhang, M. Noteborn, Apoptin: therapeutic potential of an early sensor of carcinogenic transformation, Annu. Rev. Pharmacol. Toxicol. 48 (2008) 143-169]. VP3 also caused apoptosis in immortalized cells in vitro, and there is only one article demonstrating its activity in non-tumor cells and yet these are secondary rather than primary cultures of human fetal fibroblasts [A.A. Danen-Van Oorschot, DF Fischer, JM Grimbergen, B. Klein, S-Zhuang, JH Falkenburg, C. Backendorf, PH Quax, AJ Van der Eb, MH Noteborn, Apoptin induces apoptosis in human transformed and malignant cells but not in normal cells, Proc. Natl. Acad. Know. U.S.A. 94 (1997) 5843-5847; Y.H. Zhang, P.J. Abrahams, A.J. van der Eb, M.H. Noteborn, The viral protein Apoptin induces apoptosis in individual UV-C-irradiated cells with various hereditary cancer-prone syndromes, Cancer Res. 59 (1999) 3010-3015; L. Guelen, H. Paterson, J. Gaken, M. Meyers, F. Farzaneh, M. Tavassoli, TAT-apoptin is efficiently delivered and induces apoptosis in cancer cells, Oncogene 23 (2004) 1153-1165]. These experiments raise the possibility that VP3 selectively affects normal cells in an embryonic state, but not in adult cells. Intratumoral inoculation of recombinant protein VP3 in mice implanted with human hepatoma tumor cells reduces tumor growth and induces tumor regression within one week after inoculation [A.M. Pietersen, M.M. Van der Eb, HJ Rademaker, DJ den Wollenberg, MJ Rabelink, PJ Kuppen, JH van Dierendonck, H. van Ormondt, D. Masman, Van van Velde, AJ van der Eb, RC Hoeben, MH Noteborn, Specific tumor- cell killing with adenovirus vectors containing the apoptin gene, Gene Ther, 6 (1999) 882-892]. Combined use of VP3 with other chemotherapy drugs leads to a more dramatic tumor reduction than when either VP3 or chemotherapy is administered alone [S.J. Olijslagers, Y.H. Zhang, C. Backendorf, M.H. Noteborn, Additive cytotoxic effect of apoptin and chemotherapeutic agents paclitaxel and etoposide on human tumor cells, Basic Clin. Pharmacol. Toxicol. 100 (2007) 127-131].

The mechanisms of cell death induction by VP3 are not clear, although there is consensus on some molecular events. One of the key aspects is the protein's ability to induce apoptosis independently of p53 protein, which is a tumor suppressor cell protein and is involved in induction of cell apoptosis. Thus, VP3 induces apoptosis in tumor cells that will or may not express p53.

In addition, apoptosis is known to be typically mediated by cellular proteins called caspases, which initiate and execute the apoptosis process [M. Los, S. Wesselborg, K. Schulze-Osthoff, The role of caspases in development, immunity, and apoptotic signal transduction: Iessons from knockout mice, Immunity 10 (1999) 629-639; C. Schwerk, K. Schulze-Osthoff, Regulation of Apoptosis by Alternative Splicing Pre-mRNA, Mol. Cell 19 (2005) 1-13]. Recently, VP3 expression has been shown to result in activation of cellular caspases (Burek et al.). Selective VP3 toxicity is mainly attributed to its cellular localization. It has been shown that in normal cells protein is expressed in the cytoplasm while it accumulates in the nucleus of transformed cells [A.A. Danen-Van Oorschot, Y.H. Zhang, S.R. Leliveld, J.L. Rohn, M.C. Seelen, M.W. Bolk, A. Van Zon, S.J. Erkeland, J.P. Abrahams, D.Mumberg, M.H. Noteborn, Importance of nuclear localization of apoptin for tumor-specific induction of apoptosis, J. Biol. Chem. 278 (2003) 27729-27736]. The location of this protein is determined by the presence of NLS and NES, which interact with cellular proteins to import or export proteins to and from the cell nucleus [I.K. Poon, C. Oro, M.M. Dias, J.P. Zhang, D.A. Jans, A cell-specific nuclear tumor targeting within chicken anemia virus VP3 / Apoptin, J. Virol. 79 (2005) 1339-1341; J.L. Rohn, M.H. Noteborn, The viral death effector Apoptin reveals tumor-specific processes, Apoptosis 9 (2004) 315-322]. However, it is not known which proteins are specifically expressed in tumor cells that effectively recognize VP3 NLS to direct it to the cell nucleus [Poon IK, Jans DA. Regulation of nuclear transport: Central role in development and transformation? Traffic 2005, 5, 173-86]. The ability of VP3 to induce apoptosis independently of p53 has incredible pharmacological potential. This aspect of protein function can be directly employed in anti tumor therapy. In addition, the possibility of directing the action of VP3 may be an approach to achieve tumor specificity and design new tumor treatment alternatives. The route of VP3 release in tumors is a subject of discussion. Induction of apoptosis in mouse-induced cell cultures or tumors can be obtained by inoculating VP3-expressing viral vectors (adenovirus, poxvirus), transient overexpression, or by conjugating VP3 to proteins recognized by specific cell receptors [C. Backendorf, A.E. Visser, A.G. de Boer, R. Zimmerman, M. Visser, P. Voskamp, Y.H. Zhang, M. Noteborn, Apoptin: therapeutic potential of an early sensor of carcinogenic transformation, Annu. Re?. Pharmacol. Toxicol. 48 (2008) 143-169; A.M. Pietersen, M.M. van der Eb, H.J.

Rademaker, DJ den Wollenberg, MJ Rabelink, PJ Kuppen, JH Dierendonck, H. van Ormondt, D. Masman, CJ van Velde, AJ van Eb, RC Hoeben, MH Noteborn, Specific tumor-cell killing with adenovirus vectors containing the apoptin gene, Gene Ther. 6 (1999) 882-892; X.

Li, N. Jin, Z. Mi, H. Lian, L. Sun, X. Li, H. Zheng, Antitumor effects of a recombinant fowlpox virus expressing Apoptin in vivo and in vitro, Int. J. Cancer 119 (2006) 2948-2957; D.J. Peng, J. Sun, J.Y.Z. Wang, J. Tian, Y.H. Zhang, M.H. Noteborn, S. Qu, Inhibition of hepatocarcinoma by systemic delivery of Apoptin gene via the hepatic asialoglycoprotein receptor, Cancer Gene Ther. 14 (2007) 66-73]. Still another pharmacological aspect to be explored is the induction of VP3 accumulation in the cell nucleus to try to potentiate the anti-tumor activity of VP3. CAV VP3 protein or apoptin is currently studied for its anti-tumor properties [Los M, Panigrahi S, Rashedi I, Mandai S, Stetefeld J, Essmann F, Schulze-Osthoff K. Apoptin, the tumor-selective killer. Biochim Biophys Acta. 1793 (2009) 1335-1342]. CGV2 VP3 protein is only 30% similar to CAV VP3 protein. Therefore, it probably has different anti-tumor properties. For example, the CGV2 VP3 has two core localization signals, one of them exactly in its C-terminal region. CGV2 VP3 protein does not have enough K or R residues at this site to form a localization signal [S. Maddika, F.J. Mendoza, K. Hauff, C.R. Zamzow, T. Paranjothy, M. Los, Cancerselective therapy of the future: apoptin and its mechanism of action, Cancer Biol. The R. 5 (2006) 10-19] in the nucleus and probably this region of VPV of CGV2 does not work the same as VPV of CAV. This aspect may influence the accumulation of VP3 in the cell nucleus and therefore its anti-tumor effect. Summary of the Invention Small circular single-row DNA molecules, such as the CGV2 genera, can be amplified by Phi29 DNA polymerase without any prior knowledge of. your nucleotide sequence. Amplification products are double stranded DNA and can be digested with suitable restriction enzymes and cloned into prokaryotic vectors. Some enzymes cut the genome once and these products can be isolated and re-circularized. Since, like other Clrcovirldae viruses, CGV2 has a double-stranded form of replication, this form of the CGV2 genome can be transfected into suitable eukaryotic cells, giving rise to CGV2 viruses with all their biological properties. The inventors of the present patent application use Phi29 DNA polymerase amplification and transfection methods to isolate the CGV2 virus.

The present inventors have characterized the double stranded form of the entire genome of CGV2. This genome is about 2.4 kb in length and is cloned into prokaryotic vectors such as pCR2.1. DNA was partially sequenced (SEQ ID NO: 1). In a CGV2 nucleic acid-specific PCR test, it was demonstrated in the liver, spleen, kidney and feather follicles of diseased chickens. Analysis of Phi29 DNA polymerase amplification products from four different field isolated samples showed that the cloned CGV2 genome is representative of the field CGV2. They all had a genome size of about 2.4 kb and digestions with other restriction enzymes showed the same pattern for all four isolates. In PCR experiments using CGV2 sequence derived oligonucleotides (SEQ ID NO: 1) CGV2 DNA was specifically amplified.

Brief Description of the Figures FIG. 1 shows the Phi29 DNA polymerase amplification products from four different sera from BamHI-digested diseased chickens. FIG. 2 shows an enzymatic restriction map of the cloned CGV2 genome and the positions of the main regions with an open reading frame (ORFs): VP1, VP2 and VP3. FIGS. 3A, 3B, 3C and D show the amino acid similarities found between the coded CGV2 proteins: VP1, VP2 and VP3 and those of the CAV and D: Possible functional regions of the CGV2 protein VP3 FIG. 4 shows the construction of a CGV2 negative VP3 mutant. FIG. 5 shows the construction of a eukaryotic expression vector for CGV2 VP3 Detailed Description of the Invention The present invention provides nucleotide sequence specific information corresponding to or complementary to the nucleotide sequence of a CGV2 genome. The preferred embodiment of the present invention is such a CGV2 nucleotide sequence specifically corresponding to or complementary to the nucleotide sequence SEQ ID NO: 1, a same nucleotide sequence similar to at least 70%, or part thereof. The invention consists of a single or double stranded nucleic acid or strand molecule, or linear or circular DNA or RNA, naked or encased in particles, or part of a prokaryotic or eukaryotic vector containing these nucleic acids.

An important feature of the invention is a nucleic acid molecule, which may include the complete CGV2 genome, but this is not necessarily the case. Often, only a specific part of CGV2 sequences is sufficient for the required application.

A first preferred possibility is a CGV2-specific nucleotide sequence corresponding to or complementary to a nucleotide sequence encoding a CGV2 protein and occurring in or part of a CGV2 genome. The term "part" in principle includes all parts which may still be designated as CGV2-specific. At the protein level this will be an epitope for most applications, ie an antibody recognized antigenic determinant or a biologically functional protein or part of a protein.

In a second aspect, the invention comprises the use of recombinant genetic information as defined above, in particular for diagnostic purposes, immunization, vaccination purposes, or for the production of (biologically active) CGV2 proteins. More specifically, it is the use of recombinant genetic information according to the invention as a CGV2-specific or oligonucleotide probe in a process for detecting RNA-amplified CGV2 nucleic acids via RT-PCR or amplified DNA by PCR. In particular, the invention relates to a diagnostic kit containing recombinant genetic information according to the invention, such as a CGV2-specific probe or oligonocleotide.

Another important feature of the invention is the use of recombinant genetic information according to the invention of a live virus vaccine based on a wild-type CGV2 virus or a mutant recombinant CGV2, and to protect against infection and disease caused by CGV2 or a related pathogen. The invention also extends to a vaccine preparation for immunizing against CGV2 or related pathogens, which comprises preparing the recombinant genetic information according to the invention and optionally one or more adjuvants suitable for live virus vaccines.

Another aspect of the invention relates to CGV2 proteins or part of information obtained by genetic recombination according to the invention, comprising a nucleotide sequence encoding the CGV2 protein or part thereof, as well as the CGV2 protein or part thereof obtained by isolation. of recombinant prokaryotic or eukaryotic cells containing genetic information according to the invention, comprising a nucleotide sequence encoding CGV2 proteins or parts thereof and capable of expression thereof.

Also at the protein level the invention extends to different applications, namely: the use of a CGV2 protein or part of proteins according to the invention for anti-tumor therapy or for diagnostic, immunization or vaccination purposes , or for the production of both polyclonal and monoclonal CGV2-specific antibodies.

For example, the invention provides for the use of a CGV2 protein or parts thereof as defined above as a reagent to bind specific CGV2 antibodies in an immunoassay process for the detection of specific CGV2 antibodies, for example an immunoperoxidase assay, a ELISA or immunofluorescence, and a diagnostic kit for detecting specific CGV2 antibodies in an immunoassay such as immunoperoxidase staining, an ELISA or indirect immunofluorescence, a diagnostic kit where a CGV2 protein or part of proteins according to the invention as a reagent that binds specific CGV2 - antibodies. The invention also includes the use of a CGV2 protein or protein part as defined above as a subunit vaccine to provide protection against CGV2, as well as a CGV2 vaccine preparation comprising a CGV2 protein preparation or part of proteins according to the invention and optionally one or more adjuvants suitable for subunit vaccines. The use of a CGV2 protein or protein as defined above in a process for producing specific CGV2 polyclonal or monoclonal antibodies also falls within the scope of the invention.

In another feature, the invention also relates to specific anti-CGV2 antibodies produced by means of a CGV2 protein or part of proteins as defined above, as well as the different uses for CGV2 as specific antibodies, for example for diagnostic purposes, immunization or vaccination purposes, or for large-scale protein preparation purposes. For example, a diagnostic kit for detecting CGV2 proteins in an immunoassay process, such as a CGV2 diagnostic kit containing specific antibodies according to the invention, such as CGV2 protein reagents.

Another important aspect of the invention is the use of CGV2 proteins or parts thereof, especially CGV2 VP3 protein or parts thereof, as a biologically active molecule, specifically in their use in antitumor therapy. Such application includes the isolated VP3 protein, but also the protein expressed in a eukaryote vector. These vectors may express the complete CGV2 VP3 protein, either alone or as part of a fusion protein, either in its original form or in a mutant form.

Materials and Methods DNA isolation from chicken sera DNA isolation from chicken sera is made as follows: 500 μΐ chicken serum is digested for 1:30 h at 37 ° C in 520 μΐ lysis buffer (0.3% SDS and 0.1 mg proteinase K). DNA is first extracted with 500 μΐ of saturated phenol followed by an extraction of chloroform: isoamyl alcohol (24: 1). After precipitation with 2.5 volumes of 98% cold ethanol, the pellet is washed with a 70% ethanol / water solution. The remaining part is suspended in 50 μΐ TE (10 mM Tris, 1 mM EDTA, pH 7.4) supplemented with 10 mg RNAse and incubated for 30 min at 37 ° C.

DNA isolation from chicken tissues DNA isolation from chicken tissues (brain, liver, spleen, kidney, feather follicle) is done essentially as described by Van Engelenburg et al. [Van Engelenburg et al. 1993. Development of a rapid and sensitive polymerase chain reactor. assay for detection of bovine herpesvirus type 1 in bovine semen. Journal of Clinical Microbiology 31, 3129-3135], with the following changes; 10 mg tissue is macerated and digested for 4 h at 37 ° C in 1 ml lysis buffer (10 mM Tris, 1 mM EDTA, 100 mM NaCl) containing 0.5% SDS and 0.1 mg proteinase K The DNA is extracted twice with phenol: chloroform: isoamyl alcohol (25: 24: 1), precipitated with two volumes of 100% ethanol and kept at 20 ° C for 1 h. DNA is washed in 70% ethanol, air dried and resuspended in 100 μ TE (10 mM Tris, 1 mM EDTA, pH 7.4).

Multiple-primed Rolling-Circle Amplification (MPRCA) of CGV2 Genomes DNA samples isolated from sera and tissues are subjected to multiple-primed rolling-circle amplification (MPRCA) using the phi29 DNA polymerase. The MPRCA protocol is developed essentially as described by Dezen et al. 2009 [Dezen et al. (2009) Multiply-primed rolling-circle amplification (MPRCA) of PCV2 genomes: Applications on detection, sequencing and virus isolation. Research in Veterinary Science]. A total of 100 ng of extracted DNA is used in a 25 μΐ reaction volume. The MPRCA reaction products are separated digested or undigested with restriction enzymes on a 0.7% agarose gel.

CGV2 DNA Cloning Restriction enzyme amplified CGV2 genome digestion products that yield only one or two fragments are cloned into prokaryotic vectors, such as pCR2.1, and subjected to sequence analysis. Parts of the CGV2 DNA genome are subsequently subcloned into the same vector or, for example, into pUC18 / 19. All DNA plasmid cloning steps are performed using standard methods [Sambrook, J., Russell, DW, 2001. Molecular Cloning: A Laboratory Manual, vol. 1, 3rd ed. Spring Harbor Laboratory Press, New York, U.S.A. 1.84-1.87].

CGV2 DNA Sequence Analysis Plasmids containing CGV2 genome fragments are purified by the standard 'miniprep' method and about 100 ng of each plasmid is used for nucleotide sequence analysis in a multichannel automated sequencing apparatus (ACTGene256-Mega Bace ) using standard M13 oligonocleotides or CGV2 genome-specific oligonocleotides. The sequences obtained are aligned in a sequence assembly program, such as DNASTAR Inc.'s SeqMantraII 500 program and studied using Basic Local Alignment Search Tool (BLAST) [Altschul, SF, Madden, TL, Schãffer, AA, Zhang, J. , Zhang, Z., Miller, W., Lipman, DJ, 1997. Gapped BLAST and PSI-BLAST: a new generation of protein database search programs. Nucleic Acids Research 25, 3389-3402] of the National Center for Biotechnology Information (NCBI).

Cell cultures The CGV2 virus is propagated in Marek's disease virus-transformed chicken T-cell (MDCC-MSB1) cells or chicken embryo fibroblasts (CEF) transformed with an expression vector expressing an oncogene such as Simian Vaccumizing Virus Tag40 (SV40 Large T antigen), the mouse telomerase gene (tert gene) or human papilloma virus E7 gene.

Transfection of CGV2 genomes For transfection of re-circularized CGV2 genomes into transformed chicken cells, one of the following two methods is used: the Graham and Van der Eb calcium phosphate method [Graham, FL & van der Eb, AJ (1973). A new technique for the assay of infectivity of human adenovirus 5 DNA. Virology 52, 456-467], or the lipofectamine method [Invitrogen's Lipofectamine ™ 2000]. In short, to transform chicken cells, 1 pg of the recirculated CGV2 genomic DNA is added to the cells using one of the methods mentioned above and the transfected cells are incubated in a CQ2 incubator at 37 ° C. The supernatant from transfected and untransfected cells is then tested for the presence of CGV2 genomes for 5 consecutive days with CGV2-specific PCR to monitor virus growth and by a monolayer immunoperoxidase (IPMA) assay of the transfected cells. after 5 days of cultivation.

Polymerase Chain Reaction (Polymerase Chain Reaction (PCR)).

Oligonucleotides to perform a PCR reaction will be purchased from a commercial company and their nucleotide sequence will be based on the sequence SEQ ID NO 1. DNA is either isolated from sera, or from various tissues of diseased chickens or from the supernatant of transfected cells. with CGV2 genomes. The PCR reaction is performed in a total volume of 25 μΐ containing 2.5 μΐ 10x PCR buffer (Invitrogen), 0.75 μΐ 50 mM MgCl2, 2 μΐ 10 mM dNTP, 5 pmol of each oligonocleotide, 1.25 units of Taq DNA polymerase (Invitrogen). Amplification conditions are: 7 min at 94 ° C followed by 35 cycles of 30 sec. at 94 ° C, 30 sec. at 62 ° C and 30 scg. at 72 ° C, followed by 7 min at 72 ° C in an Eppendorf Master thermocycler. One fifth of the amplified DNA is analyzed on a 1% agarose gel.

Monolayer Immunoperoxidase (IPMÃ) Test Virus-infected cells infected with CGV2 genomes and negative cells are stained after three to five days of cultivation using CGV2 positive chicken sera in a monolayer immunoperoxidase test [in English: immunoperoxidase monolayer assay (IΡΜΑ)]. The assay is performed according to the method described by Wensvoort et al. [Wensvoort, G., C. Terpstra, J. Boonstra, M. Bloemraad, and D. Van Zaane. 1986. Production of monoclonal antibodies against swine fever virus and their use in laboratory diagnosis. Vet.Microbiol. 12: 101-108]. An insoluble chromogenic substrate, 3-amino-9-ethylcarbazole (Sigma) is used for the reaction of pcroxidase.

Virus Neutralization Test To study the anti-CGV2 host immune response, a detection test for CGV2-specific neutralizing antibodies is performed using essentially the Deregt et al. [Deregt D., Cho H.J.C. & Kozub G.C. 1993. A comparative evaluation of two sensitive serum neutralization tests for bovine herpesvirus-1 antibodies. Canadian Journal of Veterinary Research. 57: 56-59.] In short, CGV2 virus (100 TCID50 per well) in 96-well microplates are preincubated for 24 hours at 37 ° C with a series of chicken serum dilutions and transferred to a second microplate with cells susceptible to CGV2. After 3 days at 37 ° C in a CO2 incubator, infected cells are examined microscopically for ECP and / or stained using the IPMA assay. Serum titer is taken as the reciprocal of the highest dilution giving complete inhibition of ECV / or CGV2 positive cells. Infection of chickens with the CGV2 virus CGV2 DNA-transfected cell supernatants and untransfected cell supernatants are injected intramuscularly into at least 18 chicks a day (9 infected + 9 uninfected). Six days after infection a necropsy is performed of 3 + 3 chickens per group. Body weight is measured and body fluids (blood with heparin, liquor, bone marrow, and feces) are collected. To isolate the virus and perform immunohistochemistry, thymus, spleen, kidney, and brain samples are collected. From the collected samples the DNA is extracted and submitted to PCR for identification of CGV2 DNA. Immunohistochemical examinations are performed by immunoperoxidase staining with CGV2 positive chicken sera. The same procedure is repeated 12 and 18 days after infection.

Examples Example 1 Amplification of CGV2 Genomes with Phi29 DNA samples isolated from diseased chicken sera were subjected to multiple-primed rolling-circle amplification (MPRCA) using Phi29 DNA polymerase and random sequence resistant DNAse oligonocleotides. Negative control sera from healthy chickens were used for negative control. A total of 100 ng of extracted DNA was used as a template in a 25 mL reaction volume. The MPRCA reaction products were separated on a 0.7% agarose gel after digestion with HindIII or Apal. Only an approximately 2.4 kb fragment appeared and after BamHI digestion two fragments of 0.6 kb and 1.8 kb respectively appeared. Phi29 amplification products from four different samples from diseased chickens were compared and all four showed the same pattern of BamHI fragments. (Figure 1} The identity of these fragments was confirmed by sequence analysis (data not shown).

Example 2 Cloning and subcloning of the double stranded form of CGV2 DNA into bacterial vectors The 0.6 kb and 1.8 kb BamHI fragments were isolated from the agarose gel and ligated into the pCR2.1-digested prokaryotic vector with corresponding enzyme. The ligation mixture was used to transform E. coli Top10 cells and ampicillin resistant colonies were isolated and tested for recombinant molecules having a 0.6 or 1.8 kb insert. CGV2 DNA insert plasmids were used to determine the nucleotide sequence of the insert and were used to subclone fragments. Subclones were also subjected to nucleotide sequencing analysis Example 3 Nucleotide sequence analysis of the CGV2 genome The nucleotide sequence of the insertions of the subcloned fragments was determined using an automatic sequencing apparatus using the Sanger et chain interruption method. al. [Sangex, et al. (1977) Proc. Natl. Acad. Know. (U.S.) 74: 5463-5467] The oligonucleotides used were M13-forward or M13-reverse or CGV2-specific oligonucleotides based on SEQ ID NO: 1.

The nucleotide sequences obtained were compared with sequences from the NCBI database using the BLAST program and a low degree (plus or minus 40%) of amino acid sequence similarity was found with proteins encoded by the chicken anemia virus (CAV). By studying the open reading phase sequence regions with the DNASTAR program a set of three coding protein regions, similar to the CAV genome organization, can be discerned: the VP3 region that overlaps a VP2 region and the VP2 region also overlaps a part of the VP1 region (Figure 2). The amino acid sequences of the three viral proteins (VPs) obtained after conceptual translation of the nucleotide sequence are given in SEQ ID NO 2, 3 and 4. The amino acid residue identities of the VPV proteins from CGV2 and those from CAV are: : (partial) VP1: 34.3%; VP2: 40.3% and VP3: 32.2%. (Figure 3).

Example 4 CGV2 DNA polymerase chain reaction (PCR) from field isolates.

A pair of oligonocleotids was designed based on SEQ ID NO. 1 to perform a CGV2-specific polymerase chain reaction (PCR). The sequences of these oligonocleotids are 5 'GGTAGAAGCCAAAGCGTCCAC 3' and 5 'CGTGTCCGCCAGCAGAAAC 3'. The amplified product has a size of 346 bp. PCR with these synthetic oligonucleotides was performed specifically to detect CGV2 DNA in chickens in the field. The PCR reaction was performed in a 25 μΐ total volume containing 2.5 μΐ PCR 10x buffer (Invitrogen), 0.75 μΐ 50 mM MgCl2, 2 μΐ 10 mM dNTP, 5 pmol of each oligonocleotide, 1.25 units of Taq DNA polymerase (Invitrogen). Amplification conditions are: 7 min at 94 ° C, followed by 35 cycles of 30 sec. at 94 ° C, 30 sec. at 62 ° C and 30 sec. at 72 ° C, followed by 7 min at 72 ° C in an Eppendorf Master thermocycler. One fifth of the amplified DNA was analyzed on a 1% agarose gel.

To determine the lower limit of detection of specific CGV2 PCR, 50 ng of the 346 bp PCR product was subjected to a series of 10 base dilutions and aliquots of all dilution steps were used as templates for new PCR reactions. . The sample with the lowest DNA concentration that still gave rise to a detectable PCR product contained about 1000 CGV2 DNA molecules. Using this PCR, CGV2 DNA can be demonstrated in the liver, spleen, kidney and feather follicles of diseased chickens. Example 5 Construction of a negative VP3 CGV2 mutant To construct a non-VP3 protein expressing CGV2 mutant, a stop codon was introduced at the beginning of the region encoding the VP3 protein. This stop codon should be designed so that the region coding for the VP2 protein is unaffected. The first amino acid that was altered in this way was VP3 leucine residue number 18. The isoleucine residue of VP2 protein in the same position as the genome was not affected by this change (Figure 4).

To introduce this mutation into the CGV2 genome a fusion PCR was performed. To this end four oligonocleotids were designed partially based on SEQ NO 1, as follows: two complementary oligonocleotides spanning the desired mutation: 5 'CTCGGTCAGAACTATaAACGCATACGAG 3' and 5 'CTCGTATGCGTTtTATAGTTCTGACCGAG 3' and two oligonocleotid localized regions such that can be cloned easily into the CGV2 genome. An oligonucleotide is located outside the Apal site and an oligonucleotide includes the HindIII site and is based on the vector sequence (M13) including an EcoRI site (EcoRI does not cut the CGV2 genome). Figure 4. The first two PCRs amplified the left and right parts including the altered region. A third PCR was performed using the two amplified regions as templates and only the two outer oligonucleotides to fuse the two halves and amplify the entire Apal - HindIII / EcoRI region. The changed Apal - HindIII / EcoRI region was cloned into a CGV2 total genome clone, cloned at the HindII site, from which the wild type version of the Apal - HindIII / EcoRI region was removed.

Example 6 Expression of CGV2 VP3 in Eukaryotes All CGV2 proteins can be produced using prokaryotic or eukaryotic expression systems. Knowledge about CGV2 coding regions is sufficient to use such regions for cloning into a suitable expression vector. There are several bacterial expression systems available. For expression in eukaryotes baculovirus and yeast systems are currently the most common. To provide a protein to a host cell, viral vectors such as retroviral vectors, adenovirus, pseudo-type baculovirus may be used. In this example, we show VP3 protein expression in a eukaryotic expression vector to test its apoptosis function and / or to produce cells complementing replication of negative mutant VPV CGV2 mutants. The CGV2 VP3 coding region is isolated from a subclone of the 1.8 kb BamHI fragment by digestion with Apol and BamHI. After separating the digested material on a 0.7% agarose gel, the 0.4 kb BamHI - Apol fragment was isolated from the gel and used in a ligation reaction with the plasmid digested pcDNA3-IRES-GFP-NLS. BamHI and EcoRI. A recombinant plasmid having the desired 0.4 kb region of CGV2 VP3 was isolated and used for transfection of transformed or untransformed cells for the study of their effect on apoptosis. Colonies of stably expressing GFP cells in the nucleus can be isolated to obtain the expressed CGV2 VP3.

Claims (21)

1. The cloning of type 2 chicken Gyrovirus DNA, comprising nucleotide sequences encoding CGV2-related polypeptides. A nucleotide sequence according to claim 1, characterized in that it encodes a sequence of at least a portion of the polypeptides: a. which has an amino acid sequence shown in SEQ ID NO: 2 or a similar amino acid sequence with an identity greater than 70%; B. which has an amino acid sequence shown in SEQ ID NO: 3 or a similar amino acid sequence with an identity greater than 70%; ç. which has an amino acid sequence shown in SEQ ID NO: 4 or a similar amino acid sequence with an identity greater than 70%; and functional equivalents thereof. 3. A nucleotide sequence comprising at least part of the CGV2 genome. A nucleotide sequence according to claim 3, characterized in that it contains at least part of the nucleotide sequence shown in SEQ ID NO: 1 or a similar amino acid sequence with an identity greater than 70%. A molecule of a recombinant nucleotide sequence characterized by a nucleotide sequence according to claims 1-4. A molecule of a recombinant nucleotide sequence according to claim 5, characterized in that it is functionally linked to an expression control sequence. A viral vector comprising a nucleotide sequence according to claims 1-4. A host cell transformed with a nucleotide sequence according to claims 1-4 or a recombinant nucleoside molecule according to claims 5-6 or containing a viral vector according to claim 7. 9. A polypeptide with immunogenic characteristics of a CGV2-related antigen. A polypeptide according to claim 9, characterized in that it contains at least part of the amino acid sequence: a. Having an amino acid sequence shown in SEQ ID NO: 2 or a similar amino acid sequence with an identity greater than 70%; B. Having an amino acid sequence shown in SEQ ID NO: 3 or a similar amino acid sequence with an identity greater than 70%; ç. Having an amino acid sequence shown in SEQ ID NO: 4 or similar amino acid sequence having an identity greater than 70%; and functional equivalents thereof. A CGV2-related polypeptide encoded by a nucleotide sequence according to claims 1-4, characterized in that it has a nucleotide identity greater than 70%. A polypeptide immunoreactive antibody or antiserum according to claims 9-11. 13. A non-naturally occurring attenuated CGV2 characterized by being obtained as a result of a mutation in the CGV2 genome introduced by recombinant DNA techniques. 14. A vaccine for the protection of chickens and other birds (such as turkeys, rheas, ostrich, pheasants, ducks, geese and quails) against a CGV2 infection comprising: a molecule of a recombinant nucleotide sequence according to claim 5 (or a portion thereof, of at least 36 nucleotides), a viral vector according to claim 6, a host cell according to claim 8, a polypeptide according to claims 9-11 or a CGV2 according to claim 11. A method for preparing a vaccine against a CGV2 infection characterized in that it is a host cell according to claim 7 is cultured, and consequently the CGV2-containing material is collected and treated was a pharmaceutical preparation with immunizing activity. A method for the preparation of a CGV2 vaccine, characterized in that a polypeptide (minimum 12 amino acids) according to claims 9-11 is processed into a pharmaceutical preparation with immunizing activity. A method for protecting chickens against CGV2 infection characterized by an effective amount of a vaccine according to claim 14 which is administered to the animals. An immunochemical reagent comprising a polypeptide (minimum 12 amino acids) according to claims 9-11. An immunoassay kit comprising an immunochemical reagent according to claim 18. A recombinant nucleotide molecule comprising a nucleic acid sequence for expressing at least part (minimum 12 amino acids) of the amino acid sequence SEQ ID NO: 4 or functional equivalents used for anticancer therapy. * One protein or at least part (minimum 12 amino acids) of amino acid sequence SEQ ID NO: 4 separately or part of a fusion protein or functional equivalent used for anti-cancer therapy.