BRPI0803008A2 - hepatitis b virus (hbsag) surface gene expression vectors and chimeric hbv-hcv plasmids against hepatitis b and hepatitis c - Google Patents

Abstract

Expression vectors of the hepatitis E virus surface gene (HBsAg) and chimeric HBV-HCV plasmids against hepatitis B and hepatitis C. The present invention relates to HBsAg vectors (pSAaVMl and pSAa-VM2) that allow a high yield of HBsAg for expression of HBsAg in mammalian cells. The invention also contemplates obtaining and using HBV-HCV chimeric plasmids against hepatitis B and hepatitis C.

Description

"Dahepatitis B virus surface gene (HBsAg) expression vectors and chimeric HBV-HCV counterhepatitis B and hepatitis C plasmids"

Field of the Invention

The present invention relates to HBsAg vectors (pSAa-VM1 and pSAa-VM2) which yield high yields of HBsAg for HBsAg expression in mammalian cells. The invention further contemplates obtaining and using HBV-HCV chimeric plasmids against hepatitis B and hepatitis C.

Background of the Invention

The World Health Organization (WHO) estimates that more than 350 million people worldwide are chronic carriers of hepatitis B virus (HBV) and more than 10% of these patients are at risk for cirrhosis and hepatocellular carcinoma (Jin et al. 2002).

HBV variants are currently classified into genotype (A-H) by comparing nucleotide sequences of the pre-S / S gene or the complete genome (Magnius & Norder, 1995, Arauz-Ruiz, 2002 and Stuyver, 2000).

HBV genotypes are not evenly distributed among the world population. Thus, the epandemic genotype A and its genome have 3,221 nucleotides; BeC genotypes are found in indigenous populations in Asia and the Pacific and their genomes have 3,215 nucleotides; genotype D is found in the Mediterranean, having 3,182 nucleotides in its genome; genome Esomente is found in Africa with a genome of 3,212 nucleotides; genotype F is found among Amerindians in Polynesia with a genome of 3,215 nucleotides, while genotype G is found in the United States and Europe, having a genome of 3,248 nucleotides. Having a strong resemblance to genotype F, genotype H was found in two samples: one from Nicaragua and one from California and would be related to the Amerindian populations. In Brazil, due to the miscegenation of the population, three major genotypes (A, DeF) are found. It has recently been shown that most isolates that circulate in Brazil are genotype A, subgenotype Aa (orAl) with probably African origin (Araújo et al. , 2004).

HBV has a unique mechanism among viruses that infect humans, which allows the production of different types of viral particles. In preparations for electron microscopy of serum from infected individuals, three particle forms are observed: infectious complete particles (42 nm), spherical noninfectious incomplete particles (22 nm) and filamentous noninfectious incomplete particles (22 nm).

The HBV genome is one of the smallest among viruses that infect humans, spanning approximately 3,200 base pairs (bp). It consists of a partially double stranded circular DNA molecule. The larger ribbon is complementary to viral RNAs and by convention has negative polarity (negative ribbon). The HBV genome is fully coding and has four open reading stages called pre-S / S, pre-C / C, P and X. Through an ingenious system that overlaps open reading stages, all virus genes are closely linked. and HBV can produce approximately 50% more protein than expected for the size of its genome (Ganem & Varmus 1987).

The pre-S / S genomic region encodes the viral surface proteins that make up HBsAg; pre-C / C is responsible for the synthesis of core antigen (HBcAg) and antigen e (HBeAg); the P gene encodes viral polymerase; the X region synthesizes a regulatory protein called protein X.

The pre-S / S region includes the pre-Sl, pre-S2 and S regions with three initiation codons in the same reading phase. The largest protein, L "large" (368 aa), is encoded from the initiation codon located at the beginning of the pre-Sl region, and the synthesis of this protein extends through the pre-Sl, pre-S2, and S regions. intermediate size, M middle (281 aa), is encoded by the pre-S2 and S regions, while the smaller protein S "small" (226 aa) is synthesized from the third initiation codon located at the beginning of the S region. All of these proteins have the same terminus codon located in the S-end region. These proteins are found in glycosylated and unglycosylated forms, and protein M may be diglycosylated (Seeger & Mason2000).

The three types of proteins are not evenly distributed among the different viral particle forms (Heermann et al. 1984). 22nm subviral particles are predominantly composed of S proteins, with varying amounts of M protein and few or no L chains. However, the virion particles are enriched with L proteins. Since L proteins are known to contain the sites of HBV binding to specific receptors on hepatocytes (Neurath et al. 1986, Klingmuller & Schaller 1993), this L protein enrichment could prevent the more numerous subviral particles from competing with virions for cell surface receptors (Ganem 1996).

Protein S, which is the major protein that forms HBsAg, is capable of inducing protective immune response (anti-HBs) against HBV, and is the antigen used in vaccine formulation (Grob 1998). Each HBsAgé particle comprised of 100 to 150 S-protein subunits. Mutations in specific epitopes occurring within the geneS may interfere with vaccine protection, serological results analysis, and impair therapy based on the use of specific antibodies to suppress infection. in transplanted individuals (Blum1993, Wallace & Carman 1994).

The HBV vaccine was the first and is still the only licensed recombinant vaccine (Koff 2002). The first HBV vaccine was released in 1981 and was derived from human plasma from chronic HBV carriers (Heptavax-B, Merck & Co). However, the risk of transmission of other infectious agents present in the plasma has driven the development of recombinant vaccines composed of genetically engineered HBsAg (Engerix-B, SmithKline and Recombivax, Merck & Co). For the production of these vaccines, recombinant DNA technology is used. for HBsAg expression in yeast (Assad & Francis 2000). The vaccine has good immunogenicity against HBV, about 90% of immunocompetent individuals, when vaccinated, develop an adequate antibody response. In addition, the vaccine has the potential to reduce cellular hepatocellular carcinoma incidence and mortality rates. However, the high cost, the existence of mutant strains of vaccine escape and the low response in neonates are still existing problems (Thanavala, 1996; Yu et al. 2006). In addition, current vaccines do not include F genotype antigens which is the most prevalent in South America and is absent from other continents (Magnius & Norder 1995). The F genotype is also the most divergent with several surface gene mutations (Naumann et al. 1993). There are no reports in the literature regarding the protection of licensed vaccines against infection by this genotype.

The currently recommended regimen with available recombinant vaccines is 3 intramuscular doses in the deltoid muscle at 1 month intervals (between 1st and 2nd dose) and 5 months (between 2nd and 3rd dose) - schedule 0.1.6 months. (Assad & Francis 2000). In our country, the vaccine is available in basic health units and in some maternity hospitals. The recommendation of the Ministry of Health (National Immunization Program - PNI) is to vaccinate all newborns, preferably within the first twelve hours of life or on the occasion of the BCG-ID vaccine. Throughout the country, avacin has been available to at-risk groups (individuals who are exposed to direct contact with human blood, its derivatives or human secretions) since the 1990s and more recently has been extended to individuals under the age of 20 years. (FUNASA 2001). The protective efficacy of the vaccine is directly related to the level of anti-HBs antibodies produced and is considered necessary for protection titre equal to or greater than 10 IU / L (CDC 1991).

Hepatitis C virus (HCV) infection affects about 2-3% of the world's population. More than 70% of HCV infections become chronic, of which 5 to 20% progress to cirrhosis and hepatocellular carcinoma (Jin et al.2002). Being a virus identified only in 1989 (Choo et al. 1989), it is believed that a considerable number of individuals are still unaware of their chronic carrier status for this infection. There is no vaccine available against HCV.

HCV is a virus that resembles its structure and genomic organization with the pestiviruses eflaviviruses and is classified as a new genus Hepacivirus within the Flaviviridae family (Robertson etal. 1998). .

HCV is among the clinically important viruses that infect humans, one of those with the highest rate of demutation, existing within an individual as some species (Martell et al. 1992). HCV is currently divided into six genotypes (1 to 6) and multiple subtypes, which show significant differences with respect to global prevalence, some with worldwide distribution, others more restricted to certain areas (Bukh et al. 1997). In Brazil, the few studies conducted in this area have shown a higher prevalence for genotypes 1, 2 and 3, especially among patients in therapeutic programs (Bassit et al. 2000).

HCV is an enveloped virus whose genome is formed by a single strand of positive polarity RNA containing approximately 9,400 nucleotides. Viral RNA has a long open reading frame that encodes a precursor polyprotein of about 3,000 amino acids (Choo et al. 1991). More than 10 different proteins are codified from the HCV genome as a result of co- and post-translational proteolytic processing of precursor polyprotein. This processing depends on enzymes encoded by the viral genome (NS3 and NS2-NS3 proteinases) and the host cell (signalase or signal peptidase). The structural proteins - oucore capsid protein (C), envelope 1 (E1) and envelope 2 (E2) glycoproteins - are located at the amino-terminal end, and non-structural proteins - NS2, NS3, NS4a, NS4b, NS5a and NS5b - are located at the carboxy terminal end of polyprotein (Grakoui et al. 1993).

Envelope glycoproteins (E1 and E2) have highly variable domains in their sequences when compared between different HCV isolates. At the N-terminal end of protein E2 there is a region characterized by a high degree of variability called hypervariable region 1 (HVR1), important in neutralizing HCV (Bukh et al. 1997; Drazan 2000). However, the high variability of this antigen fragment plays a key role in the viral escape mechanism of the host immune response and represents the major obstacle in the development of an HCV vaccine (Forns et al.2002).

The vaccines currently available against the most different infectious agents can be divided into two types: "alive" or "dead". "Live" vaccines have attenuated infectious agent, with low pathogenicity and maintaining their immunogenicity. "Dead" vaccines may be formed by the entire infectious agent no longer viable or subunits thereof. The nature of the vaccine determines the type of immune response generated by the host. "Dead" vaccines are not effective in stimulating the MHC class I immune response, generating little or very little cellular response. "Live" vaccines induce both a humoral and cellular immune response, but these vaccines pose a certain risk to pregnant women and immune depressed individuals and may still change and become pathogenic (Henke 2002).

A new alternative to protect susceptible individuals is the administration of plasmid DNA by direct inoculation in order to induce an immune response against the protein (s) encoded by this vector. Wolff et al. (1990), who showed that a simple intramuscular inoculation of plasmid DNA containing the β-galactosity protein gene was able to induce its expression in vivo. Vectors used for DNA vaccination often have the cytomegalovirus (CMV) promoter to make gene expression more efficient in mammalian cells. Next to the promoter is the synthesized aser protein gene, followed by a polyadenylation signal (poly-A) which is important for proper mRNA termination. This poly-A sequence may be derived from bovine growth hormone or the SV40 virus.

Most DNA vaccine studies have used intramuscular (im) and intradermal (id) immunization pathways, however other routes such as intravenous, intraperitoneal (Fynan et al. 1993), oral (Chen et al.1998), intranasal ( Klavinskis et al.1997) and vaginal (Livingston et al. 1998) have been evaluated. In intramuscular inoculation DNA is captured by antigen presenting cells (APC) with subsequent expression of the MHC class I antigen viamolecules. The secreted antigens are tinged by macrophages and presented by MHC class II pathway, inducing antibody synthesis and CD4 + T cell activation. Using the gene-gun system, where plasmid DNA is inserted with gold particles into it via helium gas acceleration, it has been shown that DNA is routed directly to Langerhans cells. These transfected cells migrate to local lymph nodes presenting the antigen to the immune system. In general, the type of DNA-stimulated immune response is influenced by the pathway type and inoculation method. Intramuscular inoculation induces immune response mainly through Thl cells (Raz et al. 1996). One possible explanation for this immune response is the intense synthesis of interferon-γ (IFN-γ) observed early on, which is probably stimulated by unmethylated plasmid DNA nucleotide sequences called CpG (cytidine phosphate-guanosine). These CpG motifs consist of DNA sequences such as AACGTT. Indeed, more efficient immune stimulation has been associated with the presence of such CpG motifs in the inoculated plasmid DNA, acting in the same way as adjuvants in other vaccines (Henke 2002). On the other hand, the gene-gun method requires a much smaller amount of DNA compared to the intramuscular inoculation method, and induces immune responses for both Thl and Th2 cell types (Feltquateet al. 1997).

The main advantages of DNA immunization compared to current vaccines are: The production of this type of vaccine can be done in large quantities, with a high purity and low cost; DNA stability at varying temperatures allows for easier maintenance, transport and distribution; possibility of immunization against different pathogens with a single administration of a combination of plasmids; the plasmid vector has no pathogenicity; There is little or no immune reaction to the vector. In addition, DNA vaccines mimic a natural viral infection, inducing both a humoral and cellular immune response, even in the presence of pre-existing host antibodies, which interfere with the efficacy of attenuated comvirus vaccines. In addition, DNA immunization induces a long-lasting immune response (Henke 2002). Given these characteristics, the development of DNA vaccines against HIV, malaria, tuberculosis and HCV is a very promising and fundamental area.

Hybrid HBsAg particles, also called chimeras, have been found in different immunization experiments to be very efficient proteins for presenting viral epitopes (Delpeyroux et al. 1986; Geissler et al. 1997). In studies with HCV, it has been shown that the presentation of core region epitopes (Major et al.1995; Geissler et al. 1998) and the E2 envelope (Netter et al.2001; Jin et al. 2002) is much longer. efficient when found to be fused to HBsAg. In Geissler and co-workers (1998), seroconversion rates and antibody titers were lower with plasmids expressing only the HCV core gene, whereas with the use of chimeric plasmids, an increase of 1 Ig notiter of antibodies could be observed.

Brief Description of the Figures

Figure 1 shows the sequence of SAahis +, where the underline represents the EcoNI site.

Figure 2 shows the HBV / HCV: SAaHCVHis + 3 chimera, where bolded oligonucleotides are shown to amplify HCV, in continuous underlining is the klenow-treated EcNI site and the HCV sequence is dotted.

Figure 3 shows the location of the SAaHCVHis + 3 chimera restriction site for release and orientation of the insert, XbaI and HindIII digestion. In bold, oligonucleotides are shown to amplify HCV, underline is shown the kleriow-treated EcoNI site, and stacked is the HCV insert encoded by the SAaHCVHis + 3 chimeric plasmid insert.

Figure 4 shows the sequence of the recombinant pCI-HBswt, where continuous underlining shows the dogenotype D insert of HBsAg.

Figure 5 shows XbaI digestion agarose gel electrophoresis for HBV and HBV / HCV insert release.

Figure 6 shows the enzymatic digestion of plasmidspcDNA3.I-SAaHCV, pSAaHCV-VM1, pcDNA3.I-SAa and pSAa-VM1 with the XbaI enzyme and plasmids pSAaHCV-VM2 and pSAa-VM2 with NotI and XhoI asenzymes.

Figures 7A, 7B, 7C and 7D show the construction of the plasmids of the present invention.

Detailed Description of the Invention

Obtaining HBV / HCV recombinants in pcDNA3.1 The sequence of the S gene to be cloned was selected after sequencing as having a unique insertion site. This sequence was derived from a Brazilian isolate of HBV A subgenotype with the characteristic of having a unique site for EcoNI at position 128 of protein S, which position is within the main antigenic determinant of HBV, the determinant "a" of HBsAg.

Following targeted cloning of the HBV S-region PCR product of this isolate into the opcDNA3.1 expression vector (Directional TOPO expression kit, Invitrogen, SanDiego, CA.) two recombinant plasmids, a plasmid containing the S region fused to a depolytic tail, were obtained. histidine (pcDNA3.I-SAaHis +) and another tailless plasmid (pcDNA3.I-SAaHis-). Construction of HBV / HCV chimeras was performed with the pcDNA3.1-SAaHis + plasmids.

The chimeric plasmids obtained were named pcDNA3.I-SAaHCVHis +. Two plasmids with the compatible HBsAg-HCV fusion size were selected for sequencing, pcDNA3.1-SAaHCVHis + 3 and pcDNA3.1-SAaHCVHis + 5. The release of the HBV insert from vectorpcDNA3.I-SAaHis + and chimeric insert HBV-HCV from clonespcDNA3.1-SAaHCVHis + 3 and pcDNA3.l-SAaHCVHis + 5. by digestion with restriction enzyme XbaI is shown in Figure 5. Recombinant plasmids obtained with the pcDNA3.1 (pcDNA3.I-SAaHis +, pcDNA3.I-SAaHis-, and pcDNA3.1-SAaHCVHis +) vectors were transfected into cell culture CHOther 6 days. Culture medium and cell extract were evaluated for the presence of recombinant protein produced or retained by cells by analysis of HBsAg levels by ELISA. The results were unsatisfactory in this vector.

Transfection assays and immunoenzymatic assays were performed and in all cases HBsAg levels were negative or very low. The results are shown in Table 1. Table 1: Results of the enzyme-linked immunosorbent assay performed as a culture medium and cell extract of cells transfected with recombinant and chimeric plasmids.

<table> table see original document page 15 </column> </row> <table>

* HBsAg positive results

** negative HBsAg results

Recombinant cassette exchange in pCDNA3.1 for other expression vectors:

Due to the negativity in recombinant protein production evidenced by the immunoenzymatic tests performed on the cell extract and culture medium of cells transfected by all opcDNA3.1 constructs, new recombinant and chimeric plasmids were constructed by cassette exchange in expression vectors in eukaryotic cells, pcDNA3 (Invitrogen). and pCI-HBswt (Figure 4). Thus, the gene regions initially cloned into the pcDNA3.1 vector were transferred from enzymatic digestions to the pcDNA3 and pCI-HBswt vectors, and four new plasmids were constructed. Details of these constructs are shown in Figures 7A-7D. HBsAg sequences from the new plasmids were obtained from pcDNA3.I-SAaHis-. Two plasmids for insertion of exogenous genes were constructed, pSAa-VM1 and pSAa-VM2. The first by cassette exchange of the HindIII-EcoRV fragment in pCDNA3, yielding pcDNA3-SAa, renamed to pSAa-VM1 (Figure 7A) and the second by cassette exchanged fragment XbaI and NotI into pCI-HBswt, which was renamed pCI-Aa. pSAa-VM2 (Figure 7B). Two other plasmids containing the HCV E2-fused S gene were constructed. In these cases the pcDNA3.I-SAaHis + vector was used as donor of the chimeric HBV / HCV sequence. The pCDNA3-SAaHCV chimeric plasmid was constructed by exchanging the Kpnl-Van91 fragment on pSAa-VMl. Chimeric plasmid was renamed pSAaHCV-VMl (Figure 7C). The second chimeric plasmid was constructed by exchanging the XbaI and NotI fragment of pSAaHCV-VM1 nopCI-HBswt, resulting in pCI-AaHCV, which was renamed to pSAaHCV-VM2 (Figure 7D). An enzymatic digestion releasing the plasmid inserts obtained can be seen in Figure 6. Figures 1 and 2 show the amino acid sequence of the SAaHis + and SAaHCVHis + 3 inserts. The newly constructed plasmids (pSAa-VMl, pSAa-VM2, pSAaHCV-VMl and pSAaHCV-VM2) were subjected to transient transfection assays in CHO cell culture and the levels of HBsAg from cell extract and culture media were evaluated by ELISA. HBsAg produced by plasmid transfected cells using pcDNA3.1 were very low or undetectable, as observed by the strong OD / CO ratio (optical density / cut-off). However, the culture medium and cell extract of the transfections performed with pSAa-VM1 and pSAa-VM2 were positive for the presence of this protein, and the HBsAg levels detected in the pCI assays were significantly higher than those presented for the constructs with pSAa-VM1. pcDNA3. As can be seen from Table 1, the DO / CO ratio values were 4.04 for pSAa-VM1 and 11.68 for culture name pSAa-VM2, which corresponds to an approximately 3-fold increase in expression and release. The molecular constructs of HBsAg-HCV chimeras as pCI vector showed significantly higher levels of HBsAg than those with pcDNA3, with an approximately 2-fold increase in protein-recombinant expression. Therefore, in all assays performed, the constructs made with the pCI expression vector presented the highest HBsAg values detected.

The following example is illustrative of the invention and represents the preferred embodiment of the invention, those skilled in the art know or are able to find, using nothing more than routine experimentation, as employing other appropriate materials and techniques.

Example

Sampling:

HBsAg high-titre serum samples previously tested by enzyme-linked immunosorbent assay (ELISA) (Hepanostika Uni-form, Organon Teknika B.V., Boxtel, The Netherlands) from a research project approved by the Research Ethics Committee (CONEP) were selected.

Viral DNA Extraction:

For DNA extraction from serum samples, to 250 μΐ of serum were added 80 μΐ of Iise solution containing 2 mg / ml proteinase K, 0.1 mg / ml t-RNA and 1% sodium dodecyl sulfate (SDS), in 700 mM NaCl, 0.36 mM CaCl 2, 200 mM Tris-HCL pH 9.0 and 20 mM EDTA. The mixture was incubated for 4 hours at 37 ° C. DNA was extracted by phenol / chloroform and precipitated in ethanol (2 volumes) overnight. The material was centrifuged for 30 minutes, the precipitate was washed with 70% alcohol and then dried and resuspended in 30 μΐ of distilled water according to standard laboratory methodology (Niel etal., 1994).

HBV PCR and genotyping assays:

The HBV S region (approximately 680 bp) was amplified using specially designed oligonucleotides for this work. To amplify HBV isolates of genotype A without a stop codon at the end of the open reading frame of gene S, the pair of polynucleotides S12 (sense; 5 'CACCAT GGAGAACAT CACAT CAG3'; nt 155 to 173) and S13AD (reverse 5'AATGTATACCCAGAGACAAAAAA 3) were used. 811 to 834).

In addition, PCR assays were performed using S12 primer and S13ADSTOP (reverse; 5 'TTAAATGTATACCCAGAGACAAAAGAA 3'; nt 811 to 837) which had a stop codon at the end of the S phase.

PCR assays were performed with 1 μΐ of the suspended DNA in distilled water under the following conditions: 30 cycles (94 0C - 20sec, 55 ° C - 20sec, 74 ° C - Imin), followed by a 7 minute final elongation at 74 ° C , in a 50 μ volume of amplification solution (20 mM Tris-HCl pH 8.4, 50 mM KCl, 3 mM MgCl2, 0.2 mM dNTPs, 10 pmol of each oligonucleotide) and 2.5 units of Tli DNA Polymerase (Promega, Madison, WI) which has proofreading activity required for the decon strategy used. PCR amplified products were analyzed by electrophoretic run in TBE buffer (89 mM Tris, 89 mM boric acid and 2.5 mM EDTA, pH 7.5-7.8) using 2% agarose gels. stained with 10 mg / ml ethidium bromide and visualized with luminultraviolet. Genotyping of PCR products was performed with restriction enzymes BamHI, EcoRI and StuI by the previously standardized genotyping method in our laboratory [Araújo et al., 2004].

HBV S-region molecular cloning and tracking:

HBV S-region PCR products (approximately 680 bp) with restriction profiles corresponding to the Aaf subgenotype were cloned transcriptionally into the pcDNA3.1 vector using commercial assay for this purpose (Directional TOPO expression kit, Invitrogen, SanDiego, CA). .). The cloning of the inserts is done in a targeted manner, since the sense-sense oligonucleotide is initiated by a Kozak sequence (CACC) before the ATG initiation codon. The vector tip (GTGG) is complementary to this sequence and at the time of insertion of the vector to the insert, this tip invades the insert and binds to the Kozak sequence through the action of a vector-associated topoisomer. Escherichia coli Top 10 strains were transformed by CaCl2 chemical method and grown on solid LB agar. Recombinant clones were selected by ampicillin resistance markers. Plasmid purification was performed by plasmid purification columns by commercial methods (High purityplasmid midiprep system, QIAGEN, Hiden, Germany). A total of 250 ng of DNA was sequenced by reaction using BigDye Terminator mix in 48-capillary automatic sequencer, model ABI3730 (Applied Biosystems, Foster City, CA, Fiocruz platform multi-user sequencer). Complementary oligonucleotides were used following T7 and T7 promoters. SP6 flanking the multiple site region of the pcDNA3.1 vector.

Construction of HBsAg expression plasmids that allow insertion of foreign proteins:

The unique EcoNI restriction site was selected as the insertion site for the HCV insert. After cloning of genotype A HBV S region into pcDNA3.1, 5 µg of an isolated plasmid, and fused to the dehistidine tail (pcDNA3.I-SAaHis +) was digested with EcoNI, inactivated for 30 min at 60 ° C. After visualization of agarose gel digestion, the recombinant was treated with the enzyme Klenow (Invitrogen) to blind end the digested plasmids. About 2ug were purified from the gel at a concentration of 15ng / µl in a final volume of 50ul. The linearized recombinant (600ng / 40uL) was treated with 1 phosphatase unit to remove phosphates. The product was inactivated at 68 ° C for 15 minutes and purified on Promega SV wizard column. The material was eluted in a final volume of 30uL HCV BNA extraction:

RNA extraction was performed from serum samples with QIAamp Viral RNA Mini Kit (Qiagen). Following the manufacturer's protocol, using 140 µl HCV-positive serum, and resuspending the RNA in 50 µL of AVE buffer, the RNA stored immediately on ice. HCV cDNA synthesis:

Prior to reverse transcription, the extracted RNA was subjected to a temperature of 65 ° C for 10 minutes. For reverse transcription reactions a mix was prepared containing: 20 pmol of reverse primer E245G1R1 (2431-2452) - GTACARGTAYTGYACGTCCAC) and 200U of reverse transcript (SuperScript RNase H-Reverse Transcriptase). The cDNA was kept on ice and then incubated again at 65 ° C for 15 minutes. HCV CRP1:

The first PCR amplification was sense E12F1 (5'-ATGGCWTGGGAYATGATGATGA - 3 ') (1293 - 1315), and antisense E24G1R2 (5'-CACGATGTTCTGRTGGAGRTGGAT - 3') (with 2408 - 2431); U for a final volume of 25 μΙ * and 5 μ] ^ of cDNA. Temperatures used in this first round began at 94 ° C for 3 minutes, followed by 30 cycles of: 94 ° C for 30 seconds, 65 ° C for 30 seconds, 72 ° C for 1 minute and a half and a final extension of 72 ° C. for 7 minutes.Nested-PCR of HCV and cloning of HCV in pcDNA 3.1:

For nested-PCR we used the primer E14G1F2 (5'-caccATGGWGGGGAACTGGGCKAA - 3 ') (1427-1450), and E24G1R2 (5'-CACGATGTTCTGRTGGAGRTGGAT - 3') (2408-24)). This second round was performed under the following conditions: 94 ° C for 3 minutes, followed by 30 cycles of 94 ° C for 30 seconds, 67 ° C for 30 seconds, 74 ° C for 1 minute, and a further 15 minutes at 74 ° C. ° C.

The nested-PCR product (1004bp) was ligated into the pcDNA 3.1 Directional TOPO Expression Kit (Invitrogen) expression vector. Following transformation, plasmid purification and sequencing, the HCV correct-reading phase inserts were diluted 1:10 and subjected to PCR for the formation of the following chimera.Construction of HBV-HCV chimeras in pCDNA3.1:

HCV sequences of the clones of three patients considered representative and Brazilian consensus dogenotype Ib were selected.

The HVR1 region of envelope E2 nt 1461-1588 (fragment127 bp) was PCR amplified with primer, sense 1461F (5'-GTGAAGCTTCTCTTYGCCGGCGTT - 3 ') (1461-1484), containing a Hind III and antisense 1588R (5'- GTGTTTAYAAGCTGGATTTTCTG -3 ') ·

Amplification was with Tli DNA Polymerase (high fidelity Taq DNApolymerase), and 4 μ] ^ of the plasmids (diluted 1:10) to a final volume of 100 μΕ. Initially there was heating of 95 ° C for 3 minutes, followed by 35 cycles of 94 ° C for 20 seconds, 46 ° C for 20 seconds, 74 ° C for 1 minute and 10 seconds, and an additional 15 minutes at 74 ° C.

The EcoNI linearized and klenow-treated HBV vector followed by phosphatase (100ng) was ligated to the 127 bp HCV PCR amplification product (15ng). Ligation was performed with 4 U T4 DNA ligase at 15 ° C for 15 hours. Figure 3 shows the chimeric sequence obtained (SAaHCVHis + 3), indicating the oligonucleotides used to amplify the HCV insert, the Klenow-treated EcoNI site, as well as as the peptide sequence of the HCV insert. HBV-HCV chimera selection:

Recombinant clones were selected after plasmid DNA extraction and XbaI digestion.

The orientation of HCV inserts within HBsAg was performed by HindIII digestion.

Construction of new recombinant and chimeric plasmids:

Two other eukaryotic cell expression plasmids were used. The pcDNA3 vector (Invitrogen) and the pCI vector (pCI-neo Mammalian Expression Vector, Promega) containing a molecular construct of the HBV S gene from an isolate of genotype D called pCI-HBswt. Genotype D insertion was cloned into this vector by pCI digestion with the XhoI and SmaI (blunt end) enzymes and insert digestion with the XhoI and StuI (blunt end) enzymes.

The pcDNA3.1 cloned HBsAg segment (pcDNA3.1-SAaHis-) was excised from this vector from an enzymatic digestion with HindIII and EcoRV, which contain restriction sites located on the vector polylinker, and introduced into pCDNA3, digested with them. enzymes (Figure 7A). The same HBV gene sequence was transferred from dopcDNA3.1 to pCI-HBs by digestion with the enzymes XbaI and NotI in both plasmids. The pCI-HBc vector contains a previously cloned HBV S gene sequence and the XbaI enzyme cuts the beginning of this region, so the recombinant pSAa-VM2 plasmid contains the first nucleotides of the original HBs sequence (Figure 7B). In order to transfer the HBV / HCV chimera to the other two plasmids (pcDNA3 and pCI) a different strategy was used because the chimeric segment cloned into pcDNA3.1 (pcDNA3.1-SAaHCVHis +) does not have the HBsAg translation stop codon allowing fusion with the dovector histidine tail. The chimeric segment was cloned into pcDNA3 using restriction enzymes Kpn1 and Van911. It was necessary to use a recombinant pSAa-VM1, which contained a "small" S segment of genotype A, to recover the HBsAg translation stop codon, lost in the chimeric sequence. The Van911 enzyme has a restriction site at the end of the HBsAg sequence and, therefore, when the chimeric segment is cloned into pcDNA3 it merges with the stop codon of its previous sequence (Figure 7C). The HBV / HCV segment was cloned into pCI by enzymatic digestion with XbaI and NotI from the chemical construct made on pcDNA3-SAaHCV (Figure 7D). Recombinant new clones obtained, called pSAa-VM1, pSAaHCV-VM1, pSAa-VM2 and pSAaHCV-VM2, were used to transiently transfect CHO cell culture and HBsAg levels, culture medium and cell extracts were evaluated by ELISA. , the same conditions as tests carried out for constructions as pcDNA3.1.

Transfections:

Recombinant and chimeric plasmids were used to transiently transfect CHO cell culture following the Fugene6 Transfection Reagent (Roche) transfection protocol. Immunoenzymatic Assays:

The production of recombinant proteins by the transfected cells were evaluated by enzyme-linked immunosorbent assays (ELISA) specific for the detection of hepatitis B virus surface antigen (HBsAg) (Bioelisa HBsAgcolour, Biokit, Barcelona, Spain).

Purification of recombinant DNA for animal inoculation

Plasmids constructed to express chromopombinant and chimeric HBsA with the pcDNA3 (pcDNA3-SAa, pcDNA3-SAaHCV) and pCI (pCI-SAa, pCI-SAaHCV) vectors were purified with the EndoFree Plasmid Mega Kit (QIAGEN, Hiden, Germany) according to the instructions. From 500mL of the E.coli bacterial culture transformed with the above-mentioned plasmids, purification was performed with a final yield of approximately 2mg of plasmid DNA.

Inoculation of naked DNA in mice:

For immunization, 7-week-old male Balb / c mice were used. Groups of four animals were inoculated with 100 µg of plasmid DNA in final volume 50 pL TE buffer (Tris-Cl 10mM, EDTA ImM]) each plasmid (pcDNA3-SAa, pcDNA3-SAaHCV, pCI-SAa, pCI-SAaHCV). Inoculation was performed intrasplenically. Prior to inoculation, a blood sample was taken from the retroorbital plexus.

Thirty days after inoculation, mouse blood samples were taken, also retro-orbitally, for further assays to evaluate the animal immune response against the inoculated plasmid DNA. A second blood slide was taken on day 60 post-inoculation. Thus, the animals were completely bleed by cardiac puncture using anesthetic a few minutes before collection.

Blood samples collected before and after immunization were subjected to ELISA to verify antibody production against HBV surface antigen (anti-HBs antibodies) by the mice studied. The commercial Bioelisa anti-HBs assay (Biokit, Barcelona, Spain) according to the manufacturer's instructions. Anti-HBs antibodies were detected in the serum sample collected after administration of plasmid DNA in mice immunized with the constructs using opCI as an expression vector, i.e. pCI-SAa, pCI-SAaHCV.

Accordingly, the invention shows expression plasmids constructed in accordance with the present invention, with a natural insertion site located within or around the determinant of the HBsAg protein. Examples of the invention further show that HCV segments encompassing the HVR1 region were successfully inserted into plasmid S-AHis +.

The invention described herein as well as the aspects discussed should be considered as one of the possible embodiments. It should, however, be clear that the invention is not limited to such embodiments, and those skilled in the art will appreciate that any particular feature introduced therein should be understood solely as something that has been described for ease of understanding and cannot be made without departing from the inventive concept described. . The limiting features of the object of the present invention are related to the claims that are part of this report.

REFERENCES:

(1) Araújo NM, Mello FC, Yoshida CF, Niel C, Gomes SA.2004. High proportion of subgroup A '(genotype A) among Brazilian isolates of Hepatitis B virus. Arch Virol149: 1383-1395.

(2) Arauz-Ruiz P, Norder H, Robertson BH, Magnius LO 2002. Genotype H: A new Ameridian genotype of hepatitis B virus revealed in Central America. J Gen Virol 83: 2059-2073.

(3) Assad S, Francis A 2000. Over a decade of experiencewith a yeast recombinant hepatitis B vaccine. Vaccine18: 57-67.

(4) Bassit L, Silva LC da, Ribeiro-dos-Santos G, MaertensG, Carrilho FL, Fonseca LEP, et al. 2000. Chronic hepatitis C virus infections in Brazilian patients: association with genotypes, clinical parameters and response to Long term interferon therapy. Newslab 8: 136-151.

(5) Blum HE 1993. Hepatitis B virus: significance of naturally occurring mutants. Intervirology 35: 40-50.

(6) Bukh J, Emerson SU, Purcell RH. 1997. Geneticheterogeneity of hepatitis C virus and related viruses. In: Rizzeto M, Purcell RH, Gerin JL, Worm G. Viral hepatitis and liver disease. Turin: Medical Minerva; p.167-175.

(7) CDC 1991. Hepatitis B Virus: A Comprehensive Strategy for Eliminating Transmission in the United States Through Universal Childhood Vaccination: Recommendations of the Immunization Practices Advisory Committee (ACIP). MMWR40: 1-19.

(8) Chen SC, Jones DH, Fynan EF, Farrar GH et al. 1998.Protective immunity induced by oral immunization with arotavirus DNA vaccine encapsulated in microparticles. Virol 72: 5757-5761.

(9) Choo Q-L, Kuo G, Weiner AJ, Overby LR, Bradley DW, Houghton M. 1989. Isolation of a clone derived from a non-A, non-B viral hepatitis genome. Science 244: 359-362.

(10) Choo Q-L, Riehman KH, Han JH, Berger K, Lee C, Dong Cet al. 1991. Genetie organization and diversity of thehepatitis C virus. Proc Natl Acad Sci USA 88: 2451-2455.

(11) Da Silva and Mouta S, Jr., Otavio Alves Vianna C, EnnesI, by Andrade Gomes S, da Silva Freire M, Domingos da SilvaE, Giovanni De Simone S, Terezinha Baroni de Moraes M.2003. Simple immunoaffinity method to purify recombinanthepatitis B surface antigen secreted by transfectedmammalian cells. J Chromatogr B Analyte Teehnol Biomed LifeSei 787 (2): 303-311

(12) Delpeyroux F, Chenciner N, Lim A, Malpieee Y, Blondel B, Crainie R et al. 1986. A poliovirus neutralizing epitope expressed on hybrid hepatitis B surface antigen particles.Science 233: 472-475.

(13) Drazan KE. 2000. Molecular biology of hepatitis Cinfeetion. Liver Transpl 6: 396-406.

(14) Feltquate DM, Heaney S. Webster RG, Robinson HL. 1997.Different T helper cell types and antibody isotypesgenerated by saline and gene gun DNA immunization. Immunol 158: 2278-2284.

(15) Forns X, Bukh J, Purcell RH. 2002. The challenge of developing a vaccine against hepatitis C virus. J Hepatol.37: 684-695.

(16) Fried MW, Sambrook J. 1995. Therapy of hepatitis C.Semin Liver Dis. 15: 82-91.

(17) FUNASA 2001. Handbook of Reference Centers for Special Immunologists 59-63.

(18) Fynan EF, Webster RG, Fuller DH, Haynes JR, Santoro JC, Robinson HL. 1993. DNA vaccines: protectiveimmunizations by parenteral, mucosal and gene-guninoculations. Proc Natl Acad Sci USA 90: 11478-11482.

(19) Ganem D 1996. Hepadnaviridae and their replication. In: Fields BN, Knipe DM, Howley PM. Fields Virology.Philadelphia: Lippincott - Raven 2703-2737.

(20) Ganem D, Varmus HE. 1987. The molecular biology ofhepatitis B viruses. Ann Rev Biochem 56: 651-693.

(21) Geissler M, Gesein A, Tokushige K, Wands JR-1997. Enhancement of cellular and humoral immune responses to hepatitis C virus core protein using DNA-based vaccines with cytokine-expressing plasmids. J Immunol158: 1231-1237.

(22) Geissler M, Tokushige K, Wakita T, Zurawski VR, Wands JR. 1998. Differential cellular and humoral responses to HCV core and HBV envelope proteins after geneticimmunizations using chimeric constructs. Vaccine. 16: 857-867. (23) Grakoui, Wychowski C, Lin C, Feinstone SM, Rice CM.1993. Expression and identification of hepatitis C viruspolyprotein cleavage products. J Virol. 67: 1385-1395.

(24) Grob PJ 1998. Hepatitis B: virus, pathogenesis and treatment. Vaccine 16: S11-S16.

(25) Heermann KH, Goldmann U, Schwartz W, Seyffarth T, Baumgarten H, Gerlieh WH. 1984. Large surface proteins of hepatitis B virus and the pre-S sequence. J Virol 52: 396-402.

(26) Henke A. 2002. DNA immunization - a new chance invaccine research? MedMicrobiol Immunol 191: 187-190.

(27) Jin J, Yang JY, Liu J, Kong YY, Wang Y, Li GD. 2002.DNA immunization with fusion genes encoding differentregions of hepatitis C virus E2 fused to the forhepatitis B gene surface antigen elicits immune responses toboth HCV and HBV. World J Gastroenterol 8 (3): 505-510.

(28) Jin J, Yang JY, Liu J, Kong YY, Wang Y, Li GD. 2002.DNA immunization with fusion genes encoding differentregions of hepatitis C virus E2 fused to the forhepatitis B gene surface antigen elicits immune responses toboth HCV and HBV. World J Gastroenterol. 8: 505-510 (29) Klavinskis LS, Gao L, Barnfield C, Lehner T, Parker S.1997. Mucosal immunization with DNA-Iiposome complexes. Vaccine 15: 818-820.

(30) Klingmuller U, Schaller H 1993. Hepadnavirus infection requires interaction between the viral pre-S domain and specific hepatocellular receptor. J Virol 67: 7414-7422 (31) Koff RS. 2002. Immunogenicity of hepatitis B vaccines: implications of immune memory. Vaccine 1; 20 (31-32): 3695-701.

(32) Livingston JB, Lu S, Robinson H. Anderson Anderson. 1998. Immunization of the female genital tract with a DNA-based vaccine. Infect Immun 66: 322-329.

(33) Magnius LO, Norder H 1995. Subtypes, genotypes andmolecular epidemiology of hepatitis B virus asreflected by sequence variability of the S-gene. Intervirology 38: 24-34.

(34) Major MM, Vivitski L, Mink MA, Schleef M, Whalen RG, Trepo C et al. 1995. DNA-based immunization with chimeric vectors for the induction of immune responses against the hepatitis C virus nucleocapsid. J Virol 69: 5798-5805.

(35) Martell M, Esteban JI, Either J, Genesca J, Weiner A, Esteban R, et al. 1992. Circulating hepatitis C virus (HCV) a population of different but closely related genomes: quasispecies nature of HCV genome distribution. J Virol66: 3225-29.

(36) Naumann H, Schaefer S, Yoshida CF, Gaspar AM, Rep R, Gerlieh WH. 1993. Identification of a new hepatitis B virus (HBV) genotype from Brazil that expresses HBV surfaceantigen subtype adw4. J Gen Virol 74: 1627-1632.

(37) Netter HJ, Macnaughton TB, Woo W, Tindle R, Gowans E.2001. Antigenicity and immunogenicity of novel chimerichepatitis B surface antigen particles with exposedhepatitis C virus epitopes. J Virol 75: 2130-2141.

(38) Neurath AR, Kent SBH, Strick N, Parker K. 1986. Identification and chemical synthesis of a host cell receptor binding site on hepatitis B virus. Cell 46: 429-436.

(39) Niel C, Moraes MT, Gaspar AM, Yoshida CF, Gomes SA.1994. Genetic diversity of hepatitis B virus strainsisolated in Rio de Janeiro, Brazil. J Med Virol 44 (2): 180-186.

(40) Raz E, Tighe H, Sato Y, Corr M, et al. 1996.Preferential induction of a Thl immune response and inhibition of specific IgE antibody formation by plasmidDNA immunization.

(41) Robertson B, Myers G, Howard C, Brettin T, Bukh J, Gaschen B, et al. 1998. Classification, nomenclature, and database development for hepatitis C virus (HCV) and related viruses: proposals for standardization. Arch Virol143: 2493-2503.

(42) Seeger C, Mason W. 2000. Hepatitis B virus biology.Microbiol Mol Biol Rev 64: 51-68.

(43) Stuyver L, Gendt S, Van Geyt C, Zoulim F, Fried M, Schinazi RF, Rossau R 2000. A new genotype of hepatitis Bvirus: complete genome and phylogenetic relatedness. J GenVirol 81: 67-74.

(44) Thanavala Y. 1996. Novel approaches to vaccinedevelopment against HBV. J Biotechnol 44: 67-73.

(45) Wallace LA, Carman WF 1994. Clinical implications of hepatitis B virus envelope protein variation. Int J ClinLab Res 24: 80-85.

(46) Wolff JA, Malone RW, Williams P, Chong W, Acsadi G, Jani A, Felgner PL. 1990. Direct gene transfer into mousemuscle in vivo. Science 247: 1465-1468. (47) Yu AS, Cheung RC, Keeffe EB. 2006. Hepatitis Bvaccines. Infect Dis Clin North America 20 (1): 27-45.

Claims (3)

1. Plasmid pSAaHCV-VM1, characterized in that it contains a 127 bp fragment of the HVR1 region of the HBsAg-fused HCV E2 gene by insertion into the unique EcoNI site. Plasmid pSAaHCV-VM2, characterized in that it contains a 127 bp fragment of the HVR1 region of the HBsAg-fused HCV E2 gene by insertion into the unique EcoNI site. 3. Chimeric HBV / HCV SAaHCVHis + 3 as depicted in Figure 2.