BRPI0808999B1 - ANIMAL FEED ADDITIVE, NUCLEIC ACID CONSTRUCTION, RECOMBINANT EXPRESSION VECTOR, RECOMBINANT MICROORGANISM, METHODS FOR PRODUCING A POLYPEPTIDE AND FOR IMPROVING THE NUTRITIONAL VALUE OF AN ANIMAL FEED, USE OF AT LEAST ONE POLYPEPTIDE, AND, COMPOSITION OF ANIMAL FEED - Google Patents

Abstract

ISOLATED POLYPEPTIDE, ISOLATED POLYNUCLEOTIDE, NUCLEIC ACID CONSTRUCTION, RECOMBINANT EXPRESSION VECTOR, RECOMBINANT HOST CELL, METHODS FOR PRODUCING THE POLYPEPTIDE, FOR IMPROVING THE NUTRITIONAL VALUE OF AN ANIMAL FEED, AND FOR PRODUCING A FERMENTATION PRODUCT, USE OF AT LEAST ONE POLYPEPTIDE, ANIMAL FEED ADDITIVE, AND ANIMAL FEED COMPOSITION. The present invention relates to isolated polypeptides with phytase activity and isolated polynucleotides encoding the polypeptides. The polypeptides are related to a phytase derived from Hafnia alvei, the amino acid sequence of which is presented in the attached sequence listing as SEQ ID NO: 10. The invention also relates to nucleic acid constructs, vectors and host cells comprising the polynucleotides. , as well as methods for the production and use of polypeptides, particularly in animal feed.

Description

LIST OF DEPOSITED SEQUENCES AND MICROORGANISMS Sequence Listing

[001] The present application contains a printed copy and a computer-readable format of a sequence listing. The contents in machine-readable form are incorporated herein in their entirety by reference.

Biological material deposit

[002] A phytase-producing bacterial strain was isolated from Danish soil. The strain was demonstrated to produce a phytase with optimum acidic pH and high thermostability. The strain was identified as Hafnia alvei and was deposited on March 21, 2007, under the terms of the Budapest Treaty with Deutsche Sammlung von Mikroorganismen und Zellkulturen (DSMZ) and given the following accession number: Deposit Accession Number Date of the Hafnia alvei Deposit NN020125 DSM 19197 March 21, 2007

FIELD OF INVENTION

[003] The present invention relates to isolated polypeptides with phytase activity and isolated polynucleotides encoding the polypeptides. The polypeptides are related to a phytase derived from Hafnia alvei, the amino acid sequence of which is presented in the sequence listing

[004] Phytases are well-known enzymes, as are the advantages of adding them to animal foods, including humans. Phytases have been isolated from many sources, including a variety of fungal and bacterial strains.

[005] It is an object of the present invention to provide alternative polypeptides with phytase activity and polynucleotides encoding the polypeptides. The polypeptides of the invention preferably have improved, more preferably improved, properties, for example, a different substrate specificity, a higher specific activity, an improved stability (such as acid stability, thermal stability and/or protease stability, particularly pepsin stability). ) a modified pH optimum (such as a lower, higher pH optimum) and/or improved performance in animal feed (such as improved phytate release and/or degradation).

SUMMARY OF THE INVENTION

[006] The present invention relates to polypeptides with phytase activity, selected from the group consisting of: (a) a polypeptide with an amino acid sequence which has at least 75% identity with (i) amino acids 1 to 413 of SEQ ID NO: 10, and/or (ii) the mature polypeptide part of SEQ ID NO: 10; (b) a variant comprising a deletion, insertion and/or conservative substitution of one or more amino acids of (i) amino acids 1 to 413 of SEQ ID NO: 10, and/or (ii) the part

[007] The invention also relates to isolated polynucleotides encoding a polypeptide with phytase activity, selected from the group consisting of: (a) a polynucleotide encoding a polypeptide with an amino acid sequence which has at least 75% identity with amino acids 1 at 413 of SEQ ID NO: 10; and (b) a polynucleotide with at least 75% identity to nucleotides 100 to 1338 of SEQ ID NO: 9.

[008] The invention also relates to nucleic acid constructs, recombinant expression vectors and recombinant host cells comprising polynucleotides.

[009] The invention also relates to methods for producing such polypeptides with phytase activity comprising (a) culturing a recombinant host cell comprising a nucleic acid construct comprising a polynucleotide encoding the polypeptide under conditions leading to the production of the polypeptide; and (b) recovering the polypeptide.

[0010] The invention further relates to a nucleic acid construct comprising a gene encoding a protein operatively linked to a nucleotide sequence encoding a signal peptide consisting of (i) nucleotides 1 to 99 of SEQ ID NO: 11.

[0011] The invention also relates to methods of using phytases of the invention in animal feed, as well as animal feed and animal feed additive compositions containing the polypeptides.

[0012] The invention also relates to methods of using the phytases of the invention in the production of a fermentation product, such as, for example, ethanol, beer, wine, in which fermentation is carried out in the presence of a phytase of the present invention .

[0013] The present invention relates to methods for treating proteins, including vegetable proteins, with the phytases of the present invention.

BRIEF DESCRIPTION OF FIGURES

[0014] Fig. 1 shows the phosphorus bound to residual inositol-phosphate after in vitro incubation in a comparison between Hafnia alvei phytase and a Citrobacter braaki phytase dosed from 125 to 500 FYT/Kg of feed.

[0015] Fig. 2 shows a comparison of phosphorus bound to residual inositol-phosphate after in vitro incubation in a comparison between Hafnia alvei phytase and a Peniophora lycii phytase dosed at 250 FYT/Kg of feed and 500 FYT/Kg of feed.

[0016] Fig. 3 shows the Appendix of structural coordinates for the three-dimensional structure of the dissolved crystal of Hafnia alvei phytase.

DEFINITIONS

[0017] Phytase activity: In the present context, a polypeptide with phytase activity (a phytase) is an enzyme which catalyzes the hydrolysis of phytate (myoinositol hexakisphosphate) into (1) myoinositol and/or its (2) mono, di, tri, tetra and/or pentaphosphates and (3) inorganic phosphate.

[0018] The ENZYME website (WWW.expasy.ch/enzyme) is a repository of information regarding enzyme nomenclature. It is primarily based on the recommendations of the Nomenclature Committee of the International Union of Biochemistry and Molecular Biology (IUB-MB) and it describes each type of characterized enzyme for which an EC (Enzyme Commission) number has been provided (Bairoch A. The ENZYME database, 2000, Nucleic Acids Res 28:304-305). See also the NC-IUBMB Enzyme Nomenclature Manual, 1992).

[0019] According to the ENZYME website, three different types of phytases are known: A 3-phytase (myoinostol hexaphosphate 3-phosphohydrolase, EC 3.1.3.8), a 6-phytase (myoinostol hexaphosphate 6-phosphohydrolase, EC 3.1 .3.26) and a 5-phytase (EC 3.1.3.72). For the purposes of the present invention, all types are included in the definition of phytase.

[0020] In a particular embodiment, the phytases of the invention belong to the family of histidine acid phosphatases, which includes acid phosphatase from Escherichia coli pH 2.5 (aPPA gene) as well as fungal phytases such as phytases from Aspergillus awamorii A and B (EC: 3.1.3.8) (phyA and phyB gene). Histidine acid phosphatases share two regions of sequence similarity, each centered around a conserved histidine residue. These two histidines appear to be involved in the catalytic mechanism of the enzymes. The first histidine is located in the N-terminal section and forms a phosphorus-histidine intermediate while the second is located in the C-terminal section and possibly acts as a proton donor.

[0021] In another particular embodiment, the phytases of the invention have a conserved active site portion, viz. R-H-G-X-R-X-P, where X designates any amino acid (see amino acids 18 to 24 of mature phytase shown in SEQ ID NO: 10).

[0022] For the purposes of the present invention, phytase activity is determined in the FYT unit, one FYT being the amount of enzyme that releases 1 micromol of inorganic orthophosphate per min under the following conditions: pH 5.5; temperature of 37 °C; substrate: sodium phytate (C6H6O24P6Na12) at a concentration of 0.0050 mol/L. Suitable phytase assays are the FYT and FTU assays described in Example 1 of WO

[0023] Optimum pH: The optimum pH of a polypeptide of the invention is determined by incubating phytase at various pH values, using a substrate at a predetermined concentration and a fixed incubation temperature. The optimum pH is then determined from a graphical representation of phytase activity versus pH. In a particular embodiment, the FYT assay is used, viz. the substrate is 5 mM sodium phytate, the reaction temperature is 37 °C, and the activity is determined in FYT units at various pH values, as done in the examples below. In another particular embodiment, the phytase assay of any of the examples is used. A relatively low optimum pH means an optimum pH less than pH 5.0, for example less than pH 4.5, 4.0, 3.5, 3.0, 2.5 or less than 2.0 . A relatively high optimum pH means an optimum pH above pH 5.0, for example above pH 5.5, 6.0,6.5, 7.0, 7.5,8.0, 8.5 or even greater than 9.0.

[0024] Isolated polypeptide: The term “isolated polypeptide, as used herein, refers to a polypeptide which is at least 20% pure, preferably at least 40% pure, more preferably at least 60% pure, even more preferably 80% pure, more preferably at least 90% pure, and even more preferably at least 95% pure as determined by SDS-PAGE.

[0025] Substantially pure polypeptide: The term “substantially pure polypeptide” here denotes a polypeptide preparation which contains at most 10%, preferably at most 8%, more preferably at most 6%, more preferably at most 5%, more preferably at maximum 4%, maximum 3%, even more preferably maximum 2%, more preferably maximum 1% and even more preferably maximum 0.5% by weight of the polypeptide material with which it is naturally associated. It is therefore preferred that the substantially pure polypeptide is at least 92% pure, preferably at least 94% pure, more preferably at least 95% pure, more preferably at least 96% pure, more preferably at least 96% pure, more preferably at least 97% pure, more preferably at least 98% pure, even more preferably at least 99%, more preferably at least 99.5% pure and even more preferably at least 100% pure by weight of the total polypeptide material present in the preparation.

[0026] The polypeptides of the present invention are preferably in a substantially pure form. Particularly, it is preferred that the polypeptides are in "an essentially pure form", that is, that the polypeptide preparation is essentially free of other polypeptide materials with which it is naturally associated. This can be achieved, for example, by preparing the polypeptide by well-known recombinant methods or by classical purification methods.

[0027] Here, the term “substantially pure polypeptide” is synonymous with the terms “isolated polypeptide” and “polypeptide in isolated form”.

[0028] Identity: The relationship between two amino acid sequences or between two nucleotide sequences is described by the “identity” parameter.

[0029] For the purposes of the present invention, the degree of identity between two amino acid sequences, as well as the degree of identity between the two nucleotide sequences is determined by the “align” program which is a Needleman-Wunsch alignment (i.e. , global alignment) useful for both protein and DNA alignments). The BLOSM50 predefined scoring matrix and predefined identity matrix are used for protein and DNA alignments respectively. The penalty for the first residue in a range is -12 for proteins and -16 for DNA. While the penalties for additional residue in a range are -2 for proteins and -4 for DNA.

[0030] “Align” is part of the FASTA package version v20u6 (see W. R. Pearson and D. J. Lipman (1988), "Improved Tools for Biological Sequence Analysis", PNAS 85:2444-2448, and W. R. Pearson (1990) "Rapid and Sensitive Sequence Comparison with FASTP and FASTA," Methods in Enzymology 183:63-98). FASTA protein alignments use the SmithWaterman algorithm without limitations on gap size (see "Smith-Waterman algorithm", T. F. Smith and M. S. Waterman (1981) J. Mol. Biol. 147:195-197).

[0031] The Needleman-Wunsch algorithm is described in Needleman, S. B. and Wunsch, CD., (1970), Journal of Molecular Biology, 48: 443-453, and the align program by Myers and W. Miller in "Optimal Alignments in Linear Space" CABIOS (computer applications in biosciences) (1988) 4:1117.

[0032] The degree of identity between the target sequence (or sample, or test) and a specified sequence (e.g., amino acids 1 to 413 of the mature phytase shown in SEQ ID NO: 10) can also be determined as follows: Sequences are aligned using the “align” program. The number of perfect matches (“N-perfect matches”) in the alignment is determined (a perfect match means the same amino acid residue in the same position in the alignment, usually designated with a “|” in the alignment). The length of the specified sequence (the amount of amino acid residues) is determined (“N-specified”, in the example mentioned above = 413). The degree of identity is calculated as the ratio between “N-perfect matching” and “N-specified” (for conversion to percentage identity, multiply by 100).

[0033] In an alternative embodiment, the degree of identity between a target sequence (or sample, or test) and the specified sequence (e.g., amino acids 1 to 413 of SEQ ID NO: 10) is determined as follows: The two Sequences are aligned using the “align” program. The number of perfect matches (“N-perfect matches) in the alignment is determined (a perfect match means the same amino acid residue in the same position in the alignment, usually designated with a “|” in the alignment). The common length of the two aligned sequences is also determined, viz. the total amount of amino acids in the overlapping part of the alignment (“N overlap”). The degree of identity is calculated as the proportion between “N-perfect matching” and “N overlap” (for conversion to percentage identity, multiply by 100). In one embodiment, the N overlap includes dragging and directing gaps across the alignment, if any. In another embodiment, the N overlap excludes the dragging and steering of gaps created by the alignment, if any.

[0034] In another alternative embodiment, the degree of identity between a target sequence (the sample, or test) and a specified sequence (e.g., amino acids 1 to 413 of SEQ ID NO: 10) is determined as follows: The sequences are aligned using the “align” program. The number of perfect matches (“N-perfect matches”) in the alignment is determined (a perfect match means the same amino acid residue in the same position in the alignment, usually designated with a “|” in the alignment). The length of the target sequence (the amount of amino acid residues is determined (“N-target”). The degree of identity is calculated as the ratio between “N-perfect matching” and “N-target” (for conversion to percent identity , multiply by 100).

[0035] Preferably, the overlap is at least 20% of the specified sequence (“N-overlap”, as defined above, divided by the amount of amino acids in the specified sequence (“N-specified”), and multiplied by 100), plus preferably at least 25%, 30%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90% or at least 95%. This means that at least 20% (preferably 25 to 95%) of the amino acids in the specified sequence end up being included in the overlap when the sample sequence is aligned with the specified sequence.

[0036] In the alternative, the overlap is at least 20% of the target (or sample, or test) sequence (“N-overlap”, as defined above, divided by “N-target”, as defined above, and multiplied by 100), more preferably at least 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, or at least 95%. This means that at least 20% (preferably 25 to 95%) of the amino acids in the target sequence end up being included in the overlap when aligned against the specified sequence).

[0037] Polypeptide fragment: The term “polypeptide fragment” is defined herein as a polypeptide with one or more amino acids removed from the amino and/or carboxy terminus of the mature peptide part of the specified sequence, for example SEQ ID NO: 10, or one

[0038] Subsequence: The term “subsequence” is defined herein as a nucleotide sequence with one or more nucleotides removed from the 5' and/or 3' end of the mature peptide encoding part of the specified sequence, for example, SEQ ID NO: 9 , or a homologous sequence thereof, in which the subsequence encodes a polypeptide fragment with phytase activity. In particular embodiments, the subsequence contains at least 1050, 1080, 1110, 1140, 1170, 1200, 1215, 1230, 1245, 1260, 1275, 1290, 1305, 1320 or at least 1335 nucleotides.

[0039] Allelic variant: The term “allelic variant” here denotes any one of two or more alternative forms of a gene occupying the same chromosomal location. Allelic variation arises naturally through mutation, and can result in polymorphism in populations. Genetic mutations can be silent (no change in the encoded polypeptide) or can encode polypeptides with altered amino acid sequences. An allelic variant of a polypeptide is a polypeptide encoded by an allelic variant of a gene.

[0040] Substantially pure polynucleotide: The term “substantially pure polynucleotide” as used herein refers to a polynucleotide preparation free of other external or undesirable nucleotides and in a form suitable for use in genetically modified protein production systems. Thus, a substantially pure polynucleotide contains at most 10%, preferably at most 8%, preferably at most 6%, more preferably at most 5%, more preferably at most 4%, more preferably at most 3%, even more preferably at maximum 2%, more preferably maximum 1% and even more preferably maximum 0.5% by weight of other polynucleotide materials with which it is naturally associated. However, a substantially pure polynucleotide may include naturally occurring 5' and 3' untranslated regions, such as promoters and terminators. It is preferred that the substantially pure polynucleotide is at least 90% pure, preferably at least 92% pure, more preferably at least 94% pure, more preferably at least 95% pure, more preferably at least 96% pure, more preferably at least 97% pure. % pure, even more preferably at least 98% pure, more preferably at least 99% and even more preferably at least 99.5% pure by weight. The polynucleotides of the present invention are preferably in a substantially pure form. Particularly, it is preferred that the polynucleotides disclosed herein are in an “essentially pure form”, that is, that the polynucleotide preparation is essentially free of other polynucleotide materials with which they are naturally associated. Here, the term “substantially pure polynucleotide” is synonymous with the terms “isolated polynucleotide” and “polynucleotide in isolated form”. Polynucleotides can be of genomic, cDNA, RNA, semi-synthetic, synthetic origin or any combination of these.

[0041] Nucleic acid construct: The term “nucleic acid construct” as used herein refers to a nucleic acid molecule, whether single-stranded or double-stranded, which is isolated from a naturally occurring gene or which is modified to contain nucleic acid segments so that it cannot otherwise exist in nature. The term nucleic acid construct is synonymous with the term “nucleic acid cassette.”

[0042] Control sequence: The term “control sequences” is defined herein to include all components, which are necessary or advantageous for the expression of a polynucleotide encoding a polypeptide of the present invention. Each control sequence may be natural or foreign to the nucleotide sequence encoding the polypeptide. Such control sequences include, but are not limited to, a leader sequence, polyadenylation sequence, propeptide sequence, promoter sequence, signal peptide sequence and transcription termination sequence. At a minimum, control sequences include a promoter and translation and transcription stop signals. Control sequences may be provided with the linkers for the purposes of introducing specific restriction sites that facilitate binding of the control sequences to the coding region of the nucleotide sequence encoding a polypeptide.

[0043] Operatively linked: the term “operatively linked” here denotes a configuration in which a control sequence is placed in an appropriate position relative to the coding sequence of the polynucleotide sequence, such that the control sequence directs the expression of the coding sequence of a polypeptide.

[0044] Coding sequence: when the term “coding sequence” is used here! means a nucleotide sequence, which directly specifies the amino acid sequence of its protein product. The boundaries of the coding sequence are generally determined by an open reading frame, which usually begins with the start codon

[0045] Mature polypeptide part: When used herein the terms “mature polypeptide part” or “mature peptide part” refer to that part of the polypeptide which is secreted by a cell which contains, as part of its genetic equipment, a polynucleotide encoding the polypeptide. In other words, the mature polypeptide part refers to that part of the polypeptide which remains after the signal peptide part is cleaved once it has fulfilled its function of targeting the encoded polypeptide in the cells' secretory pathway. The predicted signal peptide part of SEQ ID NO: 10 is amino acids -33 to -1 thereof, which means that the predicted mature polypeptide part of SEQ ID NO: 10 corresponds to amino acids 1 to 413 thereof. However, slight variation may occur from host cell to host cell, and consequently the mature polypeptide part of expression is preferred.

[0046] Mature polypeptide coding part: When used herein, the term “mature polypeptide coding part” or “mature polypeptide coding sequence” refers to that part of the polynucleotide coding for the polypeptide which codes for the mature polypeptide part. For example, for SEQ ID NO: 9, the predicted mature polypeptide coding part corresponds to nucleotides 100 to 1338 (encoding amino acids 1 to 413 of SEQ ID NO: 10).

[0047] Expression: The term “expression” includes any step involved in the production of the polypeptide including, but not limited to, transcription, post-transcriptional modification, translation, post-translational modification and secretion.

[0048] Expression vector: The term “expression vector” is defined here as a linear or circular DNA molecule that comprises a polynucleotide encoding a polypeptide of the invention, and which is operatively linked to additional nucleotides that provide its expression.

[0049] Host cell: The term “host cell”, as used herein, includes any cell type which is susceptible to transformation, transfection, transduction and the like with a nucleic acid construct comprising a polynucleotide of the present invention.

[0050] Modification: The term “modification” here means any chemical modification of the specified polypeptide, for example, the polypeptide consisting of amino acids 1 to 413 of SEQ ID NO: 10, as well as genetic manipulation of the DNA encoding that polypeptide. The modification(s) may be substitution(s), elimination(s) and/or insertion(s) of the amino acid(s), as well as substitution(s) of the chain(s). s) of amino acid(s).

[0051] Artificial variant: When used herein, the term “artificial variant” means a polypeptide with phytase activity produced by an organism expressing a modified nucleotide sequence of mature phytase encoding part of SEQ ID NO: 9. The modified nucleotide sequence is obtained through human intervention by modifying the mature phytase encoding part of the nucleotide sequence disclosed in SEQ ID NO: 9.

DETAILED DESCRIPTION OF THE INVENTION Polypeptides with Phytase Activity

[0052] In a first aspect, the present invention relates to isolated polypeptides with phytase activity and with an amino acid sequence which has a degree of identity with amino acids 1 to 413 of SEQ ID NO: 10 (i.e., the polypeptide mature) of at least 75%.

[0053] In particular embodiments, the degree of identity is at least 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87% , 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 96.5%, 97%, 97.5%, 98%, 98.5%, 98 .7%, 98.8%, 98.9%, 99%, 99.0%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6 %, 99.7%, 99.8% or at least 99.9%, which exhibits phytase activity (hereinafter “homologous polypeptides”).

[0054] In other particular embodiments, the homologous polypeptides have an amino acid sequence which differs by 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2 or 1 amino acid from amino acids 1 to 413 of SEQ ID NO: 10.

[0055] In particular embodiments, the polypeptide of the present invention comprises the mature part of the amino acid sequence of SEQ ID NO: 10, or is an allelic variant thereof; or a fragment thereof that has phytase activity. In still other particular embodiments, the polypeptide comprises amino acids 1 to 413 of SEQ ID NO: 10, or an allelic variant thereof; or a fragment thereof that has phytase activity.

[0056] In a second aspect, the present invention relates to isolated polypeptides with phytase activity which are encoded by polynucleotides which hybridize under conditions of at least medium stringency, preferably medium with (i) nucleotides 100 to 1338 of SEQ ID NO: 9, (II) the coding part of the mature polypeptide of SEQ ID NO: 9, and/or (iii) a complementary strand of any of (i), and (ii) and/or (iv) a subsequence of (i), (ii) or (iii) (J. Sambrook, E. F. Fritsch, and T. Maniatus, 1989, Molecular Cloning, A Laboratory Manual, 2nd edition, Cold Spring Harbor, New York). A subsequence of SEQ ID NO: 9 contains

[0057] In particular embodiments, hybridization occurs under conditions of at least medium-high, at least high or at least very high stringency; preferably under conditions of medium-high, high or very high stringency.

[0058] In alternative embodiments, hybridization is carried out under very low or low stringency conditions.

[0059] The nucleotide sequence of SEQ ID NO: 9, or a subsequence thereof, as well as the amino acid sequence of SEQ ID NO: 10 or a fragment thereof can be used to design a nucleic acid probe to identify and clone polypeptide encoding DNA clones with phytase activity from strains of different genera or species according to methods well known in the art. Particularly, such probes can be used for hybridization with genes or cDNA of the genera or species of interest, following standard Southern blotting procedures, to identify and isolate the corresponding gene therein. Such probes may be considerably shorter than the full sequence, but should be at least 14, preferably at least 25, more preferably at least 35 and most preferably at least 70 nucleotides in length. It is however preferred that the nucleic acid probe is at least 100 nucleotides in length. For example, the nucleic acid probe may be at least 200 nucleotides, preferably at least 300 nucleotides, more preferably at least 400 nucleotides, or more preferably at least 500 nucleotides in length. Even larger probes can be used, for example, nucleic acid probes which are at least 600 nucleotides, at least preferably at least 700 nucleotides, more preferably at least 800 nucleotides or more preferably at least 900 nucleotides in length. Both DNA and RNA probes can be used. Probes are typically labeled to detect the corresponding gene (e.g., with 32P, 3H, 35S, biotin, or avidin). Such probes are encompassed by the present invention.

[0060] A library of genomic DNA prepared from such other microorganisms can consequently be scanned for DNA, which hybridizes with the probes described above and which encodes a polypeptide with phytase activity. Genomic or other DNA from such other organisms can be separated by agarose or polyacrylamide gel electrophoresis or other DNA separation techniques. DNA from libraries or separated DNA can be transferred to and immobilized on nitrocellulose or other suitable carrier material. To identify a clone or DNA which is homologous to SEQ ID NO: 9, or a subsequence thereof, the carrier material is used in a Southern blot.

[0061] For the purposes of the present invention, hybridization indicates that the nucleotide sequence hybridizes to a labeled nucleic acid probe corresponding to the nucleotide sequence shown in SEQ ID NO: 9, the complementary strand thereof or a subsequence thereof, under conditions of very low or very high stringency. Molecules to which the nucleic acid probe hybridizes under these conditions can be detected using X-ray film.

[0062] In a particular embodiment, the nucleic acid probe is any one of SEQ ID Nos: 1 to 8. In another particular embodiment, the nucleic acid probe is the complementary strand of nucleotides 100 to 450, of nucleotides 450 to 900 or from nucleotides 900 to 1338 of SEQ ID NO: 9.

[0063] For long probes of at least 100 nucleotides in length, very low to very high stringency conditions are defined as prehybridization and hybridization at 42 °C in 5X SSPE, 0.3% SDS, 200 micrograms/mL cut and denatured salmon sperm DNA, and either 25% formamide for very low and low stringency, 35% formamide for medium and medium-high stringency, or 50% formamide for high and very high stringency, following Southern procedures. blotting patterns for 12 to 24 hours optimally.

[0064] For long probes of at least 100 nucleotides in length the carrier material is finally washed three times each for fifteen minutes using 2 x SC, 0.2% SDS preferably at least at 45 °C (very low stringency), more preferably at least 50°C (low stringency), more preferably at least 55°C (medium stringency), more preferably at least 60°C (medium-high stringency), even more preferably at least 65°C (high stringency). high), and more preferably at least 70°C (very high stringency).

[0065] For short probes which are from about 15 nucleotides to about 70 nucleotides in length, stringency conditions are defined as pre-hybridization, hybridization and post-hybridization washing at about 5 °C to about 10 °C below the Tm calculated using the calculation according to Bolton and McCarthy (1962, Proceedings of the

[0066] For short probes which are from about 15 nucleotides to about 70 nucleotides in length, the carrier material is washed once in 6 x SSC plus 0.1% SDS for 15 minutes and twice each for 15 minutes using 6 X SSC at 5°C to 10°C below calculated Tm.

[0067] Under salt-containing hybridization conditions, the effective Tm is what controls the degree of identity required between the probe and the filter-bound DNA for successful hybridization. The effective Tm can be determined using the formula below to determine the degree of identity required for two DNAs to hybridize under various stringency conditions. Effective Tm = 81.5 + 16.6 (log M [Na+]) + 0.41 (%G + C) - 0.72 (% formamide) (See www.ndsu.nodak.edu/instruct/mcclean/ plsc7 31/ dna/ dna6 .htm)

[0068] “G + C” designates the content of the G and T nucleotides in the probe. For medium stringency, for example, formamide is 35% and the Na+ concentration for 5x SSPE is 0.75 M.

[0069] In one aspect, the present invention relates to isolated polypeptides with phytase activity, and the following physicochemical properties (as analyzed in substantially pure polypeptides): (i) a high specific activity, such as a specific activity in phytate of at least 50% of the specific activity of E. coli appA (SPTREMBL:Q8GN88), the specific activity being preferably measured in FYT units per mg of phytase enzyme protein; (ii) acid stability; such as (a) at least 60%, preferably at least 65%, at least 70% or at least 75%, residual activity after overnight incubation at 37°C in glycine/hydrochloric acid pH 2 buffer .2, in relation to residual activity after overnight incubation at 37 °C in HEPES buffer pH 7.0; (b) at least 80%, preferably at least 85%, at least 90% or at least 95% residual activity after incubation overnight at 37°C in glycine/hydrochloric acid buffer pH 3.0 , in relation to residual activity after overnight incubation at 37 °C in HEPES buffer pH 7.0; and/or (c) a residual phytase activity after 2 hours of incubation at a temperature of 25, 30, 35 or 37 °C, preferably 37 °C, and a pH of 2.2, 2.4, 2.5 , 2.6, 2.8, 3.0, 3.2, 3.4, or 3.5, preferably glycine/hydrochloric acid buffers of pH 2.2 or 3.0, of at least 50% compared with residual appA activity from E. coli (SPTREMBL:Q8GN88); (iii) thermal stability, such as a residual phytase activity after 0.5, 1, 1.5 or 2 hours, preferably 0.5 hour of incubation at a pH of 5.5 and a temperature of 55, 60, 65, 70, 75, 80, 85 or 95 °C, preferably 70 °C, of at least 50% compared to the residual activity of appA from E. coli (SPTREMBL:Q8GN88);

[0070] Alternatively, differential scanning calorimetry (DSC) measurements can be used to determine the denaturation temperature, Td, of the purified phytase protein. Td is indicative of the thermal stability of the protein: The higher the Td, the greater the thermal stability. DSC measurements can be carried out at various pH values, for example using VP-DSC from Micro Cal. Scans are performed at a constant scan rate of 1.5 °C/min from 20 to 90 °C. Preferred pH values are 4.0 and 5.5, preferably 4.0. Before performing DSC, phytases are desalted, for example, using NAP-5 columns (Pharmacia) equilibrated in appropriate buffers (e.g., 25 mm sodium acetate pH 4.0; 0.1 M sodium acetate pH 5 ,5). Data manipulation is performed using MicroCal Origin software (version 4.10), and the denaturation temperature, Td (also called melting temperature, Tm) is defined as the temperature at the apex of the peak in the thermogram. (iv) protease stability, such as a residual phytase activity after 0.5, 1, 1.5 or 2 hours, preferably 1 hour, incubation at a temperature of 20, 25, 30.35 or 37 °C, preferably 37 °C, and a pH of 5.5, in the presence of 0.1 mg/mL pepsin, at least 50% compared to the residual activity of appA from E. coli (SPTREMBL:Q8GN88); and/or (v) an optimum pH below pH 5.0, for example below pH 4.5, 4.0, 3.5, 3.0, 2.5 or even below 2.0, determined using the FYT assay, and/or using the assay of Example 4, as described hereinbefore.

[0071] In particular embodiments of aspect (i) above, the specific activity is at least 60, 70, 80, 90, 100, 110, 120, 130, 140, or 150% of the specific activity of E's appA. coli. In particular embodiments of each of aspects (ii) to (iv) above, the residual activity is at least 60, 70, 80, 90, 100, 110, 120, 130, 140 or at least 150% of the residual activity of E. coli appA.

[0072] In a fifth aspect, the activity of the enzyme of the invention, at pH 5.0 and at 37 °C, measured on the pNP-phosphate substrate is less than 11% of the enzyme activity measured on the phytate substrate. Preferably, the proportion is less than 10%, 9%, 8%, 7%, 6%, or less than 5%. The ratio of pNP to phytate hydrolysis is indicative of the true phytase nature of the enzyme. A high ratio of activity on pNP to activity on phytate may indicate that the enzyme in question is a phosphatase with relatively low substrate specificity, whereas a low ratio indicates that this is an enzyme that accepts phytate more specifically as a substrate.

[0073] In a sixth aspect, the phytase of the invention has a greater release of phosphorus (P) in an in vitro model compared to phytase from Peniophora lycii, preferably at least 110%, more preferably at least 120%. , 130% or at least 140% yours. In one embodiment, the phytase of the invention, dosed at 0.25 FYT/g of feed, releases at least 150% phosphorus (P) in relation to the phosphorus released by Peniophora lycii phytase, also dosed at 0.25 FYT/g of feed, in the in vitro model. Preferably, the release is at least 155%, 160%, 165%, 170%, 175% or at least 180%. In another embodiment, the phytase of the invention, dosed at 0.75 FYT/g of feed, releases at least 150% of phosphorus (P) in relation to the phosphorus released by Peniophora lycii phytase, also dosed at 0.75 FYT/g of feed, in the in vitro model. Preferably, the release is at least 155%, 160%, 165%, 170%, 175%, 180%, 185%, or at least 190%.

[0074] In a seventh aspect, the phytase of the invention has a residual activity after incubation at 37 ° C and in a 0.1 M Glycine/HCl buffer, pH 2.0, for 4 hours of at least 20% compared with activity at time t = 0, activity (and residual activity) being assayed at 37 °C and pH 5.5 in 1% (w/v) Na-phytate using a 0.25 M Na-acetate buffer pH 5.5, blind buffer subtracted. In preferred embodiments, the residual activity is at least 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75% or at least 80%. In another embodiment, the phytase of the invention has a residual activity after incubation at 37 °C and in a 0.1 M Glycine/HCl buffer, pH 2.5 for 1 day (24 hours) of at least 20% compared to the activity at time t = 0, the activity (and residual activity) being assayed at 37 °C and pH 5.5 in 1% (w/v) Na-phytate using a 0.25 M Na-acetate buffer pH 5.5, blind buffer subtracted. In preferred embodiments, the residual activity is at least 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75% or at least 80%.

[0075] In an eighth aspect, the present invention relates to artificial variants comprising a substitution, deletion and/or conservative insertion of one or more of the amino acids of SEQ ID NO: 10, or its mature polypeptide. An insertion may be within the molecule, and/or at the N- or C-terminal end of the molecule, in which case it is also referred to as an extension. Preferably, amino acid changes are of a minor nature, which are conservative amino acid substitutions; small deletions, typically of one to about 30 amino acids; short amino- or carboxy-terminal extensions, such as an amino-terminal methionine residue; a small linker peptide of up to about 20 to 25 residues; or a small extension that facilitates purification by altering the net charge or other function, such as a polyhistidine feature, an antigenic epitope, or a binding domain - in other words: Changes that do not significantly affect the folding and/or activity of the protein .

[0076] Examples of conservative substitutions are within the group of basic amino acids (arginine, lysine and histidine), acidic amino acids (glutamic acid and aspartic acid), polar amino acids (glutamine and asparagine), hydrophobic amino acids (leucine, isoleucine and valine), aromatic amino acids (phenylalanine, tryptophan and tyrosine) and small amino acids (glycine, alanine, serine, threonine and methionine).

[0077] Other examples of conservative substitutions are replacements of the 20 standard amino acids with non-standard amino acids (such as 4-hydroxyproline, 6-N-methyl-lysine, 2-aminoisobutyric acid, isovaline and alpha-methylserine). Conservative substitutions may also include a substitution in amino acids that are not encoded by the genetic code, and unnatural amino acids. “Unnatural amino acids” have been modified after protein synthesis, and/or have a chemical structure in their side chain(s) different from those of standard amino acids. Non-natural amino acids can be chemically synthesized, and preferably are commercially available, and include pipecolic acid, thiazolidinecarboxylic acid, dehydroproline, 3 and 4-methylproline and 3,3-dimethylproline.

[0078] Alternatively, the amino acid changes are of such a nature that the physicochemical properties of the polypeptides are altered. For example, amino acid changes can improve polypeptide thermal stability, alter substrate specificity, alter pH optima, and similar events.

[0079] Essential amino acids in the parent polypeptide can be identified according to procedures known in the art, such as site-directed mutagenesis or alanine scanning mutagenesis (Cunningham and Wells, 1989, Science 244: 1081-1085) In the latter technique , individual alanine mutations are introduced at each residue in the molecule, and the resulting mutant molecules are tested for biological activity (i.e., phytase activity) to identify amino acid residues that are critical to the activity of the molecule. See also Hilton et al., 1996, J. Biol. chem. 271:4699-4708. The active site of the enzyme or other biological interaction may also be determined by physical analysis of the structure, as determined by such techniques as nuclear magnetic resonance, crystallography, electron diffraction, or photoaffinity labeling, together with mutation of putative contact site amino acids. . See, for example, de Vos et al., 1992, Science 255: 306-312; Smith et al., 1992, J. Mol. Biol. 224: 899-904; Wlodaver et al., 1992, FEBS Lett. 309:59-64. The identities of essential amino acids can also be inferred from analyzes of polypeptide identities which are related to a polypeptide according to the invention.

[0080] Single or multiple amino acid substitutions can be made and tested using known methods of mutagenesis, recombination and/or mixing, followed by a relevant scanning procedure, such as those described by Reidhaar-Olson and Sauer, 1988, Science 241: 53-57; Bowie and Sauer, 1989, Proc. Natl. academic Sci. USA 86: 2152-2156; WO 95/17413; or WO 95/22625. Other methods that can be used include error-prone PCR, phage display (e.g., Lowman et al., 1991, Biochem. 30:10832-10837; U.S. Patent No. 5,223,409; WO 92/06204), and mutagenesis region-directed (Derbyshire et al., 1986, Gene 46:145; Ner et al., 1988, DNA 7:127).

[0081] Mutagenesis/mixing methods can be combined with high-throughput automated scanning methods to detect the activity of modified cloned polypeptides expressed by host cells. Modified DNA molecules encoding active polypeptides can be recovered from host cells and rapidly sequenced using standard methods in the art. These methods allow rapid determination of the importance of individual amino acid residues in a polypeptide of interest, and can be applied to polypeptides of unknown structure.

[0082] The total amount of amino acid substitutions (preferably conservative substitutions), deletions and/or insertions in the sequence of amino acids 1 to 413 of SEQ ID NO: 10 is a maximum of 10, preferably a maximum of 9, more preferably a maximum of 8 , more preferably at most 7, more preferably at most 6, more preferably at most 5, more preferably at most 4, even more preferably at most 3, more preferably at most 2 and even more preferably at most 1.

[0083] The total amount of substitutions, deletions and/or insertions of amino acids 1 to 413 of SEQ ID NO: 10 is 10, preferably 9, more preferably 8, more preferably 7, more preferably a maximum of 6, more preferably a maximum of 5 , more preferably 4, even more preferably 3, more preferably 2 and even more preferably 1. In the alternative, the total amount of amino acid substitutions (preferably conservative substitutions), deletions and/or insertions in the sequence of amino acids 1 to 413 of SEQ ID NO: 10 is a maximum of 50, 45, 40, 35, 30, 25, 20, 19, 18, 17, 16, 15, 14, 13, 12 or a maximum of 11.

[0084] In a specific embodiment, the polypeptide of the invention is a low-allergenic variant, designed to elicit a reduced immune response when exposed to animals, including humans. The term immunological response is to be understood as any reaction by the immune system of an animal exposed to the polypeptide. One type of immune response is an allergic response leading to increased levels of IgE in the exposed animal. Low allergenicity variants can be prepared using techniques known in the art. For example, the polypeptide can be conjugated to polymeric moieties protecting portions or epitopes of the polypeptide involved in an immune response. Conjugation with polymers may involve in vitro chemical coupling of the polymer with the polypeptide, for example, as described in WO 96/17929, WO98/30682, WO98/35026, and/or WO99/00489. Conjugation may, in addition or alternatively to this, involve the in vivo coupling of polymers to the polypeptide. Such conjugation can be achieved by genetically engineering the nucleotide sequence encoding the polypeptide, by inserting consensus sequences encoding additional glycosylation sites into the polypeptide and expressing the polypeptide in a host capable of glycosylating the polypeptide, see for example WO00/26354. Another way to provide low-allergenic variants is to genetically engineer the nucleotide sequence encoding the polypeptide in order to cause the polypeptide to self-oligomerize, meaning that the polypeptide monomers can protect the epitopes of the other polypeptide monomers and thus reducing antigenicity. of the oligomers. Such products and preparations thereof are described, for example, in WO96/16177. Epitopes involved in an immunological response can be identified by various methods, such as the phage display method described in WO 00/26230 and WO 01/83559, or the randomized approach described in EP 561907. Once the epitope has been identified, its sequence of amino acids can be altered to produce altered immunological properties of the polypeptide by known genetic manipulation techniques, such as site-directed mutagenesis (see, for example, WO 00/26230, WO 00/26354 and/or WO00/22103) and/or or conjugation of a polymer can be done in sufficient proximity to the epitope for the polymer to protect the epitope. Three-Dimensional Structure of a Phytase from Hafnia alvei

[0085] The three-dimensional structure of a Phytase from Hafnia alvei (amino acids 1 to 413 of SEQ ID NO: 10) is provided in the Appendix. The structure was solved in accordance with principles for X-ray crystallographic methods, for example, as given in X-Ray Structure Determinations, Stout, G. K. and Jensen, L. H., John Wiley and Sons, Inc. NY 1989. The coordinates Structures for the resolved crystal structure of Hafnia alvei phytase are provided in standard PDB format (Protein Database Bank, Brookhaven National Laboratory, Brookhaven, Conn.) as set forth in the appendix. It is to be understood that the appendix forms part of the present application. The appendix gives the coordinates of heavy atoms, excluding hydrogen atoms. The first three residues of the enzyme were not visible in the crystal structure, as were the residues between amino acids 180 and 189. However, the structure between 180 and 189 was constructed using modeling combining homology modeling (see, for example, Marti-Renom et al, 2000), NEST program from the JACKAL software package (wiki.c2b2. Columbia. edu/honiglab_public/index.php/Software:Jackal) and the simulation software called CHARMm (//accelrys.com/products/scitegic /component-collections/charmm.html). Sources of Polypeptides with Phytase Activity

[0086] A polypeptide of the present invention can be obtained from microorganisms of any genus. For the purposes of the present invention, the term "obtained from" as used herein together with a given source shall mean that the polypeptide encoded by a nucleotide sequence is produced by the source or by a strand in which the nucleotide sequence of the source has been inserted. In a preferred aspect, the polypeptide obtained from a given source is secreted extracellularly.

[0087] A polypeptide of the present invention can be a bacterial polypeptide. For example, the polypeptide may be a gram-positive bacterial polypeptide such as a Bacillus polypeptide, or a Streptomyces polypeptide; or a gram-negative bacterial polypeptide, for example, an Escherichia coli, Yersinia, Klebsiella, Citrobacter or Peudomonas polypeptide. In a particular embodiment, the polypeptide is derived from Proteobacteria, such as Gammaproteobacteria, for example Enterobacteriales, such as Enterobacteriaceae.

[0088] In a particular aspect, the polypeptide derived from Enterobacteriaceae is a Hafnia polypeptide, such as a polypeptide from Hafnia alvei species.

[0089] A polypeptide of the present invention can also be a fungal polypeptide, such as a yeast polypeptide or a filamentous fungal polypeptide.

[0090] Strains of the above microorganisms are readily accessible to the public in a variety of culture collections, such as the American Type Culture Collection (ATCC), Deutsche Sammlung von Mikroorganismen und Zellkulturen GmbH (DSM), Centraalbureau Voor Schimmelcultures (CBS) and the Agricultural Research Service Patent Culture Collection, Northern Regional Research Center (NRRL).

[0091] Furthermore, such polypeptides can be identified and obtained from other sources including microorganisms isolated from nature (e.g. soil, compounds, water, etc.) using the aforementioned probes. Techniques for isolating microorganisms from habitats are well known in the art. The polynucleotide can then be obtained by similarly scanning a genomic or cDNA library from another source.

[0092] The polypeptides of the present invention also include fused polypeptides or cleavable fusion polypeptides in which another polypeptide is fused to the N terminus or C terminus of the polypeptide or fragment thereof. A fused polypeptide is produced by fusing a nucleotide sequence (or a portion thereof) encoding another polypeptide into a nucleotide sequence (or a portion thereof) of the present invention. Techniques for producing fusion polypeptides are known in the art, and include ligating the coding sequences of the polypeptides so that they are in frame and that expression of the fused polypeptide is under the control of the same promoter(s). es) and terminator.

Polynucleotides

[0093] The present invention also relates to isolated polynucleotides with a nucleotide sequence which encodes a polypeptide of the present invention. In a preferred aspect, the nucleotide sequence is set forth in SEQ ID NO: 9. In another preferred aspect, the nucleotide sequence is the mature polypeptide coding region of SEQ ID NO: 9. The present invention also encompasses nucleotide sequences as which encode a polypeptide with the amino acid sequence of SEQ ID NO: 10, or its mature polypeptides, which differ from SEQ ID NO: 9, due to the degeneration of the genetic code. The present invention also relates to the subsequences of SEQ ID NO: 9, which encode fragments of SEQ ID NO: 10, which exhibit phytase activity.

[0094] The present invention also relates to mutant polynucleotides comprising at least one mutation in the mature polypeptide coding sequence of any one of SEQ ID NO: 9, in which the modified nucleotide sequence encodes a polypeptide which consists of amino acids 1 to 413 of SEQ ID NO: 10.

[0095] Techniques used to isolate or clone a polynucleotide encoding a polypeptide are known in the art and include isolating genomic DNA, preparing cDNA or a combination thereof. Cloning of the polynucleotides of the present invention from such genomic DNA can be carried out, for example, by use of the well-known polymerase chain reaction (PCR) or antibody scanning of expression libraries to detect the cloned DNA fragments with the structural characteristics shared. See, for example, Innis et al., 1990, PCR: A Guide to Methods and Application, Academic Press, New York. Other nucleic acid amplification procedures, such as ligase chain reaction (LCR), ligated activated transcription (LAT), and nucleotide sequence-based amplification (NASBA) can be used. The polynucleotides may be cloned from a strain of Hafnia, or other organism or related organism, and thus, for example, may be an allelic or a variant species of the polypeptide coding region of the nucleotide sequence.

[0096] The present invention also relates to polynucleotides with nucleotide sequences which have a degree of identity with the mature polypeptide coding sequence of SEQ ID NO: 9 (i.e., nucleotides 100 to 1338) of at least 75% , and which encode a polypeptide with phytase activity. In particular embodiments, the degree of identity is at least. In particular embodiments, the degree of identity is at least 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88% , 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 96.5%, 97%, 97.5%, 98%, 98.5%, 98.7% , 98.8%, 98.9%, 99%, 99.0%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99 .7%, 99.8% or at least 99.9%. In alternative embodiments, the degree of identity is at least 75%, 80%, 85%, 90%, 94, 97, 98, 98.0, 98.1, 98.2 or at least 98.3%.

[0097] Modification of a nucleotide sequence encoding a polypeptide of the present invention may be necessary for the synthesis of polypeptides substantially similar to the polypeptide. The term “substantially similar” to the polypeptide refers to non-naturally occurring forms of the polypeptide. These polypeptides may differ in some engineered way from the polypeptide isolated from its natural source, for example, artificial variants that differ in specific activity, thermostability, optimum pH, or the like. The variant sequence can be constructed based on the nucleotide sequence shown as the polypeptide coding region of SEQ ID NO: 9, for example, a subsequence thereof, and/or by introducing nucleotide substitutions which do not generate another amino acid sequence of the polypeptide encoded by the nucleotide sequence, but which corresponds to the use of the codon of the host organism intended to produce the polypeptide, or by the introduction of nucleotide substitutions which can originate different amino acid sequences. For a general description of nucleotide substitution see, for example, Ford et al., 1991, Protein Expression and Purification 2: 95-107.

[0098] It would be obvious to those skilled in the art that such substitutions can be made outside regions critical to the function of the molecule and still result in an active polypeptide. Amino acid residues essential for the activity of the polypeptide encoded by an isolated polynucleotide of the invention, and therefore preferably not subject to substitution, can be identified according to procedures known in the art, such as site-directed mutagenesis or alanine scanning mutagenesis ( see, for example, Cunningham and Wells, 1989, Science 244: 1081-1085). In the latter technique, mutations are introduced at each positively charged residue in the molecule, and the resulting mutant molecules are tested for phytase activity to identify amino acid residues that are critical to the molecule's activity. Sites of substrate-polypeptide interaction can also be determined by analysis of the three-dimensional structure, as determined by such techniques as nuclear magnetic resonance analysis, crystallography, or photoaffinity labeling (see, e.g., de Vos et al., 1992, Science 255: 306-312; Smith et al., 1992, Journal of Molecular Biology 224: 899-904; Wlodaver et al., 1992, FEBS Letters 309: 59-64).

[0099] The present invention also relates to isolated polynucleotides encoding a polypeptide of the present invention, which hybridize under conditions of medium stringency, more preferably conditions of medium-high stringency, even more preferably conditions of high stringency, and most preferably conditions of very high stringency with (i) nucleotides 100 to 1338 of SEQ ID NO: 9, (ii) the mature polypeptide encoding part of SEQ ID NO: 9, and/or (iii) a complementary strand of any of (i) , and/or (ii); or allelic variants and subsequences thereof (Sambrook et al., 1989, supra), as defined herein. In alternative embodiments hybridization is carried out under very low or low stringency conditions. The present invention also relates to isolated polynucleotides obtained, or obtainable, by (a) hybridizing a population of DNA under very low, low, medium, stringency conditions, average-

Nucleic acid constructs

[00100] The present invention also relates to nucleic acid constructs comprising an isolated polynucleotide of the present invention operatively linked to one or more control sequences which direct the expression of the coding sequence in a suitable host cell under conditions compatible with the sequences of control.

[00101] An isolated polynucleotide encoding a polypeptide of the present invention can be manipulated in a variety of ways to provide expression of the polypeptide. Manipulation of the polynucleotide sequence prior to its insertion into a vector may be desirable or necessary depending on the expression vector. Techniques for modifying polynucleotide sequences using recombinant DNA methods are well known in the art.

[00102] The control sequence may be an appropriate promoter sequence, a nucleotide sequence which is recognized by a host cell for the expression of a polynucleotide encoding a polypeptide of the present invention. The promoter sequence contains transcription control sequences which mediate expression of the polypeptide. The promoter may be any nucleotide sequence which exhibits transcriptional activity in the host cell of choice, including mutant, cut and hybrid promoters, and may be obtained from genes encoding extracellular or intracellular polypeptides, homologous or heterologous in relation to the host cell.

[00103] Examples of promoters suitable for directing transcription of the nucleic acid constructs of the present invention, especially in a bacterial host cell, are the promoters obtained from the E. coli lac operon, Streptomyces coelicolor agarase gene (dagA), gene Levansucrase gene from Bacillus subtilis (sacB), alpha-amylase gene from Bacillus licheniformis (amyL), maltogenic amylase gene from Bacillus stearothermophilus (amyM), alpha-amylase gene from Bacillus amyloliquefaciens (amyQ), penicillinase gene from Bacillus licheniformis (penP), Bacillus subtilis xylA and xylB genes and prokaryotic beta-lactamase gene (Villa-Kamaroff et al., 1978, Proceedings of the National Academy of Sciences USA 75: 3727-3731), as well as the tc promoter (DeBoer et al., 1983, Proceedings of the National Academy of Sciences USA 80: 21-25). Other promoters are described in "Useful proteins from recombinant bacteria" in Scientific American, 1980, 242: 74-94; and in Sambrook et al., 1989, above.

[00104] Examples of promoters suitable for directing transcription of the nucleic acid constructs of the present invention in a filamentous fungal host cell are the promoters obtained from the genes for TAKA amylase from Aspergillus oryzae, aspartic proteinase from Rhizomucor miehei, alpha-amylase from Aspergillus niger , acid-stable alpha-amylase from Aspergillus niger, glucoamylase from Aspergillus awamori (glaA), lipase from Rhizomucor miehei, alkaline protease from Aspergillus oryzae, triose phosphate isomerase from Aspergillus oryzae, acetamidase from Aspergillus nidulans, amyloglucosidase from Fusarium venenatum (WO 00/ 56900), Fusarium venenatum Daria (WO 00/56900), Fusarium venenatum Quinn (WO 00/56900), trypsin-like protease from Fusarium oxysporum (WO 96/00787), beta-glucosidase from Trichoerma reesei, cellobiohydrolase from Trichoderma reesei, endoglucanase I from Trichoderma reesei, endoglucanase II from Trichoderma reesei, endoglucanase III from Trichoderma reesei, endoglucanase IV from Trichoderma reesei, endoglucanase V from Trichoderma reesei, xylanase I from Trichoderma reesei, xylanase II from Trichoderma reesei, beta-xylosidase from Trichoderma reesei, as well as the NA2-tpi promoter (a hybrid of the promoters of the genes for neutral alpha-amylase from Aspergillus niger and triose phosphate isomerase from Aspergillus oryzae); and mutant, cut and hybrid promoters thereof.

[00105] In a yeast host, useful promoters are obtained from the genes for enolase from Saccharomyces cerevisiae (ENO-1), galactokinase from Sacharomyces cerevisiae (GAL1), alcohol dehydrogenase/glyceraldehyde-3-phosphate dehydrogenase from Sacharomyces cerevisiae (ADH1, ADH2 /GAP), triose phosphate isomerase from Sacharomyces cerevisiae (TPI), metallothionin from Sacharomyces cerevisiae (CUP1), 3-phosphoglycerate kinase from Sacharomyces cerevisiae and alcohol oxidase from Pichia pastoris (AOX1). Other useful promoters for yeast host cells are described by Romanos et al., 1992, Yeast 8: 423-488.

[00106] The control sequence can also be a suitable transcription terminator sequence, a sequence recognized by a host cell to terminate transcription. The terminator sequence is operably linked to the 3' terminus of the nucleotide sequence encoding the polypeptide. Any terminator which is functional in the host cell of choice can be used in the present invention.

[00107] Preferred terminators for host cells of filamentous fungi are obtained from the genes for TAKA amylase from Aspergillus oryzae, glucoamylase from Aspergillus niger, anthanylate synthase from Aspergillus nidulans, alpha-glucosidase from Aspergillus niger and trypsia-like protease from Fusarium oxysprum.

[00108] Preferred terminators for yeast host cells are obtained from the genes for enolase from Saccharomyces cerevisiae, cytochrome C from Saccharomyces cerevisiae (CYC1) and glyceraldehyde-3-phosphate dehydrogenase from Saccharomyces cerevisiae. Other useful terminators for yeast host cells are described by Romanos et al., 1992, supra.

[00109] The control sequence can also be a suitable leader sequence, an untranslated region of an mRNA which is important for translation by the host cell. The leader sequence is operably linked to the 5' terminus of the nucleotide sequence encoding the polypeptide. Any leader sequence which is functional in the host cell of choice can be used in the present invention.

[00110] The control sequence can also be a suitable leader sequence, an untranslated region of an mRNA which is important for translation by the host cell. The leader sequence is operably linked to the 5' terminus of the nucleotide sequence encoding the polypeptide. Any leader sequence which is functional in the host cell of choice can be used in the present invention.

[00111] Preferred leaders for filamentous fungal host cells are obtained from the genes for TAKA amylase from Aspergillus oryzae and triose phosphate isomerase from Aspergillus nidulans.

[00112] Leaders suitable for yeast host cells are obtained from the genes for Saccharomyces cerevisiae enolase (ENO-1), Saccharomyces cerevisiae 3-phosphoglycerate kinase, Saccharomyces cerevisiae alpha factor and Saccharomyces alcohol dehydrogenase/glyceraldehyde-3-phosphate dehydrogenase cerevisiae (ADH2/GAP).

[00113] The control sequence may also be a polyadenylation sequence, a sequence operatively linked to the 3' terminus of the nucleotide sequence and which, when transcribed, is recognized by the host cell as a signal to add polyadenosine residues to the transcribed mRNA. . Any polyadenylation sequence which is functional in the host cell of choice can be used in the present invention.

[00114] Preferred polyadenylation sequences for host cells of filamentous fungi are obtained from the genes for TAKA amylase from Aspergillus oryzae, glucoamylase from Aspergillus niger, anthranilate synthase from Aspergillus nidulans, trypsin-like protease from Fusarium oxysporum and alpha-glucosidase from Aspergillus niger .

[00115] Useful polyadenylation sequences for yeast host cells are described by Guo and Sherman, 1995, Molecular Cellular Biology 15: 5983-5990.

[00116] The control sequence can also be a signal peptide coding region that encodes an amino acid sequence linked to the amino terminus of a polypeptide and directs the encoded polypeptide into the cellular secretory pathway. The 5' end of the coding sequence of the nucleotide sequence may inherently contain a signal peptide coding region naturally linked in the translational reading frame with the segment of the coding region which encodes the secreted polypeptide. Alternatively, the 5' end of the coding sequence may contain a signal peptide coding region which is external to the coding sequence. The external signal peptide coding region may be required where the coding sequence does not naturally contain a signal peptide coding region. Alternatively, the signal peptide coding region may simply replace the

[00117] Effective signal peptide coding regions for bacterial host cells are the signal peptide coding regions of the genes for maltogenic amylase from Bacillus NCIB 11837, alpha-amylase from Bacillus stearothermophilus, subtilisin from Bacillus licheniformis, beta-lactamase from Bacillus licheniformis, neutral proteases from Bacillus stearothermophilus (nprT, nprS, nprM) and prsA from Bacillus subtilis. Other signal peptides are described by Simonen and Palva, 1993, Microbiological Reviews 57: 109-137.

[00118] Effective signal peptide coding regions for host cells of filamentous fungi are the signal peptide coding regions obtained from the genes for TAKA amylase from Aspergillus oryzae, neutral amylase from Aspergillus niger, glucoamylase from Aspergillus niger, aspartic proteinase from Rhizomucor miehei , cellulase from Humicola insolens and lipase from Humicola lanuginosa.

[00119] Signal peptides useful for yeast host cells are obtained from the genes for Saccharomyces cerevisiae alpha factor and Saccharomyces cerevisiae invertase. Other useful signal peptide coding regions are described by Romanos et al., 1992, supra, and by Xiong et al in Journal of Applied Microbiology 2005, 98, 418-428.

[00120] In a preferred aspect, the signal peptide coding region is composed of nucleotides 1 to 99 of SEQ ID NO: 9, which encode amino acids 1 to 33 of SEQ ID NO: 10. In another preferred aspect, the signal peptide coding region is composed of nucleotides 1 to 81 of SEQ ID NO: 11, which encode amino acids 1 to 27 of SEQ ID NO: 12.

[00121] The control sequence can also be a propeptide coding region that encodes an amino acid sequence positioned at the amino terminus of a polypeptide. The resulting polypeptide is known as a propolypeptide or propolypeptide (or a zymogen, in some cases). A propolypeptide is generally inactive and can be converted into a mature active polypeptide by catalytic or autocatalytic cleavage of the propeptide from the propolypeptide. The propeptide coding region can be obtained from the genes for alkaline protease from Bacillus subtilis (aprE), neutral protease from Bacillus subtilis (nprT), alpha factor from Saccharomyces cerevisiae, aspartic proteinase from Rhizomocur miehei and laccase from Myeliophthora thermophila (WO 95/33836).

[00122] Where both the signal peptide and pro-peptide regions are present at the amino terminus of a polypeptide, the pro-peptide region is positioned close to the amino terminus of a polypeptide and the signal peptide region is positioned close to the amino terminus of the pro-peptide region.

[00123] It may also be desirable to add regulatory sequences which allow the regulation of polypeptide expression in relation to host cell growth. Examples of regulatory systems are those which cause gene expression to be activated or deactivated in response to a chemical or physical stimulus, including the presence of a regulatory compound. Regulatory systems in prokaryotic systems include the lac, tc, and trp operator systems. In yeast, either the ADH2 system or the GAL1 system can be used. In filamentous fungi, the TAKA alpha-amylase promoter, the Aspergillus niger glucoamylase promoter, and the

[00124] The present invention also relates to recombinant expression vectors comprising a polynucleotide of the present invention, a promoter and translation and transcription stop signals. The various control and nucleic acid sequences described above can be joined together to produce a recombinant expression vector which can include one or more convenient restriction sites to allow insertion or substitution of the nucleotide sequence encoding the polypeptide at such sites. Alternatively, a nucleotide sequence of the present invention can be expressed by inserting the nucleotide sequence or a nucleic acid construct comprising the sequence into an appropriate vector for expression. When creating the expression vector, the coding sequence is located in the vector so that the coding sequence is operatively linked with the appropriate control sequences for expression.

[00125] The recombinant expression vector can be any vector (for example, a plasmid or virus) which can be conveniently subjected to recombinant DNA procedures and can generate expression of the nucellotide sequence. The choice of vector will typically depend on the compatibility of the vector with the host cell into which the vector will be introduced. Vectors can be linear or closed circular plasmids.

[00126] The vector may be an autonomic replication vector, that is, a vector that exists as an extrachromosomal entity, the replication of which is independent of chromosomal replication, for example, a plasmid, an extrachromosomal element, a minichromosome or a chromosome artificial. The vector may contain any means to ensure replication. Alternatively, the vector may be one which, when introduced into the host cell, is integrated into the genome and replicated together with the chromosome(s) into which it has been integrated. Furthermore, an individual vector or plasmid or two or more vectors or plasmids which together contain the total DNA to be introduced into the host cell genome, or a transposon can be used.

[00127] The vectors of the present invention preferably contain one or more selectable markers, which allow easy selection of transformed cells. A selectable marker is a gene, the product of which provides biocidal activity or viral resistance, heavy metal resistance, prototrophy or auxotrophs, and the like.

[00128] A conditionally essential gene can function as a selectable non-antibiotic marker. Non-limiting examples of bacterial conditionally essential non-antibiotic selectable markers are the dal genes of Bacillus subtilis, Bacillus licheniformis, and other bacilli, which are only essential when the bacteria are grown in the absence of D-alanine. Also, genes encoding enzymes involved in UDP-galactose turnover can function as essentially conditional markers in a cell when it grows in the presence of galactose or grows in a medium which generates the presence of galactose. Non-limiting examples of such genes are those from Bacillus subtilis or Bacillus licheniformis encoding UTP-dependent phosphorylase (EC 2.7.7.10), UDP-glucose-dependent uridyltransferase (EC 2.7.7.12) or UDP-galactose epimerase (EC 5.1.3.2). . Also a xylose isomerase gene such as bacillus xylA can be used as selectable markers in cells growing in minimal medium with xylose as the sole carbon source. The genes required to utilize gluconate, gntK and gntP, can also be used as selectable markers in cells growing in minimal medium with gluconate as the sole carbon source. Other examples of conditionally essential genes are known in the art. Antibiotic selectable markers confer resistance to antibiotics such as ampicillin, kanamycin, chloramphenicol, erythromycin, tetracycline, neomycin, hygromycin or methotrexate.

[00129] Suitable markers for yeast host cells are ADE2, HIS3, LEU2, LYS2, MET3, TRP1, and URA3. Selectable markers for use in a filamentous fungal host cell include, but are not limited to, amdS (acetamidase), argB (ornithine carbamoyltransferase), bar (phosphinothricin acetyltransferase), hph (hygromycin phosphotransferase), niaD (nitrate reductase), pyrG (orotidine -5'-phosphate decarboxylase), sC (sulfate adenyltransferase) and trpC (anthranilate synthase), as well as their equivalents. Preferred for use in an Aspergillus cell are the amdS and pyrG genes from Aspergillus nidulans or Aspergillus oryzae and the bar gene from Streptomyces hygroscopicus. The vectors of the present invention preferably contain element(s) that allow integration of the vector into the host cell genome or autonomous replication of the vector in the cell independently of the genome.

[00130] For integration into the host cell genome, the vector can be based on the polynucleotide sequence encoding the polypeptide or any other element of the vector for integration into the genome by homologous or non-homologous recombination. Alternatively, the vector may contain additional nucleotide sequences to direct integration by homologous recombination into the host cell genome at precise location(s) on the chromosome(s). To increase the probability of integration at a precise location, the integration elements should preferably contain a sufficient amount of nucleic acids, such as from 100 to 10,000 base pairs, preferably from 400 to 10,000 base pairs, and most preferably from 800 to 10,000 base pairs, which have a sufficient degree of identity with the corresponding target sequence to enhance the probability of homologous recombination. The integration elements can be any sequences that are homologous to the target sequence in the host cell genome. Furthermore, the integration elements can be non-coding or coding nucleotide sequences. On the other hand, the vector can be integrated into the host cell genome by non-homologous recombination.

[00131] For autonomic replication, the vector may further comprise an origin of replication that allows the vector to replicate autonomously in the host cell in question. The origin of replication can be any plasmid replicator mediating autonomic replication which functions in a cell. The term “origin of replication” or “plasmid replicator” is defined herein as a nucleotide sequence that allows a plasmid or vector to replicate in vivo.

[00132] Examples of bacterial origins of replication are the origins of replication of plasmids pBR322, pUC19, pACYC177 and pACYC184, which allow replication in E. coli, and pUB110, pE194, pTA1060, and pAMß1 which allow replication in bacilli.

[00133] Examples of replication origins for use in a yeast host cell are the 2 micro origins of replication, ARS1 and ARS4, the combination of ARS1 and CEN3 and the combination of ARS4 and CEN6.

[00134] Examples of useful origins of replication in a filamentous fungal cell are AMA1 and ANSI (Gems et al., 1991, Gene 98:61-67; Cullen et al., 1987, Nucleic Acids Research 15: 9163-9175; WO 00/24883). Isolation of the AMA1 gene and construction of plasmids or vectors comprising the gene can be carried out according to the methods described in WO 00/24883.

[00135] More than one copy of a polynucleotide of the present invention can be inserted into the host cell to increase production of the gene product. An increase in the number of copies of the polynucleotide can be achieved by integrating at least one additional copy of the sequence into the host cell genome or by including an amplifiable selectable marker gene with the polynucleotide, where cells containing the amplified copies of the selectable marker gene , and thus additional copies of the polynucleotide, can be selected by culturing the cells in the presence of the appropriate selectable agent.

[00136] The procedures used to link the elements described above to construct the recombinant expression vectors of the present invention are well known to a person skilled in the art (see, for example, Sambrook et al., 1989, above).

Host Cells

[00137] The present invention also relates to recombinant host cells, comprising a polynucleotide of the present invention, which are advantageously used in the recombinant production of polypeptides. A vector comprising a polynucleotide of the present invention is introduced into a host cell, such that the vector is maintained as a chromosomal integrant or as a self-replicating extrachromosomal vector as previously described. the term

[00138] The host cell can be a unicellular microorganism, for example, a prokaryote, or a non-unicellular microorganism, for example, a eukaryote.

[00139] Useful unicellular microorganisms are bacterial cells, such as gram-positive bacteria including, but not limited to, bacilli cells, for example, Bacillus alkalophilus, Bacillus amyloliquefaciens, Bacillus brevis, Bacillus circulans, Bacillus clausii, Bacillus coagulans, Bacillus lautus, Bacillus lentus, Bacillus licheniformis, Bacillus megaterium, Bacillus stearothermophilus, Bacillus subtilis, and Bacillus thuringiensis; or a Streptomyces cell, for example, Streptomyces lividans and Streptomyces murinus, or gram-negative bacteria, such as E. coli and Pseudomonas sp. In a preferred aspect, the bacterial host cell is a Bacillus lentus, Bacillus licheniformis, Bacillus stearothermophilus, or Bacillus subtilis cell. In another preferred aspect, the Bacillus cell is an alkalophilic Bacillus.

[00140] The introduction of a vector into a bacterial host cell can, for example, be carried out by protoplast transformation (see, for example, Chang and Cohen, 1979, Molecular General Genetics 168: 11 1-1 15), using cells competent (see, e.g., Young and Spizizin, 1961, Journal of Bacteriology 81:823-829, or Dubnau and Davidoff-Abelson, 1971, Journal of Molecular Biology 56:209-221), electroporation (see, e.g., Shigekawa and Dower, 1988, Biotechniques 6: 742-751), or conjugation (see, for example, Koehler and Thorne, 1987, Journal of Bacteriology 169: 5771-5278).

[00141] The host cell can also be a eukaryote, such as a mammal, insect, plant or fungal cell.

[00142] In a preferred aspect, the host cell is a fungal cell. “Fungus”, as used herein, includes the phyla Ascomycota, Basidiomycota, Chytridiomycota and Zygomycota (as defined by Hawksworth et al., in, Ainsworth and Bisby's Dictionary of The Fungi, 8th Edition, 1995, CAB International, University Press, Cambridge, UK) as well as the Oomycota (as cited in Hawksworth et al., 1995, supra, page 171) and all mitosporic fungi (Hawksworth et al., 1995, supra).

[00143] In a more preferred aspect, the fungal host cell is a yeast cell. “Yeast,” as used herein, includes ascosporogenic yeast (Endomycetales), basidiosporogenic yeast, and yeast belonging to the imperfect fungi (Blastomycetes). Since the classification of yeast may change in the future, for the purposes of the invention, yeast should be defined as in Biology and Activities of Yeast (Skinner, F.A., Passmore, S. M., and Davenport, R. R., eds, Soc. App. Bacterid . Symposium Series No. 9, 1980).

[00144] In an even more preferred aspect, the yeast host cell is a Candida, Hansenula, Kluyveromyces, Pichia, Saccharomyces, Schizosaccharomyces, or Yarrowia cell.

[00145] In a more preferred aspect, the yeast host cell is a cell of Pichia pastoris, Pichia methanolica, Saccharomyces carlsbergensis, Saccharomyces cerevisiae, Saccharomyces diastaticus, Saccharomyces douglasii, Saccharomyces kluyveri, Saccharomyces norbensis or Saccharomyces oviformis. In another more preferred aspect, the yeast host cell is a Kluyveromyces lactis cell. In another more preferred aspect, the yeast host cell is a Yarrowia lipolytica cell.

[00146] In another more preferred aspect, the fungal host cell is a filamentous fungal cell. “Filamentous fungus” includes all filamentous forms of the subdivision Eumycota and Oomycota (as defined by Hawksworth et al., 1995, above). Filamentous fungi are generally characterized by a mycelial wall composed of chitin, cellulose, chitosan glucan, mannan, and other complex polysaccharides. Vegetative growth is by hyphal elongation and carbon catabolism is obligatorily aerobic. In contrast, vegetative growth by yeasts such as Saccharomyces cerevisiae is by grafting a unicellular stalk and carbon catabolism can be fermentative.

[00147] In an even more preferred aspect, the filamentous fungus host cell is a cell of Acremonium, Aspergillus, Aureobasidium, Bjerkandera, Ceriporiopsis, Coprinus, Coriolus, Cryptococcus, Filobasidium, Fusarium, Humicola, Magnaporthe, Mucor, Myceliophthora, Neocallimastix, Neurospora, Paecilomyces, Penicillium, Phanerochaete, Phlebia, Piromyces, Pleurotus, Schizophyllum, Talaromyces, Thermoascus, Thielavia, Tolypocladium, Trametes, or Trichoderma.

[00148] In a more preferred aspect, the filamentous fungus host cell is a cell of Aspergillus awamori, Aspergillus fumigatus, Aspergillus foetidus, Aspergillus japonicus, Aspergillus nidulans, Aspergillus niger or Aspergillus oryzae. In another more preferred aspect, the filamentous fungal host cell is a cell of Fusarium bactridioides, Fusarium cerealis, Fusarium crookwellense, Fusarium culmorum, Fusarium graminearum, Fusarium graminum, Fusarium heterosporum, Fusarium negundi, Fusarium oxysporum, Fusarium reticulatum, Fusarium roseum, Fusarium sambucinum, Fusarium sarcochroum, Fusarium sporotrichioides, Fusarium sulphureum, Fusarium torulosum, Fusarium trichothecioides or Fusarium venenatum.; In another more preferred aspect, the filamentous fungal host cell is a strain cell of Bjerkandera adusta, Ceriporiopsis aneirina, Ceriporiopsis aneirina, Ceriporiopsis caregiea, Ceriporiopsis gilvescens, Ceriporiopsis pannocinta, Ceriporiopsis rivulosa, Ceriporiopsis subrufa, or Ceriporiopsis subvermispora, Coprinus cine reus, Coriolus hirsutus, Humicola insolens, Humicola lanuginosa, Mucor miehei, Myceliophthora thermophila, Neurospora crassa, Penicillium purpurogenum, Phanerochaete chrysosporium, Phlebia radiata, Pleurotus eryngii, Thielavia terrestris, Trametes villosa, Trametes versicolor, Trichoderma harzianum, Trichoderma koningii, Trichoderma longibra chiatum, Trichoderma reesei, or Trichoderma viride.

[00149] Fungal cells can be transformed by a process involving protoplast formation, protoplast transformation and cell wall regeneration in a manner known per se. Suitable procedures for transforming Aspergillus and Trichoderma host cells are described in EP 238 023 and Yelton et al., 1984, Proceedings of the National Academy of Sciences USA 81: 1470-1474. Suitable methods for transforming Fusarium species are described by Malardier et al., 1989, Gene 78: 147-156, and WO 96/00787. yeast can be transformed using the procedures described by Becker and Guarente, in Abelson, J.N. and Simon, M.I., editors, Guide to Yeast Genetics and Molecular Biology, Methods in Enzymology, Volume 194, pp 182-187, Academic Press, Inc., New York; lto et al., 1983, Journal of Bacteriology 153: 163; and Hinnen et al., 1978, Proceedings of the National Academy of Sciences USA 75: 1920.

Production Methods

[00150] The present invention also relates to methods for producing a polypeptide of the present invention, comprising (a) culturing a cell, which in its wild-type form is capable of producing the polypeptide, under conditions leading to the production of the polypeptide; and (b) recovery of the polypeptide. Preferably, the cell is of the genus Hafnia, and more preferably Hafnia alvei.

[00151] The present invention also relates to methods for producing a polypeptide of the present invention, comprising (a) culturing a host cell under conditions that lead to the production of the polypeptide; and (b) recovery of the polypeptide.

[00152] The present invention also relates to methods for producing a polypeptide of the present invention, comprising (a) culturing a host cell under conditions leading to the production of the polypeptide, wherein the host cell comprises a nucleotide sequence mutant with at least one mutation in the mature polypeptide coding region of any of SEQ ID NO: 9, wherein the mutant nucleotide sequence encodes a polypeptide which consists of amino acids 1 to 413 of SEQ ID NO: 10, and (b ) recovery of the polypeptide.

[00153] In the production methods of the present invention, cells are cultivated in a stable nutrient medium for the production of the polypeptide using methods well known in the art. For example, the cell may be grown by shake flask cultivation, and small-scale or large-scale fermentation (including continuous, batch, fed-batch, or solid-state fermentations) in laboratory or industrial fermentors carried out in a suitable medium and under conditions that allow the polypeptide to be expressed and/or isolated. Cultivation takes place in a suitable nutrient medium comprising carbon and nitrogen sources and inorganic salts, using procedures known in the art. Suitable media are available from commercial suppliers or can be prepared according to published compositions (e.g., in American Type Culture Collection catalogs). If the polypeptide is secreted into the nutrient medium, the polypeptide can be recovered directly from the medium. If the polypeptide is not secreted, it can be recovered from cell lysates.

[00154] Polypeptides can be detected using methods known in the art that are specific for the polypeptides. These detection methods may include the use of specific antibodies, the formation of a polypeptide product, or the disappearance of a polypeptide substrate. For example, a polypeptide assay can be used to determine the activity of the polypeptide as described herein.

[00155] The resulting polypeptide can be recovered using methods known in the art. For example, the polypeptide can be recovered from the nutrient medium by conventional procedures including, but not limited to, centrifugation, filtration, extraction, atomization, evaporation or precipitation.

[00156] The polypeptides of the present invention can be purified by a variety of procedures known in the art including, but not limited to, chromatography (e.g., ion ring, affinity, hydrophobic, isoelectric focusing and size exclusion), procedures electrophoretics (e.g., preparative isoelectric focusing), differential solubility (e.g., ammonium sulfate precipitation), SDS-PAGE, or extraction (see, e.g., Protein Purification, J. -C. Janson and Lars Ryden, editors, VCH Publishers, New York, 1989).

Transgenic Plants

[00157] The present invention also relates to a transgenic plant, plant part or plant cell which has been transformed with a nucleotide sequence encoding a polypeptide with phytase activity of the present invention, in order to express and produce the polypeptide in recoverable quantities. The polypeptide can be recovered from the plant or plant part. Alternatively, the plant or plant part containing the recombinant polypeptide can be used as such to improve the quality of a food or feed, for example by improving nutritional value, palatability and rheological properties, or to destroy an anti-nutritive factor.

[00158] In a particular embodiment, the polypeptide is targeted in the endosperm storage vacuoles in seeds. This can be achieved by its synthesis as a precursor with a suitable signal peptide, see Horvath et al in PNAS, February 15, 2000, vol. 97, no. 4, p. 1914-1919.

[00159] The transgenic plant can be a dicotyledon (a dicot) or a monocot (a monocot) or engineered variants thereof. Examples of monocot plants are grasses such as prairie grasses (poa), hay grasses such as Festuca, Lolium, temperate grasses such as Agrostis, and cereals, for example wheat, oats, rye, barley, rice, sorghum, triticale (stabilized hybrid of wheat (Triticum) and rice (Secale), and maize (corn). Examples of dicotyledonous plants are tobacco, legumes such as sunflower (Helianthus), cotton (Gossypium), lupins, potato, beets, peas, beans, and soybeans, and cruciferous plants (family Brassicaceae), such as cauliflower, rapeseed, and the closely related model organism Arabidopsis thaliana. Low phytate plants are described, for example, in U.S. Patent No. 5,689 054 and US Patent No. 6,111,168 are examples of engineered plans.

[00160] Examples of plant parts are stem, callus, leaves, root, fruits, seeds and tubers, as well as the individual tissues comprising these parts, for example, epidermis, mesophylls, parenchyma, vascular tissues, meristems. Also cellular compartments of specific plants, such as chloroplast, apoplast, mitochondria, vacuoles, peroxisomes and cytoplasms are considered to be a plant part, in addition, any plant cell, whatever the tissue origin, is considered to be a plant part. Likewise, plant parts, such as specific tissues and cells isolated to facilitate the use of the invention, are also considered plant parts, for example, embryos, endosperms, aleurone and seed coats.

[00161] Also included within the scope of the present invention are the progeny of such plants, plant parts and plant cells.

[00162] The transgenic plant or plant cell expressing a polypeptide of the present invention can be constructed according to methods known in the art. Briefly, the plant or plant cell is constructed by incorporating one or more expression constructs encoding a polypeptide of the present invention into the host plant genome and propagating the resulting modified plant or plant cell into a transgenic plant or plant cell.

[00163] Conveniently, the expression construct is a nucleic acid construct which comprises a nucleic acid sequence encoding a polypeptide of the present invention operatively linked with appropriate regulatory sequences required for the expression of the nucleic acid sequence in the plant or plant part of choice. Furthermore, the expression construct may comprise a selectable marker useful for identifying the host cells in which the expression construct was

[00164] The choice of regulatory sequences, such as promoter and terminator sequences, and optionally signal or transit sequences are determined, for example, based on when, where and how it is desirable for the polypeptide to be expressed. For example, expression of the gene encoding a polypeptide of the present invention may be constitutive or inducible, or may be developmental, stage, or tissue specific, and the gene product may be targeted to a specific cellular compartment, tissue, or plant part. such as seeds or leaves. Regulatory sequences are, for example, described by Tague et al., 1988, Plant Physiology 86:506.

[00165] For constitutive expression, the following promoters can be used: the 35S-CaMV promoter (Franck et al., 1980, Cell 21: 285-294), maize ubiquitin 1 (Christensen AH, Sharrock RA and Quail 1992 . Maize polyubiquitin genes: structure, thermal perturbation of expression and transcript splicing, and promoter activity following transfer to protoplasts by electroporation), or the rice actin 1 promoter (Plant Mol. Biol. 18, 675689.; Zhang W, McElroy D . and Wu R 1991, Analysis of rice Act1 5' region activity in transgenic rice plants. Plant Cell 3, 1 155-1165). Organ-specific promoters can be, for example, a promoter from storage collecting tissues such as seeds, potato tubers and fruits (Edwards & Coruzzi, 1990, Ann. Rev. Genet. 24: 275-303), a specific promoter from seed such as the rice glutein, prolamin, globulin or albumin promoter (Wu et al., 1998, Plant and Cell Physiology 39: 885-889), a Vicia faba legumin B4 promoter and the unknown seed protein gene from Vicia faba (Conrad et al., 1998, Journal of Plant Physiology 152:708-711), a promoter of a seed oil body protein (Chen et al., 1998, Plant and Cell Physiology 39:935-941), the Brassica napus storage protein napA promoter or any other specific seed promoter known in the art, for example as described in WO 91/14772. Furthermore, the promoter may be a leaf-specific promoter, such as the rice or tomato rbcs promoter (Kyozuka et al., 1993, Plant Physiology 102: 991-1000), the cholera virus adenine methyltransferase gene promoter. (Mitra and Higgins, 1994, Plant Molecular Biology 26: 85-93), or the rice aldP gene promoter (Kagaya et al., 1995, Molecular and General Genetics 248: 668-674), or a wound-inducible promoter such as the potato pin2 promoter (Xu et al., 1993, Plant Molecular Biology 22: 573-588). Likewise, the promoter may be inducible by abiotic treatments such as temperature, dryness or changes in salinity or inducible by exogenously applied substances that activate the promoter, for example, ethanol, oestrogens, ethylene-type plant hormones, abscisic acid, gibberellic acid and /or heavy metals.

[00166] A promoter enhancer element can also be used to achieve greater expression of the polypeptide in the plant. For example, the promoter enhancer element may be an intron which is placed between the promoter and the nucleotide sequence encoding a polypeptide of the present invention. For example, Xu et al., 1993, above discloses the use of the first intron of the rice actin 1 gene to increase expression.

[00167] Still further, codon usage can be improved for the plant species in question to improve expression (see Horvath et al referred to above).

[00168] The selectable marker gene and any other blueprints of the expression construct can be chosen from those available in the art.

[00169] The nucleic acid construct is incorporated into the plant genome according to conventional techniques known in the art, including agrobacterium-mediated transformation, virus-mediated transformation, microinjection, particle bombardment, biolistic transformation and electroporation (Gasser et al., 1990 , Science 244: 1293; Potrykus, 1990, Bio/Technology 8: 535; Shimamoto et al., 1989, Nature 338: 274).

[00170] Currently, Agrobacterium tumefaciens-mediated gene transfer is the method of choice for generating transgenic dicots (for a review, see Hooykas and Schilperoort, 1992, Plant Molecular Biology 19: 15-38), and it can be used to transform monocots, although other transformation methods are more often used for these plants. Currently, the method of choice for generating transgenic monocots, supplementing the Agrobacterium approach, is particle bombardment (microscopic gold or tungsten particles coated with transforming DNA) of embryonic calli or developing embryos (Christou, 1992, Plant Journal 2 : 275-281; Shimamoto, 1994, Current Opinion Biotechnology 5: 158-162; Vasil et al., 1992, Bio/Technology 10: 667-674). An alternative method for monocot transformation is based on protoplast transformation as described by Omirulleh et al., 1993, Plant Molecular Biology 21: 415-428.

[00171] After transformation, transformants having incorporated the expression construct there are selected and regenerated into whole plants according to methods well known in the art. Generally the transformation procedure is designed to eliminate

[00172] The present invention also relates to methods for producing a polypeptide of the present invention comprising (a) cultivating a transgenic plant or a plant cell comprising a nucleic acid sequence encoding a phytase-active polypeptide of the present invention under conditions that lead to the production of the polypeptide; and (b) recovery of the polypeptide.

Transgenic animals

[00173] The present invention also relates to transgenic, non-human animals and products or elements thereof, examples of which are bodily fluids, such as milk and blood, organs, fat and animal cells. Techniques for expressing proteins, for example, in mammalian cells, are known in the art, for example, the Manual Expression: A Practical Approach, Higgins and Hames (eds), Oxford University Press (1999), and the three other manuals of this series related to Gene Transcription, RNA Processing and Post-translational Processing. Generally, to prepare a transgenic animal, selected cells from a selected animal are transformed with a nucleic acid sequence encoding a polypeptide with phytase activity of the present invention in order to express and produce the polypeptide. The polypeptide may be recovered from the animal, for example, from female milk, or the polypeptide may be expressed for the benefit of the animal itself, for example, to aid animal digestion. Examples of animals are mentioned below in the section titled Animal Feed.

[00174] To produce a transgenic animal with the aim of recovering the polypeptide from the animal's milk, a gene encoding the polypeptide can be inserted into the fertilized eggs of the animal in question, for example, by the use of a transgenic expression vector which comprises a suitable milk protein promoter, and the gene encoding the polypeptide. The transgene expression vector is microinjected into the fertilized eggs, and preferably permanently integrated into the chromosome. Once the eggs begin to grow and divide, the potential embryo is implanted into a surrogate mother, and the animals carrying the transgene are identified. The resulting animal can then be reproduced by conventional breeding. The polypeptide can be purified from the animal's milk, see for example Meade, H. M. et al (1999): Expression of recombinant proteins in the milk of transgenic animals, Gene expression systems: Using nature for the art of expression. J. M. Fernandez and J. P. Hoeffler (eds.), Academic Press.

[00175] In the alternative, to produce a transgenic non-human animal that carries in the genome of its somatic and/or germ cells a nucleic acid sequence including a heterologous transgene construct including a transgene encoding the polypeptide, the transgene can be operably linked to a first regulatory sequence for salivary gland-specific expression of the polypeptide, as disclosed in WO 00/064247.

Compositions and Uses

[00176] In still other aspects, the present invention relates to compositions comprising a polypeptide of the present invention, as well as methods of using them.

[00177] Polypeptide compositions can be prepared according to methods known in the art and can be in the form of a

[00178] The phytase of the invention can be used for degradation, in an industrial context, for example, of phytate, phytic acid and/or mono, di, tri, tetra and/or myoinositol pentaphosphates. It is well known that the phosphate portions of these compounds chelate divalent and trivalent cations such as metal ions, i.a. the nutritionally essential ions of calcium, iron, zinc and magnesium, as well as trace minerals of manganese, copper and molybdenum. Furthermore, phytic acid to some extent binds to proteins by electrostatic interaction.

[00179] Accordingly, preferred uses of the polypeptides of the invention are in animal feed preparations (including human food) or in additives for such preparations.

[00180] In a particular embodiment, the polypeptide of the invention can be used to improve the nutritional valve of an animal feed. Non-limiting examples for improving the nutritional value of animal feed (including human food) are: improving feed digestibility; promoting animal growth; improving feed use; improvement of protein bioavailability; increased level of digestible phosphate; improvement of phytate release and/or degradation; improving the bioavailability of trace minerals; improving the bioavailability of macrominerals; elimination of the need to add phosphate in the form of supplements, trace minerals and/or macrominerals; and/or improving eggshell quality. The nutritional value of the feed is thus increased, and the rate of growth and/or weight gain and/or feed conversion (i.e., the weight of feed ingested in relation to weight gain) of the animal can be improved. .

[00181] Furthermore, the polypeptide of the invention can be used to reduce the phytate level of fertilizer.

Animals, Animal Feed and Animal Feed Additives

[00182] The term animal includes all animals, including human beings. Examples of animals are non-ruminants and ruminants. Ruminant animals include, for example, animals such as sheep, goats, horses and cattle, for example beef cattle, cows and young calves. In a particular embodiment, the animal is a non-ruminant animal. Non-ruminant animals include monogastric animals, for example, pigs or swine (including, but not limited to, piglets, growing pigs and sows); birds such as turkeys, ducks and chickens (including but not limited to broiler and egg-laying hens; young calves; and fish (including but not limited to salmon, trout, tilapia, lamprey and carp; and crustaceans ( including, but not limited to, shrimp and pitus).

[00183] The term feed or feed composition means any compound, preparation, mixture or composition suitable for or intended to be ingested by the animal.

[00184] In use according to the invention, the polypeptide can be fed to the animal before, after or simultaneously with the diet. The latter case is preferred.

[00185] In a particular embodiment, the polypeptide, in a form in which it is added to feed, or when included in a feed additive, is substantially pure. In a particular embodiment, it is well defined. The term “well-defined” means that the phytase preparation is at least 50% pure as determined by size exclusion chromatography.

[00186] A well-defined and/or substantially pure polypeptide preparation is advantageous. For example, it is very easy to correctly dose a polypeptide in feed that is essentially free from interference or contamination from other polypeptides. The term dose correctly refers particularly to the goal of obtaining consistent and constant results, and the ability to optimize the dosage based on the desired effect.

[00187] For use in animal feed, however, the phytase polypeptide of the invention does not need to be pure; it may, for example, include other polypeptides, in which case it could be called a phytase preparation.

[00188] The phytase preparation can be (a) added directly to feed (or used directly in a protein treatment process), or (b) it can be used in the production of one or more intermediate compositions such as feed additives or premixes that are subsequently added to feed (or used in a treatment process). The degree of purity described above refers to the purity of the original polypeptide preparation, whether used in accordance with (a) or (b) above.

[00189] Polypeptide preparations with purities of this order of magnitude are particularly obtainable using recombinant production methods, although they are not as easily obtained and also subject to much greater batch-to-batch variation when the polypeptide is produced by traditional fermentation methods.

[00190] Such a polypeptide preparation can clearly be mixed with other polypeptides.

[00191] The polypeptide can be added to the feed in any form, whether as a relatively pure polypeptide or mixed with other components intended for addition to an animal feed, that is, in the form of animal feed additives, such as so-called premixes for animal feed.

[00192] In another aspect the present invention relates to compositions for use in animal feed, such as animal feed, and animal feed additives, for example, premixes.

[00193] In addition to the polypeptide of the invention, the animal feed additives of the invention contain at least one fat-soluble vitamin, and/or at least one water-soluble vitamin, and/or at least one trace mineral. The feed additive may also contain at least one macromineral. The feed additive may also contain at least one macromineral.

[00194] Furthermore, optionally, the feed additive ingredients are coloring agents, for example, carotenoids such as beta-carotene, astaxanthin and lutein; aromatic compounds; stabilizers; antimicrobial peptides; polyunsaturated fatty acids; reactive oxygen-generating species; and/or at least one other polypeptide selected from phytase (EC 3.1.3.8 or 3.1.3.26); xylanase (EC 3.2.1.8); galactanase (EC 3.2.1.89); alpha-galactosidase (EC 3.2.1.22); protease (EC 3.4.-.-), phospholipase A1 (EC 3.1.1.32); phospholipase A2 (EC 3.1.1.4); lysophospholipase (EC 3.1.1.5); phospholipase C (3.1.4.3); phospholipase D (EC 3.1.4.4); amylase such as, for example, alpha-amylase (EC 3.2.1.1); and/or beta-glucanase (EC 3.2.1.4 or EC 3.2.1.6).

[00195] In a particular embodiment, these other peptides are well defined (as defined above for phytase preparations).

[00196] In a particularly preferred embodiment, the phytase of the invention with a relatively low optimum pH is combined with at least one phytase with a higher optimum pH. Preferred examples of phytases with a higher optimum pH are Bacillus phytases, such as phytases from Bacillus licheniformis and Bacillus subtilis, as well as derivatives, variants or fragments thereof with phytase activity.

[00197] The phytase of the invention can also be combined with other phytases, for example, ascomycete phytases such as Aspergillus phytases, for example derived from Aspergillus ficuum, Aspergillus niger, or Aspergillus awamori; or basidiomycete phytases, for example derived from Peniophora lycii, Agrocybe pediades, Trametes pubescens, or Paxillus involutus; or derivatives, fragments or variants thereof which have phytase activity.

[00198] Thus, in preferred embodiments of the animal feed use of the invention, and in preferred embodiments of the animal feed additive and animal feed of the invention, the phytase of the invention is combined with such phytases.

[00199] The aforementioned ascomycete and basidiomycete phytases, particularly the RONOZYME P phytase derived from Peniophora lycii as well as derivatives, variants and fragments thereof, can also be combined with Bacillus phytases, particularly with the B. licheniformis phytase as well as with a derivative, fragment or variant thereof, particularly for animal feed purposes.

[00200] Examples of antimicrobial peptides (AMP's) are CAP18, Leukocin A, Tritrptycin, Protegrin-1, Thanatin, Defensin, Lactoferrin, Lactoferricin and Ovispirin such as Novispiria (Robert Lehrer, 2000), Plectasins and Statins, including compounds and polypeptides disclosed in WO 03/044049 and WO 03/048148, as well as variants or fragments thereof that retain antimicrobial activity.

[00201] Examples of antifungal polypeptides (AFP's) are Aspergillus giganteus, and Aspergillus niger peptides, as well as variants and fragments thereof which retain antifungal activity, as disclosed in WO 94/01459 and WO 02/090384.

[00202] Examples of polyunsaturated fatty acids are C18, C20 and C22 polyunsaturated fatty acids, such as arachidonic acid, docosohexaenoic acid, eicosapentaenoic acid and gamma-linoleic acid.

[00203] Examples of reactive oxygen generating species are chemical species such as perborate, persulfate or percarbonate; and polypeptides such as an oxidase, an oxygenase or a synthetase.

[00204] Generally fat-soluble and water-soluble vitamins, as well as trace minerals, form part of a so-called premix intended for addition to feed, while macrominerals are generally added separately to feed. Either of these two types of composition, when enriched with a polypeptide of the invention, is an animal feed additive of the invention.

[00205] In a particular embodiment, the animal feed additive of the invention is intended to be included (or prescribed as having to be included) in animal diets or feed at levels of 0.01 to 10.0%; more particularly from 0.05 to 5.0%; or from 0.2 to 1.0% (% meaning g of additive per 100 g of feed). This is very particularly for premixes.

[00206] The following are non-exclusive lists of these components:

[00207] Examples of fat-soluble vitamins are vitamin A, vitamin D3, vitamin E and vitamin K, for example, vitamin K3.

[00208] Examples of water-soluble vitamins are vitamin B12, biotin and choline, vitamin B1, vitamin B2, vitamin B6, niacin, folic acid and pantothenate, for example, calcium D-pantothenate.

[00209] Examples of trace minerals are manganese, zinc, iron, copper, iodine, selenium and cobalt.

[00210] Examples of macrominerals are calcium, phosphorus and sodium.

[00211] The nutritional requirements of these components (exemplified with poultry and piglets/pigs) are listed in Table A of WO 01/58275. Nutritional need means that these components must be supplied in the diet in the indicated concentrations.

[00212] In an alternative, the animal feed additive of the invention comprises at least one of the individual components specified in Table A of WO 01/58275. At least one form out of one or more of one, or two, or three, or four, and so on up to all thirteen, or up to all fifteen individual components. More specifically, at least this individual component is included in the additive of the invention in an amount such as to provide a concentration in the feed within the range indicated in column four, or column five, or column six of Table A.

[00213] The present invention also relates to animal feed compositions. Animal feed compositions or diets have a relatively high protein content. Poultry and pork diets may be characterized in accordance with Table B of WO 01/58275, columns 2 to 3. Fish diets may be characterized as indicated in column 4 of this Table B. In addition, such fish diets generally have a raw fat content of 200 to 310 g/kg.

[00214] WO 01/58275 corresponds to US 09/779334, which is hereby incorporated by reference.

[00215] An animal feed composition according to the invention has a crude protein content of 50 to 800 g/kg, and further comprises at least one polypeptide as claimed herein.

[00216] In addition, or as an alternative (to the crude protein content indicated above), the animal feed composition of the invention has a metabolizable energy content of 10 to 30 MJ/Kg; and/or a calcium content of 0.1 to 200 g/kg; and/or an available phosphorus content of 0.1 to 200 g/kg; and/or a methionine content of 0.1 to 100 g/kg; and/or a methionine plus cysteine content of 0.1 to 150 g/kg; and/or a lysine content of 0.5 to 50 g/kg.

[00217] In particular embodiments, the content of metabolizable energy, crude protein, calcium, phosphorus, methionine, methionine plus cysteine and/or lysine is within any of ranges 2, 3, 4 or 5 in Table B of WO 01/ 58275 (R. 2-5).

[00218] Crude protein is calculated as nitrogen (N) multiplied by an act of 6.25, that is, crude protein (g/Kg) = N (g/Kg) x 6.25. Nitrogen content is determined by the Kjedahl method (A.O.A.C, 1984, Official Methods of Analysis 14th ed., Association of Official Analytical Chemists, Washington DC).

[00219] Metabolizable energy can be calculated based on the nutrient requirements of the publication NRC subcommittee on swine nutrition, committee on animal nutrition, board of agriculture, national research council. National Academy Press, Washington, D.C, pp. 2-6, and the European Table of Energy Values for Poultry Feed-stuffs, Spelderholt center for poultry research and extension, 7361 DA Beekbergen, The Netherlands. Grafisch bedrijf Ponsen & looijen bv, Wageningen. ISBN 90- 71463-12-5.

[00220] The dietary content of calcium, available phosphorus and amino acids in complete animal diets is calculated based on tables

[00221] In a particular embodiment, the animal feed composition of the invention contains at least one protein. The protein may be an animal protein, such as meat and bone meal, and/or fish meal; or it can be a vegetable protein. The term vegetable proteins, as used herein, refers to any compound, composition, preparation or mixture that includes at least one protein derived from or originating from a vegetable, including modified proteins and protein derivatives. In particular embodiments, the protein content of vegetable proteins is at least 10, 20, 30, 40, 50, or 60% (w/w).

[00222] Vegetable proteins can be derived from vegetable protein sources, such as legumes and cereals, for example, plant materials from the families Fabaceae (Leguminosae), Cruciferaceae, Chenopodiaceae and Poaceae, such as soy flour, lupine flour and rapeseed flour .

[00223] In a particular embodiment, the vegetable protein source is a material from one or more plants of the Fabaceae family, for example, soybeans, lupins, peas or beans.

[00224] In another particular embodiment, the vegetable protein source is material from one or more plants of the chenopodiaceae family, for example beetroot, beetroot, spinach or quinoa.

[00225] Other examples of vegetable protein sources are rapeseed, sunflower seed, cotton seed and cabbage.

[00226] Soy is a preferred source of vegetable protein.

[00227] Other examples of plant protein sources are cereals, such as barley, wheat, rye, oats, corn (corn), rice, triticale and sorghum.

[00228] In still other particular embodiments, the animal feed composition of the invention contains from 0 to 80% corn; and/or from 0 to 80% sorghum; and/or from 0 to 70% wheat; and/or from 0 to 70% barley; and/or 0 to 30% oats; and/or from 0 to 40% soy flour; and/or 0 to 25% fishmeal; and/or 0 to 25% meat and bone meal; and/or 0 to 20% whey.

[00229] Animal diets can, for example, be produced as paste (non-pelletized) feed or pelleted feed. Typically, ground foodstuffs are mixed and sufficient amounts of essential vitamins and minerals are added according to specifications for the species in question. Polypeptides can be added as solid or liquid polypeptide formulations. For example, a solid polypeptide formulation is typically added before or during the mixing step; and a liquid polypeptide preparation is typically added after the pelleting step. The polypeptide can also be incorporated into a feed additive or premix.

[00230] The final polypeptide concentration in the diet is within the range of 0.01 to 200 mg of polypeptide protein per kg of diet, for example, in the range of 0.1 to 10 mg/kg of animal diet (typical dosage is in the range of 250 to 2000 FYT/Kg of animal diet).

[00231] The phytase of the invention must obviously be applied in an effective amount, that is, in an amount suitable to improve solubilization and/or improve the nutritional value of the feed. It is presently contemplated that the polypeptide is administered in one or more of the following amounts (dosage ranges): 0.01-200; 0.01-100; 0.5-100; 1-50; 5-100; 10-100; 0.05-50; or 0.10-10 - all these ranges being in mg of phytase polypeptide protein per kg of feed (ppm).

[00232] To determine the phytase polypeptide protein per kg of feed, phytase is purified from the feed composition, and the specific activity of the purified phytase is determined using a relevant assay. The phytase activity of the feed composition as such is also determined using the same assay, and based on these two determinations, the dosage in mg of phytase protein per kg of feed is calculated.

[00233] The same principles apply to determine the amount in mg of the phytase polypeptide protein in feed additives. Obviously, if the sample is available to prepare the feed additive or feed, the specific activity will be determined from that sample (no need to purify the phytase from the feed or additive composition).

Methods for Producing Fermentation Products

[00234] Yet another aspect of the present invention relates to methods for producing a fermentation product, such as, for example, ethanol, beer, wine, dried distillers grains (DDG), wherein the fermentation is carried out in the presence of a phytase of the present invention. Examples of fermentation processes include, for example, the processes described in WO 01/62947. Fermentation is carried out using a fermenting microorganism, such as yeast.

[00235] In a particular embodiment, the present invention provides methods for producing a fermentation product, comprising (a) fermenting (using a fermentative microorganism, such as yeast), a carbohydrate-containing material (e.g., starch) in the presence of a phytase of the present invention and (b) producing a fermentation product from the carbohydrate-containing material.

[00236] In a particular embodiment, the present invention provides methods for producing ethanol, comprising fermentation (using a

[00237] In another embodiment, the present invention provides methods for producing ethanol comprising a) the hydrolysis of starch, for example, by a liquefaction and/or saccharification process, a crude starch hydrolysis process, b) the fermentation of the resulting starch in the presence of a phytase of the present invention, and c) production of ethanol.

[00238] Phytase can be added to the fermentation process at any suitable stage and in any suitable composition, including alone or in combination with other enzymes, such as one or more alpha-amylases, glucoamylases, proteases and/or cellulases.

[00239] In another embodiment, the present invention provides methods for producing ethanol comprising biomass hydrolysis and fermentation (using a fermentative microorganism, such as yeast), the resulting biomass in the presence of a phytase of the present invention.

Signal peptide

[00240] The present invention also relates to nucleic acid constructs comprising a gene encoding a protein operably linked to a first nucleotide sequence consisting of nucleotides 1 to 99 of SEQ ID NO: 9, encoding a signal peptide consisting of the amino acids 1 to 33 of SEQ ID NO: 10, where the gene is external to the first nucleotide sequences.

[00241] The present invention also relates to recombinant expression vectors and recombinant host cells comprising such nucleic acid constructs.

[00242] The present invention also relates to methods for producing a protein comprising (a) culturing such a recombinant host cell under conditions suitable for producing the protein; and (b) recovery of the protein.

[00243] The first nucleotide sequences can be operatively linked to the external genes individually with other control sequences or together with other control sequences. Such other control sequences are described above.

[00244] The protein can be natural or heterologous to a host cell. The term “protein” does not refer here to a specific length of the encoded product and consequently encompasses peptides, oligopeptides and proteins. The term “protein” also encompasses two or more polypeptides combined to form the encoded product. Proteins also include hybrid polypeptides which comprise a combination of partial or complete polypeptide sequences obtained from at least two different proteins, one or more of which may be heterologous or natural to the host cell. Proteins further include naturally occurring engineered and allelic variations of the aforementioned proteins and hybrid proteins.

[00245] Preferably, the protein is a hormone or variant thereof, polypeptide, for example, enzyme, receptor or portion thereof, antibody or portion thereof, or reporter. In a more preferred aspect, the protein is an oxidoreductase, transferase, hydrolase, lyase, isomerase or ligase. In an even more preferred aspect, the protein is an aminopeptidase, amylase, carbohydrase, carboxypeptidase, catalase, cellulase, chitinase, cutinase, cyclodextrin glycoyltransferase, deoxyribonuclease, esterase, alpha-galactosidase, beta-galactosidase, glucoamylase, alpha-glucosidase, beta-

[00246] The gene can be obtained from any prokaryote, eukaryote or other source.

Various modalities

[00247] The following are additional embodiments of the present invention. Also included herein are corresponding aspects relating to nucleic acid sequences, nucleic acid constructs, recombinant expression vectors, recombinant host cells, methods for producing the polypeptides, transgenic plants and animals and the various uses, methods of use and compositions. /feed additives, all as claimed.

[00248] An isolated polypeptide with phytase activity and a residual activity after incubation at 37 ° C and in 0.1 M glycine/HCl buffer, pH 2.0, for 4 hours of at least 20%, compared to the activity at time t = 0, activity being evaluated at 37 °C and pH 5.5 in 1% (w/v) sodium phytate using a 0.25 M sodium acetate buffer pH 5.5, blind buffer subtracted; preferably with an identity i) to amino acids 1 to 413 of SEQ ID NO: 10 of at least 75%, preferably of at least 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83% , 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 96.5%, 97%, 97, 5%, 98%, 98.5%, 98.7%, 98.8%, 98.9%, 99%, 99.0%, 99.1%, 99.2%, 99.3%, 99 .4%, 99.5%, 99.6%, 99.7%, 99.8%, or at least 99.9%.

[00249] An isolated polypeptide with phytase activity and a residual activity after incubation at 37 ° C and in a 0.1 M glycine/HCl buffer, pH 2.5, for 24 hours of at least 20% compared to the activity at time t = 0, activity being evaluated at 37 °C and pH 5.5 in 1% (w/v) sodium phytate using a 0.25 M sodium acetate buffer pH 5.5, blind buffer subtracted; preferably with an identity i) to amino acids 1 to 413 of SEQ ID NO: 10 of at least 75%, preferably of at least 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83% , 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 96.5%, 97%, 97, 5%, 98%, 98.5%, 98.7%, 98.8%, 98.9%, 99%, 99.0%, 99.1%, 99.2%, 99.3%, 99 .4%, 99.5%, 99.6%, 99.7%, 99.8%, or at least 99.9%.

[00250] An isolated polypeptide with phytase activity in which the activity of the polypeptide, at pH 5.0 at 37 °C, measured on the pNP-phosphate substrate is less than 11% of the activity of the polypeptide measured on the phytate substrate; preferably with an identity i) to amino acids 1 to 413 of SEQ ID NO: 10 of at least 75%, preferably of at least 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83% , 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 96.5%, 97%, 97, 5%, 98%, 98.5%, 98.7%, 98.8%, 98.9%, 99%, 99.0%, 99.1%, 99.2%, 99.3%, 99 .4%, 99.5%, 99.6%, 99.7%, 99.8%, or at least 99.9%.

[00251] An isolated polypeptide with phytase activity, in which the polypeptide has a higher release of phosphorus (P) compared to phytase from Peniophora lycii; preferably as measured in an in vitro model; and/or wherein the polypeptide has an identity with i) amino acids 1 to 413 of SEQ ID NO: 10 of at least 75%, preferably of at least 76%, 77%, 78%, 79%, 80%, 81 %, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 96.5 %, 97%, 97.5%, 98%, 98.5%, 98.7%, 98.8%, 98.9%, 99%, 99.0%, 99.1%, 99.2% , 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, or at least 99.9%.

[00252] An isolated polypeptide with phytase activity, in which the polypeptide, dosed at 0.25 FYT/g of feed, releases at least 150% phosphorus (P) in relation to the phosphorus released by Peniophora lycii phytase, also dosed at 0.25 FYT/g of feed/ and/or wherein the polypeptide preferably has an identity with i) amino acids 1 to 413 of SEQ ID NO: 10 of at least 75%, preferably of at least 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94% , 95%, 96%, 96.5%, 97%, 97.5%, 98%, 98.5%, 98.7%, 98.8%, 98.9%, 99%, 99.0% , 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, or at least 99.9%.

[00253] An isolated polypeptide with phytase activity, in which the polypeptide, dosed at 0.75 FYT/g of feed, releases at least 150% of phosphorus (P) in relation to the phosphorus released by Peniophora lycii phytase, also dosed at 0.75 FYT/g of feed; and/or wherein the polypeptide preferably has an identity with i) amino acids 1 to 413 of SEQ ID NO: 10 of at least 75%, preferably of at least 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 96, 5%, 97%, 97.5%, 98%, 98.5%, 98.7%, 98.8%, 98.9%, 99%, 99.0%, 99.1%, 99.2 %, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, or at least 99.9%. I. An isolated polypeptide with phytase activity, selected from the group consisting of: (a) a polypeptide with an amino acid sequence which has at least 75% identity with (i) amino acids 1 to 413 of SEQ ID NO: 10 and /or (ii) the mature polypeptide part of SEQ ID NO: 10, (b) a polypeptide which is encoded by a polynucleotide which hybridizes under conditions of at least medium stringency with (i) nucleotides 100 to 1338 of SEQ ID NO: 9, (ii) the mature polypeptide encoding part of SEQ ID NO: 9, and/or (iii) a complementary strand of any of (i) or (ii); (c) a variant of any II. An isolated polynucleotide comprising a nucleotide sequence which encodes the polypeptide of section I. III. An isolated polynucleotide encoding a polypeptide with phytase activity, selected from the group consisting of: (a) a polynucleotide encoding a polypeptide with an amino acid sequence which has at least 75% identity, preferably at least 76%, 77%, 78% , 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95 %, 96%, 96.5%, 97%, 97.5%, 98%, 98.5%, 98.7%, 98.8%, 98.9%, 99%, 99.0%, 99 .1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8% or at least 99.9% identity with the amino acids 1 to 413 of SEQ ID NO: 10; (b) a polynucleotide with at least 75% identity, preferably at least 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87 %, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 96.5%, 97%, 97.5%, 98%, 98.5%, 98.7%, 98.8%, 98.9%, 99%, 99.0%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99, 6%, 99.7%, 99.8% or at least 99.9% identity with nucleotides 100 to 1338 of SEQ ID NO: 9; and (c) a polynucleotide which hybridizes under conditions of at least average stringency to (i) nucleotides 100 to 1338 of SEQ ID NO: 9, (ii) the mature polypeptide encoding part of SEQ ID NO: 9, (iii ) a complementary strand of either (i) or (ii). IV. The polynucleotide isolated from any of sections II and III, with at least one modification to the mature polypeptide coding sequence of SEQ ID NO: 9, in which the mutant nucleotide sequence encodes a polypeptide comprising amino acids 1 to 413 of SEQ ID NO : 10. VI. A recombinant expression vector comprising the nucleic acid construct of section V. VII. A recombinant host cell comprising the nucleic acid construct of section V. VIII. A method of producing the polypeptide and of section I comprising (a) culturing the cell, which in its wild-type form is capable of producing the polypeptide, under conditions that lead to the production of the polypeptide; and (b) recovery of the polypeptide. IX. A method for producing the polypeptide of section I comprising (a) culturing a recombinant host cell comprising a nucleic acid construct comprising a nucleotide sequence encoding the polypeptide under conditions leading to the production of the polypeptide; and (b) recovery of the polypeptide. X. A transgenic plant, plant part or plant cell, which has been transformed with a polynucleotide encoding the polypeptide of section I. A transgenic non-human animal, or products or elements thereof being capable of expressing the polypeptide of section I. XII. Use of at least one section I polypeptide in animal feed. XIII. Use of at least one polypeptide from section I in the preparation of a composition for use in animal feed. XIV. A method of improving the nutritional value of an animal feed, wherein at least one section I polypeptide is added to the feed. XVI. The animal feed additive of section a beta-glucanase. XVII. The animal feed additive of section XVI, wherein the additional strand has an optimum pH which is greater than the optimum pH of the polypeptide having the amino acid sequence of amino acids 1 to 413 of SEQ ID NO: 10. IIXX: A composition of animal feed having a crude protein content of 50 to 800 g/kg and comprising at least one polypeptide of section I. A polypeptide with phytase activity which comprises, preferably has or consists of an amino acid sequence which has at least 75 % identity, preferably at least 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90 %, 91%, 92%, 93%, 94%, 95%, 96%, 96.5%, 97%, 97.5%, 98%, 98.5%, 98.7%, 98.8% , 98.9%, 99%, 99.0%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99 .8% or at least 99.9% identity with amino acids 1 to 413 of SEQ ID NO: 10.

[00254] A polypeptide with phytase activity which preferably comprises the sequence of (i) amino acids 1 to 413 of SEQ ID NO: 10, and/or (ii) the mature polypeptide part of SEQ ID NO: 10; or whose polypeptide (a) is a variant of any of the polypeptides of (i)-(ii), comprising a conservative deletion, insertion and/or substitution of one or more amino acids; or (b) is a fragment of any of polypeptides (i)-(ii). The present invention is further described by the following examples, which should not be construed as limiting the scope of the invention.

EXAMPLES Example 1. Cloning of the phytase gene from Hafnia alvei

[00255] A multiple alignment was made of the following histidine acid phosphatases (HAP): appA from Escherichia coli (SPTREMBLQ8GN88), DSM 13694 phytase from Citrobacter gillenii (geneseqp:aehO4533), phytase from Citrobacter amalonaticus ATCC 25407 (geneseqp:aehO4535), phytase from Citrobacter braakii (geneseqp:aehO4827) and ypo1648 from Yersinia pestis CO92 (SPTREMBLQ8ZFP6). Two oligonucleotide primers were designed based on consensus sequences: 2123fw: 5-CATGGTGTGCGNGCNCCNACNAA-3 (SEQ ID NO: 1) 2065rev: 5-CCCACCAGGNGGNGTRTTRTCNGGYTG-3' (SEQ ID NO: 2), where Y designates T or C , R designates A or G, and N designates A, C, G or T.

[00256] The primers were used for PCR scanning of various bacterial species at annealing temperatures between 40 and 50 °C, but typical as the touch down program starting with 50 °C and then reducing the annealing temperature with 1 ° C for each cycle for the next 10 cycles before performing the standard PCR.

[00257] A partial phytase gene in the form of a PCR fragment of approximately 950 bp was identified in Hafnia alvei (DSM 19197).

[00258] The PCR fragment was isolated from agarose gel and the fragment was sequenced using the same PCR primers with which the fragment was generated. By translation of the nucleotide sequence, it was confirmed that the DNA fragment was part of a HAP phytase gene.

[00259] To obtain the full-length nucleotide sequence of the gene, the DNA WALKING SPEEDUP™ kit (DWSK-V102 from Seegene, Inc., 2nd Fl., Myungji Bldg., 142-21, Samsung-dong, Kangnam-gu , Seoul, 135-090, Korea) was used, which is designed to capture unknown target sites. For this purpose, 6 specific oligonucleotides were designed and used with the kit. 2328 TSPldw: 5'- ACTTGCATCGACGTTGGCTG (SEQ ID NO: 3) 2329 TSP2dw: 5'- ACTGAGCAGCAATGGAACTCTCTG (SEQ ID NO: 4) 2330 TSP3dw: 5'- ACTGGGTTCCAATATCACGAGTC (SEQ ID NO: 5) 2331 TSP1up: 5'- AT GGTGGATCGCTAAATCACACTG ( SEQ ID NO: 6) 2332 TSP2up: 5'- ACGTCTGCCCAAACATACACG (SEQ ID NO: 7) 2333 TSP3up: 5'- ACCGCCCATCAGGCTAATC (SEQ ID NO: 8)

[00260] The total nucleotide sequence encoding the phytase of Hafnia alvei DSM 19197 is shown in the sequence listing as SEQ ID NO: 9, and the corresponding encoded amino acid sequence is shown in SEQ ID NO: 10. The first 33 amino acids of the SEQ ID NO: 10 (i.e. amino acids -33 to -1) are a signal peptide as predicted by the Signal PV3.0 software (see www.cbs.dtu.dk/services/SignalP/).

Example 2. Expression of the Hafnia alvei phytase gene

[00261] A polynucleotide encoding the 27 amino acid signal peptide of a natural protease, Savniase™, from Bacillus licheniformis was fused by PCR in frame to the gene encoding the mature phytase of Hafnia alvei. The signal peptide coding sequence is shown in SEQ ID NO: 11, encoding the signal peptide of SEQ ID NO: 12.

[00262] The DNA encoding the effusion polypeptide was integrated by homologous recombination into a Bacillus subtilis host cell genome. The gene construct was expressed under the control of a triple promoter system (as described in WO 99/43835), consisting of the promoters of the Bacillus licheniformis alpha-amylase gene (amyL), the Bacillus amyloliquefaciens alpha-amylase gene ( amyQ), and the Bacillus thuringiensis cryIIIA promoter including the mRNA stabilizing sequence. The gene encoding a chloramphenicol acetyltransferase was used as a marker, as described, for example, in Diderichsen et al., A useful cloning vector for Bacillus subtilis. Plasmid, 30, p. 312, 1993.

[00263] Chloramphenicol-resistant transformants were grown in OS-1 medium (10% sucrose, 4% soy flour, 1% Na3PO4- 12H2O, 0.5% CaCO3 and 0.01% pluronic acid) shaken at 250 RPM at 30 °C. After 2 to 5 days of incubation, the supernatant was removed and phytase activity was identified by applying 20 microliters of the supernatant into 4 mm diameter holes drilled in 1% LSB-agarose plates containing 0.1 sodium acetate. M pH 4.5 and inositolexophosphoric acid 0.1%. The plates were left overnight at 37°C and a buffer consisting of 0.25 M CaCl2 and 500 mM MES (adjusted to pH 6.5 with 4N NaOH) was poured onto the plates. The plates were left at room temperature for 1 h and inositolphosphate phosphatase, or phytase activity was then identified as a clear region.

[00264] Several phytase positive transformants were analyzed by DNA sequencing to ensure the correct DNA sequence of the constructs. A correct clone was selected.

Example 3. Host fermentation of Hafnia NN020125 phytase

[00265] The selected clone of Bacillus subtilis, which was harboring the Hafnia alvei phytase construct and was capable of expressing phytase (mature part) was cultivated at 30 ° C and 250 rpm for 6 days in medium

[00266] The fermentation supernatant with phytase was first centrifuged at 7200 rpm and 5 ° C for one hour and filtered through a sandwich of four Whatman glass microfiber filters (2.7, 1.6, 1.2 and 0 .7 micrometers). After that, the solution was subjected to sterilization by filtration through a Seitz-EKS deep filter using pressure. Then, the filtered supernatant was pretreated as follows.

[00267] The sample solution was washed with water and concentrated using an ultrafiltration unit (Filtron, from Filtron Technology Corporation) equipped with a 10 KDa cutoff ultrafiltration membrane. The pH was then adjusted to 4.5 with 10% (w/v) acetic acid, which caused less precipitation. No activity was found in the precipitate, and it was removed by filtration through the top filter of the Fast PES bottle with a cutoff of 0.22 micrometers.

[00268] After pretreatment, the phytase was purified by chromatography on S Sepharose, approximately 50 mL on an XK26 column, using 50 mM sodium acetate A pH 4.5 as a buffer, and 50 mM sodium acetate B as a buffer of sodium acetate + 1 M NaCl pH 4.5. Fractions from the column were analyzed for activity using the phosphatase assay (see below) and fractions with activity were pooled.

[00269] Solid ammonium sulfate was added to the solution to a final concentration of 1.5 M and the pH was adjusted to 6.0 using 6 M HCl. The phytase-containing solution was applied to a butyl sepharose column, approximately 30 mL in an .0 25mM. Fractions from the column were analyzed for activity using the phosphatase assay (see below) and fractions with activity were pooled. Finally, the solution containing the purified phytase was buffer modified to 50 mM sodium acetate + 0.1 M NaCl, pH 4.5 and concentrated using an Amicon ultra-15 filtration device with a 30 KDa cutoff membrane.

[00270] The molecular weight, as estimated from SDS-PAGE, was approximately 40 KDa and the purity was > 95%.

Example 5. Activity assays Determination of phosphatase activity

[00271] 75 microliters of enzyme solution containing phytase are dispensed into a microtiter plate well, e.g., NUNC 269620, and 75 microliters of substrate are added (to prepare the substrate, two 5 mg p-nitrophenylphosphate tablets (Signa, Cat. No. N-9389) are dissolved in 10 mL of 0.1 M sodium acetate buffer, pH 5.5). The plate is closed and incubated for 15 min, shaking at 750 rpm at 37 °C. After the incubation time, 75 microliters of stop reagent is added (the stop reagent is 0.1 M disodium tetraborate in water) and the absorbance at 405 nm is measured on a microtiter plate spectrophotometer.

Determination of Phytase Activity

[00272] 75 microliters of enzyme solution containing phytase, approximately diluted in 0.25 M sodium acetate, 0.005% (w/v) Tween-20, pH 5.5, are dispensed into a microtiter plate well, e.g. , NUNC 269620 and 75 microliters of substrate are added (prepared by dissolving 100 mg of rice sodium phytate (Aldrich Cat No. 274321) in 10 mL of 0.25 M sodium acetate buffer, pH 5.5) . The plate is closed and incubated for 15 min, shaking at 750 rpm at 37 °C. After incubation, 75 microliters of stop reagent is added (the stop reagent being prepared by mixing 10 mL of molybdate solution (10% (w/v) ammonium heptamolybdate) in 0.25% (w/v) ammonium solution. v), 10 mL of ammonium vanadate (0.24% commercial product from Bie&Berntsen, Cat No. LAB17650), and 20 mL of 21.7% (w/v) nitric acid, and the absorbance at 405 nm is measured on a microtiter plate spectrophotometer. Phytase activity is expressed in the unit of FYT, a FYT being the amount of enzyme that releases 1 micromol of inorganic orthophosphate per minute under the above conditions. An absolute value for measured phytase activity may be obtained by reference to a standard curve prepared from appropriate dilutions of inorganic phosphate, or by reference to a standard curve made from the dilutions of a phytase enzyme preparation with known activity (such standard enzyme preparation with a known activity is available upon request from Novozymes A/S, Krogshoejvej 36, DK-2880 Bagsvaerd).

Determination of specific phytase activity

[00273] The specific activity of phytase was determined in sodium acetate buffer, pH 5.5. Phytase was highly purified as described above, i.e., only one component was identified on an SDS polyacrylamide gel.

[00274] Protein concentration was determined by amino acid analysis as follows: an aliquot of the sample was hydrolyzed in 6 M HCl, 0.1% phenol for 16 h at 110 ° C in an evacuated glass tube. The resulting amino acids were quantified using a

[00275] Phytase activity was determined in FYT units as described above and specific activity was calculated as phytase activity measured in FYT units per mg of phytase enzyme protein.

[00276] The resulting specific activity was 980 FYT/Mg of protein. Specific activity was determined in sodium phytate at pH 5.5 and 37 °C.

Example 6. Determination of the pH profile of phytase

[00277] The pH profile was determined at 37 °C in the pH range of 2.0 to 7.5 (in steps of 0.5 pH units) as described above in the “Determination of Phytase Activity” section, except that a buffer cocktail (50 mM glycine, 50 mM acetic acid, and 50 mM Bis-Tris were used instead of the 0.25 M sodium acetate pH 5.5 buffer. The results are summarized in Table 1 below. Values given for each pH in the range of 2.0 to 7.5 are the relative activities % normalized to an optimum value.Table 1: pH profile

Example 7. Determination of the isoelectric point of phytase

[00278] The isoelectric point, pl, for phytase was determined using isoelectric focusing gels (Novex pH 310 IEF gel from Invitrogen, catalog number EC6655A2) performed as described by the manufacturer. The PI of Hafnia alvei phytase is about 7.4.

Example 8. Temperature profile of phytase

[00279] The temperature profile (phytase activity as a function of temperature) was determined for Hafnia alvei phytase in the temperature range of 20 to 90 °C, essentially as described above (“Determination of Phytase Activity”). However, the enzymatic reactions (100 microliters of enzyme solution containing phytase + 100 microliters of substrate) were carried out in PCR tubes instead of in microtiter plates. After a 15-minute reaction period at a desired temperature, the tubes were cooled to 20 °C for 20 seconds and 150 microliters of each reaction mixture were transferred to a microtiter plate. 75 microliters of stopping reagent was added and absorbance at 405 nm was measured on a microtiter plate spectrophotometer. The results are summarized in Table 2 below. The numbers given for each temperature are relative activity (in %) normalized to the optimal value. Table 2: Temperature profile

Example 9. Phytase thermostability

[00280] Phytase from Hafnia alvei expressed in both Aspergillus oryzae and Bacillus subtilis was subjected to thermostability measurements by Differential Scanning Calorimetry (DSC) and compared with phytase from E. coli (commercially available as PHYZYME XP from Danisco NS) . An aliquot of the Hafnia alvei phytase protein sample (purified as described in Example 4) was dialyzed against 2 x 500 mL of 20 mM sodium acetate, pH 4.0 at 4 °C in a 2 to 3 h step followed by a step from one day to the next. The sample was filtered at 0.45 µm and diluted with buffer to approximately 2 A280 units. The exact measured absorbance values are given in the table results shown

[00281] A DSC scan was performed at a constant scan rate of 1.5 °C/min from 20 to 80 °C. Filtration period: 16 s. Before performing DSC, phytases were dialyzed against appropriate buffers (e.g., 0.1 M glycine-HCl, pH 2.5 or 3.0; 20 mM sodium acetate, pH 4.0; 0 .1 M, pH 5.5; 0.1 M Tris-HCl, pH 7.0). Data manipulation was performed using MicroCal Origin software (version 4.10) and the denaturation temperature, Td (also called melting temperature, Tm) is defined as the temperature at the apex of the peak in the thermogram. To probe the reversibility of the unfolding process, a second scan was performed immediately after a short cooling phase. For the second scan the peak area (the area between the peak and the baseline = splitting enthalpy, which is compared) is compared with the peak area of the first scan. A large peak (between 75 and 100% of the peak area of the first scan) is interpreted as an unfolding/folding process.

[00282] The DSC results for Hafnia alvei phytase expressed in both Aspergillus oryzae and Bacillus subtilis are summarized in Table 3 below. Table 3. Comparative Thermostability of Phytase from Hafnia alvei and Phytase from E. coli

[00283] As illustrated in the table above, phytase from Hafnia alvei had greater thermostability than phytase from E. coli. It is clear that the thermostability of Hafnia alvei phytase was not affected by the expression host.

Example 10. Gastric Proteolytic Resistance of Phytase from Hafnia alvei and Phytase from E. coli

[00284] Samples of H. alvei phytase and E. coli phytase (PHYZYME XP, available from Danisco) were treated with pepsin (Pepsin 1:60000 from porcine stomach mucosa, Wako 162-18721, 2900 units/mg , Lot SDK5232) in 250 mM glycine buffer, pH 3.0 (approximately 1000 pepsin units/mg phytase). Incubated for 30 minutes at 40 °C under shaking (750 rpm). After incubation with pepsin, phytase activity was determined as described in Example 5 and compared with the activity of a sample treated in the same way, but without addition of pepsin. The results are summarized in Table 4 below. TABLE 4. Gastric Proteolytic Resistance of Phytase from Hafnia alvei and Phytase from E. Coli

[00285] Therefore, E. coli phytase and H. alvei phytase have very similar gastric proteolytic resistance properties.

Example 11. Animal feed performance and in vitro model for Hafnia alvei phytase and Citrobacter braakii phytase

[00286] The performance of Hafnia alvei phytase in animal feed was compared, in an in vitro model, with the performance of a phytase from

[00287] Feed samples composed of 30% soy flour and 70% corn flour with CaCl2 added to a concentration of 5 g of calcium per kg of feed are then prepared and pre-incubated at 40 ° C and pH 3 .0 for 30 minutes, followed by the addition of pepsin (3000 U/g feed) and appropriate dosages of the phytases (identical dosages are used for all phytases to be tested to allow comparison), for example, between 0.1 and 1.0 FYT phytase units/g of feed. A blank without phytase activity was also included as a reference. Samples were then incubated at 40°C and pH 3.0 for 60 minutes, followed by pH 4.0 for 30 minutes.

[00288] The reactions were stopped and phytic acid and inositol phosphates extracted by adding HCl to a final concentration of 0.5 M and incubating at 40 ° C for 2 hours, followed by a freeze-thaw cycle and incubation for 1 hour at 40°C.

[00289] Phytic acid and inositol-phosphate were separated by high performance ion chromatography, as described by Chen et al in Journal of Chromatography A (2003) vol. 1018, pp. 41-52 and quantified as described by Skoglund et al in J. Agric. FoodChem. (1997), vol. 45, pp. 431-436.

[00290] Figure 1 shows a dose-response of Hafnia alvei phytase compared to a Citrobacter braakii phytase at a dosage of 125 FYT/Kg of feed, 250 FYT/Kg of feed and 500 FYT/Kg of feed. The effects of phytases in vitro are shown as the residual inositol-phosphate-bound phosphorus (IP-P) remaining in a sample after in vitro incubation and compared with the IP-P remaining in a control sample without phytase. All numbers given are means and standard deviations of 4 or 5 replicates (in vitro incubations). Dosing 250 FYT/Kg of Hafnia phytase reduced the amount of residual IP-P in the in vitro sample to approximately the same degree as 125 FYT/Kg of Citrobacter phytase.

[00291] Accordingly, Hafnia phytase was able to obtain a very good reduction in the amount of phosphorus bound to residual inositol-phosphate.

Example 12: Animal feed performance in an in vitro model for Hafnia alvei phytase and Peniophora lycii phytase.

[00292] The performance in animal feed of Hafnia alvei phytase in an in vitro model was also compared with the performance of a Peniophoa lycii phytase at a dosage of 250 FYT/Kg and 500 FYT/Kg of feed. The results were obtained following the experimental protocol as described in Example 11. As shown in Figure 2, phytase from Hafnia alvei reduced the amount of residual IP-P in the sample in vitro_better than phytase from Peniophora lycii.

Claims (10)

1. Animal feed additive, characterized by the fact that it comprises: (a) an isolated polypeptide having phytase activity, said polypeptide comprising amino acids 1 to 413 of SEQ ID NO: 10; and (b) at least one fat-soluble vitamin, at least one water-soluble vitamin, at least one trace mineral or combinations thereof. 2. Nucleic acid construction, characterized by the fact that it comprises the polynucleotide comprising nucleotides 100 to 1338 of SEQ ID NO: 9, operably linked to one or more control sequences, wherein the control sequences are heterologous. 3. Recombinant expression vector, characterized by the fact that it comprises the nucleic acid construct as defined in claim 2. 4. Recombinant microorganism, characterized by the fact that it comprises the nucleic acid construction as defined in claim 2. 5. Method for producing an isolated polypeptide having phytase activity comprising amino acids 1 to 413 of SEQ ID NO: 10, the method being characterized by the fact that it comprises (a) culturing a recombinant microorganism comprising a nucleic acid construct comprising nucleotides 100 to 1338 of SEQ ID NO: 9; and (b) recovery of the polypeptide. 6. Use of at least one isolated polypeptide having phytase activity comprising amino acids 1 to 413 of SEQ ID NO: 10, characterized by the fact that it is in animal feed. 7. Use of at least one isolated polypeptide having phytase activity comprising amino acids 1 to 413 of SEQ ID NO: 10, characterized by the fact that it is in the preparation of a composition for use in animal feed. 8. Method for improving the nutritional value of an animal feed, characterized by the fact that at least one isolated polypeptide having phytase activity comprising amino acids 1 to 413 of SEQ ID NO: 10 is added to the feed. 9. Animal feed additive according to claim 1, characterized in that it further comprises at least one amylase, at least one additional phytase, at least one xylanase, at least one galactanase, at least one alpha-galactosidase, at least a protease, at least one phospholipase and/or at least one beta-glucanase. 10. Composition of animal feed, characterized by the fact that it has a crude protein content of 50 to 800 g/Kg and comprising at least one isolated polypeptide having phytase activity comprising amino acids 1 to 413 of SEQ ID NO: 10.